>Feature sequence001 835 308 gene locus_tag LOCUS_00010 835 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 996 4076 gene locus_tag LOCUS_00020 996 4076 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994214.1 protein_id gnl|my_center|LOCUS_00020 4178 4828 gene locus_tag LOCUS_00030 4178 4828 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_00030 4895 5641 gene locus_tag LOCUS_00040 4895 5641 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038142.1 protein_id gnl|my_center|LOCUS_00040 5714 6241 gene locus_tag LOCUS_00050 gene ruvC 5714 6241 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038141.1 protein_id gnl|my_center|LOCUS_00050 6315 6902 gene locus_tag LOCUS_00060 gene ruvA 6315 6902 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450983.1 protein_id gnl|my_center|LOCUS_00060 6940 8856 gene locus_tag LOCUS_00070 6940 8856 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 protein_id gnl|my_center|LOCUS_00070 8992 10032 gene locus_tag LOCUS_00080 gene ruvB 8992 10032 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_00080 10025 10453 gene locus_tag LOCUS_00090 gene ybgC 10025 10453 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_00090 10464 11240 gene locus_tag LOCUS_00100 gene tolQ 10464 11240 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 protein_id gnl|my_center|LOCUS_00100 11278 11706 gene locus_tag LOCUS_00110 gene tolR 11278 11706 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_00110 11696 12772 gene locus_tag LOCUS_00120 gene tolA 11696 12772 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038135.1 protein_id gnl|my_center|LOCUS_00120 12927 14246 gene locus_tag LOCUS_00130 gene tolB 12927 14246 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_00130 14311 14829 gene locus_tag LOCUS_00140 gene pal 14311 14829 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_00140 14833 15627 gene locus_tag LOCUS_00150 gene ybgF 14833 15627 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_00150 15723 16424 gene locus_tag LOCUS_00160 gene queE 15723 16424 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_00160 16504 17169 gene locus_tag LOCUS_00170 gene queC 16504 17169 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_00170 17298 17373 gene locus_tag LOCUS_t00010 17298 17373 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17515 18066 gene locus_tag LOCUS_00180 17515 18066 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_00180 18066 20834 gene locus_tag LOCUS_00190 18066 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22666 20831 gene locus_tag LOCUS_00200 gene recQ 22666 20831 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_00200 23932 23384 gene locus_tag LOCUS_00210 23932 23384 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038069.1 protein_id gnl|my_center|LOCUS_00210 24021 28172 gene locus_tag LOCUS_00220 gene hrpA 24021 28172 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038068.1 protein_id gnl|my_center|LOCUS_00220 28775 28242 gene locus_tag LOCUS_00230 28775 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29343 28831 gene locus_tag LOCUS_00240 29343 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 protein_id gnl|my_center|LOCUS_00240 29407 31569 gene locus_tag LOCUS_00250 29407 31569 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275520.1 protein_id gnl|my_center|LOCUS_00250 31616 33163 gene locus_tag LOCUS_00260 31616 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054319.1 protein_id gnl|my_center|LOCUS_00260 35259 33160 gene locus_tag LOCUS_00270 35259 33160 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275305.1 protein_id gnl|my_center|LOCUS_00270 35356 37761 gene locus_tag LOCUS_00280 gene mrcB 35356 37761 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038055.1 protein_id gnl|my_center|LOCUS_00280 37769 38299 gene locus_tag LOCUS_00290 37769 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 protein_id gnl|my_center|LOCUS_00290 38377 40407 gene locus_tag LOCUS_00300 38377 40407 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_00300 40404 41108 gene locus_tag LOCUS_00310 gene tsaB 40404 41108 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_00310 41968 41162 gene locus_tag LOCUS_00320 41968 41162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42881 42006 gene locus_tag LOCUS_00330 42881 42006 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 protein_id gnl|my_center|LOCUS_00330 43856 42996 gene locus_tag LOCUS_00340 43856 42996 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037872.1 protein_id gnl|my_center|LOCUS_00340 44058 46667 gene locus_tag LOCUS_00350 44058 46667 CDS product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037871.1 protein_id gnl|my_center|LOCUS_00350 46749 48104 gene locus_tag LOCUS_00360 gene murL 46749 48104 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_00360 48085 49491 gene locus_tag LOCUS_00370 gene murD 48085 49491 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_00370 49693 50490 gene locus_tag LOCUS_00380 49693 50490 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690367.1 protein_id gnl|my_center|LOCUS_00380 50865 50608 gene locus_tag LOCUS_00390 50865 50608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704706.1 protein_id gnl|my_center|LOCUS_00390 51868 50870 gene locus_tag LOCUS_00400 51868 50870 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_00400 52046 53659 gene locus_tag LOCUS_00410 52046 53659 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_00410 54111 53920 gene locus_tag LOCUS_00420 54111 53920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 56936 54165 gene locus_tag LOCUS_00430 56936 54165 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275328.1 protein_id gnl|my_center|LOCUS_00430 59320 57254 gene locus_tag LOCUS_00440 59320 57254 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_00440 59518 60999 gene locus_tag LOCUS_00450 59518 60999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_00450 60999 62729 gene locus_tag LOCUS_00460 60999 62729 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994018.1 protein_id gnl|my_center|LOCUS_00460 62824 63204 gene locus_tag LOCUS_00470 62824 63204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 64336 63275 gene locus_tag LOCUS_00480 64336 63275 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508157.1 protein_id gnl|my_center|LOCUS_00480 64717 64373 gene locus_tag LOCUS_00490 64717 64373 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461224.1 protein_id gnl|my_center|LOCUS_00490 64804 65397 gene locus_tag LOCUS_00500 64804 65397 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 protein_id gnl|my_center|LOCUS_00500 65533 66069 gene locus_tag LOCUS_00510 65533 66069 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 protein_id gnl|my_center|LOCUS_00510 66950 66219 gene locus_tag LOCUS_00520 gene arsH 66950 66219 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919380.1 protein_id gnl|my_center|LOCUS_00520 66968 67300 gene locus_tag LOCUS_00530 66968 67300 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_00530 67355 67867 gene locus_tag LOCUS_00540 67355 67867 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_00540 67881 68912 gene locus_tag LOCUS_00550 gene arsB 67881 68912 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_00550 69113 70276 gene locus_tag LOCUS_00560 69113 70276 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_00560 71648 70539 gene locus_tag LOCUS_00570 71648 70539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71927 72916 gene locus_tag LOCUS_00580 71927 72916 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_00580 72921 73907 gene locus_tag LOCUS_00590 72921 73907 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920949.1 protein_id gnl|my_center|LOCUS_00590 75136 73985 gene locus_tag LOCUS_00600 75136 73985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 75699 78527 gene locus_tag LOCUS_00610 75699 78527 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035779.1 protein_id gnl|my_center|LOCUS_00610 78716 80677 gene locus_tag LOCUS_00620 78716 80677 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_00620 82503 80746 gene locus_tag LOCUS_00630 82503 80746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 82743 84704 gene locus_tag LOCUS_00640 82743 84704 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_00640 84857 86923 gene locus_tag LOCUS_00650 84857 86923 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036305.1 protein_id gnl|my_center|LOCUS_00650 87426 88679 gene locus_tag LOCUS_00660 87426 88679 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 protein_id gnl|my_center|LOCUS_00660 88863 90116 gene locus_tag LOCUS_00670 88863 90116 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 protein_id gnl|my_center|LOCUS_00670 90433 90209 gene locus_tag LOCUS_00680 90433 90209 CDS product CstA-like transporter-associated (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037849.1 protein_id gnl|my_center|LOCUS_00680 92499 90433 gene locus_tag LOCUS_00690 92499 90433 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037848.1 protein_id gnl|my_center|LOCUS_00690 92731 93582 gene locus_tag LOCUS_00700 92731 93582 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_00700 94092 93631 gene locus_tag LOCUS_00710 94092 93631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037845.1 protein_id gnl|my_center|LOCUS_00710 95042 94320 gene locus_tag LOCUS_00720 gene aqpZ 95042 94320 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_00720 95992 95120 gene locus_tag LOCUS_00730 95992 95120 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_00730 96767 96084 gene locus_tag LOCUS_00740 gene nfi 96767 96084 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037843.1 protein_id gnl|my_center|LOCUS_00740 96895 97623 gene locus_tag LOCUS_00750 gene gpmA 96895 97623 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037842.1 protein_id gnl|my_center|LOCUS_00750 98155 97769 gene locus_tag LOCUS_00760 98155 97769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 98331 98702 gene locus_tag LOCUS_00770 98331 98702 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 protein_id gnl|my_center|LOCUS_00770 98891 99370 gene locus_tag LOCUS_00780 98891 99370 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_00780 99484 101583 gene locus_tag LOCUS_00790 99484 101583 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037840.1 protein_id gnl|my_center|LOCUS_00790 102090 101761 gene locus_tag LOCUS_00800 102090 101761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 102545 102087 gene locus_tag LOCUS_00810 102545 102087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 102742 104241 gene locus_tag LOCUS_00820 gene cls 102742 104241 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_00820 104886 104260 gene locus_tag LOCUS_00830 104886 104260 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813001.1 protein_id gnl|my_center|LOCUS_00830 108449 104979 gene locus_tag LOCUS_00840 gene mfd 108449 104979 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037828.1 protein_id gnl|my_center|LOCUS_00840 109304 108759 gene locus_tag LOCUS_00850 109304 108759 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037827.1 protein_id gnl|my_center|LOCUS_00850 110312 109455 gene locus_tag LOCUS_00860 gene rlmJ 110312 109455 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 protein_id gnl|my_center|LOCUS_00860 110358 111056 gene locus_tag LOCUS_00870 gene creB 110358 111056 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 protein_id gnl|my_center|LOCUS_00870 111661 113097 gene locus_tag LOCUS_00880 gene creC 111661 113097 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_00880 116225 113160 gene locus_tag LOCUS_00890 116225 113160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 116440 117768 gene locus_tag LOCUS_00900 gene creD 116440 117768 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037822.1 protein_id gnl|my_center|LOCUS_00900 117765 118151 gene locus_tag LOCUS_00910 117765 118151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 118170 118520 gene locus_tag LOCUS_00920 118170 118520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 118562 119167 gene locus_tag LOCUS_00930 118562 119167 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037819.1 protein_id gnl|my_center|LOCUS_00930 119164 120045 gene locus_tag LOCUS_00940 119164 120045 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 protein_id gnl|my_center|LOCUS_00940 120204 121781 gene locus_tag LOCUS_00950 120204 121781 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_00950 122281 121874 gene locus_tag LOCUS_00960 122281 121874 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_00960 125238 122281 gene locus_tag LOCUS_00970 gene uvrA 125238 122281 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 protein_id gnl|my_center|LOCUS_00970 125520 125828 gene locus_tag LOCUS_00980 gene rplU 125520 125828 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989959.1 protein_id gnl|my_center|LOCUS_00980 125846 126106 gene locus_tag LOCUS_00990 gene rpmA 125846 126106 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036349.1 protein_id gnl|my_center|LOCUS_00990 126227 127030 gene locus_tag LOCUS_01000 126227 127030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 127017 128072 gene locus_tag LOCUS_01010 gene obgE 127017 128072 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036350.1 protein_id gnl|my_center|LOCUS_01010 128885 128616 gene locus_tag LOCUS_01020 gene rpsT 128885 128616 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002807888.1 protein_id gnl|my_center|LOCUS_01020 129001 130593 gene locus_tag LOCUS_01030 gene murJ 129001 130593 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036351.1 protein_id gnl|my_center|LOCUS_01030 130676 131716 gene locus_tag LOCUS_01040 130676 131716 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 protein_id gnl|my_center|LOCUS_01040 131723 134554 gene locus_tag LOCUS_01050 gene ileS 131723 134554 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036353.1 protein_id gnl|my_center|LOCUS_01050 134586 135149 gene locus_tag LOCUS_01060 gene lspA 134586 135149 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036354.1 protein_id gnl|my_center|LOCUS_01060 135209 136159 gene locus_tag LOCUS_01070 gene ispH 135209 136159 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036355.1 protein_id gnl|my_center|LOCUS_01070 136196 136271 gene locus_tag LOCUS_t00020 136196 136271 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 136416 136697 gene locus_tag LOCUS_01080 136416 136697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01080 136757 136888 gene locus_tag LOCUS_01090 136757 136888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01090 136892 137065 gene locus_tag LOCUS_01100 136892 137065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01100 137095 137286 gene locus_tag LOCUS_01110 137095 137286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01110 137406 139517 gene locus_tag LOCUS_01120 137406 139517 CDS product PHD finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922228.1 protein_id gnl|my_center|LOCUS_01120 142648 139886 gene locus_tag LOCUS_01130 142648 139886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 143634 142657 gene locus_tag LOCUS_01140 143634 142657 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_01140 144290 143631 gene locus_tag LOCUS_01150 144290 143631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 144424 147309 gene locus_tag LOCUS_01160 144424 147309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 147590 148630 gene locus_tag LOCUS_01170 gene cyoA 147590 148630 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036356.1 protein_id gnl|my_center|LOCUS_01170 148633 150633 gene locus_tag LOCUS_01180 gene cyoB 148633 150633 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036357.1 protein_id gnl|my_center|LOCUS_01180 150630 151268 gene locus_tag LOCUS_01190 gene cyoC 150630 151268 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217107.1 protein_id gnl|my_center|LOCUS_01190 151268 151609 gene locus_tag LOCUS_01200 151268 151609 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 protein_id gnl|my_center|LOCUS_01200 153795 151687 gene locus_tag LOCUS_01210 153795 151687 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113558.1 protein_id gnl|my_center|LOCUS_01210 153882 155258 gene locus_tag LOCUS_01220 gene radA 153882 155258 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438953.1 protein_id gnl|my_center|LOCUS_01220 155304 155774 gene locus_tag LOCUS_01230 155304 155774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 156596 155802 gene locus_tag LOCUS_01240 gene ccsA 156596 155802 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 protein_id gnl|my_center|LOCUS_01240 156715 158094 gene locus_tag LOCUS_01250 gene ffh 156715 158094 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036391.1 protein_id gnl|my_center|LOCUS_01250 158232 159302 gene locus_tag LOCUS_01260 158232 159302 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036394.1 protein_id gnl|my_center|LOCUS_01260 159299 160093 gene locus_tag LOCUS_01270 159299 160093 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_01270 160206 160466 gene locus_tag LOCUS_01280 gene rpsP 160206 160466 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036396.1 protein_id gnl|my_center|LOCUS_01280 160505 161020 gene locus_tag LOCUS_01290 gene rimM 160505 161020 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_01290 161026 161805 gene locus_tag LOCUS_01300 gene trmD 161026 161805 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036398.1 protein_id gnl|my_center|LOCUS_01300 161938 162345 gene locus_tag LOCUS_01310 gene rplS 161938 162345 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036399.1 protein_id gnl|my_center|LOCUS_01310 163515 162739 gene locus_tag LOCUS_01320 163515 162739 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704761.1 protein_id gnl|my_center|LOCUS_01320 164884 163550 gene locus_tag LOCUS_01330 gene kbaZ 164884 163550 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 protein_id gnl|my_center|LOCUS_01330 165839 164901 gene locus_tag LOCUS_01340 gene nagK 165839 164901 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 protein_id gnl|my_center|LOCUS_01340 166986 165832 gene locus_tag LOCUS_01350 166986 165832 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704759.1 protein_id gnl|my_center|LOCUS_01350 167300 170662 gene locus_tag LOCUS_01360 167300 170662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 170780 173758 gene locus_tag LOCUS_01370 170780 173758 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_01370 173880 175235 gene locus_tag LOCUS_01380 173880 175235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_01380 176840 175368 gene locus_tag LOCUS_01390 176840 175368 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_01390 176969 177205 gene locus_tag LOCUS_01400 176969 177205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 177198 177605 gene locus_tag LOCUS_01410 177198 177605 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036401.1 protein_id gnl|my_center|LOCUS_01410 178313 177708 gene locus_tag LOCUS_01420 178313 177708 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036403.1 protein_id gnl|my_center|LOCUS_01420 178346 178642 gene locus_tag LOCUS_01430 178346 178642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 180275 178632 gene locus_tag LOCUS_01440 gene katA 180275 178632 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951343.1 protein_id gnl|my_center|LOCUS_01440 181074 180415 gene locus_tag LOCUS_01450 181074 180415 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199340.1 protein_id gnl|my_center|LOCUS_01450 181220 181924 gene locus_tag LOCUS_01460 181220 181924 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968439.1 protein_id gnl|my_center|LOCUS_01460 181984 182607 gene locus_tag LOCUS_01470 181984 182607 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_01470 186183 183553 gene locus_tag LOCUS_01480 gene mutS 186183 183553 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574877.1 protein_id gnl|my_center|LOCUS_01480 186359 188086 gene locus_tag LOCUS_01490 186359 188086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 188110 188886 gene locus_tag LOCUS_01500 188110 188886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 188883 189503 gene locus_tag LOCUS_01510 188883 189503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 189676 190329 gene locus_tag LOCUS_01520 189676 190329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 190322 191233 gene locus_tag LOCUS_01530 190322 191233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 191223 191969 gene locus_tag LOCUS_01540 191223 191969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 192651 194333 gene locus_tag LOCUS_01550 192651 194333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 194330 195439 gene locus_tag LOCUS_01560 194330 195439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 195436 195696 gene locus_tag LOCUS_01570 195436 195696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 195758 196786 gene locus_tag LOCUS_01580 195758 196786 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_01580 197552 196791 gene locus_tag LOCUS_01590 197552 196791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 197681 198421 gene locus_tag LOCUS_01600 197681 198421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 198421 198792 gene locus_tag LOCUS_01610 198421 198792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 198789 199172 gene locus_tag LOCUS_01620 198789 199172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 199169 199660 gene locus_tag LOCUS_01630 199169 199660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 200465 199650 gene locus_tag LOCUS_01640 200465 199650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105153.1 protein_id gnl|my_center|LOCUS_01640 201030 200512 gene locus_tag LOCUS_01650 201030 200512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 201198 201746 gene locus_tag LOCUS_01660 gene radC 201198 201746 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036798.1 protein_id gnl|my_center|LOCUS_01660 201846 202343 gene locus_tag LOCUS_01670 201846 202343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 202473 203156 gene locus_tag LOCUS_01680 202473 203156 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311365.1 protein_id gnl|my_center|LOCUS_01680 203188 205362 gene locus_tag LOCUS_01690 203188 205362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 205722 207098 gene locus_tag LOCUS_01700 205722 207098 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_01700 207095 208036 gene locus_tag LOCUS_01710 207095 208036 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_01710 208055 208621 gene locus_tag LOCUS_01720 208055 208621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 209887 208625 gene locus_tag LOCUS_01730 209887 208625 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 protein_id gnl|my_center|LOCUS_01730 209899 210150 gene locus_tag LOCUS_01740 209899 210150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 210520 210143 gene locus_tag LOCUS_01750 210520 210143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 210983 210522 gene locus_tag LOCUS_01760 gene umuD 210983 210522 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705001.1 protein_id gnl|my_center|LOCUS_01760 211673 211167 gene locus_tag LOCUS_01770 211673 211167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 212136 211693 gene locus_tag LOCUS_01780 212136 211693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 212318 212656 gene locus_tag LOCUS_01790 212318 212656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 212661 213263 gene locus_tag LOCUS_01800 212661 213263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 213260 213574 gene locus_tag LOCUS_01810 213260 213574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 213839 213540 gene locus_tag LOCUS_01820 213839 213540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 214156 214398 gene locus_tag LOCUS_01830 214156 214398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 214395 214835 gene locus_tag LOCUS_01840 214395 214835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 214846 215820 gene locus_tag LOCUS_01850 214846 215820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 215895 216182 gene locus_tag LOCUS_01860 215895 216182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 216282 216806 gene locus_tag LOCUS_01870 216282 216806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 216809 217222 gene locus_tag LOCUS_01880 216809 217222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 217416 218900 gene locus_tag LOCUS_01890 217416 218900 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 protein_id gnl|my_center|LOCUS_01890 218912 219805 gene locus_tag LOCUS_01900 218912 219805 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_01900 221013 220033 gene locus_tag LOCUS_01910 221013 220033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 222260 221007 gene locus_tag LOCUS_01920 222260 221007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 222660 222866 gene locus_tag LOCUS_01930 222660 222866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 222917 223108 gene locus_tag LOCUS_01940 222917 223108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 223203 224108 gene locus_tag LOCUS_01950 223203 224108 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035362.1 protein_id gnl|my_center|LOCUS_01950 224134 224310 gene locus_tag LOCUS_01960 224134 224310 CDS product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037452.1 protein_id gnl|my_center|LOCUS_01960 224320 226884 gene locus_tag LOCUS_01970 gene ligD 224320 226884 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 protein_id gnl|my_center|LOCUS_01970 227126 226887 gene locus_tag LOCUS_01980 227126 226887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01980 227486 227139 gene locus_tag LOCUS_01990 227486 227139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01990 227926 228297 gene locus_tag LOCUS_02000 227926 228297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 228493 228684 gene locus_tag LOCUS_02010 228493 228684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 228681 228866 gene locus_tag LOCUS_02020 228681 228866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 229962 228832 gene locus_tag LOCUS_02030 229962 228832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 230469 230128 gene locus_tag LOCUS_02040 230469 230128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 230859 230494 gene locus_tag LOCUS_02050 230859 230494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 230989 231744 gene locus_tag LOCUS_02060 230989 231744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574588.1 protein_id gnl|my_center|LOCUS_02060 231741 232106 gene locus_tag LOCUS_02070 231741 232106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 232166 232660 gene locus_tag LOCUS_02080 232166 232660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 232685 233101 gene locus_tag LOCUS_02090 232685 233101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 233385 233618 gene locus_tag LOCUS_02100 233385 233618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 233618 233962 gene locus_tag LOCUS_02110 233618 233962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 233949 234446 gene locus_tag LOCUS_02120 233949 234446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 >Feature sequence002 460 1542 gene locus_tag LOCUS_02130 460 1542 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036765.1 protein_id gnl|my_center|LOCUS_02130 2355 1627 gene locus_tag LOCUS_02140 gene hutC 2355 1627 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036764.1 protein_id gnl|my_center|LOCUS_02140 3745 2375 gene locus_tag LOCUS_02150 3745 2375 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275387.1 protein_id gnl|my_center|LOCUS_02150 3807 5015 gene locus_tag LOCUS_02160 gene hutI 3807 5015 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036762.1 protein_id gnl|my_center|LOCUS_02160 5140 6681 gene locus_tag LOCUS_02170 gene hutH 5140 6681 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036761.1 protein_id gnl|my_center|LOCUS_02170 6950 7798 gene locus_tag LOCUS_02180 gene hutG 6950 7798 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036760.1 protein_id gnl|my_center|LOCUS_02180 7795 9465 gene locus_tag LOCUS_02190 gene hutU 7795 9465 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 protein_id gnl|my_center|LOCUS_02190 9682 11208 gene locus_tag LOCUS_02200 9682 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 11284 11649 gene locus_tag LOCUS_02210 11284 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11642 12211 gene locus_tag LOCUS_02220 11642 12211 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919522.1 protein_id gnl|my_center|LOCUS_02220 12208 12528 gene locus_tag LOCUS_02230 12208 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12674 13180 gene locus_tag LOCUS_02240 12674 13180 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 protein_id gnl|my_center|LOCUS_02240 14026 13301 gene locus_tag LOCUS_02250 14026 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14370 14137 gene locus_tag LOCUS_02260 14370 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 16143 14977 gene locus_tag LOCUS_02270 16143 14977 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930659.1 protein_id gnl|my_center|LOCUS_02270 19091 16746 gene locus_tag LOCUS_02280 19091 16746 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_02280 19048 19287 gene locus_tag LOCUS_02290 19048 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 19309 20433 gene locus_tag LOCUS_02300 19309 20433 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_02300 21682 20984 gene locus_tag LOCUS_02310 21682 20984 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036626.1 protein_id gnl|my_center|LOCUS_02310 22382 21939 gene locus_tag LOCUS_02320 22382 21939 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162277122.1 protein_id gnl|my_center|LOCUS_02320 22488 24170 gene locus_tag LOCUS_02330 22488 24170 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_02330 24329 25216 gene locus_tag LOCUS_02340 24329 25216 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_02340 27418 25241 gene locus_tag LOCUS_02350 27418 25241 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037026.1 protein_id gnl|my_center|LOCUS_02350 28481 27420 gene locus_tag LOCUS_02360 28481 27420 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_02360 30191 28674 gene locus_tag LOCUS_02370 gene lysS 30191 28674 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 protein_id gnl|my_center|LOCUS_02370 31220 30294 gene locus_tag LOCUS_02380 gene prfB 31220 30294 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100097357.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 31588 32730 gene locus_tag LOCUS_02390 31588 32730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 32856 34199 gene locus_tag LOCUS_02400 32856 34199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 35160 34282 gene locus_tag LOCUS_02410 35160 34282 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994057.1 protein_id gnl|my_center|LOCUS_02410 35313 36503 gene locus_tag LOCUS_02420 35313 36503 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_02420 38189 36525 gene locus_tag LOCUS_02430 gene recJ 38189 36525 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037016.1 protein_id gnl|my_center|LOCUS_02430 37894 37815 gene locus_tag LOCUS_t00030 37894 37815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39174 38245 gene locus_tag LOCUS_02440 39174 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_02440 39919 39443 gene locus_tag LOCUS_02450 gene greA 39919 39443 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507602.1 protein_id gnl|my_center|LOCUS_02450 43158 39916 gene locus_tag LOCUS_02460 gene carB 43158 39916 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 protein_id gnl|my_center|LOCUS_02460 44395 43268 gene locus_tag LOCUS_02470 gene carA 44395 43268 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 protein_id gnl|my_center|LOCUS_02470 45283 44603 gene locus_tag LOCUS_02480 gene dapB 45283 44603 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037010.1 protein_id gnl|my_center|LOCUS_02480 45817 46398 gene locus_tag LOCUS_02490 45817 46398 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_02490 46739 46485 gene locus_tag LOCUS_02500 46739 46485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037006.1 protein_id gnl|my_center|LOCUS_02500 48601 46739 gene locus_tag LOCUS_02510 48601 46739 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_02510 48843 48598 gene locus_tag LOCUS_02520 48843 48598 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 protein_id gnl|my_center|LOCUS_02520 49375 49016 gene locus_tag LOCUS_02530 49375 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 49705 49475 gene locus_tag LOCUS_02540 49705 49475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 50585 49809 gene locus_tag LOCUS_02550 50585 49809 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_02550 51202 50732 gene locus_tag LOCUS_02560 51202 50732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 51906 51199 gene locus_tag LOCUS_02570 51906 51199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 52703 51906 gene locus_tag LOCUS_02580 52703 51906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 53521 52703 gene locus_tag LOCUS_02590 53521 52703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 54927 53512 gene locus_tag LOCUS_02600 54927 53512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 60491 54924 gene locus_tag LOCUS_02610 60491 54924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 61195 60836 gene locus_tag LOCUS_02620 61195 60836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 62325 61348 gene locus_tag LOCUS_02630 62325 61348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 62550 62329 gene locus_tag LOCUS_02640 62550 62329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 63002 62547 gene locus_tag LOCUS_02650 63002 62547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 63502 62999 gene locus_tag LOCUS_02660 63502 62999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 63856 63506 gene locus_tag LOCUS_02670 63856 63506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 64828 63935 gene locus_tag LOCUS_02680 64828 63935 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142982.1 protein_id gnl|my_center|LOCUS_02680 65278 64865 gene locus_tag LOCUS_02690 65278 64865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 66406 65318 gene locus_tag LOCUS_02700 66406 65318 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 protein_id gnl|my_center|LOCUS_02700 67145 66645 gene locus_tag LOCUS_02710 67145 66645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 68417 67233 gene locus_tag LOCUS_02720 68417 67233 CDS product PBECR2 nuclease fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110752062.1 protein_id gnl|my_center|LOCUS_02720 70011 68410 gene locus_tag LOCUS_02730 70011 68410 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070990.1 protein_id gnl|my_center|LOCUS_02730 71660 70005 gene locus_tag LOCUS_02740 71660 70005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_02740 72220 71660 gene locus_tag LOCUS_02750 72220 71660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 72523 72224 gene locus_tag LOCUS_02760 72523 72224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 72792 72520 gene locus_tag LOCUS_02770 72792 72520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 73022 72792 gene locus_tag LOCUS_02780 73022 72792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 73224 73003 gene locus_tag LOCUS_02790 73224 73003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 73880 73221 gene locus_tag LOCUS_02800 73880 73221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 74596 73874 gene locus_tag LOCUS_02810 74596 73874 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939968.1 protein_id gnl|my_center|LOCUS_02810 74910 74593 gene locus_tag LOCUS_02820 74910 74593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 75441 75079 gene locus_tag LOCUS_02830 75441 75079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 75866 75444 gene locus_tag LOCUS_02840 75866 75444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 76458 75850 gene locus_tag LOCUS_02850 76458 75850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 76742 76458 gene locus_tag LOCUS_02860 76742 76458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 77332 76742 gene locus_tag LOCUS_02870 77332 76742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 77583 77332 gene locus_tag LOCUS_02880 77583 77332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 77760 77587 gene locus_tag LOCUS_02890 77760 77587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 78023 77760 gene locus_tag LOCUS_02900 78023 77760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 78311 78027 gene locus_tag LOCUS_02910 78311 78027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 78754 78308 gene locus_tag LOCUS_02920 78754 78308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 79373 78756 gene locus_tag LOCUS_02930 79373 78756 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_02930 79530 79360 gene locus_tag LOCUS_02940 79530 79360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 79820 79527 gene locus_tag LOCUS_02950 79820 79527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 80251 79817 gene locus_tag LOCUS_02960 80251 79817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 80448 80248 gene locus_tag LOCUS_02970 80448 80248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 81608 80445 gene locus_tag LOCUS_02980 81608 80445 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072600.1 protein_id gnl|my_center|LOCUS_02980 83620 81605 gene locus_tag LOCUS_02990 83620 81605 CDS product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072599.1 protein_id gnl|my_center|LOCUS_02990 84063 83620 gene locus_tag LOCUS_03000 84063 83620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 84604 84257 gene locus_tag LOCUS_03010 84604 84257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 84810 85289 gene locus_tag LOCUS_03020 84810 85289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 85255 85587 gene locus_tag LOCUS_03030 85255 85587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 85837 86634 gene locus_tag LOCUS_03040 85837 86634 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_03040 86631 87524 gene locus_tag LOCUS_03050 86631 87524 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_03050 87551 87967 gene locus_tag LOCUS_03060 87551 87967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 88041 88811 gene locus_tag LOCUS_03070 88041 88811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_03070 88879 89445 gene locus_tag LOCUS_03080 gene yeiP 88879 89445 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037000.1 protein_id gnl|my_center|LOCUS_03080 89867 89601 gene locus_tag LOCUS_03090 89867 89601 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_03090 91700 89961 gene locus_tag LOCUS_03100 91700 89961 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036998.1 protein_id gnl|my_center|LOCUS_03100 91999 91700 gene locus_tag LOCUS_03110 91999 91700 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036997.1 protein_id gnl|my_center|LOCUS_03110 93436 92048 gene locus_tag LOCUS_03120 93436 92048 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 protein_id gnl|my_center|LOCUS_03120 93642 94883 gene locus_tag LOCUS_03130 gene serA 93642 94883 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 protein_id gnl|my_center|LOCUS_03130 95514 94957 gene locus_tag LOCUS_03140 95514 94957 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_03140 95697 97175 gene locus_tag LOCUS_03150 95697 97175 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 protein_id gnl|my_center|LOCUS_03150 97240 98673 gene locus_tag LOCUS_03160 97240 98673 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_03160 98861 99508 gene locus_tag LOCUS_03170 98861 99508 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_03170 99593 100147 gene locus_tag LOCUS_03180 99593 100147 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036989.1 protein_id gnl|my_center|LOCUS_03180 100457 101155 gene locus_tag LOCUS_03190 gene mtnC 100457 101155 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036988.1 protein_id gnl|my_center|LOCUS_03190 101347 101838 gene locus_tag LOCUS_03200 101347 101838 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974409.1 protein_id gnl|my_center|LOCUS_03200 103019 101853 gene locus_tag LOCUS_03210 103019 101853 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_03210 105059 103239 gene locus_tag LOCUS_03220 105059 103239 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 protein_id gnl|my_center|LOCUS_03220 105334 106542 gene locus_tag LOCUS_03230 105334 106542 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_03230 107211 106588 gene locus_tag LOCUS_03240 107211 106588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 107873 107199 gene locus_tag LOCUS_03250 107873 107199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 108000 108548 gene locus_tag LOCUS_03260 108000 108548 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_03260 108541 109524 gene locus_tag LOCUS_03270 108541 109524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 109591 110568 gene locus_tag LOCUS_03280 109591 110568 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275470.1 protein_id gnl|my_center|LOCUS_03280 111271 110591 gene locus_tag LOCUS_03290 111271 110591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 111355 111819 gene locus_tag LOCUS_03300 111355 111819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 113355 111829 gene locus_tag LOCUS_03310 113355 111829 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_03310 114095 113460 gene locus_tag LOCUS_03320 gene hisIE 114095 113460 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036985.1 protein_id gnl|my_center|LOCUS_03320 114861 114085 gene locus_tag LOCUS_03330 gene hisF 114861 114085 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036984.1 protein_id gnl|my_center|LOCUS_03330 115589 114855 gene locus_tag LOCUS_03340 gene hisA 115589 114855 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036983.1 protein_id gnl|my_center|LOCUS_03340 116188 115586 gene locus_tag LOCUS_03350 gene hisH 116188 115586 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036982.1 protein_id gnl|my_center|LOCUS_03350 117258 116185 gene locus_tag LOCUS_03360 gene hisB 117258 116185 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036981.1 protein_id gnl|my_center|LOCUS_03360 118337 117255 gene locus_tag LOCUS_03370 gene hisC 118337 117255 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036980.1 protein_id gnl|my_center|LOCUS_03370 119629 118334 gene locus_tag LOCUS_03380 gene hisD 119629 118334 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036979.1 protein_id gnl|my_center|LOCUS_03380 120537 119626 gene locus_tag LOCUS_03390 gene hisG 120537 119626 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036978.1 protein_id gnl|my_center|LOCUS_03390 120874 120548 gene locus_tag LOCUS_03400 120874 120548 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 protein_id gnl|my_center|LOCUS_03400 122404 120998 gene locus_tag LOCUS_03410 gene hisS 122404 120998 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_03410 122514 123272 gene locus_tag LOCUS_03420 122514 123272 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 protein_id gnl|my_center|LOCUS_03420 123361 123804 gene locus_tag LOCUS_03430 123361 123804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 125246 123948 gene locus_tag LOCUS_03440 gene thrC 125246 123948 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 protein_id gnl|my_center|LOCUS_03440 126228 125293 gene locus_tag LOCUS_03450 126228 125293 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036971.1 protein_id gnl|my_center|LOCUS_03450 128750 126240 gene locus_tag LOCUS_03460 gene thrA 128750 126240 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_03460 130193 129261 gene locus_tag LOCUS_03470 130193 129261 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036055.1 protein_id gnl|my_center|LOCUS_03470 131011 130277 gene locus_tag LOCUS_03480 131011 130277 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266709.1 protein_id gnl|my_center|LOCUS_03480 131107 131031 gene locus_tag LOCUS_t00040 131107 131031 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 131259 132791 gene locus_tag LOCUS_03490 131259 132791 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_03490 132990 133277 gene locus_tag LOCUS_03500 132990 133277 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036963.1 protein_id gnl|my_center|LOCUS_03500 133285 134055 gene locus_tag LOCUS_03510 133285 134055 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_03510 134061 135116 gene locus_tag LOCUS_03520 134061 135116 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 protein_id gnl|my_center|LOCUS_03520 135113 136153 gene locus_tag LOCUS_03530 gene murB 135113 136153 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036960.1 protein_id gnl|my_center|LOCUS_03530 136150 137049 gene locus_tag LOCUS_03540 136150 137049 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_03540 138746 137181 gene locus_tag LOCUS_03550 gene guaA 138746 137181 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 protein_id gnl|my_center|LOCUS_03550 140310 138853 gene locus_tag LOCUS_03560 gene guaB 140310 138853 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037330.1 protein_id gnl|my_center|LOCUS_03560 141379 140495 gene locus_tag LOCUS_03570 gene folD 141379 140495 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037331.1 protein_id gnl|my_center|LOCUS_03570 142618 141461 gene locus_tag LOCUS_03580 gene moeB 142618 141461 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 protein_id gnl|my_center|LOCUS_03580 144100 142700 gene locus_tag LOCUS_03590 gene der 144100 142700 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037150.1 protein_id gnl|my_center|LOCUS_03590 145309 144113 gene locus_tag LOCUS_03600 gene bamB 145309 144113 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507731.1 protein_id gnl|my_center|LOCUS_03600 145950 145309 gene locus_tag LOCUS_03610 145950 145309 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037148.1 protein_id gnl|my_center|LOCUS_03610 146842 146009 gene locus_tag LOCUS_03620 146842 146009 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 protein_id gnl|my_center|LOCUS_03620 147658 146867 gene locus_tag LOCUS_03630 gene pilW 147658 146867 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_03630 148868 147651 gene locus_tag LOCUS_03640 gene rlmN 148868 147651 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065467767.1 protein_id gnl|my_center|LOCUS_03640 149317 148892 gene locus_tag LOCUS_03650 gene ndk 149317 148892 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812972.1 protein_id gnl|my_center|LOCUS_03650 149527 150180 gene locus_tag LOCUS_03660 149527 150180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence003 6405 1 gene locus_tag LOCUS_03670 6405 1 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211921382.1 protein_id gnl|my_center|LOCUS_03670 6724 7269 gene locus_tag LOCUS_03680 6724 7269 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 protein_id gnl|my_center|LOCUS_03680 7349 7885 gene locus_tag LOCUS_03690 7349 7885 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039264.1 protein_id gnl|my_center|LOCUS_03690 7971 8510 gene locus_tag LOCUS_03700 7971 8510 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039265.1 protein_id gnl|my_center|LOCUS_03700 8512 9075 gene locus_tag LOCUS_03710 8512 9075 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102257240.1 protein_id gnl|my_center|LOCUS_03710 9427 9137 gene locus_tag LOCUS_03720 9427 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039267.1 protein_id gnl|my_center|LOCUS_03720 10311 9619 gene locus_tag LOCUS_03730 10311 9619 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530528.1 protein_id gnl|my_center|LOCUS_03730 10470 11093 gene locus_tag LOCUS_03740 gene pncA 10470 11093 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870185.1 protein_id gnl|my_center|LOCUS_03740 11954 11103 gene locus_tag LOCUS_03750 gene purU 11954 11103 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275169.1 protein_id gnl|my_center|LOCUS_03750 13152 12058 gene locus_tag LOCUS_03760 13152 12058 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437089.1 protein_id gnl|my_center|LOCUS_03760 14101 13226 gene locus_tag LOCUS_03770 14101 13226 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 protein_id gnl|my_center|LOCUS_03770 14520 14116 gene locus_tag LOCUS_03780 14520 14116 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 protein_id gnl|my_center|LOCUS_03780 15685 14621 gene locus_tag LOCUS_03790 15685 14621 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_03790 15792 16112 gene locus_tag LOCUS_03800 15792 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 18560 16176 gene locus_tag LOCUS_03810 18560 16176 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_03810 19244 20053 gene locus_tag LOCUS_03820 19244 20053 CDS product DUF2884 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275534.1 protein_id gnl|my_center|LOCUS_03820 21683 20205 gene locus_tag LOCUS_03830 21683 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 22916 21813 gene locus_tag LOCUS_03840 gene zapE 22916 21813 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035516.1 protein_id gnl|my_center|LOCUS_03840 23581 22910 gene locus_tag LOCUS_03850 23581 22910 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_03850 23649 24503 gene locus_tag LOCUS_03860 23649 24503 CDS product EamA/RhaT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275155.1 protein_id gnl|my_center|LOCUS_03860 24580 24951 gene locus_tag LOCUS_03870 24580 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 26727 25000 gene locus_tag LOCUS_03880 26727 25000 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053209.1 protein_id gnl|my_center|LOCUS_03880 27324 26803 gene locus_tag LOCUS_03890 27324 26803 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 protein_id gnl|my_center|LOCUS_03890 28059 27433 gene locus_tag LOCUS_03900 28059 27433 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 protein_id gnl|my_center|LOCUS_03900 28202 29365 gene locus_tag LOCUS_03910 28202 29365 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 protein_id gnl|my_center|LOCUS_03910 29515 31125 gene locus_tag LOCUS_03920 29515 31125 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 protein_id gnl|my_center|LOCUS_03920 31499 33481 gene locus_tag LOCUS_03930 31499 33481 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_03930 34987 33824 gene locus_tag LOCUS_03940 34987 33824 CDS product putative peptide maturation dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053194.1 protein_id gnl|my_center|LOCUS_03940 35089 35445 gene locus_tag LOCUS_03950 35089 35445 CDS product NHLP-related RiPP peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275153.1 protein_id gnl|my_center|LOCUS_03950 38048 35385 gene locus_tag LOCUS_03960 38048 35385 CDS product putative peptide modification system cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035495.1 protein_id gnl|my_center|LOCUS_03960 39096 38050 gene locus_tag LOCUS_03970 39096 38050 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035494.1 protein_id gnl|my_center|LOCUS_03970 40608 39277 gene locus_tag LOCUS_03980 gene aceA 40608 39277 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095023.1 protein_id gnl|my_center|LOCUS_03980 42306 40666 gene locus_tag LOCUS_03990 gene aceB 42306 40666 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 protein_id gnl|my_center|LOCUS_03990 42415 43383 gene locus_tag LOCUS_04000 42415 43383 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_04000 43471 45564 gene locus_tag LOCUS_04010 43471 45564 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_04010 47339 45642 gene locus_tag LOCUS_04020 gene dld 47339 45642 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208066.1 protein_id gnl|my_center|LOCUS_04020 48475 47336 gene locus_tag LOCUS_04030 gene lldD 48475 47336 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035364.1 protein_id gnl|my_center|LOCUS_04030 49257 48472 gene locus_tag LOCUS_04040 gene lldR 49257 48472 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686511.1 protein_id gnl|my_center|LOCUS_04040 50169 49540 gene locus_tag LOCUS_04050 gene lepB 50169 49540 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_04050 50335 50832 gene locus_tag LOCUS_04060 50335 50832 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275485.1 protein_id gnl|my_center|LOCUS_04060 50819 51040 gene locus_tag LOCUS_04070 50819 51040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 53276 51120 gene locus_tag LOCUS_04080 gene dcp 53276 51120 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_04080 54824 53388 gene locus_tag LOCUS_04090 54824 53388 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_04090 55445 54828 gene locus_tag LOCUS_04100 55445 54828 CDS product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_04100 55880 55449 gene locus_tag LOCUS_04110 gene arfB 55880 55449 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_04110 56881 55937 gene locus_tag LOCUS_04120 56881 55937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 59244 56878 gene locus_tag LOCUS_04130 59244 56878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 60538 59258 gene locus_tag LOCUS_04140 60538 59258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 60499 60428 gene locus_tag LOCUS_t00050 60499 60428 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 62082 60556 gene locus_tag LOCUS_04150 62082 60556 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_04150 63140 62079 gene locus_tag LOCUS_04160 63140 62079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 63288 64271 gene locus_tag LOCUS_04170 63288 64271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 64340 64729 gene locus_tag LOCUS_04180 64340 64729 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689346.1 protein_id gnl|my_center|LOCUS_04180 65578 64829 gene locus_tag LOCUS_04190 65578 64829 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275145.1 protein_id gnl|my_center|LOCUS_04190 66336 65662 gene locus_tag LOCUS_04200 66336 65662 CDS product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 protein_id gnl|my_center|LOCUS_04200 67982 66333 gene locus_tag LOCUS_04210 gene ubiB 67982 66333 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035479.1 protein_id gnl|my_center|LOCUS_04210 68644 67997 gene locus_tag LOCUS_04220 68644 67997 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_04220 68853 69956 gene locus_tag LOCUS_04230 gene ddlA 68853 69956 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053170.1 protein_id gnl|my_center|LOCUS_04230 70019 71230 gene locus_tag LOCUS_04240 70019 71230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706487.1 protein_id gnl|my_center|LOCUS_04240 71413 71258 gene locus_tag LOCUS_04250 71413 71258 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003468167.1 protein_id gnl|my_center|LOCUS_04250 72515 71517 gene locus_tag LOCUS_04260 72515 71517 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_04260 74164 72512 gene locus_tag LOCUS_04270 gene oleC 74164 72512 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_04270 74267 74683 gene locus_tag LOCUS_04280 74267 74683 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 protein_id gnl|my_center|LOCUS_04280 75752 74862 gene locus_tag LOCUS_04290 75752 74862 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 protein_id gnl|my_center|LOCUS_04290 76593 75883 gene locus_tag LOCUS_04300 76593 75883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 76712 77299 gene locus_tag LOCUS_04310 76712 77299 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_04310 77454 78182 gene locus_tag LOCUS_04320 77454 78182 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 protein_id gnl|my_center|LOCUS_04320 79503 78487 gene locus_tag LOCUS_04330 79503 78487 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_04330 80032 79721 gene locus_tag LOCUS_04340 80032 79721 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509441.1 protein_id gnl|my_center|LOCUS_04340 82993 80135 gene locus_tag LOCUS_04350 82993 80135 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_04350 83422 83817 gene locus_tag LOCUS_04360 83422 83817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035466.1 protein_id gnl|my_center|LOCUS_04360 84544 85782 gene locus_tag LOCUS_04370 84544 85782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 86055 85783 gene locus_tag LOCUS_04380 86055 85783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 86507 87316 gene locus_tag LOCUS_04390 86507 87316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 87384 88577 gene locus_tag LOCUS_04400 gene dcm 87384 88577 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_04400 88567 89298 gene locus_tag LOCUS_04410 88567 89298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 89790 89314 gene locus_tag LOCUS_04420 gene radC 89790 89314 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036798.1 protein_id gnl|my_center|LOCUS_04420 90306 90866 gene locus_tag LOCUS_04430 90306 90866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 91432 90899 gene locus_tag LOCUS_04440 91432 90899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 93140 91353 gene locus_tag LOCUS_04450 93140 91353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 93226 93714 gene locus_tag LOCUS_04460 93226 93714 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035465.1 protein_id gnl|my_center|LOCUS_04460 93803 94270 gene locus_tag LOCUS_04470 93803 94270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 95518 94289 gene locus_tag LOCUS_04480 95518 94289 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389759.1 protein_id gnl|my_center|LOCUS_04480 96758 95586 gene locus_tag LOCUS_04490 96758 95586 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_04490 96989 98368 gene locus_tag LOCUS_04500 96989 98368 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037940.1 protein_id gnl|my_center|LOCUS_04500 98464 99051 gene locus_tag LOCUS_04510 98464 99051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 99115 99378 gene locus_tag LOCUS_04520 99115 99378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 101628 99442 gene locus_tag LOCUS_04530 gene dinG 101628 99442 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039022.1 protein_id gnl|my_center|LOCUS_04530 102066 102503 gene locus_tag LOCUS_04540 102066 102503 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_04540 103147 102800 gene locus_tag LOCUS_04550 103147 102800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 104001 103153 gene locus_tag LOCUS_04560 gene aroE 104001 103153 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039025.1 protein_id gnl|my_center|LOCUS_04560 104055 104936 gene locus_tag LOCUS_04570 104055 104936 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039026.1 protein_id gnl|my_center|LOCUS_04570 105507 105205 gene locus_tag LOCUS_04580 105507 105205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 106496 105507 gene locus_tag LOCUS_04590 gene hemB 106496 105507 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039028.1 protein_id gnl|my_center|LOCUS_04590 107437 106523 gene locus_tag LOCUS_04600 107437 106523 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853391.1 protein_id gnl|my_center|LOCUS_04600 107763 107515 gene locus_tag LOCUS_04610 107763 107515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 107895 108314 gene locus_tag LOCUS_04620 107895 108314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039030.1 protein_id gnl|my_center|LOCUS_04620 110172 108382 gene locus_tag LOCUS_04630 110172 108382 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275500.1 protein_id gnl|my_center|LOCUS_04630 110699 110211 gene locus_tag LOCUS_04640 110699 110211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 112944 110719 gene locus_tag LOCUS_04650 112944 110719 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_04650 113174 113031 gene locus_tag LOCUS_04660 113174 113031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 113597 113295 gene locus_tag LOCUS_04670 113597 113295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 117138 114088 gene locus_tag LOCUS_04680 117138 114088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 118824 117151 gene locus_tag LOCUS_04690 118824 117151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 119906 119217 gene locus_tag LOCUS_04700 119906 119217 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 protein_id gnl|my_center|LOCUS_04700 120016 120597 gene locus_tag LOCUS_04710 120016 120597 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448628.1 protein_id gnl|my_center|LOCUS_04710 120797 121792 gene locus_tag LOCUS_04720 120797 121792 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence004 <1 1320 gene locus_tag LOCUS_04730 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039259.1:exodeoxyribonuclease V subunit alpha 1422 3431 gene locus_tag LOCUS_04740 1422 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4463 3543 gene locus_tag LOCUS_04750 4463 3543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_04750 4551 5300 gene locus_tag LOCUS_04760 4551 5300 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_04760 5377 5967 gene locus_tag LOCUS_04770 5377 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6067 6462 gene locus_tag LOCUS_04780 6067 6462 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228843.1 protein_id gnl|my_center|LOCUS_04780 7261 6587 gene locus_tag LOCUS_04790 7261 6587 CDS product DUF2894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198086.1 protein_id gnl|my_center|LOCUS_04790 7898 7251 gene locus_tag LOCUS_04800 7898 7251 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038795.1 protein_id gnl|my_center|LOCUS_04800 10291 7895 gene locus_tag LOCUS_04810 10291 7895 CDS product DUF802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205575.1 protein_id gnl|my_center|LOCUS_04810 11057 10302 gene locus_tag LOCUS_04820 11057 10302 CDS product DUF3348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275455.1 protein_id gnl|my_center|LOCUS_04820 11398 11126 gene locus_tag LOCUS_04830 11398 11126 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082658.1 protein_id gnl|my_center|LOCUS_04830 11445 12407 gene locus_tag LOCUS_04840 gene aitP 11445 12407 CDS product CDF family iron/cobalt efflux transporter AitP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_04840 13055 12420 gene locus_tag LOCUS_04850 13055 12420 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 protein_id gnl|my_center|LOCUS_04850 14158 13052 gene locus_tag LOCUS_04860 14158 13052 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_04860 14321 15022 gene locus_tag LOCUS_04870 14321 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 15991 15101 gene locus_tag LOCUS_04880 gene phhA 15991 15101 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_04880 16120 16605 gene locus_tag LOCUS_04890 16120 16605 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_04890 16682 17968 gene locus_tag LOCUS_04900 16682 17968 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_04900 19076 17985 gene locus_tag LOCUS_04910 19076 17985 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_04910 19732 19136 gene locus_tag LOCUS_04920 19732 19136 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112490.1 protein_id gnl|my_center|LOCUS_04920 20849 19836 gene locus_tag LOCUS_04930 20849 19836 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_04930 22046 20937 gene locus_tag LOCUS_04940 22046 20937 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_04940 23022 22180 gene locus_tag LOCUS_04950 23022 22180 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_04950 23896 23081 gene locus_tag LOCUS_04960 23896 23081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035418.1 protein_id gnl|my_center|LOCUS_04960 24039 25241 gene locus_tag LOCUS_04970 24039 25241 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035419.1 protein_id gnl|my_center|LOCUS_04970 25238 25609 gene locus_tag LOCUS_04980 25238 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035420.1 protein_id gnl|my_center|LOCUS_04980 25846 26667 gene locus_tag LOCUS_04990 gene mutM 25846 26667 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_04990 26774 28369 gene locus_tag LOCUS_05000 26774 28369 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039214.1 protein_id gnl|my_center|LOCUS_05000 28606 30051 gene locus_tag LOCUS_05010 28606 30051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 30729 30109 gene locus_tag LOCUS_05020 30729 30109 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039212.1 protein_id gnl|my_center|LOCUS_05020 31614 30865 gene locus_tag LOCUS_05030 31614 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 31721 33706 gene locus_tag LOCUS_05040 31721 33706 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039208.1 protein_id gnl|my_center|LOCUS_05040 33778 34299 gene locus_tag LOCUS_05050 33778 34299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_05050 35443 34784 gene locus_tag LOCUS_05060 35443 34784 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039205.1 protein_id gnl|my_center|LOCUS_05060 35563 36465 gene locus_tag LOCUS_05070 35563 36465 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 protein_id gnl|my_center|LOCUS_05070 36462 37181 gene locus_tag LOCUS_05080 gene pyrF 36462 37181 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_05080 37538 38416 gene locus_tag LOCUS_05090 37538 38416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942118.1 protein_id gnl|my_center|LOCUS_05090 38416 41028 gene locus_tag LOCUS_05100 gene plsB 38416 41028 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039197.1 protein_id gnl|my_center|LOCUS_05100 41065 41289 gene locus_tag LOCUS_05110 41065 41289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 41521 41315 gene locus_tag LOCUS_05120 41521 41315 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509561.1 protein_id gnl|my_center|LOCUS_05120 43008 41539 gene locus_tag LOCUS_05130 43008 41539 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_05130 45554 43008 gene locus_tag LOCUS_05140 45554 43008 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_05140 45676 46596 gene locus_tag LOCUS_05150 gene ttcA 45676 46596 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039168.1 protein_id gnl|my_center|LOCUS_05150 46691 47599 gene locus_tag LOCUS_05160 46691 47599 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039167.1 protein_id gnl|my_center|LOCUS_05160 47652 48440 gene locus_tag LOCUS_05170 47652 48440 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275488.1 protein_id gnl|my_center|LOCUS_05170 49339 48482 gene locus_tag LOCUS_05180 49339 48482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275487.1 protein_id gnl|my_center|LOCUS_05180 50298 49336 gene locus_tag LOCUS_05190 gene hemH 50298 49336 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921524.1 protein_id gnl|my_center|LOCUS_05190 50615 51514 gene locus_tag LOCUS_05200 50615 51514 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275486.1 protein_id gnl|my_center|LOCUS_05200 51590 51817 gene locus_tag LOCUS_05210 gene tatA 51590 51817 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039162.1 protein_id gnl|my_center|LOCUS_05210 51834 52274 gene locus_tag LOCUS_05220 51834 52274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 52271 53029 gene locus_tag LOCUS_05230 gene tatC 52271 53029 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039160.1 protein_id gnl|my_center|LOCUS_05230 53126 56731 gene locus_tag LOCUS_05240 53126 56731 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079042.1 protein_id gnl|my_center|LOCUS_05240 56716 57573 gene locus_tag LOCUS_05250 56716 57573 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538167.1 protein_id gnl|my_center|LOCUS_05250 57570 58145 gene locus_tag LOCUS_05260 57570 58145 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 protein_id gnl|my_center|LOCUS_05260 58136 59125 gene locus_tag LOCUS_05270 58136 59125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 60030 59137 gene locus_tag LOCUS_05280 60030 59137 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039159.1 protein_id gnl|my_center|LOCUS_05280 60890 60171 gene locus_tag LOCUS_05290 60890 60171 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_05290 62701 60887 gene locus_tag LOCUS_05300 62701 60887 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_05300 62778 63689 gene locus_tag LOCUS_05310 gene glyQ 62778 63689 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_05310 63686 65758 gene locus_tag LOCUS_05320 gene glyS 63686 65758 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039155.1 protein_id gnl|my_center|LOCUS_05320 65762 67324 gene locus_tag LOCUS_05330 65762 67324 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_05330 70150 67376 gene locus_tag LOCUS_05340 70150 67376 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_05340 70351 72135 gene locus_tag LOCUS_05350 70351 72135 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238119.1 protein_id gnl|my_center|LOCUS_05350 72132 76007 gene locus_tag LOCUS_05360 72132 76007 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039153.1 protein_id gnl|my_center|LOCUS_05360 77422 76130 gene locus_tag LOCUS_05370 77422 76130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_05370 78482 80626 gene locus_tag LOCUS_05380 78482 80626 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_05380 80771 81520 gene locus_tag LOCUS_05390 80771 81520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930182.1 protein_id gnl|my_center|LOCUS_05390 81670 82431 gene locus_tag LOCUS_05400 81670 82431 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930182.1 protein_id gnl|my_center|LOCUS_05400 82732 90837 gene locus_tag LOCUS_05410 82732 90837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 87964 87890 gene locus_tag LOCUS_t00060 87964 87890 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 90834 94217 gene locus_tag LOCUS_05420 90834 94217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 94228 95241 gene locus_tag LOCUS_05430 94228 95241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 97219 95312 gene locus_tag LOCUS_05440 97219 95312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 97487 98908 gene locus_tag LOCUS_05450 97487 98908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 98984 102406 gene locus_tag LOCUS_05460 98984 102406 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_05460 103512 102931 gene locus_tag LOCUS_05470 103512 102931 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039144.1 protein_id gnl|my_center|LOCUS_05470 103874 106342 gene locus_tag LOCUS_05480 103874 106342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 107058 106393 gene locus_tag LOCUS_05490 107058 106393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_05490 109164 107221 gene locus_tag LOCUS_05500 gene acs 109164 107221 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039129.1 protein_id gnl|my_center|LOCUS_05500 109406 110836 gene locus_tag LOCUS_05510 109406 110836 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_05510 110980 111297 gene locus_tag LOCUS_05520 110980 111297 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_05520 111294 113015 gene locus_tag LOCUS_05530 111294 113015 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039126.1 protein_id gnl|my_center|LOCUS_05530 113155 114195 gene locus_tag LOCUS_05540 gene bla 113155 114195 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_05540 114964 114209 gene locus_tag LOCUS_05550 114964 114209 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037558.1 protein_id gnl|my_center|LOCUS_05550 115127 116071 gene locus_tag LOCUS_05560 115127 116071 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037557.1 protein_id gnl|my_center|LOCUS_05560 116068 117186 gene locus_tag LOCUS_05570 116068 117186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037556.1 protein_id gnl|my_center|LOCUS_05570 117183 117425 gene locus_tag LOCUS_05580 117183 117425 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence005 467 1153 gene locus_tag LOCUS_05590 gene ftsE 467 1153 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 protein_id gnl|my_center|LOCUS_05590 1150 2127 gene locus_tag LOCUS_05600 gene ftsX 1150 2127 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038856.1 protein_id gnl|my_center|LOCUS_05600 2135 2977 gene locus_tag LOCUS_05610 2135 2977 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506371.1 protein_id gnl|my_center|LOCUS_05610 2974 3708 gene locus_tag LOCUS_05620 gene ung 2974 3708 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_05620 3887 4762 gene locus_tag LOCUS_05630 gene rpoH 3887 4762 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 protein_id gnl|my_center|LOCUS_05630 4942 5343 gene locus_tag LOCUS_05640 4942 5343 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_05640 6656 5355 gene locus_tag LOCUS_05650 6656 5355 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_05650 6788 7564 gene locus_tag LOCUS_05660 6788 7564 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_05660 7644 8264 gene locus_tag LOCUS_05670 7644 8264 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275459.1 protein_id gnl|my_center|LOCUS_05670 11538 8458 gene locus_tag LOCUS_05680 11538 8458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275463.1 protein_id gnl|my_center|LOCUS_05680 12279 14729 gene locus_tag LOCUS_05690 12279 14729 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039282.1 protein_id gnl|my_center|LOCUS_05690 14857 15918 gene locus_tag LOCUS_05700 14857 15918 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507348.1 protein_id gnl|my_center|LOCUS_05700 15998 17257 gene locus_tag LOCUS_05710 gene fucP 15998 17257 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_05710 17264 18259 gene locus_tag LOCUS_05720 17264 18259 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_05720 18256 19533 gene locus_tag LOCUS_05730 18256 19533 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 protein_id gnl|my_center|LOCUS_05730 19574 22288 gene locus_tag LOCUS_05740 19574 22288 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_05740 22288 23715 gene locus_tag LOCUS_05750 22288 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23860 24969 gene locus_tag LOCUS_05760 23860 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 27204 25009 gene locus_tag LOCUS_05770 27204 25009 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 protein_id gnl|my_center|LOCUS_05770 27691 28701 gene locus_tag LOCUS_05780 27691 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038846.1 protein_id gnl|my_center|LOCUS_05780 28688 29251 gene locus_tag LOCUS_05790 28688 29251 CDS product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506381.1 protein_id gnl|my_center|LOCUS_05790 29412 30773 gene locus_tag LOCUS_05800 29412 30773 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_05800 30843 32750 gene locus_tag LOCUS_05810 gene sppA 30843 32750 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 protein_id gnl|my_center|LOCUS_05810 33043 32825 gene locus_tag LOCUS_05820 33043 32825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 33134 33907 gene locus_tag LOCUS_05830 33134 33907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_05830 34597 33923 gene locus_tag LOCUS_05840 34597 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038839.1 protein_id gnl|my_center|LOCUS_05840 35255 34695 gene locus_tag LOCUS_05850 35255 34695 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_05850 37876 35387 gene locus_tag LOCUS_05860 37876 35387 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_05860 38983 38063 gene locus_tag LOCUS_05870 38983 38063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 39793 39017 gene locus_tag LOCUS_05880 39793 39017 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056901.1 protein_id gnl|my_center|LOCUS_05880 40360 39869 gene locus_tag LOCUS_05890 40360 39869 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_05890 41537 40386 gene locus_tag LOCUS_05900 gene dprA 41537 40386 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 protein_id gnl|my_center|LOCUS_05900 42751 41615 gene locus_tag LOCUS_05910 42751 41615 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 protein_id gnl|my_center|LOCUS_05910 42852 43397 gene locus_tag LOCUS_05920 gene def 42852 43397 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_05920 43486 44409 gene locus_tag LOCUS_05930 gene fmt 43486 44409 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_05930 44414 45751 gene locus_tag LOCUS_05940 gene rsmB 44414 45751 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275458.1 protein_id gnl|my_center|LOCUS_05940 45989 46747 gene locus_tag LOCUS_05950 45989 46747 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466243.1 protein_id gnl|my_center|LOCUS_05950 47714 46788 gene locus_tag LOCUS_05960 47714 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 48649 47711 gene locus_tag LOCUS_05970 48649 47711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088745.1 protein_id gnl|my_center|LOCUS_05970 48819 50129 gene locus_tag LOCUS_05980 48819 50129 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038827.1 protein_id gnl|my_center|LOCUS_05980 50932 50120 gene locus_tag LOCUS_05990 50932 50120 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_05990 50931 51992 gene locus_tag LOCUS_06000 50931 51992 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038825.1 protein_id gnl|my_center|LOCUS_06000 53519 52020 gene locus_tag LOCUS_06010 53519 52020 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038824.1 protein_id gnl|my_center|LOCUS_06010 54028 53522 gene locus_tag LOCUS_06020 54028 53522 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038823.1 protein_id gnl|my_center|LOCUS_06020 55214 54084 gene locus_tag LOCUS_06030 gene ribA 55214 54084 CDS product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 protein_id gnl|my_center|LOCUS_06030 56217 55297 gene locus_tag LOCUS_06040 56217 55297 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_06040 56340 56780 gene locus_tag LOCUS_06050 gene dtd 56340 56780 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_06050 56872 58725 gene locus_tag LOCUS_06060 gene rpoD 56872 58725 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038818.1 protein_id gnl|my_center|LOCUS_06060 58864 61197 gene locus_tag LOCUS_06070 58864 61197 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 protein_id gnl|my_center|LOCUS_06070 61267 61342 gene locus_tag LOCUS_t00070 61267 61342 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 61521 62750 gene locus_tag LOCUS_06080 61521 62750 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_06080 62880 64658 gene locus_tag LOCUS_06090 62880 64658 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_06090 64651 66066 gene locus_tag LOCUS_06100 64651 66066 CDS product nuclease PIN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942012.1 protein_id gnl|my_center|LOCUS_06100 66601 66326 gene locus_tag LOCUS_06110 66601 66326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 66605 67252 gene locus_tag LOCUS_06120 66605 67252 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087143.1 protein_id gnl|my_center|LOCUS_06120 67249 67518 gene locus_tag LOCUS_06130 67249 67518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 67505 67702 gene locus_tag LOCUS_06140 67505 67702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 68452 68766 gene locus_tag LOCUS_06150 68452 68766 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514508.1 protein_id gnl|my_center|LOCUS_06150 72711 68971 gene locus_tag LOCUS_06160 72711 68971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 73068 72775 gene locus_tag LOCUS_06170 73068 72775 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105091.1 protein_id gnl|my_center|LOCUS_06170 73486 74235 gene locus_tag LOCUS_06180 73486 74235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 74371 74652 gene locus_tag LOCUS_06190 74371 74652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 74668 75201 gene locus_tag LOCUS_06200 74668 75201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 75198 75713 gene locus_tag LOCUS_06210 75198 75713 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_06210 75973 77643 gene locus_tag LOCUS_06220 75973 77643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 77543 78259 gene locus_tag LOCUS_06230 77543 78259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 78256 78498 gene locus_tag LOCUS_06240 78256 78498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 78849 79685 gene locus_tag LOCUS_06250 78849 79685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 79721 81427 gene locus_tag LOCUS_06260 79721 81427 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104676.1 protein_id gnl|my_center|LOCUS_06260 82427 83332 gene locus_tag LOCUS_06270 82427 83332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 83622 83885 gene locus_tag LOCUS_06280 83622 83885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 84501 84211 gene locus_tag LOCUS_06290 84501 84211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 85614 84868 gene locus_tag LOCUS_06300 85614 84868 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_06300 86762 85605 gene locus_tag LOCUS_06310 86762 85605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 87212 86916 gene locus_tag LOCUS_06320 87212 86916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 88444 87809 gene locus_tag LOCUS_06330 88444 87809 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_06330 88527 88706 gene locus_tag LOCUS_06340 88527 88706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 89366 88803 gene locus_tag LOCUS_06350 89366 88803 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_06350 90180 89506 gene locus_tag LOCUS_06360 90180 89506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 91784 90705 gene locus_tag LOCUS_06370 91784 90705 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_06370 92580 91807 gene locus_tag LOCUS_06380 92580 91807 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_06380 93110 92577 gene locus_tag LOCUS_06390 93110 92577 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_06390 94360 93107 gene locus_tag LOCUS_06400 94360 93107 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_06400 95133 94357 gene locus_tag LOCUS_06410 95133 94357 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_06410 96380 95130 gene locus_tag LOCUS_06420 96380 95130 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_06420 97347 96382 gene locus_tag LOCUS_06430 97347 96382 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_06430 97546 98130 gene locus_tag LOCUS_06440 97546 98130 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 protein_id gnl|my_center|LOCUS_06440 98127 98795 gene locus_tag LOCUS_06450 98127 98795 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770944.1 protein_id gnl|my_center|LOCUS_06450 99579 98860 gene locus_tag LOCUS_06460 99579 98860 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_06460 101216 99687 gene locus_tag LOCUS_06470 101216 99687 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 protein_id gnl|my_center|LOCUS_06470 101965 101213 gene locus_tag LOCUS_06480 101965 101213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 102540 101962 gene locus_tag LOCUS_06490 102540 101962 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_06490 102422 102745 gene locus_tag LOCUS_06500 102422 102745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 102727 102885 gene locus_tag LOCUS_06510 102727 102885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 102897 103562 gene locus_tag LOCUS_06520 102897 103562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 103641 104405 gene locus_tag LOCUS_06530 103641 104405 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_06530 104393 105685 gene locus_tag LOCUS_06540 104393 105685 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406604.1 protein_id gnl|my_center|LOCUS_06540 106086 105799 gene locus_tag LOCUS_06550 106086 105799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 106524 106294 gene locus_tag LOCUS_06560 106524 106294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 106523 106870 gene locus_tag LOCUS_06570 106523 106870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 106861 107223 gene locus_tag LOCUS_06580 106861 107223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 107252 109885 gene locus_tag LOCUS_06590 107252 109885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 110786 109896 gene locus_tag LOCUS_06600 110786 109896 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038631.1 protein_id gnl|my_center|LOCUS_06600 110902 111834 gene locus_tag LOCUS_06610 110902 111834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038618.1 protein_id gnl|my_center|LOCUS_06610 112108 113154 gene locus_tag LOCUS_06620 112108 113154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 113695 113231 gene locus_tag LOCUS_06630 113695 113231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence006 315 2207 gene locus_tag LOCUS_06640 315 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2137 2622 gene locus_tag LOCUS_06650 2137 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3662 3180 gene locus_tag LOCUS_06660 3662 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4118 3918 gene locus_tag LOCUS_06670 4118 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4584 4961 gene locus_tag LOCUS_06680 4584 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4976 8599 gene locus_tag LOCUS_06690 4976 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 9263 8757 gene locus_tag LOCUS_06700 9263 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011052161.1 protein_id gnl|my_center|LOCUS_06700 9600 10880 gene locus_tag LOCUS_06710 9600 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 10902 11105 gene locus_tag LOCUS_06720 10902 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 13438 11177 gene locus_tag LOCUS_06730 13438 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 14544 13693 gene locus_tag LOCUS_06740 14544 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 14959 14555 gene locus_tag LOCUS_06750 14959 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 15112 15294 gene locus_tag LOCUS_06760 15112 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 15390 16475 gene locus_tag LOCUS_06770 15390 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 16472 17509 gene locus_tag LOCUS_06780 16472 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 17520 19214 gene locus_tag LOCUS_06790 17520 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 19214 19702 gene locus_tag LOCUS_06800 19214 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 20946 19927 gene locus_tag LOCUS_06810 20946 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 24208 20951 gene locus_tag LOCUS_06820 24208 20951 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 protein_id gnl|my_center|LOCUS_06820 25509 24217 gene locus_tag LOCUS_06830 25509 24217 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_06830 27560 25506 gene locus_tag LOCUS_06840 27560 25506 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_06840 28037 27729 gene locus_tag LOCUS_06850 28037 27729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 30729 28402 gene locus_tag LOCUS_06860 30729 28402 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378421.1 protein_id gnl|my_center|LOCUS_06860 31364 30819 gene locus_tag LOCUS_06870 31364 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 32744 31515 gene locus_tag LOCUS_06880 32744 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 33354 33100 gene locus_tag LOCUS_06890 33354 33100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 33353 33619 gene locus_tag LOCUS_06900 33353 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 33943 34188 gene locus_tag LOCUS_06910 33943 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 34178 35140 gene locus_tag LOCUS_06920 34178 35140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 35140 36111 gene locus_tag LOCUS_06930 35140 36111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 36614 37798 gene locus_tag LOCUS_06940 36614 37798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 38385 38029 gene locus_tag LOCUS_06950 38385 38029 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036785.1 protein_id gnl|my_center|LOCUS_06950 38481 39320 gene locus_tag LOCUS_06960 38481 39320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 39334 39741 gene locus_tag LOCUS_06970 39334 39741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 39783 40034 gene locus_tag LOCUS_06980 39783 40034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 40388 40110 gene locus_tag LOCUS_06990 40388 40110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 40964 40392 gene locus_tag LOCUS_07000 40964 40392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 41860 41132 gene locus_tag LOCUS_07010 41860 41132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 43191 42286 gene locus_tag LOCUS_07020 43191 42286 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947834.1 protein_id gnl|my_center|LOCUS_07020 45526 43238 gene locus_tag LOCUS_07030 gene ldcA 45526 43238 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_07030 46908 45559 gene locus_tag LOCUS_07040 gene adiC 46908 45559 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093130.1 protein_id gnl|my_center|LOCUS_07040 48378 46975 gene locus_tag LOCUS_07050 48378 46975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 49793 48672 gene locus_tag LOCUS_07060 49793 48672 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_07060 51292 49859 gene locus_tag LOCUS_07070 51292 49859 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931513.1 protein_id gnl|my_center|LOCUS_07070 51492 52295 gene locus_tag LOCUS_07080 51492 52295 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_07080 52324 53136 gene locus_tag LOCUS_07090 gene dsbG 52324 53136 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_07090 53239 54189 gene locus_tag LOCUS_07100 53239 54189 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036459.1 protein_id gnl|my_center|LOCUS_07100 54260 54511 gene locus_tag LOCUS_07110 54260 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 55856 55131 gene locus_tag LOCUS_07120 55856 55131 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_07120 56068 55859 gene locus_tag LOCUS_07130 gene ccoS 56068 55859 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_07130 58497 56068 gene locus_tag LOCUS_07140 58497 56068 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 protein_id gnl|my_center|LOCUS_07140 59009 58506 gene locus_tag LOCUS_07150 59009 58506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 60556 59006 gene locus_tag LOCUS_07160 gene ccoG 60556 59006 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_07160 61003 60704 gene locus_tag LOCUS_07170 61003 60704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 61941 61000 gene locus_tag LOCUS_07180 gene ccoP 61941 61000 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_07180 62096 61938 gene locus_tag LOCUS_07190 62096 61938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 62722 62093 gene locus_tag LOCUS_07200 gene ccoO 62722 62093 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_07200 64177 62738 gene locus_tag LOCUS_07210 gene ccoN 64177 62738 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_07210 64829 64371 gene locus_tag LOCUS_07220 gene azu 64829 64371 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 protein_id gnl|my_center|LOCUS_07220 67206 65143 gene locus_tag LOCUS_07230 67206 65143 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_07230 67561 68181 gene locus_tag LOCUS_07240 gene rpoE 67561 68181 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_07240 68178 69047 gene locus_tag LOCUS_07250 68178 69047 CDS product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036462.1 protein_id gnl|my_center|LOCUS_07250 69172 70689 gene locus_tag LOCUS_07260 69172 70689 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 protein_id gnl|my_center|LOCUS_07260 70844 72637 gene locus_tag LOCUS_07270 gene lepA 70844 72637 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275537.1 protein_id gnl|my_center|LOCUS_07270 72686 73504 gene locus_tag LOCUS_07280 gene lepB 72686 73504 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036465.1 protein_id gnl|my_center|LOCUS_07280 73532 73900 gene locus_tag LOCUS_07290 73532 73900 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 protein_id gnl|my_center|LOCUS_07290 73905 74567 gene locus_tag LOCUS_07300 gene rnc 73905 74567 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 protein_id gnl|my_center|LOCUS_07300 74564 75460 gene locus_tag LOCUS_07310 gene era 74564 75460 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_07310 75625 76350 gene locus_tag LOCUS_07320 gene recO 75625 76350 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036469.1 protein_id gnl|my_center|LOCUS_07320 77176 76460 gene locus_tag LOCUS_07330 77176 76460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 protein_id gnl|my_center|LOCUS_07330 77253 78638 gene locus_tag LOCUS_07340 gene rlmD 77253 78638 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_07340 78907 79410 gene locus_tag LOCUS_07350 78907 79410 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_07350 79438 80133 gene locus_tag LOCUS_07360 79438 80133 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275410.1 protein_id gnl|my_center|LOCUS_07360 80188 81195 gene locus_tag LOCUS_07370 gene nagZ 80188 81195 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036477.1 protein_id gnl|my_center|LOCUS_07370 81195 81746 gene locus_tag LOCUS_07380 81195 81746 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036478.1 protein_id gnl|my_center|LOCUS_07380 81934 82680 gene locus_tag LOCUS_07390 81934 82680 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_07390 82771 82977 gene locus_tag LOCUS_07400 82771 82977 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_07400 83062 84279 gene locus_tag LOCUS_07410 83062 84279 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 protein_id gnl|my_center|LOCUS_07410 84360 86003 gene locus_tag LOCUS_07420 84360 86003 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_07420 86518 86123 gene locus_tag LOCUS_07430 86518 86123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 87149 86754 gene locus_tag LOCUS_07440 87149 86754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 88393 87218 gene locus_tag LOCUS_07450 88393 87218 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_07450 88578 91415 gene locus_tag LOCUS_07460 88578 91415 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036491.1 protein_id gnl|my_center|LOCUS_07460 92586 91489 gene locus_tag LOCUS_07470 92586 91489 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 protein_id gnl|my_center|LOCUS_07470 92870 96415 gene locus_tag LOCUS_07480 92870 96415 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_07480 96674 98293 gene locus_tag LOCUS_07490 96674 98293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 98476 98288 gene locus_tag LOCUS_07500 98476 98288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 98644 99657 gene locus_tag LOCUS_07510 98644 99657 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_07510 99770 101110 gene locus_tag LOCUS_07520 99770 101110 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_07520 101207 102724 gene locus_tag LOCUS_07530 101207 102724 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_07530 102822 103523 gene locus_tag LOCUS_07540 102822 103523 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705478.1 protein_id gnl|my_center|LOCUS_07540 103520 104911 gene locus_tag LOCUS_07550 103520 104911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 105127 108078 gene locus_tag LOCUS_07560 105127 108078 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_07560 108756 108148 gene locus_tag LOCUS_07570 gene rnt 108756 108148 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036706.1 protein_id gnl|my_center|LOCUS_07570 109694 108843 gene locus_tag LOCUS_07580 109694 108843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 109851 110744 gene locus_tag LOCUS_07590 109851 110744 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_07590 110820 111731 gene locus_tag LOCUS_07600 110820 111731 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence007 3 365 gene locus_tag LOCUS_07610 3 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 697 3528 gene locus_tag LOCUS_07620 697 3528 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035699.1 protein_id gnl|my_center|LOCUS_07620 3528 3920 gene locus_tag LOCUS_07630 3528 3920 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990640.1 protein_id gnl|my_center|LOCUS_07630 3917 5452 gene locus_tag LOCUS_07640 3917 5452 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035697.1 protein_id gnl|my_center|LOCUS_07640 5449 5955 gene locus_tag LOCUS_07650 5449 5955 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 protein_id gnl|my_center|LOCUS_07650 5952 6236 gene locus_tag LOCUS_07660 5952 6236 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 protein_id gnl|my_center|LOCUS_07660 6233 6622 gene locus_tag LOCUS_07670 6233 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7671 6706 gene locus_tag LOCUS_07680 7671 6706 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 protein_id gnl|my_center|LOCUS_07680 8401 7745 gene locus_tag LOCUS_07690 8401 7745 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994150.1 protein_id gnl|my_center|LOCUS_07690 8527 9033 gene locus_tag LOCUS_07700 8527 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275199.1 protein_id gnl|my_center|LOCUS_07700 10416 9118 gene locus_tag LOCUS_07710 gene hmgA 10416 9118 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 protein_id gnl|my_center|LOCUS_07710 11632 10520 gene locus_tag LOCUS_07720 gene hppD 11632 10520 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 protein_id gnl|my_center|LOCUS_07720 11699 12253 gene locus_tag LOCUS_07730 11699 12253 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_07730 13474 12335 gene locus_tag LOCUS_07740 13474 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 14306 13701 gene locus_tag LOCUS_07750 14306 13701 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035687.1 protein_id gnl|my_center|LOCUS_07750 15825 14326 gene locus_tag LOCUS_07760 15825 14326 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_07760 16882 16007 gene locus_tag LOCUS_07770 16882 16007 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_07770 17218 18300 gene locus_tag LOCUS_07780 gene pdhA 17218 18300 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 protein_id gnl|my_center|LOCUS_07780 18293 19360 gene locus_tag LOCUS_07790 18293 19360 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_07790 19362 19715 gene locus_tag LOCUS_07800 19362 19715 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 protein_id gnl|my_center|LOCUS_07800 19712 21109 gene locus_tag LOCUS_07810 19712 21109 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035680.1 protein_id gnl|my_center|LOCUS_07810 21319 21657 gene locus_tag LOCUS_07820 21319 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767450.1 protein_id gnl|my_center|LOCUS_07820 21689 22321 gene locus_tag LOCUS_07830 21689 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 22352 22738 gene locus_tag LOCUS_07840 22352 22738 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 protein_id gnl|my_center|LOCUS_07840 22791 23549 gene locus_tag LOCUS_07850 22791 23549 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_07850 24208 23576 gene locus_tag LOCUS_07860 24208 23576 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237186.1 protein_id gnl|my_center|LOCUS_07860 24321 25871 gene locus_tag LOCUS_07870 24321 25871 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035660.1 protein_id gnl|my_center|LOCUS_07870 28718 25971 gene locus_tag LOCUS_07880 28718 25971 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479871.1 protein_id gnl|my_center|LOCUS_07880 29314 28979 gene locus_tag LOCUS_07890 29314 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 29881 29387 gene locus_tag LOCUS_07900 29881 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 31393 30485 gene locus_tag LOCUS_07910 31393 30485 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 protein_id gnl|my_center|LOCUS_07910 31572 33224 gene locus_tag LOCUS_07920 31572 33224 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 protein_id gnl|my_center|LOCUS_07920 33516 35618 gene locus_tag LOCUS_07930 33516 35618 CDS product phosphoglycerol transferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035656.1 protein_id gnl|my_center|LOCUS_07930 38136 35689 gene locus_tag LOCUS_07940 38136 35689 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040940459.1 protein_id gnl|my_center|LOCUS_07940 38487 38239 gene locus_tag LOCUS_07950 38487 38239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 38620 39111 gene locus_tag LOCUS_07960 38620 39111 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192886228.1 protein_id gnl|my_center|LOCUS_07960 39133 40344 gene locus_tag LOCUS_07970 39133 40344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 protein_id gnl|my_center|LOCUS_07970 40442 40876 gene locus_tag LOCUS_07980 40442 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 41233 40910 gene locus_tag LOCUS_07990 41233 40910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 41473 41943 gene locus_tag LOCUS_08000 41473 41943 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035532.1 protein_id gnl|my_center|LOCUS_08000 42623 42048 gene locus_tag LOCUS_08010 42623 42048 CDS product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 protein_id gnl|my_center|LOCUS_08010 43241 42759 gene locus_tag LOCUS_08020 gene cueR 43241 42759 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 protein_id gnl|my_center|LOCUS_08020 45743 43269 gene locus_tag LOCUS_08030 45743 43269 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_08030 45974 46171 gene locus_tag LOCUS_08040 45974 46171 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206222.1 protein_id gnl|my_center|LOCUS_08040 46699 46265 gene locus_tag LOCUS_08050 46699 46265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 46837 47232 gene locus_tag LOCUS_08060 46837 47232 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_08060 47437 47309 gene locus_tag LOCUS_08070 47437 47309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 48212 47562 gene locus_tag LOCUS_08080 gene bioD 48212 47562 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205940.1 protein_id gnl|my_center|LOCUS_08080 49405 48209 gene locus_tag LOCUS_08090 49405 48209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 50082 49549 gene locus_tag LOCUS_08100 50082 49549 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_08100 50431 50162 gene locus_tag LOCUS_08110 50431 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 51201 50725 gene locus_tag LOCUS_08120 51201 50725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 52416 51286 gene locus_tag LOCUS_08130 52416 51286 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_08130 53314 52562 gene locus_tag LOCUS_08140 53314 52562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 54185 53469 gene locus_tag LOCUS_08150 54185 53469 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036280.1 protein_id gnl|my_center|LOCUS_08150 55119 54355 gene locus_tag LOCUS_08160 55119 54355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_08160 55882 55196 gene locus_tag LOCUS_08170 55882 55196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 58178 56025 gene locus_tag LOCUS_08180 58178 56025 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_08180 58640 60064 gene locus_tag LOCUS_08190 58640 60064 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 protein_id gnl|my_center|LOCUS_08190 60162 60521 gene locus_tag LOCUS_08200 60162 60521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038974.1 protein_id gnl|my_center|LOCUS_08200 60529 61026 gene locus_tag LOCUS_08210 60529 61026 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038975.1 protein_id gnl|my_center|LOCUS_08210 61023 61451 gene locus_tag LOCUS_08220 61023 61451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 61499 62608 gene locus_tag LOCUS_08230 61499 62608 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 protein_id gnl|my_center|LOCUS_08230 62647 63342 gene locus_tag LOCUS_08240 62647 63342 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_08240 63347 64006 gene locus_tag LOCUS_08250 63347 64006 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_08250 64062 65435 gene locus_tag LOCUS_08260 64062 65435 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_08260 65577 66683 gene locus_tag LOCUS_08270 65577 66683 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038980.1 protein_id gnl|my_center|LOCUS_08270 66680 67216 gene locus_tag LOCUS_08280 66680 67216 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 protein_id gnl|my_center|LOCUS_08280 67905 67303 gene locus_tag LOCUS_08290 67905 67303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 protein_id gnl|my_center|LOCUS_08290 69092 67902 gene locus_tag LOCUS_08300 69092 67902 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050912608.1 protein_id gnl|my_center|LOCUS_08300 69914 69129 gene locus_tag LOCUS_08310 69914 69129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027603.1 protein_id gnl|my_center|LOCUS_08310 70840 69914 gene locus_tag LOCUS_08320 70840 69914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_08320 71044 72294 gene locus_tag LOCUS_08330 71044 72294 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_08330 73139 73825 gene locus_tag LOCUS_08340 73139 73825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_08340 73909 75069 gene locus_tag LOCUS_08350 73909 75069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_08350 75080 76387 gene locus_tag LOCUS_08360 75080 76387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_08360 76629 79484 gene locus_tag LOCUS_08370 76629 79484 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 protein_id gnl|my_center|LOCUS_08370 79680 80813 gene locus_tag LOCUS_08380 79680 80813 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038989.1 protein_id gnl|my_center|LOCUS_08380 81769 80858 gene locus_tag LOCUS_08390 gene rarD 81769 80858 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 protein_id gnl|my_center|LOCUS_08390 82599 81766 gene locus_tag LOCUS_08400 gene yedA 82599 81766 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_08400 84619 82967 gene locus_tag LOCUS_08410 84619 82967 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275546.1 protein_id gnl|my_center|LOCUS_08410 85666 84734 gene locus_tag LOCUS_08420 85666 84734 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_08420 86085 85786 gene locus_tag LOCUS_08430 86085 85786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 87462 86164 gene locus_tag LOCUS_08440 87462 86164 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 protein_id gnl|my_center|LOCUS_08440 88198 88455 gene locus_tag LOCUS_08450 88198 88455 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090806.1 protein_id gnl|my_center|LOCUS_08450 91671 88504 gene locus_tag LOCUS_08460 91671 88504 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_08460 92705 91869 gene locus_tag LOCUS_08470 92705 91869 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_08470 93583 92702 gene locus_tag LOCUS_08480 93583 92702 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_08480 94854 93580 gene locus_tag LOCUS_08490 94854 93580 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_08490 96480 94864 gene locus_tag LOCUS_08500 96480 94864 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_08500 99561 96565 gene locus_tag LOCUS_08510 99561 96565 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_08510 100640 99612 gene locus_tag LOCUS_08520 100640 99612 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_08520 101065 100793 gene locus_tag LOCUS_08530 101065 100793 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_08530 101361 101062 gene locus_tag LOCUS_08540 101361 101062 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_08540 101775 102623 gene locus_tag LOCUS_08550 101775 102623 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_08550 102640 103479 gene locus_tag LOCUS_08560 102640 103479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence008 178 1863 gene locus_tag LOCUS_08570 178 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1875 8621 gene locus_tag LOCUS_08580 1875 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9069 8872 gene locus_tag LOCUS_08590 9069 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 9572 8964 gene locus_tag LOCUS_08600 9572 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 10113 9871 gene locus_tag LOCUS_08610 10113 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10902 10267 gene locus_tag LOCUS_08620 10902 10267 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_08620 12336 10957 gene locus_tag LOCUS_08630 12336 10957 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_08630 12657 13382 gene locus_tag LOCUS_08640 12657 13382 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_08640 13385 14215 gene locus_tag LOCUS_08650 13385 14215 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316055.1 protein_id gnl|my_center|LOCUS_08650 14325 15287 gene locus_tag LOCUS_08660 14325 15287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_08660 16108 15503 gene locus_tag LOCUS_08670 gene yihA 16108 15503 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038495.1 protein_id gnl|my_center|LOCUS_08670 16228 17004 gene locus_tag LOCUS_08680 16228 17004 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437398.1 protein_id gnl|my_center|LOCUS_08680 17102 17749 gene locus_tag LOCUS_08690 17102 17749 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038497.1 protein_id gnl|my_center|LOCUS_08690 17869 18693 gene locus_tag LOCUS_08700 17869 18693 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038498.1 protein_id gnl|my_center|LOCUS_08700 18737 19501 gene locus_tag LOCUS_08710 18737 19501 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_08710 20521 19643 gene locus_tag LOCUS_08720 20521 19643 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 protein_id gnl|my_center|LOCUS_08720 21038 20631 gene locus_tag LOCUS_08730 21038 20631 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 protein_id gnl|my_center|LOCUS_08730 21226 23184 gene locus_tag LOCUS_08740 21226 23184 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993987.1 protein_id gnl|my_center|LOCUS_08740 23181 24407 gene locus_tag LOCUS_08750 23181 24407 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_08750 25500 24418 gene locus_tag LOCUS_08760 25500 24418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 26708 25620 gene locus_tag LOCUS_08770 26708 25620 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_08770 28480 27290 gene locus_tag LOCUS_08780 gene nagA 28480 27290 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_08780 29630 28605 gene locus_tag LOCUS_08790 29630 28605 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038509.1 protein_id gnl|my_center|LOCUS_08790 30744 29635 gene locus_tag LOCUS_08800 30744 29635 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038510.1 protein_id gnl|my_center|LOCUS_08800 32038 30755 gene locus_tag LOCUS_08810 32038 30755 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_08810 32410 33432 gene locus_tag LOCUS_08820 32410 33432 CDS product glucokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 protein_id gnl|my_center|LOCUS_08820 33548 36349 gene locus_tag LOCUS_08830 33548 36349 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918334.1 protein_id gnl|my_center|LOCUS_08830 36516 38858 gene locus_tag LOCUS_08840 36516 38858 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918335.1 protein_id gnl|my_center|LOCUS_08840 40138 38906 gene locus_tag LOCUS_08850 40138 38906 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_08850 40238 42535 gene locus_tag LOCUS_08860 40238 42535 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918335.1 protein_id gnl|my_center|LOCUS_08860 42980 42609 gene locus_tag LOCUS_08870 42980 42609 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_08870 43719 43306 gene locus_tag LOCUS_08880 43719 43306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038528.1 protein_id gnl|my_center|LOCUS_08880 44900 43716 gene locus_tag LOCUS_08890 44900 43716 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 protein_id gnl|my_center|LOCUS_08890 44955 45692 gene locus_tag LOCUS_08900 44955 45692 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_08900 46340 45852 gene locus_tag LOCUS_08910 gene folK 46340 45852 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 protein_id gnl|my_center|LOCUS_08910 48038 46518 gene locus_tag LOCUS_08920 48038 46518 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 protein_id gnl|my_center|LOCUS_08920 48485 48045 gene locus_tag LOCUS_08930 48485 48045 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 protein_id gnl|my_center|LOCUS_08930 50302 48497 gene locus_tag LOCUS_08940 50302 48497 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038534.1 protein_id gnl|my_center|LOCUS_08940 50855 50496 gene locus_tag LOCUS_08950 50855 50496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 51788 50874 gene locus_tag LOCUS_08960 gene gnd 51788 50874 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_08960 53026 51791 gene locus_tag LOCUS_08970 53026 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993985.1 protein_id gnl|my_center|LOCUS_08970 53598 53053 gene locus_tag LOCUS_08980 53598 53053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 55868 53694 gene locus_tag LOCUS_08990 55868 53694 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_08990 57232 56225 gene locus_tag LOCUS_09000 gene lipA 57232 56225 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038549.1 protein_id gnl|my_center|LOCUS_09000 57898 57248 gene locus_tag LOCUS_09010 gene lipB 57898 57248 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_09010 58218 57940 gene locus_tag LOCUS_09020 58218 57940 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038551.1 protein_id gnl|my_center|LOCUS_09020 59364 58387 gene locus_tag LOCUS_09030 59364 58387 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038552.1 protein_id gnl|my_center|LOCUS_09030 59757 59491 gene locus_tag LOCUS_09040 59757 59491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 59644 60702 gene locus_tag LOCUS_09050 59644 60702 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_09050 61965 60766 gene locus_tag LOCUS_09060 61965 60766 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 protein_id gnl|my_center|LOCUS_09060 63299 62085 gene locus_tag LOCUS_09070 63299 62085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 64432 63296 gene locus_tag LOCUS_09080 gene mltB 64432 63296 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038556.1 protein_id gnl|my_center|LOCUS_09080 66112 64982 gene locus_tag LOCUS_09090 gene rodA 66112 64982 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 protein_id gnl|my_center|LOCUS_09090 68121 66109 gene locus_tag LOCUS_09100 gene mrdA 68121 66109 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 protein_id gnl|my_center|LOCUS_09100 68610 68125 gene locus_tag LOCUS_09110 gene mreD 68610 68125 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038565.1 protein_id gnl|my_center|LOCUS_09110 69707 68607 gene locus_tag LOCUS_09120 gene mreC 69707 68607 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_09120 70880 69834 gene locus_tag LOCUS_09130 70880 69834 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 protein_id gnl|my_center|LOCUS_09130 71156 72088 gene locus_tag LOCUS_09140 71156 72088 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_09140 72652 72458 gene locus_tag LOCUS_09150 72652 72458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 73123 72884 gene locus_tag LOCUS_09160 73123 72884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082053.1 protein_id gnl|my_center|LOCUS_09160 73581 73123 gene locus_tag LOCUS_09170 73581 73123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 74390 73650 gene locus_tag LOCUS_09180 74390 73650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038578.1 protein_id gnl|my_center|LOCUS_09180 76489 74555 gene locus_tag LOCUS_09190 76489 74555 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_09190 77368 76604 gene locus_tag LOCUS_09200 gene ubiE 77368 76604 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509029.1 protein_id gnl|my_center|LOCUS_09200 77461 77913 gene locus_tag LOCUS_09210 77461 77913 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_09210 78095 78346 gene locus_tag LOCUS_09220 78095 78346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 81572 78426 gene locus_tag LOCUS_09230 81572 78426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_09230 82757 81585 gene locus_tag LOCUS_09240 82757 81585 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_09240 82945 83643 gene locus_tag LOCUS_09250 82945 83643 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406317.1 protein_id gnl|my_center|LOCUS_09250 85089 83716 gene locus_tag LOCUS_09260 gene hslU 85089 83716 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038587.1 protein_id gnl|my_center|LOCUS_09260 85770 85219 gene locus_tag LOCUS_09270 gene hslV 85770 85219 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038588.1 protein_id gnl|my_center|LOCUS_09270 85920 86360 gene locus_tag LOCUS_09280 85920 86360 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928030.1 protein_id gnl|my_center|LOCUS_09280 86439 86762 gene locus_tag LOCUS_09290 86439 86762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 87837 86947 gene locus_tag LOCUS_09300 gene xerC 87837 86947 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_09300 88528 87851 gene locus_tag LOCUS_09310 88528 87851 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_09310 89376 88525 gene locus_tag LOCUS_09320 gene dapF 89376 88525 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038591.1 protein_id gnl|my_center|LOCUS_09320 89569 89369 gene locus_tag LOCUS_09330 89569 89369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 90029 89625 gene locus_tag LOCUS_09340 90029 89625 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038593.1 protein_id gnl|my_center|LOCUS_09340 92152 90044 gene locus_tag LOCUS_09350 92152 90044 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275248.1 protein_id gnl|my_center|LOCUS_09350 92260 93483 gene locus_tag LOCUS_09360 92260 93483 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_09360 94300 93563 gene locus_tag LOCUS_09370 94300 93563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 96579 94480 gene locus_tag LOCUS_09380 96579 94480 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_09380 96986 96648 gene locus_tag LOCUS_09390 96986 96648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 97088 97687 gene locus_tag LOCUS_09400 97088 97687 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038600.1 protein_id gnl|my_center|LOCUS_09400 97803 98273 gene locus_tag LOCUS_09410 97803 98273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence009 <1 744 gene locus_tag LOCUS_09420 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877572.1:DNA-binding protein WhiA 935 1561 gene locus_tag LOCUS_09430 935 1561 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_09430 1678 2676 gene locus_tag LOCUS_09440 gene gap 1678 2676 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_09440 2845 5556 gene locus_tag LOCUS_09450 2845 5556 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097121319.1 protein_id gnl|my_center|LOCUS_09450 5553 6932 gene locus_tag LOCUS_09460 5553 6932 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038296.1 protein_id gnl|my_center|LOCUS_09460 7569 7009 gene locus_tag LOCUS_09470 7569 7009 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_09470 7652 8830 gene locus_tag LOCUS_09480 7652 8830 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 protein_id gnl|my_center|LOCUS_09480 8827 9471 gene locus_tag LOCUS_09490 8827 9471 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038294.1 protein_id gnl|my_center|LOCUS_09490 9818 11284 gene locus_tag LOCUS_09500 gene pyk 9818 11284 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508780.1 protein_id gnl|my_center|LOCUS_09500 11449 12453 gene locus_tag LOCUS_09510 11449 12453 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_09510 13405 12824 gene locus_tag LOCUS_09520 13405 12824 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038291.1 protein_id gnl|my_center|LOCUS_09520 14540 13581 gene locus_tag LOCUS_09530 gene cysK 14540 13581 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038289.1 protein_id gnl|my_center|LOCUS_09530 16093 14561 gene locus_tag LOCUS_09540 gene cysG 16093 14561 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930160.1 protein_id gnl|my_center|LOCUS_09540 16187 17170 gene locus_tag LOCUS_09550 16187 17170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038287.1 protein_id gnl|my_center|LOCUS_09550 17643 18317 gene locus_tag LOCUS_09560 17643 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18709 19137 gene locus_tag LOCUS_09570 18709 19137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 19207 21267 gene locus_tag LOCUS_09580 19207 21267 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_09580 21351 21794 gene locus_tag LOCUS_09590 21351 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 22670 21936 gene locus_tag LOCUS_09600 22670 21936 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 protein_id gnl|my_center|LOCUS_09600 24373 22667 gene locus_tag LOCUS_09610 gene cysI 24373 22667 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038281.1 protein_id gnl|my_center|LOCUS_09610 26296 24410 gene locus_tag LOCUS_09620 26296 24410 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038280.1 protein_id gnl|my_center|LOCUS_09620 26494 27405 gene locus_tag LOCUS_09630 gene cysD 26494 27405 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038279.1 protein_id gnl|my_center|LOCUS_09630 27405 29285 gene locus_tag LOCUS_09640 gene cysN 27405 29285 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994000.1 protein_id gnl|my_center|LOCUS_09640 29662 30735 gene locus_tag LOCUS_09650 29662 30735 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_09650 30732 33857 gene locus_tag LOCUS_09660 30732 33857 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 protein_id gnl|my_center|LOCUS_09660 33850 34386 gene locus_tag LOCUS_09670 33850 34386 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275297.1 protein_id gnl|my_center|LOCUS_09670 34475 35977 gene locus_tag LOCUS_09680 34475 35977 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038273.1 protein_id gnl|my_center|LOCUS_09680 35993 36832 gene locus_tag LOCUS_09690 35993 36832 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038272.1 protein_id gnl|my_center|LOCUS_09690 38890 37220 gene locus_tag LOCUS_09700 38890 37220 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 protein_id gnl|my_center|LOCUS_09700 40457 39042 gene locus_tag LOCUS_09710 40457 39042 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038264.1 protein_id gnl|my_center|LOCUS_09710 40997 40590 gene locus_tag LOCUS_09720 gene mscL 40997 40590 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038263.1 protein_id gnl|my_center|LOCUS_09720 41765 41058 gene locus_tag LOCUS_09730 41765 41058 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 protein_id gnl|my_center|LOCUS_09730 42231 41950 gene locus_tag LOCUS_09740 42231 41950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038261.1 protein_id gnl|my_center|LOCUS_09740 42402 42743 gene locus_tag LOCUS_09750 42402 42743 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_09750 44611 42764 gene locus_tag LOCUS_09760 44611 42764 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_09760 45529 44831 gene locus_tag LOCUS_09770 gene trmB 45529 44831 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038258.1 protein_id gnl|my_center|LOCUS_09770 46377 45583 gene locus_tag LOCUS_09780 46377 45583 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_09780 46704 46504 gene locus_tag LOCUS_09790 gene thiS 46704 46504 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038256.1 protein_id gnl|my_center|LOCUS_09790 46842 48683 gene locus_tag LOCUS_09800 46842 48683 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_09800 48814 48887 gene locus_tag LOCUS_t00080 48814 48887 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48994 50523 gene locus_tag LOCUS_09810 48994 50523 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011346949.1 protein_id gnl|my_center|LOCUS_09810 50716 50537 gene locus_tag LOCUS_09820 50716 50537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 51755 52525 gene locus_tag LOCUS_09830 51755 52525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 53084 52416 gene locus_tag LOCUS_09840 53084 52416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 54985 53123 gene locus_tag LOCUS_09850 54985 53123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 55181 55531 gene locus_tag LOCUS_09860 55181 55531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 55528 55740 gene locus_tag LOCUS_09870 55528 55740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 55737 57566 gene locus_tag LOCUS_09880 55737 57566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 58121 57567 gene locus_tag LOCUS_09890 58121 57567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 58344 59219 gene locus_tag LOCUS_09900 gene rimK 58344 59219 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038222.1 protein_id gnl|my_center|LOCUS_09900 59429 59899 gene locus_tag LOCUS_09910 59429 59899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 60066 60743 gene locus_tag LOCUS_09920 60066 60743 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_09920 60736 62073 gene locus_tag LOCUS_09930 60736 62073 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_09930 62727 62104 gene locus_tag LOCUS_09940 gene coaE 62727 62104 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038217.1 protein_id gnl|my_center|LOCUS_09940 63637 62774 gene locus_tag LOCUS_09950 63637 62774 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038216.1 protein_id gnl|my_center|LOCUS_09950 64868 63645 gene locus_tag LOCUS_09960 64868 63645 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_09960 65298 65654 gene locus_tag LOCUS_09970 65298 65654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 65785 66126 gene locus_tag LOCUS_09980 65785 66126 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070777.1 protein_id gnl|my_center|LOCUS_09980 66265 67239 gene locus_tag LOCUS_09990 gene galE 66265 67239 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 protein_id gnl|my_center|LOCUS_09990 67959 67261 gene locus_tag LOCUS_10000 67959 67261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 68364 68053 gene locus_tag LOCUS_10010 68364 68053 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_10010 68615 68364 gene locus_tag LOCUS_10020 68615 68364 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217148.1 protein_id gnl|my_center|LOCUS_10020 68778 70481 gene locus_tag LOCUS_10030 gene pilB 68778 70481 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_10030 70793 72994 gene locus_tag LOCUS_10040 70793 72994 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_10040 72998 74920 gene locus_tag LOCUS_10050 72998 74920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 76519 75125 gene locus_tag LOCUS_10060 76519 75125 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594919.1 protein_id gnl|my_center|LOCUS_10060 78169 76556 gene locus_tag LOCUS_10070 78169 76556 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_10070 78429 79601 gene locus_tag LOCUS_10080 gene sucC 78429 79601 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038209.1 protein_id gnl|my_center|LOCUS_10080 79783 80658 gene locus_tag LOCUS_10090 gene sucD 79783 80658 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_10090 81417 80734 gene locus_tag LOCUS_10100 81417 80734 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037920.1 protein_id gnl|my_center|LOCUS_10100 82190 81420 gene locus_tag LOCUS_10110 82190 81420 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037919.1 protein_id gnl|my_center|LOCUS_10110 82912 82253 gene locus_tag LOCUS_10120 gene purN 82912 82253 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037918.1 protein_id gnl|my_center|LOCUS_10120 83517 82909 gene locus_tag LOCUS_10130 83517 82909 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120574.1 protein_id gnl|my_center|LOCUS_10130 84004 83561 gene locus_tag LOCUS_10140 84004 83561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037917.1 protein_id gnl|my_center|LOCUS_10140 85087 84029 gene locus_tag LOCUS_10150 gene purM 85087 84029 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628894.1 protein_id gnl|my_center|LOCUS_10150 85197 86294 gene locus_tag LOCUS_10160 85197 86294 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_10160 86291 87460 gene locus_tag LOCUS_10170 86291 87460 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_10170 87457 88152 gene locus_tag LOCUS_10180 gene hda 87457 88152 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 protein_id gnl|my_center|LOCUS_10180 89679 88981 gene locus_tag LOCUS_10190 89679 88981 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 protein_id gnl|my_center|LOCUS_10190 90689 89676 gene locus_tag LOCUS_10200 90689 89676 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037911.1 protein_id gnl|my_center|LOCUS_10200 91052 90783 gene locus_tag LOCUS_10210 91052 90783 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037910.1 protein_id gnl|my_center|LOCUS_10210 92610 91117 gene locus_tag LOCUS_10220 92610 91117 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_10220 92811 93143 gene locus_tag LOCUS_10230 92811 93143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 95082 93676 gene locus_tag LOCUS_10240 95082 93676 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 protein_id gnl|my_center|LOCUS_10240 95246 97483 gene locus_tag LOCUS_10250 95246 97483 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence010 192 31 gene locus_tag LOCUS_10260 192 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1374 232 gene locus_tag LOCUS_10270 1374 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1649 3385 gene locus_tag LOCUS_10280 gene ggt 1649 3385 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640110.1 protein_id gnl|my_center|LOCUS_10280 4759 3548 gene locus_tag LOCUS_10290 gene gltS 4759 3548 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 protein_id gnl|my_center|LOCUS_10290 5609 5214 gene locus_tag LOCUS_10300 5609 5214 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189219.1 protein_id gnl|my_center|LOCUS_10300 7163 5742 gene locus_tag LOCUS_10310 7163 5742 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 protein_id gnl|my_center|LOCUS_10310 8030 7167 gene locus_tag LOCUS_10320 8030 7167 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266383.1 protein_id gnl|my_center|LOCUS_10320 9401 8046 gene locus_tag LOCUS_10330 9401 8046 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266384.1 protein_id gnl|my_center|LOCUS_10330 10658 9423 gene locus_tag LOCUS_10340 10658 9423 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_10340 10900 13191 gene locus_tag LOCUS_10350 10900 13191 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038443.1 protein_id gnl|my_center|LOCUS_10350 14006 13287 gene locus_tag LOCUS_10360 gene abaR 14006 13287 CDS product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 protein_id gnl|my_center|LOCUS_10360 14152 14523 gene locus_tag LOCUS_10370 14152 14523 CDS product DUF4902 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528152.1 protein_id gnl|my_center|LOCUS_10370 14675 15316 gene locus_tag LOCUS_10380 gene abaI 14675 15316 CDS product acyl-homoserine-lactone synthase AbaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208102.1 protein_id gnl|my_center|LOCUS_10380 15398 15607 gene locus_tag LOCUS_10390 15398 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15926 16123 gene locus_tag LOCUS_10400 15926 16123 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_10400 16132 17244 gene locus_tag LOCUS_10410 16132 17244 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_10410 17273 18571 gene locus_tag LOCUS_10420 17273 18571 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_10420 19482 18556 gene locus_tag LOCUS_10430 19482 18556 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 protein_id gnl|my_center|LOCUS_10430 19604 20899 gene locus_tag LOCUS_10440 gene waaA 19604 20899 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_10440 22366 21008 gene locus_tag LOCUS_10450 22366 21008 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_10450 23038 22391 gene locus_tag LOCUS_10460 23038 22391 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_10460 23834 23169 gene locus_tag LOCUS_10470 23834 23169 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_10470 24098 25069 gene locus_tag LOCUS_10480 gene mexJ 24098 25069 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_10480 25073 28234 gene locus_tag LOCUS_10490 25073 28234 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_10490 28350 31322 gene locus_tag LOCUS_10500 28350 31322 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_10500 31402 32343 gene locus_tag LOCUS_10510 gene pip 31402 32343 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_10510 33197 32385 gene locus_tag LOCUS_10520 33197 32385 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 protein_id gnl|my_center|LOCUS_10520 33742 33194 gene locus_tag LOCUS_10530 33742 33194 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_10530 34677 33739 gene locus_tag LOCUS_10540 34677 33739 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_10540 35249 34674 gene locus_tag LOCUS_10550 35249 34674 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 protein_id gnl|my_center|LOCUS_10550 35560 37866 gene locus_tag LOCUS_10560 35560 37866 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036078.1 protein_id gnl|my_center|LOCUS_10560 37924 39027 gene locus_tag LOCUS_10570 37924 39027 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_10570 39032 39370 gene locus_tag LOCUS_10580 39032 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963484.1 protein_id gnl|my_center|LOCUS_10580 39964 39539 gene locus_tag LOCUS_10590 39964 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 40326 39964 gene locus_tag LOCUS_10600 40326 39964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036082.1 protein_id gnl|my_center|LOCUS_10600 40865 40323 gene locus_tag LOCUS_10610 40865 40323 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506786.1 protein_id gnl|my_center|LOCUS_10610 40998 41300 gene locus_tag LOCUS_10620 40998 41300 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_10620 41297 41794 gene locus_tag LOCUS_10630 41297 41794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 41791 43230 gene locus_tag LOCUS_10640 41791 43230 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_10640 43999 43634 gene locus_tag LOCUS_10650 43999 43634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 44164 44715 gene locus_tag LOCUS_10660 gene sufT 44164 44715 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_10660 44782 45879 gene locus_tag LOCUS_10670 44782 45879 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_10670 46564 46088 gene locus_tag LOCUS_10680 gene ybaK 46564 46088 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036091.1 protein_id gnl|my_center|LOCUS_10680 47053 46565 gene locus_tag LOCUS_10690 47053 46565 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_10690 47506 47162 gene locus_tag LOCUS_10700 47506 47162 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036094.1 protein_id gnl|my_center|LOCUS_10700 48096 47503 gene locus_tag LOCUS_10710 gene wrbA 48096 47503 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_10710 48174 49448 gene locus_tag LOCUS_10720 48174 49448 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036096.1 protein_id gnl|my_center|LOCUS_10720 49445 50035 gene locus_tag LOCUS_10730 49445 50035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 50061 50249 gene locus_tag LOCUS_10740 50061 50249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 51090 50311 gene locus_tag LOCUS_10750 gene ppk2 51090 50311 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 protein_id gnl|my_center|LOCUS_10750 51303 52442 gene locus_tag LOCUS_10760 51303 52442 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037207.1 protein_id gnl|my_center|LOCUS_10760 52464 53813 gene locus_tag LOCUS_10770 52464 53813 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275362.1 protein_id gnl|my_center|LOCUS_10770 53810 54058 gene locus_tag LOCUS_10780 53810 54058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507790.1 protein_id gnl|my_center|LOCUS_10780 55884 54181 gene locus_tag LOCUS_10790 55884 54181 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036102.1 protein_id gnl|my_center|LOCUS_10790 57062 55977 gene locus_tag LOCUS_10800 gene prfA 57062 55977 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036103.1 protein_id gnl|my_center|LOCUS_10800 58323 57040 gene locus_tag LOCUS_10810 gene hemA 58323 57040 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036104.1 protein_id gnl|my_center|LOCUS_10810 58392 60077 gene locus_tag LOCUS_10820 58392 60077 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 protein_id gnl|my_center|LOCUS_10820 60098 60724 gene locus_tag LOCUS_10830 gene lolB 60098 60724 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036106.1 protein_id gnl|my_center|LOCUS_10830 60721 61602 gene locus_tag LOCUS_10840 gene ispE 60721 61602 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036107.1 protein_id gnl|my_center|LOCUS_10840 61606 61682 gene locus_tag LOCUS_t00090 61606 61682 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 61816 62775 gene locus_tag LOCUS_10850 61816 62775 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 protein_id gnl|my_center|LOCUS_10850 62883 63485 gene locus_tag LOCUS_10860 62883 63485 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 protein_id gnl|my_center|LOCUS_10860 63537 64118 gene locus_tag LOCUS_10870 gene pth 63537 64118 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036110.1 protein_id gnl|my_center|LOCUS_10870 64195 65286 gene locus_tag LOCUS_10880 gene ychF 64195 65286 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036111.1 protein_id gnl|my_center|LOCUS_10880 68331 65584 gene locus_tag LOCUS_10890 68331 65584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_10890 68297 68476 gene locus_tag LOCUS_10900 68297 68476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 68589 69581 gene locus_tag LOCUS_10910 68589 69581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 69733 70752 gene locus_tag LOCUS_10920 69733 70752 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_10920 70890 70975 gene locus_tag LOCUS_t00100 70890 70975 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 71003 71076 gene locus_tag LOCUS_t00110 71003 71076 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 71114 71189 gene locus_tag LOCUS_t00120 71114 71189 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 71237 72427 gene locus_tag LOCUS_10930 gene tuf 71237 72427 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036121.1 protein_id gnl|my_center|LOCUS_10930 72535 72610 gene locus_tag LOCUS_t00130 72535 72610 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 72658 73065 gene locus_tag LOCUS_10940 gene secE 72658 73065 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450619.1 protein_id gnl|my_center|LOCUS_10940 73076 73636 gene locus_tag LOCUS_10950 gene nusG 73076 73636 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_10950 73838 74266 gene locus_tag LOCUS_10960 gene rplK 73838 74266 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036114.1 protein_id gnl|my_center|LOCUS_10960 74271 74969 gene locus_tag LOCUS_10970 gene rplA 74271 74969 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036115.1 protein_id gnl|my_center|LOCUS_10970 75353 75886 gene locus_tag LOCUS_10980 gene rplJ 75353 75886 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036116.1 protein_id gnl|my_center|LOCUS_10980 75950 76318 gene locus_tag LOCUS_10990 gene rplL 75950 76318 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036117.1 protein_id gnl|my_center|LOCUS_10990 76627 80820 gene locus_tag LOCUS_11000 gene rpoB 76627 80820 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 protein_id gnl|my_center|LOCUS_11000 80911 85137 gene locus_tag LOCUS_11010 gene rpoC 80911 85137 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036119.1 protein_id gnl|my_center|LOCUS_11010 85388 85762 gene locus_tag LOCUS_11020 gene rpsL 85388 85762 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003469157.1 protein_id gnl|my_center|LOCUS_11020 85775 86242 gene locus_tag LOCUS_11030 gene rpsG 85775 86242 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993356.1 protein_id gnl|my_center|LOCUS_11030 86382 88511 gene locus_tag LOCUS_11040 gene fusA 86382 88511 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036120.1 protein_id gnl|my_center|LOCUS_11040 88566 89756 gene locus_tag LOCUS_11050 gene tuf 88566 89756 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036121.1 protein_id gnl|my_center|LOCUS_11050 89864 89939 gene locus_tag LOCUS_t00140 89864 89939 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 89987 90394 gene locus_tag LOCUS_11060 gene secE 89987 90394 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450619.1 protein_id gnl|my_center|LOCUS_11060 90405 90965 gene locus_tag LOCUS_11070 gene nusG 90405 90965 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_11070 91167 91595 gene locus_tag LOCUS_11080 gene rplK 91167 91595 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036114.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence011 843 34 gene locus_tag LOCUS_11090 843 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1195 845 gene locus_tag LOCUS_11100 1195 845 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 protein_id gnl|my_center|LOCUS_11100 2273 1197 gene locus_tag LOCUS_11110 2273 1197 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_11110 3354 2266 gene locus_tag LOCUS_11120 gene pdhA 3354 2266 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 protein_id gnl|my_center|LOCUS_11120 3632 4513 gene locus_tag LOCUS_11130 3632 4513 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_11130 4713 6203 gene locus_tag LOCUS_11140 4713 6203 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_11140 6214 6810 gene locus_tag LOCUS_11150 6214 6810 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035687.1 protein_id gnl|my_center|LOCUS_11150 6930 8054 gene locus_tag LOCUS_11160 6930 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8646 8152 gene locus_tag LOCUS_11170 8646 8152 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_11170 8772 9887 gene locus_tag LOCUS_11180 gene hppD 8772 9887 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 protein_id gnl|my_center|LOCUS_11180 9956 11251 gene locus_tag LOCUS_11190 gene hmgA 9956 11251 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 protein_id gnl|my_center|LOCUS_11190 11759 11253 gene locus_tag LOCUS_11200 11759 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275199.1 protein_id gnl|my_center|LOCUS_11200 12177 15035 gene locus_tag LOCUS_11210 12177 15035 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_11210 15452 15099 gene locus_tag LOCUS_11220 15452 15099 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035694.1 protein_id gnl|my_center|LOCUS_11220 15733 15449 gene locus_tag LOCUS_11230 15733 15449 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 protein_id gnl|my_center|LOCUS_11230 16236 15730 gene locus_tag LOCUS_11240 16236 15730 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 protein_id gnl|my_center|LOCUS_11240 17777 16233 gene locus_tag LOCUS_11250 17777 16233 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035697.1 protein_id gnl|my_center|LOCUS_11250 18148 17774 gene locus_tag LOCUS_11260 18148 17774 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990640.1 protein_id gnl|my_center|LOCUS_11260 20976 18148 gene locus_tag LOCUS_11270 20976 18148 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035699.1 protein_id gnl|my_center|LOCUS_11270 21361 22221 gene locus_tag LOCUS_11280 21361 22221 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035700.1 protein_id gnl|my_center|LOCUS_11280 22795 22316 gene locus_tag LOCUS_11290 22795 22316 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035701.1 protein_id gnl|my_center|LOCUS_11290 23780 22854 gene locus_tag LOCUS_11300 23780 22854 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_11300 23925 24254 gene locus_tag LOCUS_11310 23925 24254 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035707.1 protein_id gnl|my_center|LOCUS_11310 24266 24940 gene locus_tag LOCUS_11320 gene rpe 24266 24940 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 protein_id gnl|my_center|LOCUS_11320 24943 25428 gene locus_tag LOCUS_11330 24943 25428 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084777.1 protein_id gnl|my_center|LOCUS_11330 25757 25990 gene locus_tag LOCUS_11340 25757 25990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 26060 26344 gene locus_tag LOCUS_11350 26060 26344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 26399 27079 gene locus_tag LOCUS_11360 26399 27079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_11360 27079 28470 gene locus_tag LOCUS_11370 27079 28470 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968992.1 protein_id gnl|my_center|LOCUS_11370 28696 30171 gene locus_tag LOCUS_11380 gene trpE 28696 30171 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_11380 30173 30940 gene locus_tag LOCUS_11390 30173 30940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 30951 31535 gene locus_tag LOCUS_11400 30951 31535 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_11400 31529 32047 gene locus_tag LOCUS_11410 31529 32047 CDS product DUF1543 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 protein_id gnl|my_center|LOCUS_11410 32061 33092 gene locus_tag LOCUS_11420 gene trpD 32061 33092 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035722.1 protein_id gnl|my_center|LOCUS_11420 33145 33939 gene locus_tag LOCUS_11430 gene trpC 33145 33939 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_11430 33936 34652 gene locus_tag LOCUS_11440 33936 34652 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035724.1 protein_id gnl|my_center|LOCUS_11440 35453 34695 gene locus_tag LOCUS_11450 35453 34695 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970243.1 protein_id gnl|my_center|LOCUS_11450 36369 35668 gene locus_tag LOCUS_11460 gene crp 36369 35668 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035725.1 protein_id gnl|my_center|LOCUS_11460 36514 37308 gene locus_tag LOCUS_11470 gene speD 36514 37308 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990692.1 protein_id gnl|my_center|LOCUS_11470 37470 37784 gene locus_tag LOCUS_11480 37470 37784 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 protein_id gnl|my_center|LOCUS_11480 37870 38190 gene locus_tag LOCUS_11490 37870 38190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 38822 38178 gene locus_tag LOCUS_11500 gene coq7 38822 38178 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 protein_id gnl|my_center|LOCUS_11500 39016 39444 gene locus_tag LOCUS_11510 gene rplM 39016 39444 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_11510 39447 39839 gene locus_tag LOCUS_11520 gene rpsI 39447 39839 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_11520 40099 40025 gene locus_tag LOCUS_t00150 40099 40025 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40282 40208 gene locus_tag LOCUS_t00160 40282 40208 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40390 40314 gene locus_tag LOCUS_t00170 40390 40314 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 40511 41131 gene locus_tag LOCUS_11530 40511 41131 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035729.1 protein_id gnl|my_center|LOCUS_11530 41224 41448 gene locus_tag LOCUS_11540 41224 41448 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 protein_id gnl|my_center|LOCUS_11540 41594 42064 gene locus_tag LOCUS_11550 gene bfr 41594 42064 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_11550 44527 42242 gene locus_tag LOCUS_11560 44527 42242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994151.1 protein_id gnl|my_center|LOCUS_11560 46346 44529 gene locus_tag LOCUS_11570 46346 44529 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275209.1 protein_id gnl|my_center|LOCUS_11570 47016 46378 gene locus_tag LOCUS_11580 47016 46378 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 protein_id gnl|my_center|LOCUS_11580 47186 47926 gene locus_tag LOCUS_11590 47186 47926 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035735.1 protein_id gnl|my_center|LOCUS_11590 47926 48354 gene locus_tag LOCUS_11600 47926 48354 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_11600 48386 48772 gene locus_tag LOCUS_11610 gene erpA 48386 48772 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_11610 48859 49764 gene locus_tag LOCUS_11620 gene nudC 48859 49764 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035738.1 protein_id gnl|my_center|LOCUS_11620 49841 50728 gene locus_tag LOCUS_11630 49841 50728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_11630 51559 51143 gene locus_tag LOCUS_11640 51559 51143 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_11640 51871 51563 gene locus_tag LOCUS_11650 51871 51563 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035741.1 protein_id gnl|my_center|LOCUS_11650 52220 51894 gene locus_tag LOCUS_11660 52220 51894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 54200 52311 gene locus_tag LOCUS_11670 54200 52311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 protein_id gnl|my_center|LOCUS_11670 55122 54187 gene locus_tag LOCUS_11680 55122 54187 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035743.1 protein_id gnl|my_center|LOCUS_11680 55222 56403 gene locus_tag LOCUS_11690 55222 56403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035744.1 protein_id gnl|my_center|LOCUS_11690 58598 56400 gene locus_tag LOCUS_11700 gene yccS 58598 56400 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035745.1 protein_id gnl|my_center|LOCUS_11700 59734 58814 gene locus_tag LOCUS_11710 59734 58814 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 protein_id gnl|my_center|LOCUS_11710 59811 60806 gene locus_tag LOCUS_11720 59811 60806 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_11720 62226 60940 gene locus_tag LOCUS_11730 gene purD 62226 60940 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_11730 62660 62250 gene locus_tag LOCUS_11740 62660 62250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 63478 62657 gene locus_tag LOCUS_11750 63478 62657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 65072 63489 gene locus_tag LOCUS_11760 gene purH 65072 63489 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035747.1 protein_id gnl|my_center|LOCUS_11760 65579 65385 gene locus_tag LOCUS_11770 65579 65385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 66504 65755 gene locus_tag LOCUS_11780 66504 65755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 67448 66534 gene locus_tag LOCUS_11790 gene prmA 67448 66534 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035761.1 protein_id gnl|my_center|LOCUS_11790 68993 67626 gene locus_tag LOCUS_11800 gene accC 68993 67626 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_11800 69486 69004 gene locus_tag LOCUS_11810 gene accB 69486 69004 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035766.1 protein_id gnl|my_center|LOCUS_11810 69982 69548 gene locus_tag LOCUS_11820 gene aroQ 69982 69548 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_11820 70765 70193 gene locus_tag LOCUS_11830 70765 70193 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527768.1 protein_id gnl|my_center|LOCUS_11830 73091 70767 gene locus_tag LOCUS_11840 73091 70767 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 protein_id gnl|my_center|LOCUS_11840 73429 73094 gene locus_tag LOCUS_11850 73429 73094 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_11850 73637 73924 gene locus_tag LOCUS_11860 73637 73924 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483210.1 protein_id gnl|my_center|LOCUS_11860 73983 75626 gene locus_tag LOCUS_11870 gene groL 73983 75626 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_11870 76317 75874 gene locus_tag LOCUS_11880 gene trxC 76317 75874 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_11880 76622 77695 gene locus_tag LOCUS_11890 76622 77695 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038671.1 protein_id gnl|my_center|LOCUS_11890 77844 78287 gene locus_tag LOCUS_11900 77844 78287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 78307 78567 gene locus_tag LOCUS_11910 78307 78567 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038187.1 protein_id gnl|my_center|LOCUS_11910 78701 79039 gene locus_tag LOCUS_11920 78701 79039 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 protein_id gnl|my_center|LOCUS_11920 80623 79109 gene locus_tag LOCUS_11930 80623 79109 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038672.1 protein_id gnl|my_center|LOCUS_11930 81355 80927 gene locus_tag LOCUS_11940 81355 80927 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_11940 81606 81355 gene locus_tag LOCUS_11950 81606 81355 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417286.1 protein_id gnl|my_center|LOCUS_11950 81706 84510 gene locus_tag LOCUS_11960 gene glnE 81706 84510 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_11960 85962 85408 gene locus_tag LOCUS_11970 85962 85408 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038685.1 protein_id gnl|my_center|LOCUS_11970 86642 86124 gene locus_tag LOCUS_11980 86642 86124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 87507 86659 gene locus_tag LOCUS_11990 87507 86659 CDS product DUF2145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 protein_id gnl|my_center|LOCUS_11990 <88417 87545 gene locus_tag LOCUS_12000 <88417 87545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038688.1:ELM1/GtrOC1 family putative glycosyltransferase >Feature sequence012 1513 650 gene locus_tag LOCUS_12010 gene htpX 1513 650 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_12010 1608 2492 gene locus_tag LOCUS_12020 gene gluQRS 1608 2492 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037437.1 protein_id gnl|my_center|LOCUS_12020 2552 3295 gene locus_tag LOCUS_12030 2552 3295 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_12030 3471 3992 gene locus_tag LOCUS_12040 gene phaR 3471 3992 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 protein_id gnl|my_center|LOCUS_12040 5078 4071 gene locus_tag LOCUS_12050 5078 4071 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_12050 5998 5075 gene locus_tag LOCUS_12060 5998 5075 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_12060 7869 6019 gene locus_tag LOCUS_12070 gene mutL 7869 6019 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_12070 9637 8093 gene locus_tag LOCUS_12080 9637 8093 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275349.1 protein_id gnl|my_center|LOCUS_12080 10197 9718 gene locus_tag LOCUS_12090 gene tsaE 10197 9718 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 protein_id gnl|my_center|LOCUS_12090 11678 10206 gene locus_tag LOCUS_12100 11678 10206 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037445.1 protein_id gnl|my_center|LOCUS_12100 11729 12784 gene locus_tag LOCUS_12110 gene queG 11729 12784 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_12110 12866 14203 gene locus_tag LOCUS_12120 gene xseA 12866 14203 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037447.1 protein_id gnl|my_center|LOCUS_12120 15465 14566 gene locus_tag LOCUS_12130 15465 14566 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_12130 17708 15852 gene locus_tag LOCUS_12140 17708 15852 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275348.1 protein_id gnl|my_center|LOCUS_12140 17803 18897 gene locus_tag LOCUS_12150 gene rnd 17803 18897 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037450.1 protein_id gnl|my_center|LOCUS_12150 18978 19053 gene locus_tag LOCUS_t00180 18978 19053 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20676 19126 gene locus_tag LOCUS_12160 20676 19126 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_12160 20903 20828 gene locus_tag LOCUS_t00190 20903 20828 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21165 21704 gene locus_tag LOCUS_12170 21165 21704 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_12170 23175 21715 gene locus_tag LOCUS_12180 23175 21715 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 protein_id gnl|my_center|LOCUS_12180 25007 23187 gene locus_tag LOCUS_12190 25007 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 26033 25023 gene locus_tag LOCUS_12200 26033 25023 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_12200 26604 26017 gene locus_tag LOCUS_12210 26604 26017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 30025 26666 gene locus_tag LOCUS_12220 30025 26666 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_12220 30200 30676 gene locus_tag LOCUS_12230 30200 30676 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037572.1 protein_id gnl|my_center|LOCUS_12230 30714 32504 gene locus_tag LOCUS_12240 30714 32504 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 protein_id gnl|my_center|LOCUS_12240 32582 33247 gene locus_tag LOCUS_12250 32582 33247 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_12250 33789 35699 gene locus_tag LOCUS_12260 gene dxs 33789 35699 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037575.1 protein_id gnl|my_center|LOCUS_12260 36095 35952 gene locus_tag LOCUS_12270 36095 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 36604 36531 gene locus_tag LOCUS_t00200 36604 36531 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 36758 36683 gene locus_tag LOCUS_t00210 36758 36683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37017 36942 gene locus_tag LOCUS_t00220 37017 36942 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37682 37068 gene locus_tag LOCUS_12280 gene pgsA 37682 37068 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_12280 39597 37690 gene locus_tag LOCUS_12290 gene uvrC 39597 37690 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037266.1 protein_id gnl|my_center|LOCUS_12290 41003 39606 gene locus_tag LOCUS_12300 41003 39606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275359.1 protein_id gnl|my_center|LOCUS_12300 41506 41018 gene locus_tag LOCUS_12310 41506 41018 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037268.1 protein_id gnl|my_center|LOCUS_12310 42276 41503 gene locus_tag LOCUS_12320 gene kdsB 42276 41503 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672371.1 protein_id gnl|my_center|LOCUS_12320 43513 42491 gene locus_tag LOCUS_12330 gene lpxK 43513 42491 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_12330 45258 43513 gene locus_tag LOCUS_12340 gene msbA 45258 43513 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037271.1 protein_id gnl|my_center|LOCUS_12340 45677 45255 gene locus_tag LOCUS_12350 45677 45255 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_12350 46343 45684 gene locus_tag LOCUS_12360 46343 45684 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_12360 48764 46347 gene locus_tag LOCUS_12370 48764 46347 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_12370 51086 48978 gene locus_tag LOCUS_12380 gene pnp 51086 48978 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_12380 51493 51233 gene locus_tag LOCUS_12390 gene rpsO 51493 51233 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037641.1 protein_id gnl|my_center|LOCUS_12390 52589 51678 gene locus_tag LOCUS_12400 gene truB 52589 51678 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037642.1 protein_id gnl|my_center|LOCUS_12400 53413 53021 gene locus_tag LOCUS_12410 gene rbfA 53413 53021 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 protein_id gnl|my_center|LOCUS_12410 56122 53489 gene locus_tag LOCUS_12420 gene infB 56122 53489 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275326.1 protein_id gnl|my_center|LOCUS_12420 57729 56218 gene locus_tag LOCUS_12430 gene nusA 57729 56218 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_12430 58324 57734 gene locus_tag LOCUS_12440 gene rimP 58324 57734 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037646.1 protein_id gnl|my_center|LOCUS_12440 58598 58522 gene locus_tag LOCUS_t00230 58598 58522 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60266 58806 gene locus_tag LOCUS_12450 gene nuoN 60266 58806 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037647.1 protein_id gnl|my_center|LOCUS_12450 61815 60304 gene locus_tag LOCUS_12460 61815 60304 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_12460 63974 61836 gene locus_tag LOCUS_12470 gene nuoL 63974 61836 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 protein_id gnl|my_center|LOCUS_12470 64287 63982 gene locus_tag LOCUS_12480 gene nuoK 64287 63982 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 protein_id gnl|my_center|LOCUS_12480 64943 64284 gene locus_tag LOCUS_12490 64943 64284 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 protein_id gnl|my_center|LOCUS_12490 65442 64954 gene locus_tag LOCUS_12500 gene nuoI 65442 64954 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_12500 66540 65446 gene locus_tag LOCUS_12510 gene nuoH 66540 65446 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037652.1 protein_id gnl|my_center|LOCUS_12510 68783 66537 gene locus_tag LOCUS_12520 gene nuoG 68783 66537 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037653.1 protein_id gnl|my_center|LOCUS_12520 70117 68780 gene locus_tag LOCUS_12530 gene nuoF 70117 68780 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_12530 70648 70121 gene locus_tag LOCUS_12540 gene nuoE 70648 70121 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_12540 72047 70740 gene locus_tag LOCUS_12550 72047 70740 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037656.1 protein_id gnl|my_center|LOCUS_12550 72730 72044 gene locus_tag LOCUS_12560 72730 72044 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 protein_id gnl|my_center|LOCUS_12560 73383 72829 gene locus_tag LOCUS_12570 73383 72829 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 protein_id gnl|my_center|LOCUS_12570 73778 73374 gene locus_tag LOCUS_12580 73778 73374 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037659.1 protein_id gnl|my_center|LOCUS_12580 73927 73843 gene locus_tag LOCUS_t00240 73927 73843 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74401 73979 gene locus_tag LOCUS_12590 gene secG 74401 73979 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037660.1 protein_id gnl|my_center|LOCUS_12590 75185 74430 gene locus_tag LOCUS_12600 gene tpiA 75185 74430 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_12600 76283 75348 gene locus_tag LOCUS_12610 76283 75348 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_12610 76468 77715 gene locus_tag LOCUS_12620 76468 77715 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_12620 77627 78481 gene locus_tag LOCUS_12630 77627 78481 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813227.1 protein_id gnl|my_center|LOCUS_12630 79966 78596 gene locus_tag LOCUS_12640 gene glmM 79966 78596 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037669.1 protein_id gnl|my_center|LOCUS_12640 80853 79966 gene locus_tag LOCUS_12650 gene accD 80853 79966 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037670.1 protein_id gnl|my_center|LOCUS_12650 81696 81073 gene locus_tag LOCUS_12660 81696 81073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence013 1309 305 gene locus_tag LOCUS_12670 1309 305 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_12670 2328 1306 gene locus_tag LOCUS_12680 2328 1306 CDS product glucokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038066.1 protein_id gnl|my_center|LOCUS_12680 2789 2403 gene locus_tag LOCUS_12690 gene crcB 2789 2403 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_12690 4161 2857 gene locus_tag LOCUS_12700 4161 2857 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037140.1 protein_id gnl|my_center|LOCUS_12700 4940 4302 gene locus_tag LOCUS_12710 gene lolA 4940 4302 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_12710 7392 5032 gene locus_tag LOCUS_12720 7392 5032 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_12720 7635 8657 gene locus_tag LOCUS_12730 gene trxB 7635 8657 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037135.1 protein_id gnl|my_center|LOCUS_12730 8682 9572 gene locus_tag LOCUS_12740 8682 9572 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_12740 9569 10708 gene locus_tag LOCUS_12750 9569 10708 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_12750 11666 11109 gene locus_tag LOCUS_12760 11666 11109 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707712.1 protein_id gnl|my_center|LOCUS_12760 11768 12610 gene locus_tag LOCUS_12770 11768 12610 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194102.1 protein_id gnl|my_center|LOCUS_12770 13384 14142 gene locus_tag LOCUS_12780 gene aat 13384 14142 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037133.1 protein_id gnl|my_center|LOCUS_12780 14155 14448 gene locus_tag LOCUS_12790 14155 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16913 14634 gene locus_tag LOCUS_12800 gene clpA 16913 14634 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_12800 17531 17211 gene locus_tag LOCUS_12810 gene clpS 17531 17211 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_12810 17638 18114 gene locus_tag LOCUS_12820 17638 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056178.1 protein_id gnl|my_center|LOCUS_12820 18117 18578 gene locus_tag LOCUS_12830 18117 18578 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_12830 18575 19759 gene locus_tag LOCUS_12840 gene mnmA 18575 19759 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037128.1 protein_id gnl|my_center|LOCUS_12840 19756 20379 gene locus_tag LOCUS_12850 gene hflD 19756 20379 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 protein_id gnl|my_center|LOCUS_12850 20411 21622 gene locus_tag LOCUS_12860 20411 21622 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_12860 21672 21893 gene locus_tag LOCUS_12870 21672 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 25181 22419 gene locus_tag LOCUS_12880 25181 22419 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945287.1 protein_id gnl|my_center|LOCUS_12880 25351 26328 gene locus_tag LOCUS_12890 25351 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 26331 28076 gene locus_tag LOCUS_12900 26331 28076 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037122.1 protein_id gnl|my_center|LOCUS_12900 29345 28122 gene locus_tag LOCUS_12910 29345 28122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037121.1 protein_id gnl|my_center|LOCUS_12910 29761 29423 gene locus_tag LOCUS_12920 29761 29423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037120.1 protein_id gnl|my_center|LOCUS_12920 30060 29758 gene locus_tag LOCUS_12930 gene flgM 30060 29758 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037119.1 protein_id gnl|my_center|LOCUS_12930 30770 30126 gene locus_tag LOCUS_12940 gene flgA 30770 30126 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037118.1 protein_id gnl|my_center|LOCUS_12940 30925 31869 gene locus_tag LOCUS_12950 30925 31869 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037117.1 protein_id gnl|my_center|LOCUS_12950 32087 32485 gene locus_tag LOCUS_12960 gene flgB 32087 32485 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037116.1 protein_id gnl|my_center|LOCUS_12960 32496 32903 gene locus_tag LOCUS_12970 gene flgC 32496 32903 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037115.1 protein_id gnl|my_center|LOCUS_12970 32927 33601 gene locus_tag LOCUS_12980 32927 33601 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037114.1 protein_id gnl|my_center|LOCUS_12980 33636 34913 gene locus_tag LOCUS_12990 gene flgE 33636 34913 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_12990 35050 35799 gene locus_tag LOCUS_13000 gene flgF 35050 35799 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037112.1 protein_id gnl|my_center|LOCUS_13000 35900 36685 gene locus_tag LOCUS_13010 gene flgG 35900 36685 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 protein_id gnl|my_center|LOCUS_13010 36709 37401 gene locus_tag LOCUS_13020 gene flgH 36709 37401 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037111.1 protein_id gnl|my_center|LOCUS_13020 37413 38606 gene locus_tag LOCUS_13030 37413 38606 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 protein_id gnl|my_center|LOCUS_13030 38609 39808 gene locus_tag LOCUS_13040 38609 39808 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037109.1 protein_id gnl|my_center|LOCUS_13040 39820 41703 gene locus_tag LOCUS_13050 gene flgK 39820 41703 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_13050 41703 42905 gene locus_tag LOCUS_13060 gene flgL 41703 42905 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_13060 42968 44215 gene locus_tag LOCUS_13070 42968 44215 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037106.1 protein_id gnl|my_center|LOCUS_13070 44455 45816 gene locus_tag LOCUS_13080 gene fliD 44455 45816 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037105.1 protein_id gnl|my_center|LOCUS_13080 45926 46345 gene locus_tag LOCUS_13090 gene fliS 45926 46345 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037104.1 protein_id gnl|my_center|LOCUS_13090 46351 46659 gene locus_tag LOCUS_13100 46351 46659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 46656 47240 gene locus_tag LOCUS_13110 46656 47240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 47314 47958 gene locus_tag LOCUS_13120 47314 47958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 protein_id gnl|my_center|LOCUS_13120 48226 49638 gene locus_tag LOCUS_13130 gene rpoN 48226 49638 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037100.1 protein_id gnl|my_center|LOCUS_13130 49652 50035 gene locus_tag LOCUS_13140 49652 50035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997154.1 protein_id gnl|my_center|LOCUS_13140 50028 51467 gene locus_tag LOCUS_13150 50028 51467 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 protein_id gnl|my_center|LOCUS_13150 51517 52005 gene locus_tag LOCUS_13160 gene tagD 51517 52005 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721506.1 protein_id gnl|my_center|LOCUS_13160 52005 54518 gene locus_tag LOCUS_13170 52005 54518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 54515 55795 gene locus_tag LOCUS_13180 54515 55795 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_13180 55792 57306 gene locus_tag LOCUS_13190 55792 57306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 57388 58518 gene locus_tag LOCUS_13200 gene vioA 57388 58518 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 protein_id gnl|my_center|LOCUS_13200 58535 59797 gene locus_tag LOCUS_13210 58535 59797 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876000.1 protein_id gnl|my_center|LOCUS_13210 59797 63315 gene locus_tag LOCUS_13220 59797 63315 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768866.1 protein_id gnl|my_center|LOCUS_13220 63633 63995 gene locus_tag LOCUS_13230 gene fliE 63633 63995 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507679.1 protein_id gnl|my_center|LOCUS_13230 64009 65652 gene locus_tag LOCUS_13240 gene fliF 64009 65652 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037092.1 protein_id gnl|my_center|LOCUS_13240 65645 66652 gene locus_tag LOCUS_13250 gene fliG 65645 66652 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_13250 66649 67296 gene locus_tag LOCUS_13260 66649 67296 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037090.1 protein_id gnl|my_center|LOCUS_13260 67293 68702 gene locus_tag LOCUS_13270 gene fliI 67293 68702 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 protein_id gnl|my_center|LOCUS_13270 68699 69151 gene locus_tag LOCUS_13280 gene fliJ 68699 69151 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037088.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence014 1776 1330 gene locus_tag LOCUS_13290 1776 1330 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_13290 5476 1898 gene locus_tag LOCUS_13300 5476 1898 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_13300 6381 5488 gene locus_tag LOCUS_13310 6381 5488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_13310 6961 6572 gene locus_tag LOCUS_13320 6961 6572 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 protein_id gnl|my_center|LOCUS_13320 8028 6958 gene locus_tag LOCUS_13330 8028 6958 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_13330 9920 8046 gene locus_tag LOCUS_13340 9920 8046 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 protein_id gnl|my_center|LOCUS_13340 10773 10096 gene locus_tag LOCUS_13350 10773 10096 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 protein_id gnl|my_center|LOCUS_13350 10892 12274 gene locus_tag LOCUS_13360 10892 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994075.1 protein_id gnl|my_center|LOCUS_13360 12805 12344 gene locus_tag LOCUS_13370 12805 12344 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_13370 14499 12874 gene locus_tag LOCUS_13380 14499 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 16286 14496 gene locus_tag LOCUS_13390 16286 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 17166 16309 gene locus_tag LOCUS_13400 gene trxA 17166 16309 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_13400 17332 17763 gene locus_tag LOCUS_13410 17332 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 17760 17972 gene locus_tag LOCUS_13420 17760 17972 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_13420 18066 18668 gene locus_tag LOCUS_13430 18066 18668 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037751.1 protein_id gnl|my_center|LOCUS_13430 19993 18710 gene locus_tag LOCUS_13440 19993 18710 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_13440 20212 22854 gene locus_tag LOCUS_13450 gene leuS 20212 22854 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057355.1 protein_id gnl|my_center|LOCUS_13450 23198 23743 gene locus_tag LOCUS_13460 gene lptE 23198 23743 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037748.1 protein_id gnl|my_center|LOCUS_13460 23786 24829 gene locus_tag LOCUS_13470 gene holA 23786 24829 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 protein_id gnl|my_center|LOCUS_13470 24835 25536 gene locus_tag LOCUS_13480 24835 25536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 25533 26012 gene locus_tag LOCUS_13490 gene rsfS 25533 26012 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_13490 26088 26558 gene locus_tag LOCUS_13500 gene rlmH 26088 26558 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037743.1 protein_id gnl|my_center|LOCUS_13500 26583 26659 gene locus_tag LOCUS_t00250 26583 26659 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 26714 26917 gene locus_tag LOCUS_13510 26714 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 27320 26925 gene locus_tag LOCUS_13520 27320 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13520 28090 27632 gene locus_tag LOCUS_13530 28090 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 28428 28087 gene locus_tag LOCUS_13540 28428 28087 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265882.1 protein_id gnl|my_center|LOCUS_13540 29167 28835 gene locus_tag LOCUS_13550 29167 28835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 29582 29142 gene locus_tag LOCUS_13560 29582 29142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 32873 29985 gene locus_tag LOCUS_13570 32873 29985 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_13570 33662 33000 gene locus_tag LOCUS_13580 33662 33000 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037742.1 protein_id gnl|my_center|LOCUS_13580 34596 33862 gene locus_tag LOCUS_13590 34596 33862 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_13590 34804 35379 gene locus_tag LOCUS_13600 34804 35379 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037740.1 protein_id gnl|my_center|LOCUS_13600 35384 36874 gene locus_tag LOCUS_13610 gene rng 35384 36874 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_13610 37005 40832 gene locus_tag LOCUS_13620 37005 40832 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_13620 40886 42346 gene locus_tag LOCUS_13630 gene tldD 40886 42346 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_13630 43109 42375 gene locus_tag LOCUS_13640 43109 42375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 43695 43111 gene locus_tag LOCUS_13650 gene yjgA 43695 43111 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037735.1 protein_id gnl|my_center|LOCUS_13650 43891 45258 gene locus_tag LOCUS_13660 gene pmbA 43891 45258 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_13660 45354 45713 gene locus_tag LOCUS_13670 45354 45713 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_13670 46694 45816 gene locus_tag LOCUS_13680 46694 45816 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_13680 46944 46684 gene locus_tag LOCUS_13690 46944 46684 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 protein_id gnl|my_center|LOCUS_13690 48319 46976 gene locus_tag LOCUS_13700 gene tilS 48319 46976 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 protein_id gnl|my_center|LOCUS_13700 48884 48369 gene locus_tag LOCUS_13710 48884 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 50632 48902 gene locus_tag LOCUS_13720 50632 48902 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_13720 50748 52058 gene locus_tag LOCUS_13730 50748 52058 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037726.1 protein_id gnl|my_center|LOCUS_13730 52165 53532 gene locus_tag LOCUS_13740 52165 53532 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_13740 53543 54964 gene locus_tag LOCUS_13750 53543 54964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 55746 55096 gene locus_tag LOCUS_13760 55746 55096 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037714.1 protein_id gnl|my_center|LOCUS_13760 56343 55948 gene locus_tag LOCUS_13770 56343 55948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 56592 57074 gene locus_tag LOCUS_13780 56592 57074 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037712.1 protein_id gnl|my_center|LOCUS_13780 57201 58421 gene locus_tag LOCUS_13790 57201 58421 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_13790 58673 60025 gene locus_tag LOCUS_13800 gene gorA 58673 60025 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037709.1 protein_id gnl|my_center|LOCUS_13800 60080 61042 gene locus_tag LOCUS_13810 60080 61042 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_13810 61039 61398 gene locus_tag LOCUS_13820 61039 61398 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037708.1 protein_id gnl|my_center|LOCUS_13820 61781 62449 gene locus_tag LOCUS_13830 61781 62449 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_13830 64618 62609 gene locus_tag LOCUS_13840 64618 62609 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037706.1 protein_id gnl|my_center|LOCUS_13840 66927 64828 gene locus_tag LOCUS_13850 66927 64828 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921850.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence015 667 592 gene locus_tag LOCUS_t00260 667 592 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1492 710 gene locus_tag LOCUS_13860 1492 710 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039009.1 protein_id gnl|my_center|LOCUS_13860 2239 1502 gene locus_tag LOCUS_13870 2239 1502 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039010.1 protein_id gnl|my_center|LOCUS_13870 3201 2236 gene locus_tag LOCUS_13880 gene birA 3201 2236 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_13880 3330 3617 gene locus_tag LOCUS_13890 3330 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3584 4387 gene locus_tag LOCUS_13900 3584 4387 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 protein_id gnl|my_center|LOCUS_13900 5903 4476 gene locus_tag LOCUS_13910 5903 4476 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_13910 6608 5925 gene locus_tag LOCUS_13920 6608 5925 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_13920 7051 6680 gene locus_tag LOCUS_13930 7051 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039016.1 protein_id gnl|my_center|LOCUS_13930 8234 7239 gene locus_tag LOCUS_13940 gene dusA 8234 7239 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 protein_id gnl|my_center|LOCUS_13940 8343 9350 gene locus_tag LOCUS_13950 8343 9350 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_13950 9624 9412 gene locus_tag LOCUS_13960 9624 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10182 9670 gene locus_tag LOCUS_13970 10182 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11156 10224 gene locus_tag LOCUS_13980 11156 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11210 11440 gene locus_tag LOCUS_13990 11210 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 11433 11648 gene locus_tag LOCUS_14000 11433 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 11656 11856 gene locus_tag LOCUS_14010 11656 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 11849 12454 gene locus_tag LOCUS_14020 11849 12454 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_14020 12912 13175 gene locus_tag LOCUS_14030 12912 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 13786 13235 gene locus_tag LOCUS_14040 13786 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14547 13798 gene locus_tag LOCUS_14050 14547 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 14846 14547 gene locus_tag LOCUS_14060 14846 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 16204 14846 gene locus_tag LOCUS_14070 16204 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 16512 16201 gene locus_tag LOCUS_14080 16512 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 16927 16526 gene locus_tag LOCUS_14090 16927 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 17481 16927 gene locus_tag LOCUS_14100 17481 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 17897 17490 gene locus_tag LOCUS_14110 17897 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 18082 17894 gene locus_tag LOCUS_14120 18082 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 18887 18090 gene locus_tag LOCUS_14130 18887 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 22811 18891 gene locus_tag LOCUS_14140 22811 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 23063 22812 gene locus_tag LOCUS_14150 23063 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 23862 23101 gene locus_tag LOCUS_14160 23862 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 25822 23864 gene locus_tag LOCUS_14170 25822 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 26070 25819 gene locus_tag LOCUS_14180 26070 25819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 26486 26109 gene locus_tag LOCUS_14190 26486 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 27089 26610 gene locus_tag LOCUS_14200 27089 26610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 27532 27170 gene locus_tag LOCUS_14210 27532 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 28032 27529 gene locus_tag LOCUS_14220 28032 27529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 28357 28025 gene locus_tag LOCUS_14230 28357 28025 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938789.1 protein_id gnl|my_center|LOCUS_14230 28779 28354 gene locus_tag LOCUS_14240 28779 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 29174 28779 gene locus_tag LOCUS_14250 29174 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 30470 29223 gene locus_tag LOCUS_14260 30470 29223 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_14260 31276 30539 gene locus_tag LOCUS_14270 31276 30539 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938793.1 protein_id gnl|my_center|LOCUS_14270 32561 31239 gene locus_tag LOCUS_14280 32561 31239 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938794.1 protein_id gnl|my_center|LOCUS_14280 34231 32561 gene locus_tag LOCUS_14290 34231 32561 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_14290 34615 34235 gene locus_tag LOCUS_14300 34615 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 35067 34723 gene locus_tag LOCUS_14310 35067 34723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 35399 35067 gene locus_tag LOCUS_14320 35399 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 35575 35399 gene locus_tag LOCUS_14330 35575 35399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 35931 35575 gene locus_tag LOCUS_14340 35931 35575 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744232.1 protein_id gnl|my_center|LOCUS_14340 36506 35928 gene locus_tag LOCUS_14350 36506 35928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 36780 36490 gene locus_tag LOCUS_14360 36780 36490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 37372 36797 gene locus_tag LOCUS_14370 37372 36797 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072876.1 protein_id gnl|my_center|LOCUS_14370 37562 37362 gene locus_tag LOCUS_14380 37562 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 38154 37732 gene locus_tag LOCUS_14390 gene hicB 38154 37732 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_14390 38381 38196 gene locus_tag LOCUS_14400 gene hicA 38381 38196 CDS product type II toxin-antitoxin system mRNA interferase toxin HicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813797.1 protein_id gnl|my_center|LOCUS_14400 39352 38741 gene locus_tag LOCUS_14410 39352 38741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 39645 39349 gene locus_tag LOCUS_14420 39645 39349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 40247 39723 gene locus_tag LOCUS_14430 40247 39723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 41259 40294 gene locus_tag LOCUS_14440 41259 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 41584 41273 gene locus_tag LOCUS_14450 41584 41273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 42054 41584 gene locus_tag LOCUS_14460 42054 41584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 42215 42451 gene locus_tag LOCUS_14470 42215 42451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 42912 42514 gene locus_tag LOCUS_14480 42912 42514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 42987 43511 gene locus_tag LOCUS_14490 42987 43511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 43447 43779 gene locus_tag LOCUS_14500 43447 43779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 43992 44540 gene locus_tag LOCUS_14510 43992 44540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 44560 45207 gene locus_tag LOCUS_14520 44560 45207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 45207 46301 gene locus_tag LOCUS_14530 45207 46301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 46310 46603 gene locus_tag LOCUS_14540 46310 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 46600 47775 gene locus_tag LOCUS_14550 46600 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 47772 47978 gene locus_tag LOCUS_14560 47772 47978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 47968 48198 gene locus_tag LOCUS_14570 47968 48198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 48191 48478 gene locus_tag LOCUS_14580 48191 48478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 48480 48725 gene locus_tag LOCUS_14590 48480 48725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 48718 48936 gene locus_tag LOCUS_14600 48718 48936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 48933 49349 gene locus_tag LOCUS_14610 48933 49349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 49321 49560 gene locus_tag LOCUS_14620 49321 49560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 49544 49750 gene locus_tag LOCUS_14630 49544 49750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 49740 49955 gene locus_tag LOCUS_14640 49740 49955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 50199 50573 gene locus_tag LOCUS_14650 50199 50573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 50729 50920 gene locus_tag LOCUS_14660 50729 50920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 51277 50972 gene locus_tag LOCUS_14670 51277 50972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 51504 51836 gene locus_tag LOCUS_14680 gene emrE 51504 51836 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070449.1 protein_id gnl|my_center|LOCUS_14680 52886 53257 gene locus_tag LOCUS_14690 52886 53257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 53395 54732 gene locus_tag LOCUS_14700 53395 54732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 54729 56222 gene locus_tag LOCUS_14710 54729 56222 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_14710 56224 59388 gene locus_tag LOCUS_14720 56224 59388 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence016 2951 1176 gene locus_tag LOCUS_14730 2951 1176 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038326.1 protein_id gnl|my_center|LOCUS_14730 3943 2948 gene locus_tag LOCUS_14740 3943 2948 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 protein_id gnl|my_center|LOCUS_14740 4398 3943 gene locus_tag LOCUS_14750 4398 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5390 4395 gene locus_tag LOCUS_14760 5390 4395 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275283.1 protein_id gnl|my_center|LOCUS_14760 6397 5387 gene locus_tag LOCUS_14770 6397 5387 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_14770 8403 6514 gene locus_tag LOCUS_14780 8403 6514 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 protein_id gnl|my_center|LOCUS_14780 8961 8425 gene locus_tag LOCUS_14790 8961 8425 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_14790 9638 8961 gene locus_tag LOCUS_14800 9638 8961 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_14800 10333 9635 gene locus_tag LOCUS_14810 10333 9635 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 protein_id gnl|my_center|LOCUS_14810 11289 10333 gene locus_tag LOCUS_14820 11289 10333 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_14820 11610 14033 gene locus_tag LOCUS_14830 11610 14033 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522231.1 protein_id gnl|my_center|LOCUS_14830 14112 14750 gene locus_tag LOCUS_14840 14112 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_14840 16644 15370 gene locus_tag LOCUS_14850 16644 15370 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 protein_id gnl|my_center|LOCUS_14850 17251 17009 gene locus_tag LOCUS_14860 17251 17009 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_14860 18276 17335 gene locus_tag LOCUS_14870 18276 17335 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_14870 20486 18342 gene locus_tag LOCUS_14880 gene recG 20486 18342 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038341.1 protein_id gnl|my_center|LOCUS_14880 20879 20496 gene locus_tag LOCUS_14890 20879 20496 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_14890 23521 21410 gene locus_tag LOCUS_14900 23521 21410 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 protein_id gnl|my_center|LOCUS_14900 24125 23826 gene locus_tag LOCUS_14910 gene rpoZ 24125 23826 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812428.1 protein_id gnl|my_center|LOCUS_14910 24924 24313 gene locus_tag LOCUS_14920 gene gmk 24924 24313 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038351.1 protein_id gnl|my_center|LOCUS_14920 26292 25030 gene locus_tag LOCUS_14930 26292 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 27411 26563 gene locus_tag LOCUS_14940 27411 26563 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_14940 27536 28264 gene locus_tag LOCUS_14950 gene rph 27536 28264 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_14950 28261 28650 gene locus_tag LOCUS_14960 28261 28650 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038354.1 protein_id gnl|my_center|LOCUS_14960 28647 29243 gene locus_tag LOCUS_14970 gene rdgB 28647 29243 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877719.1 protein_id gnl|my_center|LOCUS_14970 29273 30493 gene locus_tag LOCUS_14980 gene hemW 29273 30493 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_14980 30574 33084 gene locus_tag LOCUS_14990 30574 33084 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038357.1 protein_id gnl|my_center|LOCUS_14990 33081 33428 gene locus_tag LOCUS_15000 33081 33428 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038358.1 protein_id gnl|my_center|LOCUS_15000 33508 34836 gene locus_tag LOCUS_15010 gene pepQ 33508 34836 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_15010 36981 35656 gene locus_tag LOCUS_15020 36981 35656 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_15020 37615 36989 gene locus_tag LOCUS_15030 37615 36989 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038362.1 protein_id gnl|my_center|LOCUS_15030 37643 37882 gene locus_tag LOCUS_15040 37643 37882 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_15040 37879 38178 gene locus_tag LOCUS_15050 37879 38178 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_15050 38554 39144 gene locus_tag LOCUS_15060 38554 39144 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038365.1 protein_id gnl|my_center|LOCUS_15060 39141 39626 gene locus_tag LOCUS_15070 39141 39626 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_15070 39718 40365 gene locus_tag LOCUS_15080 gene rpiA 39718 40365 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 protein_id gnl|my_center|LOCUS_15080 41370 40399 gene locus_tag LOCUS_15090 41370 40399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 41886 41452 gene locus_tag LOCUS_15100 41886 41452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 41983 42504 gene locus_tag LOCUS_15110 41983 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 42564 43016 gene locus_tag LOCUS_15120 42564 43016 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 protein_id gnl|my_center|LOCUS_15120 43097 43945 gene locus_tag LOCUS_15130 43097 43945 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038369.1 protein_id gnl|my_center|LOCUS_15130 44231 44076 gene locus_tag LOCUS_15140 44231 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 44337 44969 gene locus_tag LOCUS_15150 gene thiE 44337 44969 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_15150 46914 45640 gene locus_tag LOCUS_15160 46914 45640 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_15160 47047 48342 gene locus_tag LOCUS_15170 gene hemL 47047 48342 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038374.1 protein_id gnl|my_center|LOCUS_15170 48354 49067 gene locus_tag LOCUS_15180 48354 49067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 55245 49213 gene locus_tag LOCUS_15190 55245 49213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 56786 55512 gene locus_tag LOCUS_15200 56786 55512 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038384.1 protein_id gnl|my_center|LOCUS_15200 56813 57688 gene locus_tag LOCUS_15210 56813 57688 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038385.1 protein_id gnl|my_center|LOCUS_15210 58585 57731 gene locus_tag LOCUS_15220 58585 57731 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence017 832 95 gene locus_tag LOCUS_15230 832 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1093 860 gene locus_tag LOCUS_15240 1093 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1448 1179 gene locus_tag LOCUS_15250 1448 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1965 1564 gene locus_tag LOCUS_15260 1965 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2412 2083 gene locus_tag LOCUS_15270 2412 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3131 2409 gene locus_tag LOCUS_15280 3131 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3216 3449 gene locus_tag LOCUS_15290 3216 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3627 3460 gene locus_tag LOCUS_15300 3627 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3739 4047 gene locus_tag LOCUS_15310 3739 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4079 4903 gene locus_tag LOCUS_15320 4079 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4900 6195 gene locus_tag LOCUS_15330 4900 6195 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 protein_id gnl|my_center|LOCUS_15330 6192 6740 gene locus_tag LOCUS_15340 6192 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6737 6958 gene locus_tag LOCUS_15350 6737 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6955 7236 gene locus_tag LOCUS_15360 6955 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 7233 7793 gene locus_tag LOCUS_15370 7233 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 7795 8034 gene locus_tag LOCUS_15380 7795 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8102 8551 gene locus_tag LOCUS_15390 8102 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 8557 8787 gene locus_tag LOCUS_15400 8557 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8787 10385 gene locus_tag LOCUS_15410 8787 10385 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064788614.1 protein_id gnl|my_center|LOCUS_15410 10382 10630 gene locus_tag LOCUS_15420 10382 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10605 11486 gene locus_tag LOCUS_15430 10605 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 11703 12566 gene locus_tag LOCUS_15440 11703 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 12639 13157 gene locus_tag LOCUS_15450 12639 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 13234 13824 gene locus_tag LOCUS_15460 13234 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 13828 16011 gene locus_tag LOCUS_15470 13828 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 16008 16457 gene locus_tag LOCUS_15480 16008 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 16460 16927 gene locus_tag LOCUS_15490 16460 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 16927 19005 gene locus_tag LOCUS_15500 16927 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 19002 21422 gene locus_tag LOCUS_15510 19002 21422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 21482 23872 gene locus_tag LOCUS_15520 21482 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039763.1 protein_id gnl|my_center|LOCUS_15520 23874 24230 gene locus_tag LOCUS_15530 23874 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 24220 25860 gene locus_tag LOCUS_15540 24220 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 25884 26132 gene locus_tag LOCUS_15550 25884 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 26125 26667 gene locus_tag LOCUS_15560 gene rrrD 26125 26667 CDS product lysozyme RrrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075107.1 protein_id gnl|my_center|LOCUS_15560 26664 27047 gene locus_tag LOCUS_15570 26664 27047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 27217 28740 gene locus_tag LOCUS_15580 27217 28740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 28740 29912 gene locus_tag LOCUS_15590 28740 29912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 29905 30885 gene locus_tag LOCUS_15600 29905 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 30885 32561 gene locus_tag LOCUS_15610 30885 32561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 32816 34105 gene locus_tag LOCUS_15620 32816 34105 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037246.1 protein_id gnl|my_center|LOCUS_15620 34136 35758 gene locus_tag LOCUS_15630 34136 35758 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522103.1 protein_id gnl|my_center|LOCUS_15630 37085 35838 gene locus_tag LOCUS_15640 37085 35838 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 protein_id gnl|my_center|LOCUS_15640 37500 37069 gene locus_tag LOCUS_15650 37500 37069 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507823.1 protein_id gnl|my_center|LOCUS_15650 37658 38023 gene locus_tag LOCUS_15660 37658 38023 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_15660 38045 38797 gene locus_tag LOCUS_15670 38045 38797 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037242.1 protein_id gnl|my_center|LOCUS_15670 38977 39966 gene locus_tag LOCUS_15680 38977 39966 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036863.1 protein_id gnl|my_center|LOCUS_15680 40711 40037 gene locus_tag LOCUS_15690 40711 40037 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438572.1 protein_id gnl|my_center|LOCUS_15690 42011 40695 gene locus_tag LOCUS_15700 42011 40695 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036866.1 protein_id gnl|my_center|LOCUS_15700 42289 42915 gene locus_tag LOCUS_15710 42289 42915 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_15710 43058 44179 gene locus_tag LOCUS_15720 43058 44179 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_15720 45760 44270 gene locus_tag LOCUS_15730 45760 44270 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036870.1 protein_id gnl|my_center|LOCUS_15730 47897 46008 gene locus_tag LOCUS_15740 gene parE 47897 46008 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055568.1 protein_id gnl|my_center|LOCUS_15740 48059 48307 gene locus_tag LOCUS_15750 48059 48307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 48495 50159 gene locus_tag LOCUS_15760 48495 50159 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036874.1 protein_id gnl|my_center|LOCUS_15760 50317 51150 gene locus_tag LOCUS_15770 gene kdsA 50317 51150 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_15770 51314 52606 gene locus_tag LOCUS_15780 gene eno 51314 52606 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036877.1 protein_id gnl|my_center|LOCUS_15780 52612 52962 gene locus_tag LOCUS_15790 gene ftsB 52612 52962 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036878.1 protein_id gnl|my_center|LOCUS_15790 52959 53654 gene locus_tag LOCUS_15800 gene ispD 52959 53654 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 protein_id gnl|my_center|LOCUS_15800 53708 54205 gene locus_tag LOCUS_15810 gene ispF 53708 54205 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036880.1 protein_id gnl|my_center|LOCUS_15810 54360 55406 gene locus_tag LOCUS_15820 gene truD 54360 55406 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_15820 56099 55554 gene locus_tag LOCUS_15830 56099 55554 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_15830 56268 57047 gene locus_tag LOCUS_15840 gene surE 56268 57047 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_15840 57044 57718 gene locus_tag LOCUS_15850 57044 57718 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_15850 57737 58351 gene locus_tag LOCUS_15860 57737 58351 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036885.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence018 3644 546 gene locus_tag LOCUS_15870 3644 546 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_15870 4319 3948 gene locus_tag LOCUS_15880 4319 3948 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038745.1 protein_id gnl|my_center|LOCUS_15880 4484 4921 gene locus_tag LOCUS_15890 4484 4921 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_15890 4944 5381 gene locus_tag LOCUS_15900 4944 5381 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_15900 5384 5788 gene locus_tag LOCUS_15910 5384 5788 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_15910 5850 6206 gene locus_tag LOCUS_15920 5850 6206 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 protein_id gnl|my_center|LOCUS_15920 6261 7514 gene locus_tag LOCUS_15930 6261 7514 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190738.1 protein_id gnl|my_center|LOCUS_15930 7793 9517 gene locus_tag LOCUS_15940 7793 9517 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_15940 9729 11018 gene locus_tag LOCUS_15950 9729 11018 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634437.1 protein_id gnl|my_center|LOCUS_15950 11008 11781 gene locus_tag LOCUS_15960 11008 11781 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_15960 11815 12159 gene locus_tag LOCUS_15970 11815 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 12798 12196 gene locus_tag LOCUS_15980 12798 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083993029.1 protein_id gnl|my_center|LOCUS_15980 13129 14049 gene locus_tag LOCUS_15990 13129 14049 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038755.1 protein_id gnl|my_center|LOCUS_15990 16227 14128 gene locus_tag LOCUS_16000 16227 14128 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275451.1 protein_id gnl|my_center|LOCUS_16000 16514 19465 gene locus_tag LOCUS_16010 16514 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 20365 19457 gene locus_tag LOCUS_16020 20365 19457 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_16020 20467 21264 gene locus_tag LOCUS_16030 20467 21264 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_16030 21381 23027 gene locus_tag LOCUS_16040 21381 23027 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038744.1 protein_id gnl|my_center|LOCUS_16040 23321 23073 gene locus_tag LOCUS_16050 23321 23073 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038741.1 protein_id gnl|my_center|LOCUS_16050 23411 23983 gene locus_tag LOCUS_16060 23411 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038740.1 protein_id gnl|my_center|LOCUS_16060 24348 24073 gene locus_tag LOCUS_16070 24348 24073 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038739.1 protein_id gnl|my_center|LOCUS_16070 24860 24363 gene locus_tag LOCUS_16080 24860 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 25915 24941 gene locus_tag LOCUS_16090 25915 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 26773 25919 gene locus_tag LOCUS_16100 gene motA 26773 25919 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_16100 27314 26847 gene locus_tag LOCUS_16110 gene msrB 27314 26847 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_16110 27419 27817 gene locus_tag LOCUS_16120 27419 27817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 27830 28138 gene locus_tag LOCUS_16130 27830 28138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 28683 28204 gene locus_tag LOCUS_16140 28683 28204 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038732.1 protein_id gnl|my_center|LOCUS_16140 28885 30153 gene locus_tag LOCUS_16150 28885 30153 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038731.1 protein_id gnl|my_center|LOCUS_16150 30153 31229 gene locus_tag LOCUS_16160 gene alr 30153 31229 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038730.1 protein_id gnl|my_center|LOCUS_16160 31871 31302 gene locus_tag LOCUS_16170 31871 31302 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921578.1 protein_id gnl|my_center|LOCUS_16170 32050 34068 gene locus_tag LOCUS_16180 32050 34068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506491.1 protein_id gnl|my_center|LOCUS_16180 34145 35200 gene locus_tag LOCUS_16190 34145 35200 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_16190 35197 35904 gene locus_tag LOCUS_16200 35197 35904 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_16200 35901 36608 gene locus_tag LOCUS_16210 35901 36608 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 protein_id gnl|my_center|LOCUS_16210 37250 36702 gene locus_tag LOCUS_16220 37250 36702 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_16220 37850 37365 gene locus_tag LOCUS_16230 37850 37365 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 protein_id gnl|my_center|LOCUS_16230 39011 37911 gene locus_tag LOCUS_16240 39011 37911 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_16240 39147 40004 gene locus_tag LOCUS_16250 39147 40004 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 protein_id gnl|my_center|LOCUS_16250 40119 41126 gene locus_tag LOCUS_16260 40119 41126 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 protein_id gnl|my_center|LOCUS_16260 41123 41812 gene locus_tag LOCUS_16270 41123 41812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217164.1 protein_id gnl|my_center|LOCUS_16270 41925 42725 gene locus_tag LOCUS_16280 41925 42725 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038711.1 protein_id gnl|my_center|LOCUS_16280 42966 43724 gene locus_tag LOCUS_16290 42966 43724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_16290 44465 43815 gene locus_tag LOCUS_16300 44465 43815 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035787.1 protein_id gnl|my_center|LOCUS_16300 44663 45247 gene locus_tag LOCUS_16310 44663 45247 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994201.1 protein_id gnl|my_center|LOCUS_16310 45400 46776 gene locus_tag LOCUS_16320 gene aceF 45400 46776 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16320 46794 48587 gene locus_tag LOCUS_16330 gene lpdA 46794 48587 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_16330 48647 49354 gene locus_tag LOCUS_16340 48647 49354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 50285 49461 gene locus_tag LOCUS_16350 50285 49461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594608.1 protein_id gnl|my_center|LOCUS_16350 50696 51061 gene locus_tag LOCUS_16360 50696 51061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035795.1 protein_id gnl|my_center|LOCUS_16360 51089 51886 gene locus_tag LOCUS_16370 gene atpB 51089 51886 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035796.1 protein_id gnl|my_center|LOCUS_16370 51961 52263 gene locus_tag LOCUS_16380 gene atpE 51961 52263 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814105.1 protein_id gnl|my_center|LOCUS_16380 52375 52845 gene locus_tag LOCUS_16390 52375 52845 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035797.1 protein_id gnl|my_center|LOCUS_16390 52849 53376 gene locus_tag LOCUS_16400 52849 53376 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035798.1 protein_id gnl|my_center|LOCUS_16400 53421 54968 gene locus_tag LOCUS_16410 gene atpA 53421 54968 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035799.1 protein_id gnl|my_center|LOCUS_16410 55047 55910 gene locus_tag LOCUS_16420 gene atpG 55047 55910 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_16420 55948 57354 gene locus_tag LOCUS_16430 gene atpD 55948 57354 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035801.1 protein_id gnl|my_center|LOCUS_16430 57438 57860 gene locus_tag LOCUS_16440 57438 57860 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence019 <1 943 gene locus_tag LOCUS_16450 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039098.1:FAD-dependent oxidoreductase 1057 3246 gene locus_tag LOCUS_16460 gene uvrD 1057 3246 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039097.1 protein_id gnl|my_center|LOCUS_16460 3349 3798 gene locus_tag LOCUS_16470 3349 3798 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039095.1 protein_id gnl|my_center|LOCUS_16470 4305 4018 gene locus_tag LOCUS_16480 4305 4018 CDS product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039092.1 protein_id gnl|my_center|LOCUS_16480 4397 7165 gene locus_tag LOCUS_16490 gene polA 4397 7165 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_16490 7719 8198 gene locus_tag LOCUS_16500 7719 8198 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_16500 9169 8249 gene locus_tag LOCUS_16510 gene hemF 9169 8249 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039090.1 protein_id gnl|my_center|LOCUS_16510 9770 9192 gene locus_tag LOCUS_16520 9770 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 10347 9814 gene locus_tag LOCUS_16530 10347 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 12748 10385 gene locus_tag LOCUS_16540 12748 10385 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 protein_id gnl|my_center|LOCUS_16540 13032 14303 gene locus_tag LOCUS_16550 gene xanA2 13032 14303 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_16550 15986 14976 gene locus_tag LOCUS_16560 15986 14976 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_16560 16187 16456 gene locus_tag LOCUS_16570 gene xanC 16187 16456 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_16570 16462 17184 gene locus_tag LOCUS_16580 16462 17184 CDS product ketosynthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039082.1 protein_id gnl|my_center|LOCUS_16580 17208 17531 gene locus_tag LOCUS_16590 17208 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039080.1 protein_id gnl|my_center|LOCUS_16590 17528 18508 gene locus_tag LOCUS_16600 17528 18508 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_16600 18450 19109 gene locus_tag LOCUS_16610 18450 19109 CDS product fatty acyl CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994205.1 protein_id gnl|my_center|LOCUS_16610 19106 21445 gene locus_tag LOCUS_16620 19106 21445 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_16620 21432 21866 gene locus_tag LOCUS_16630 21432 21866 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_16630 21877 22623 gene locus_tag LOCUS_16640 gene fabG 21877 22623 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_16640 23455 22655 gene locus_tag LOCUS_16650 23455 22655 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039071.1 protein_id gnl|my_center|LOCUS_16650 24236 23448 gene locus_tag LOCUS_16660 24236 23448 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_16660 25453 24242 gene locus_tag LOCUS_16670 25453 24242 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_16670 25677 25952 gene locus_tag LOCUS_16680 25677 25952 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039068.1 protein_id gnl|my_center|LOCUS_16680 25945 29271 gene locus_tag LOCUS_16690 25945 29271 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 protein_id gnl|my_center|LOCUS_16690 31182 29362 gene locus_tag LOCUS_16700 31182 29362 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039063.1 protein_id gnl|my_center|LOCUS_16700 31514 32884 gene locus_tag LOCUS_16710 gene mgtE 31514 32884 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039061.1 protein_id gnl|my_center|LOCUS_16710 33157 35871 gene locus_tag LOCUS_16720 33157 35871 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 protein_id gnl|my_center|LOCUS_16720 35898 36626 gene locus_tag LOCUS_16730 35898 36626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 protein_id gnl|my_center|LOCUS_16730 36939 36586 gene locus_tag LOCUS_16740 36939 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 37976 37020 gene locus_tag LOCUS_16750 37976 37020 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_16750 38078 38947 gene locus_tag LOCUS_16760 38078 38947 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275157.1 protein_id gnl|my_center|LOCUS_16760 39122 39664 gene locus_tag LOCUS_16770 39122 39664 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_16770 40056 39703 gene locus_tag LOCUS_16780 40056 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035529.1 protein_id gnl|my_center|LOCUS_16780 42804 40303 gene locus_tag LOCUS_16790 gene hrpB 42804 40303 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 protein_id gnl|my_center|LOCUS_16790 42882 43694 gene locus_tag LOCUS_16800 42882 43694 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_16800 44605 43691 gene locus_tag LOCUS_16810 44605 43691 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_16810 45540 44602 gene locus_tag LOCUS_16820 gene panE 45540 44602 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039051.1 protein_id gnl|my_center|LOCUS_16820 46375 45581 gene locus_tag LOCUS_16830 46375 45581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994124.1 protein_id gnl|my_center|LOCUS_16830 47325 46372 gene locus_tag LOCUS_16840 47325 46372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039048.1 protein_id gnl|my_center|LOCUS_16840 47464 48174 gene locus_tag LOCUS_16850 47464 48174 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 protein_id gnl|my_center|LOCUS_16850 48259 49419 gene locus_tag LOCUS_16860 48259 49419 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063758.1 protein_id gnl|my_center|LOCUS_16860 49537 49716 gene locus_tag LOCUS_16870 49537 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 49720 50301 gene locus_tag LOCUS_16880 49720 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506192.1 protein_id gnl|my_center|LOCUS_16880 50312 50509 gene locus_tag LOCUS_16890 50312 50509 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006449488.1 protein_id gnl|my_center|LOCUS_16890 50576 52108 gene locus_tag LOCUS_16900 50576 52108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_16900 52140 52895 gene locus_tag LOCUS_16910 52140 52895 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_16910 52892 54085 gene locus_tag LOCUS_16920 52892 54085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence020 34 1245 gene locus_tag LOCUS_16930 34 1245 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036714.1 protein_id gnl|my_center|LOCUS_16930 1768 2787 gene locus_tag LOCUS_16940 gene pstS 1768 2787 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 protein_id gnl|my_center|LOCUS_16940 3077 4162 gene locus_tag LOCUS_16950 gene pstS 3077 4162 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036712.1 protein_id gnl|my_center|LOCUS_16950 4252 5220 gene locus_tag LOCUS_16960 gene pstC 4252 5220 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036711.1 protein_id gnl|my_center|LOCUS_16960 5220 6080 gene locus_tag LOCUS_16970 gene pstA 5220 6080 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036710.1 protein_id gnl|my_center|LOCUS_16970 6115 6945 gene locus_tag LOCUS_16980 gene pstB 6115 6945 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036709.1 protein_id gnl|my_center|LOCUS_16980 7139 7849 gene locus_tag LOCUS_16990 gene phoU 7139 7849 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036708.1 protein_id gnl|my_center|LOCUS_16990 8967 8143 gene locus_tag LOCUS_17000 8967 8143 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013925029.1 protein_id gnl|my_center|LOCUS_17000 10332 8995 gene locus_tag LOCUS_17010 10332 8995 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113059.1 protein_id gnl|my_center|LOCUS_17010 10721 10329 gene locus_tag LOCUS_17020 10721 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 protein_id gnl|my_center|LOCUS_17020 11749 11006 gene locus_tag LOCUS_17030 gene rlmB 11749 11006 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036704.1 protein_id gnl|my_center|LOCUS_17030 11969 12466 gene locus_tag LOCUS_17040 11969 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 14983 12530 gene locus_tag LOCUS_17050 gene rnr 14983 12530 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116922455.1 protein_id gnl|my_center|LOCUS_17050 15098 15182 gene locus_tag LOCUS_t00270 15098 15182 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15440 15524 gene locus_tag LOCUS_t00280 15440 15524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17221 15662 gene locus_tag LOCUS_17060 17221 15662 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036592.1 protein_id gnl|my_center|LOCUS_17060 18405 17233 gene locus_tag LOCUS_17070 18405 17233 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036591.1 protein_id gnl|my_center|LOCUS_17070 19918 18416 gene locus_tag LOCUS_17080 19918 18416 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036590.1 protein_id gnl|my_center|LOCUS_17080 20358 19915 gene locus_tag LOCUS_17090 20358 19915 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036589.1 protein_id gnl|my_center|LOCUS_17090 20561 22804 gene locus_tag LOCUS_17100 gene parC 20561 22804 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036587.1 protein_id gnl|my_center|LOCUS_17100 23036 23287 gene locus_tag LOCUS_17110 23036 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 23298 23957 gene locus_tag LOCUS_17120 23298 23957 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_17120 24522 24034 gene locus_tag LOCUS_17130 gene bfr 24522 24034 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036585.1 protein_id gnl|my_center|LOCUS_17130 24665 27085 gene locus_tag LOCUS_17140 24665 27085 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275396.1 protein_id gnl|my_center|LOCUS_17140 27548 27123 gene locus_tag LOCUS_17150 27548 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 29389 27704 gene locus_tag LOCUS_17160 gene asnB 29389 27704 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 protein_id gnl|my_center|LOCUS_17160 30869 29742 gene locus_tag LOCUS_17170 gene dapE 30869 29742 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941552.1 protein_id gnl|my_center|LOCUS_17170 31239 30883 gene locus_tag LOCUS_17180 31239 30883 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 protein_id gnl|my_center|LOCUS_17180 32329 31286 gene locus_tag LOCUS_17190 gene dapD 32329 31286 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438809.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17190 34977 32329 gene locus_tag LOCUS_17200 34977 32329 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036575.1 protein_id gnl|my_center|LOCUS_17200 35774 34974 gene locus_tag LOCUS_17210 gene map 35774 34974 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 protein_id gnl|my_center|LOCUS_17210 36090 36896 gene locus_tag LOCUS_17220 gene rpsB 36090 36896 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_17220 37028 37909 gene locus_tag LOCUS_17230 gene tsf 37028 37909 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036566.1 protein_id gnl|my_center|LOCUS_17230 38093 39598 gene locus_tag LOCUS_17240 38093 39598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 39708 40436 gene locus_tag LOCUS_17250 gene pyrH 39708 40436 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_17250 40568 41125 gene locus_tag LOCUS_17260 gene frr 40568 41125 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036562.1 protein_id gnl|my_center|LOCUS_17260 41141 41902 gene locus_tag LOCUS_17270 gene uppS 41141 41902 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921694.1 protein_id gnl|my_center|LOCUS_17270 41899 42720 gene locus_tag LOCUS_17280 41899 42720 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_17280 42722 43927 gene locus_tag LOCUS_17290 42722 43927 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_17290 43954 45303 gene locus_tag LOCUS_17300 gene rseP 43954 45303 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036558.1 protein_id gnl|my_center|LOCUS_17300 45375 47840 gene locus_tag LOCUS_17310 gene bamA 45375 47840 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237827.1 protein_id gnl|my_center|LOCUS_17310 48061 49083 gene locus_tag LOCUS_17320 gene lpxD 48061 49083 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036555.1 protein_id gnl|my_center|LOCUS_17320 49080 49538 gene locus_tag LOCUS_17330 gene fabZ 49080 49538 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036554.1 protein_id gnl|my_center|LOCUS_17330 49558 50349 gene locus_tag LOCUS_17340 gene lpxA 49558 50349 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036553.1 protein_id gnl|my_center|LOCUS_17340 50346 51593 gene locus_tag LOCUS_17350 gene lpxB 50346 51593 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629001.1 protein_id gnl|my_center|LOCUS_17350 51590 52231 gene locus_tag LOCUS_17360 51590 52231 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036551.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence021 <1 857 gene locus_tag LOCUS_17370 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037816.1:glutamate--tRNA ligase 874 1362 gene locus_tag LOCUS_17380 874 1362 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_17380 3111 1408 gene locus_tag LOCUS_17390 3111 1408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_17390 4333 3200 gene locus_tag LOCUS_17400 4333 3200 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038583.1 protein_id gnl|my_center|LOCUS_17400 5996 4344 gene locus_tag LOCUS_17410 5996 4344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_17410 6565 5993 gene locus_tag LOCUS_17420 6565 5993 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275439.1 protein_id gnl|my_center|LOCUS_17420 8877 6724 gene locus_tag LOCUS_17430 8877 6724 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_17430 8812 9021 gene locus_tag LOCUS_17440 8812 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 9014 9475 gene locus_tag LOCUS_17450 9014 9475 CDS product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_17450 9584 9766 gene locus_tag LOCUS_17460 9584 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10173 11141 gene locus_tag LOCUS_17470 10173 11141 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390571.1 protein_id gnl|my_center|LOCUS_17470 12592 11339 gene locus_tag LOCUS_17480 12592 11339 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037784.1 protein_id gnl|my_center|LOCUS_17480 13164 12655 gene locus_tag LOCUS_17490 13164 12655 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_17490 14630 13161 gene locus_tag LOCUS_17500 14630 13161 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_17500 14982 14680 gene locus_tag LOCUS_17510 14982 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 14870 15919 gene locus_tag LOCUS_17520 14870 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037781.1 protein_id gnl|my_center|LOCUS_17520 16021 17202 gene locus_tag LOCUS_17530 gene ubiM 16021 17202 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_17530 17431 17219 gene locus_tag LOCUS_17540 17431 17219 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189709.1 protein_id gnl|my_center|LOCUS_17540 17757 19679 gene locus_tag LOCUS_17550 17757 19679 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_17550 19861 21516 gene locus_tag LOCUS_17560 19861 21516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 21524 22246 gene locus_tag LOCUS_17570 21524 22246 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037770.1 protein_id gnl|my_center|LOCUS_17570 22336 23400 gene locus_tag LOCUS_17580 22336 23400 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 protein_id gnl|my_center|LOCUS_17580 24330 23410 gene locus_tag LOCUS_17590 24330 23410 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_17590 25270 24377 gene locus_tag LOCUS_17600 25270 24377 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037768.1 protein_id gnl|my_center|LOCUS_17600 25733 25302 gene locus_tag LOCUS_17610 25733 25302 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 protein_id gnl|my_center|LOCUS_17610 25831 27411 gene locus_tag LOCUS_17620 25831 27411 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_17620 28092 27658 gene locus_tag LOCUS_17630 28092 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 28486 30318 gene locus_tag LOCUS_17640 28486 30318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_17640 30801 30448 gene locus_tag LOCUS_17650 30801 30448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 30985 32211 gene locus_tag LOCUS_17660 30985 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 32271 32969 gene locus_tag LOCUS_17670 32271 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 33057 33710 gene locus_tag LOCUS_17680 33057 33710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098693.1 protein_id gnl|my_center|LOCUS_17680 33703 35526 gene locus_tag LOCUS_17690 33703 35526 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098692.1 protein_id gnl|my_center|LOCUS_17690 36316 35741 gene locus_tag LOCUS_17700 36316 35741 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_17700 36862 36383 gene locus_tag LOCUS_17710 36862 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 37160 36909 gene locus_tag LOCUS_17720 37160 36909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 37517 37179 gene locus_tag LOCUS_17730 37517 37179 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810814.1 protein_id gnl|my_center|LOCUS_17730 38119 37625 gene locus_tag LOCUS_17740 38119 37625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 40073 38271 gene locus_tag LOCUS_17750 40073 38271 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_17750 40180 40536 gene locus_tag LOCUS_17760 40180 40536 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812199.1 protein_id gnl|my_center|LOCUS_17760 41052 40822 gene locus_tag LOCUS_17770 41052 40822 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_17770 41463 41170 gene locus_tag LOCUS_17780 41463 41170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508313.1 protein_id gnl|my_center|LOCUS_17780 41651 42523 gene locus_tag LOCUS_17790 41651 42523 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_17790 43479 42583 gene locus_tag LOCUS_17800 43479 42583 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_17800 43632 43997 gene locus_tag LOCUS_17810 43632 43997 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_17810 45782 44355 gene locus_tag LOCUS_17820 gene hemN 45782 44355 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 protein_id gnl|my_center|LOCUS_17820 46347 45931 gene locus_tag LOCUS_17830 46347 45931 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_17830 46534 46821 gene locus_tag LOCUS_17840 46534 46821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 46818 47930 gene locus_tag LOCUS_17850 46818 47930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 48962 47943 gene locus_tag LOCUS_17860 48962 47943 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_17860 49412 49336 gene locus_tag LOCUS_t00290 49412 49336 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49835 49479 gene locus_tag LOCUS_17870 49835 49479 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_17870 50115 49816 gene locus_tag LOCUS_17880 50115 49816 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811076.1 protein_id gnl|my_center|LOCUS_17880 52520 50139 gene locus_tag LOCUS_17890 gene pheT 52520 50139 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037596.1 protein_id gnl|my_center|LOCUS_17890 <53174 52588 gene locus_tag LOCUS_17900 <53174 52588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037597.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence022 598 1965 gene locus_tag LOCUS_17910 gene glmU 598 1965 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035805.1 protein_id gnl|my_center|LOCUS_17910 3571 2216 gene locus_tag LOCUS_17920 3571 2216 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035808.1 protein_id gnl|my_center|LOCUS_17920 4913 3573 gene locus_tag LOCUS_17930 4913 3573 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 protein_id gnl|my_center|LOCUS_17930 6170 4956 gene locus_tag LOCUS_17940 6170 4956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_17940 7516 6182 gene locus_tag LOCUS_17950 7516 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 7989 7513 gene locus_tag LOCUS_17960 7989 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 9226 8009 gene locus_tag LOCUS_17970 9226 8009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_17970 10718 9405 gene locus_tag LOCUS_17980 10718 9405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_17980 12038 10815 gene locus_tag LOCUS_17990 12038 10815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_17990 13435 12131 gene locus_tag LOCUS_18000 13435 12131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_18000 14679 13456 gene locus_tag LOCUS_18010 14679 13456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_18010 16013 14682 gene locus_tag LOCUS_18020 16013 14682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_18020 16745 16023 gene locus_tag LOCUS_18030 16745 16023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_18030 18165 16897 gene locus_tag LOCUS_18040 18165 16897 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 protein_id gnl|my_center|LOCUS_18040 18383 20215 gene locus_tag LOCUS_18050 gene glmS 18383 20215 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_18050 21473 20277 gene locus_tag LOCUS_18060 gene chrA 21473 20277 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_18060 24038 21720 gene locus_tag LOCUS_18070 24038 21720 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_18070 24368 24742 gene locus_tag LOCUS_18080 24368 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 25002 25922 gene locus_tag LOCUS_18090 25002 25922 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 protein_id gnl|my_center|LOCUS_18090 25982 28597 gene locus_tag LOCUS_18100 25982 28597 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 protein_id gnl|my_center|LOCUS_18100 28699 30207 gene locus_tag LOCUS_18110 28699 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 30204 30830 gene locus_tag LOCUS_18120 30204 30830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 30817 34248 gene locus_tag LOCUS_18130 30817 34248 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084480.1 protein_id gnl|my_center|LOCUS_18130 34854 34339 gene locus_tag LOCUS_18140 gene gloA 34854 34339 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035820.1 protein_id gnl|my_center|LOCUS_18140 35284 35679 gene locus_tag LOCUS_18150 35284 35679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 35774 38482 gene locus_tag LOCUS_18160 35774 38482 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944144.1 protein_id gnl|my_center|LOCUS_18160 38538 39230 gene locus_tag LOCUS_18170 38538 39230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 39227 41047 gene locus_tag LOCUS_18180 39227 41047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 41806 41285 gene locus_tag LOCUS_18190 41806 41285 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 protein_id gnl|my_center|LOCUS_18190 42170 41862 gene locus_tag LOCUS_18200 42170 41862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 43503 42229 gene locus_tag LOCUS_18210 43503 42229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 45275 43500 gene locus_tag LOCUS_18220 45275 43500 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035822.1 protein_id gnl|my_center|LOCUS_18220 45822 45448 gene locus_tag LOCUS_18230 45822 45448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 45945 47066 gene locus_tag LOCUS_18240 45945 47066 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035824.1 protein_id gnl|my_center|LOCUS_18240 47102 49129 gene locus_tag LOCUS_18250 47102 49129 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035825.1 protein_id gnl|my_center|LOCUS_18250 49217 49567 gene locus_tag LOCUS_18260 49217 49567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence023 1260 358 gene locus_tag LOCUS_18270 1260 358 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 protein_id gnl|my_center|LOCUS_18270 1336 2499 gene locus_tag LOCUS_18280 1336 2499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811192.1 protein_id gnl|my_center|LOCUS_18280 2557 3360 gene locus_tag LOCUS_18290 gene dkgB 2557 3360 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112990.1 protein_id gnl|my_center|LOCUS_18290 3814 6537 gene locus_tag LOCUS_18300 3814 6537 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_18300 6937 7248 gene locus_tag LOCUS_18310 gene rpsJ 6937 7248 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036122.1 protein_id gnl|my_center|LOCUS_18310 7260 7910 gene locus_tag LOCUS_18320 gene rplC 7260 7910 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036123.1 protein_id gnl|my_center|LOCUS_18320 7923 8528 gene locus_tag LOCUS_18330 gene rplD 7923 8528 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036124.1 protein_id gnl|my_center|LOCUS_18330 8525 8824 gene locus_tag LOCUS_18340 gene rplW 8525 8824 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811694.1 protein_id gnl|my_center|LOCUS_18340 8835 9662 gene locus_tag LOCUS_18350 gene rplB 8835 9662 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036125.1 protein_id gnl|my_center|LOCUS_18350 9669 9938 gene locus_tag LOCUS_18360 gene rpsS 9669 9938 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 protein_id gnl|my_center|LOCUS_18360 9951 10286 gene locus_tag LOCUS_18370 gene rplV 9951 10286 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_18370 10289 11023 gene locus_tag LOCUS_18380 gene rpsC 10289 11023 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_18380 11029 11442 gene locus_tag LOCUS_18390 gene rplP 11029 11442 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036127.1 protein_id gnl|my_center|LOCUS_18390 11442 11627 gene locus_tag LOCUS_18400 gene rpmC 11442 11627 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036128.1 protein_id gnl|my_center|LOCUS_18400 11639 11908 gene locus_tag LOCUS_18410 gene rpsQ 11639 11908 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_18410 11921 12289 gene locus_tag LOCUS_18420 gene rplN 11921 12289 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_18420 12306 12623 gene locus_tag LOCUS_18430 gene rplX 12306 12623 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_18430 12635 13177 gene locus_tag LOCUS_18440 gene rplE 12635 13177 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 protein_id gnl|my_center|LOCUS_18440 13196 13501 gene locus_tag LOCUS_18450 gene rpsN 13196 13501 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917137.1 protein_id gnl|my_center|LOCUS_18450 13718 14116 gene locus_tag LOCUS_18460 gene rpsH 13718 14116 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371096.1 protein_id gnl|my_center|LOCUS_18460 14134 14661 gene locus_tag LOCUS_18470 gene rplF 14134 14661 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036130.1 protein_id gnl|my_center|LOCUS_18470 14695 15048 gene locus_tag LOCUS_18480 gene rplR 14695 15048 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993383.1 protein_id gnl|my_center|LOCUS_18480 15209 15751 gene locus_tag LOCUS_18490 gene rpsE 15209 15751 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 protein_id gnl|my_center|LOCUS_18490 15744 15935 gene locus_tag LOCUS_18500 gene rpmD 15744 15935 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450646.1 protein_id gnl|my_center|LOCUS_18500 15942 16385 gene locus_tag LOCUS_18510 gene rplO 15942 16385 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439114.1 protein_id gnl|my_center|LOCUS_18510 16393 17748 gene locus_tag LOCUS_18520 gene secY 16393 17748 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036132.1 protein_id gnl|my_center|LOCUS_18520 18097 18453 gene locus_tag LOCUS_18530 gene rpsM 18097 18453 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036133.1 protein_id gnl|my_center|LOCUS_18530 18466 18858 gene locus_tag LOCUS_18540 gene rpsK 18466 18858 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_18540 18873 19502 gene locus_tag LOCUS_18550 gene rpsD 18873 19502 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811641.1 protein_id gnl|my_center|LOCUS_18550 19558 20556 gene locus_tag LOCUS_18560 gene rpoA 19558 20556 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811635.1 protein_id gnl|my_center|LOCUS_18560 20749 21135 gene locus_tag LOCUS_18570 gene rplQ 20749 21135 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_18570 21400 21915 gene locus_tag LOCUS_18580 21400 21915 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_18580 21965 23350 gene locus_tag LOCUS_18590 21965 23350 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_18590 23518 24630 gene locus_tag LOCUS_18600 23518 24630 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_18600 26202 24655 gene locus_tag LOCUS_18610 26202 24655 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_18610 26850 26368 gene locus_tag LOCUS_18620 26850 26368 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104616959.1 protein_id gnl|my_center|LOCUS_18620 28685 26856 gene locus_tag LOCUS_18630 gene typA 28685 26856 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036140.1 protein_id gnl|my_center|LOCUS_18630 28894 29388 gene locus_tag LOCUS_18640 28894 29388 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_18640 29512 30495 gene locus_tag LOCUS_18650 29512 30495 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036142.1 protein_id gnl|my_center|LOCUS_18650 30625 31239 gene locus_tag LOCUS_18660 30625 31239 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_18660 31383 33263 gene locus_tag LOCUS_18670 gene prpE 31383 33263 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010288.1 protein_id gnl|my_center|LOCUS_18670 33385 33864 gene locus_tag LOCUS_18680 33385 33864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 33968 35029 gene locus_tag LOCUS_18690 33968 35029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 36550 35054 gene locus_tag LOCUS_18700 36550 35054 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_18700 37263 36547 gene locus_tag LOCUS_18710 37263 36547 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_18710 37408 37911 gene locus_tag LOCUS_18720 37408 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 37948 39696 gene locus_tag LOCUS_18730 37948 39696 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 protein_id gnl|my_center|LOCUS_18730 39735 40454 gene locus_tag LOCUS_18740 gene msrA 39735 40454 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 protein_id gnl|my_center|LOCUS_18740 41161 40544 gene locus_tag LOCUS_18750 41161 40544 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036143.1 protein_id gnl|my_center|LOCUS_18750 41702 41244 gene locus_tag LOCUS_18760 41702 41244 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506828.1 protein_id gnl|my_center|LOCUS_18760 44322 42292 gene locus_tag LOCUS_18770 44322 42292 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 protein_id gnl|my_center|LOCUS_18770 44334 44582 gene locus_tag LOCUS_18780 44334 44582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 45731 44706 gene locus_tag LOCUS_18790 45731 44706 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_18790 46116 47225 gene locus_tag LOCUS_18800 46116 47225 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_18800 47414 47902 gene locus_tag LOCUS_18810 47414 47902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036150.1 protein_id gnl|my_center|LOCUS_18810 47973 48755 gene locus_tag LOCUS_18820 47973 48755 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036151.1 protein_id gnl|my_center|LOCUS_18820 48844 49155 gene locus_tag LOCUS_18830 48844 49155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence024 623 102 gene locus_tag LOCUS_18840 623 102 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_18840 614 1645 gene locus_tag LOCUS_18850 gene xerD 614 1645 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035895.1 protein_id gnl|my_center|LOCUS_18850 2406 3185 gene locus_tag LOCUS_18860 2406 3185 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_18860 3209 3712 gene locus_tag LOCUS_18870 3209 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3818 7771 gene locus_tag LOCUS_18880 gene purL 3818 7771 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035897.1 protein_id gnl|my_center|LOCUS_18880 8035 8904 gene locus_tag LOCUS_18890 8035 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035911.1 protein_id gnl|my_center|LOCUS_18890 8901 9737 gene locus_tag LOCUS_18900 8901 9737 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 protein_id gnl|my_center|LOCUS_18900 10010 10465 gene locus_tag LOCUS_18910 10010 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10488 10793 gene locus_tag LOCUS_18920 10488 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 10882 13032 gene locus_tag LOCUS_18930 gene bcsA 10882 13032 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 protein_id gnl|my_center|LOCUS_18930 13029 15347 gene locus_tag LOCUS_18940 gene bcsB 13029 15347 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770921.1 protein_id gnl|my_center|LOCUS_18940 15350 16516 gene locus_tag LOCUS_18950 gene bcsZ 15350 16516 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770923.1 protein_id gnl|my_center|LOCUS_18950 16498 20913 gene locus_tag LOCUS_18960 16498 20913 CDS product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994102.1 protein_id gnl|my_center|LOCUS_18960 21019 22197 gene locus_tag LOCUS_18970 gene pncB 21019 22197 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035921.1 protein_id gnl|my_center|LOCUS_18970 22395 23912 gene locus_tag LOCUS_18980 gene bcsE 22395 23912 CDS product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 protein_id gnl|my_center|LOCUS_18980 23909 24091 gene locus_tag LOCUS_18990 23909 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 24088 25734 gene locus_tag LOCUS_19000 gene bcsG 24088 25734 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 protein_id gnl|my_center|LOCUS_19000 25731 25910 gene locus_tag LOCUS_19010 25731 25910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 25907 26662 gene locus_tag LOCUS_19020 gene bcsQ 25907 26662 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_19020 26674 29292 gene locus_tag LOCUS_19030 gene bcsA 26674 29292 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817395.1 protein_id gnl|my_center|LOCUS_19030 29289 31643 gene locus_tag LOCUS_19040 gene bcsB 29289 31643 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 protein_id gnl|my_center|LOCUS_19040 31640 35209 gene locus_tag LOCUS_19050 gene bcsC 31640 35209 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 protein_id gnl|my_center|LOCUS_19050 35193 36326 gene locus_tag LOCUS_19060 35193 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 36393 37184 gene locus_tag LOCUS_19070 36393 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 38540 37224 gene locus_tag LOCUS_19080 38540 37224 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035550.1 protein_id gnl|my_center|LOCUS_19080 40407 38743 gene locus_tag LOCUS_19090 gene ettA 40407 38743 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035928.1 protein_id gnl|my_center|LOCUS_19090 40654 41097 gene locus_tag LOCUS_19100 40654 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 41234 42487 gene locus_tag LOCUS_19110 41234 42487 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 protein_id gnl|my_center|LOCUS_19110 42564 43082 gene locus_tag LOCUS_19120 42564 43082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 43155 43682 gene locus_tag LOCUS_19130 gene nrdR 43155 43682 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997276.1 protein_id gnl|my_center|LOCUS_19130 43688 44197 gene locus_tag LOCUS_19140 43688 44197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597552.1 protein_id gnl|my_center|LOCUS_19140 44190 45284 gene locus_tag LOCUS_19150 gene ribD 44190 45284 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_19150 46021 45293 gene locus_tag LOCUS_19160 46021 45293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 46057 46689 gene locus_tag LOCUS_19170 46057 46689 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_19170 46686 47786 gene locus_tag LOCUS_19180 gene ribB 46686 47786 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 protein_id gnl|my_center|LOCUS_19180 47887 48354 gene locus_tag LOCUS_19190 gene ribH 47887 48354 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035936.1 protein_id gnl|my_center|LOCUS_19190 48351 48830 gene locus_tag LOCUS_19200 gene nusB 48351 48830 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence025 <1 2354 gene locus_tag LOCUS_19210 <1 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037143.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 2460 3668 gene locus_tag LOCUS_19220 2460 3668 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_19220 5013 4222 gene locus_tag LOCUS_19230 gene galU 5013 4222 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037334.1 protein_id gnl|my_center|LOCUS_19230 7010 5097 gene locus_tag LOCUS_19240 7010 5097 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275356.1 protein_id gnl|my_center|LOCUS_19240 8003 7014 gene locus_tag LOCUS_19250 8003 7014 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275529.1 protein_id gnl|my_center|LOCUS_19250 9185 8007 gene locus_tag LOCUS_19260 gene lapB 9185 8007 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 protein_id gnl|my_center|LOCUS_19260 9476 9192 gene locus_tag LOCUS_19270 9476 9192 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037338.1 protein_id gnl|my_center|LOCUS_19270 9857 9552 gene locus_tag LOCUS_19280 9857 9552 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_19280 11630 9945 gene locus_tag LOCUS_19290 gene rpsA 11630 9945 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037340.1 protein_id gnl|my_center|LOCUS_19290 12534 11824 gene locus_tag LOCUS_19300 gene cmk 12534 11824 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037341.1 protein_id gnl|my_center|LOCUS_19300 13052 13384 gene locus_tag LOCUS_19310 13052 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 protein_id gnl|my_center|LOCUS_19310 13509 14543 gene locus_tag LOCUS_19320 13509 14543 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275355.1 protein_id gnl|my_center|LOCUS_19320 14671 15555 gene locus_tag LOCUS_19330 14671 15555 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_19330 15571 16101 gene locus_tag LOCUS_19340 15571 16101 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037345.1 protein_id gnl|my_center|LOCUS_19340 16106 17323 gene locus_tag LOCUS_19350 16106 17323 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_19350 17756 17346 gene locus_tag LOCUS_19360 17756 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 18481 17768 gene locus_tag LOCUS_19370 18481 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21611 18534 gene locus_tag LOCUS_19380 21611 18534 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_19380 25108 21617 gene locus_tag LOCUS_19390 25108 21617 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_19390 26244 25105 gene locus_tag LOCUS_19400 26244 25105 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_19400 26450 26842 gene locus_tag LOCUS_19410 26450 26842 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037295.1 protein_id gnl|my_center|LOCUS_19410 26852 27313 gene locus_tag LOCUS_19420 26852 27313 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877747.1 protein_id gnl|my_center|LOCUS_19420 29406 27655 gene locus_tag LOCUS_19430 29406 27655 CDS product transmembrane repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275360.1 protein_id gnl|my_center|LOCUS_19430 30024 29425 gene locus_tag LOCUS_19440 30024 29425 CDS product NfuA family Fe-S biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037235.1 protein_id gnl|my_center|LOCUS_19440 30113 30457 gene locus_tag LOCUS_19450 30113 30457 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_19450 30459 30872 gene locus_tag LOCUS_19460 30459 30872 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037237.1 protein_id gnl|my_center|LOCUS_19460 31909 30974 gene locus_tag LOCUS_19470 31909 30974 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037239.1 protein_id gnl|my_center|LOCUS_19470 32334 35504 gene locus_tag LOCUS_19480 32334 35504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 36228 35581 gene locus_tag LOCUS_19490 36228 35581 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 protein_id gnl|my_center|LOCUS_19490 37195 36497 gene locus_tag LOCUS_19500 37195 36497 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_19500 38450 37176 gene locus_tag LOCUS_19510 gene ispG 38450 37176 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036954.1 protein_id gnl|my_center|LOCUS_19510 38524 39759 gene locus_tag LOCUS_19520 38524 39759 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507542.1 protein_id gnl|my_center|LOCUS_19520 39756 40319 gene locus_tag LOCUS_19530 39756 40319 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036952.1 protein_id gnl|my_center|LOCUS_19530 41120 40353 gene locus_tag LOCUS_19540 41120 40353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 protein_id gnl|my_center|LOCUS_19540 43857 41266 gene locus_tag LOCUS_19550 gene acnB 43857 41266 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037033.1 protein_id gnl|my_center|LOCUS_19550 44300 43899 gene locus_tag LOCUS_19560 44300 43899 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_19560 44539 44297 gene locus_tag LOCUS_19570 44539 44297 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037031.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence026 1 1515 gene locus_tag LOCUS_19580 1 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2214 1549 gene locus_tag LOCUS_19590 2214 1549 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_19590 3132 2335 gene locus_tag LOCUS_19600 gene bdhA 3132 2335 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_19600 3345 5078 gene locus_tag LOCUS_19610 3345 5078 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186332.1 protein_id gnl|my_center|LOCUS_19610 5192 5791 gene locus_tag LOCUS_19620 5192 5791 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216841.1 protein_id gnl|my_center|LOCUS_19620 5866 6252 gene locus_tag LOCUS_19630 5866 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 8302 6695 gene locus_tag LOCUS_19640 8302 6695 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037907.1 protein_id gnl|my_center|LOCUS_19640 9267 8299 gene locus_tag LOCUS_19650 9267 8299 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_19650 10256 9402 gene locus_tag LOCUS_19660 10256 9402 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_19660 10799 10281 gene locus_tag LOCUS_19670 10799 10281 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 protein_id gnl|my_center|LOCUS_19670 11530 10826 gene locus_tag LOCUS_19680 11530 10826 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_19680 14017 11591 gene locus_tag LOCUS_19690 14017 11591 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127697866.1 protein_id gnl|my_center|LOCUS_19690 14546 14133 gene locus_tag LOCUS_19700 14546 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 15367 14690 gene locus_tag LOCUS_19710 15367 14690 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 protein_id gnl|my_center|LOCUS_19710 16104 15379 gene locus_tag LOCUS_19720 16104 15379 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037902.1 protein_id gnl|my_center|LOCUS_19720 18484 16202 gene locus_tag LOCUS_19730 18484 16202 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207070.1 protein_id gnl|my_center|LOCUS_19730 19054 18620 gene locus_tag LOCUS_19740 19054 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 19463 19131 gene locus_tag LOCUS_19750 19463 19131 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_19750 20092 19460 gene locus_tag LOCUS_19760 20092 19460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_19760 21351 20095 gene locus_tag LOCUS_19770 21351 20095 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037897.1 protein_id gnl|my_center|LOCUS_19770 22655 21348 gene locus_tag LOCUS_19780 gene sufD 22655 21348 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 protein_id gnl|my_center|LOCUS_19780 23419 22655 gene locus_tag LOCUS_19790 gene sufC 23419 22655 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_19790 23869 23459 gene locus_tag LOCUS_19800 23869 23459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 25341 23866 gene locus_tag LOCUS_19810 gene sufB 25341 23866 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037894.1 protein_id gnl|my_center|LOCUS_19810 25805 25359 gene locus_tag LOCUS_19820 25805 25359 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_19820 25977 26450 gene locus_tag LOCUS_19830 25977 26450 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_19830 27235 26648 gene locus_tag LOCUS_19840 27235 26648 CDS product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037890.1 protein_id gnl|my_center|LOCUS_19840 27634 27329 gene locus_tag LOCUS_19850 27634 27329 CDS product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508439.1 protein_id gnl|my_center|LOCUS_19850 28587 28120 gene locus_tag LOCUS_19860 28587 28120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 28846 29280 gene locus_tag LOCUS_19870 28846 29280 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037875.1 protein_id gnl|my_center|LOCUS_19870 29385 30074 gene locus_tag LOCUS_19880 29385 30074 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437811.1 protein_id gnl|my_center|LOCUS_19880 30368 30117 gene locus_tag LOCUS_19890 30368 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 30249 31865 gene locus_tag LOCUS_19900 30249 31865 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_19900 32349 35066 gene locus_tag LOCUS_19910 32349 35066 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_19910 35099 37045 gene locus_tag LOCUS_19920 35099 37045 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_19920 37975 37085 gene locus_tag LOCUS_19930 37975 37085 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_19930 38919 37972 gene locus_tag LOCUS_19940 gene gshB 38919 37972 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038049.1 protein_id gnl|my_center|LOCUS_19940 39218 39571 gene locus_tag LOCUS_19950 gene pilG 39218 39571 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_19950 39588 39950 gene locus_tag LOCUS_19960 39588 39950 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038047.1 protein_id gnl|my_center|LOCUS_19960 39950 40480 gene locus_tag LOCUS_19970 39950 40480 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508568.1 protein_id gnl|my_center|LOCUS_19970 40522 42558 gene locus_tag LOCUS_19980 40522 42558 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038045.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence027 622 119 gene locus_tag LOCUS_19990 622 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 1159 1713 gene locus_tag LOCUS_20000 1159 1713 CDS product DUF3228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056523.1 protein_id gnl|my_center|LOCUS_20000 2184 1720 gene locus_tag LOCUS_20010 2184 1720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705323.1 protein_id gnl|my_center|LOCUS_20010 3117 2290 gene locus_tag LOCUS_20020 3117 2290 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_20020 3268 3963 gene locus_tag LOCUS_20030 3268 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5485 4040 gene locus_tag LOCUS_20040 gene ahcY 5485 4040 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_20040 5736 8234 gene locus_tag LOCUS_20050 5736 8234 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_20050 8732 11443 gene locus_tag LOCUS_20060 gene ppc 8732 11443 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035990.1 protein_id gnl|my_center|LOCUS_20060 11476 14412 gene locus_tag LOCUS_20070 11476 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14956 14483 gene locus_tag LOCUS_20080 14956 14483 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316052.1 protein_id gnl|my_center|LOCUS_20080 16396 15119 gene locus_tag LOCUS_20090 gene metK 16396 15119 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035997.1 protein_id gnl|my_center|LOCUS_20090 16576 18288 gene locus_tag LOCUS_20100 16576 18288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 protein_id gnl|my_center|LOCUS_20100 18285 19190 gene locus_tag LOCUS_20110 18285 19190 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090885.1 protein_id gnl|my_center|LOCUS_20110 19263 20654 gene locus_tag LOCUS_20120 19263 20654 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 protein_id gnl|my_center|LOCUS_20120 20651 21661 gene locus_tag LOCUS_20130 20651 21661 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087251.1 protein_id gnl|my_center|LOCUS_20130 21646 22824 gene locus_tag LOCUS_20140 21646 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 22821 23945 gene locus_tag LOCUS_20150 22821 23945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_20150 24036 25097 gene locus_tag LOCUS_20160 24036 25097 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_20160 25244 25843 gene locus_tag LOCUS_20170 25244 25843 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355475.1 protein_id gnl|my_center|LOCUS_20170 26145 25804 gene locus_tag LOCUS_20180 26145 25804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 27175 26162 gene locus_tag LOCUS_20190 gene dusB 27175 26162 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_20190 28268 27315 gene locus_tag LOCUS_20200 28268 27315 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036000.1 protein_id gnl|my_center|LOCUS_20200 29623 28325 gene locus_tag LOCUS_20210 29623 28325 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_20210 29824 30795 gene locus_tag LOCUS_20220 29824 30795 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_20220 30934 31131 gene locus_tag LOCUS_20230 30934 31131 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666304.1 protein_id gnl|my_center|LOCUS_20230 31275 33464 gene locus_tag LOCUS_20240 31275 33464 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_20240 33512 34483 gene locus_tag LOCUS_20250 33512 34483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 protein_id gnl|my_center|LOCUS_20250 34886 34533 gene locus_tag LOCUS_20260 34886 34533 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_20260 35026 35739 gene locus_tag LOCUS_20270 35026 35739 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 protein_id gnl|my_center|LOCUS_20270 35841 37160 gene locus_tag LOCUS_20280 35841 37160 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_20280 37175 37366 gene locus_tag LOCUS_20290 37175 37366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 37371 37739 gene locus_tag LOCUS_20300 37371 37739 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 protein_id gnl|my_center|LOCUS_20300 37788 38537 gene locus_tag LOCUS_20310 37788 38537 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 protein_id gnl|my_center|LOCUS_20310 38542 39306 gene locus_tag LOCUS_20320 38542 39306 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 protein_id gnl|my_center|LOCUS_20320 39311 40192 gene locus_tag LOCUS_20330 39311 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 40192 40683 gene locus_tag LOCUS_20340 40192 40683 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275436.1 protein_id gnl|my_center|LOCUS_20340 40748 41653 gene locus_tag LOCUS_20350 gene lgt 40748 41653 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 protein_id gnl|my_center|LOCUS_20350 41728 42522 gene locus_tag LOCUS_20360 41728 42522 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036023.1 protein_id gnl|my_center|LOCUS_20360 42522 43019 gene locus_tag LOCUS_20370 42522 43019 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036024.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence028 397 501 gene locus_tag LOCUS_r00010 397 501 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 974 621 gene locus_tag LOCUS_20380 974 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2535 1327 gene locus_tag LOCUS_20390 gene fabB 2535 1327 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035826.1 protein_id gnl|my_center|LOCUS_20390 3050 2535 gene locus_tag LOCUS_20400 gene fabA 3050 2535 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035827.1 protein_id gnl|my_center|LOCUS_20400 3250 4326 gene locus_tag LOCUS_20410 gene dinB 3250 4326 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035828.1 protein_id gnl|my_center|LOCUS_20410 4379 5026 gene locus_tag LOCUS_20420 4379 5026 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_20420 7044 5188 gene locus_tag LOCUS_20430 gene btuB 7044 5188 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_20430 7533 8603 gene locus_tag LOCUS_20440 gene cobT 7533 8603 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086060.1 protein_id gnl|my_center|LOCUS_20440 8600 9184 gene locus_tag LOCUS_20450 8600 9184 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_20450 9181 9924 gene locus_tag LOCUS_20460 9181 9924 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038172.1 protein_id gnl|my_center|LOCUS_20460 10317 9943 gene locus_tag LOCUS_20470 10317 9943 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035830.1 protein_id gnl|my_center|LOCUS_20470 10796 10314 gene locus_tag LOCUS_20480 10796 10314 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945126.1 protein_id gnl|my_center|LOCUS_20480 11367 10966 gene locus_tag LOCUS_20490 11367 10966 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035833.1 protein_id gnl|my_center|LOCUS_20490 11783 11427 gene locus_tag LOCUS_20500 gene queD 11783 11427 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_20500 11959 14592 gene locus_tag LOCUS_20510 11959 14592 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_20510 14711 17275 gene locus_tag LOCUS_20520 14711 17275 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_20520 18764 17370 gene locus_tag LOCUS_20530 18764 17370 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 protein_id gnl|my_center|LOCUS_20530 19244 20233 gene locus_tag LOCUS_20540 19244 20233 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_20540 20377 21033 gene locus_tag LOCUS_20550 gene maiA 20377 21033 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035836.1 protein_id gnl|my_center|LOCUS_20550 22245 21115 gene locus_tag LOCUS_20560 22245 21115 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 protein_id gnl|my_center|LOCUS_20560 22414 22725 gene locus_tag LOCUS_20570 22414 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 22806 23606 gene locus_tag LOCUS_20580 22806 23606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035839.1 protein_id gnl|my_center|LOCUS_20580 24000 24218 gene locus_tag LOCUS_20590 24000 24218 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237985.1 protein_id gnl|my_center|LOCUS_20590 24405 25775 gene locus_tag LOCUS_20600 24405 25775 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_20600 25846 27033 gene locus_tag LOCUS_20610 25846 27033 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_20610 27026 27937 gene locus_tag LOCUS_20620 gene rmd 27026 27937 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_20620 27934 28920 gene locus_tag LOCUS_20630 gene gmd 27934 28920 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096890.1 protein_id gnl|my_center|LOCUS_20630 30294 29131 gene locus_tag LOCUS_20640 30294 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 34663 30299 gene locus_tag LOCUS_20650 34663 30299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 36021 34660 gene locus_tag LOCUS_20660 36021 34660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_20660 36679 36011 gene locus_tag LOCUS_20670 36679 36011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_20670 36964 37842 gene locus_tag LOCUS_20680 36964 37842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 37902 38792 gene locus_tag LOCUS_20690 37902 38792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 38833 39360 gene locus_tag LOCUS_20700 38833 39360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 39444 41207 gene locus_tag LOCUS_20710 39444 41207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 41314 42309 gene locus_tag LOCUS_20720 41314 42309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence029 1070 1714 gene locus_tag LOCUS_20730 1070 1714 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 protein_id gnl|my_center|LOCUS_20730 1714 2487 gene locus_tag LOCUS_20740 1714 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2583 3869 gene locus_tag LOCUS_20750 gene folC 2583 3869 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_20750 3998 5020 gene locus_tag LOCUS_20760 3998 5020 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036165.1 protein_id gnl|my_center|LOCUS_20760 5057 5788 gene locus_tag LOCUS_20770 5057 5788 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036166.1 protein_id gnl|my_center|LOCUS_20770 5820 7286 gene locus_tag LOCUS_20780 gene purF 5820 7286 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036167.1 protein_id gnl|my_center|LOCUS_20780 7290 8132 gene locus_tag LOCUS_20790 7290 8132 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_20790 8233 8679 gene locus_tag LOCUS_20800 8233 8679 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921454.1 protein_id gnl|my_center|LOCUS_20800 9527 8784 gene locus_tag LOCUS_20810 gene lpxH 9527 8784 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_20810 10167 9628 gene locus_tag LOCUS_20820 10167 9628 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_20820 11284 10148 gene locus_tag LOCUS_20830 11284 10148 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_20830 12983 11457 gene locus_tag LOCUS_20840 gene ppx 12983 11457 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 protein_id gnl|my_center|LOCUS_20840 15228 13141 gene locus_tag LOCUS_20850 gene ppk1 15228 13141 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_20850 16538 15225 gene locus_tag LOCUS_20860 gene phoR 16538 15225 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506859.1 protein_id gnl|my_center|LOCUS_20860 17339 16650 gene locus_tag LOCUS_20870 gene phoB 17339 16650 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_20870 19076 17427 gene locus_tag LOCUS_20880 19076 17427 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036178.1 protein_id gnl|my_center|LOCUS_20880 19228 19503 gene locus_tag LOCUS_20890 gene grxC 19228 19503 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506861.1 protein_id gnl|my_center|LOCUS_20890 19500 19889 gene locus_tag LOCUS_20900 19500 19889 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_20900 20020 21024 gene locus_tag LOCUS_20910 20020 21024 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_20910 21851 21174 gene locus_tag LOCUS_20920 21851 21174 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_20920 22070 22146 gene locus_tag LOCUS_t00300 22070 22146 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22191 22267 gene locus_tag LOCUS_t00310 22191 22267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22301 22377 gene locus_tag LOCUS_t00320 22301 22377 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22459 22534 gene locus_tag LOCUS_t00330 22459 22534 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22646 22721 gene locus_tag LOCUS_t00340 22646 22721 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22907 22991 gene locus_tag LOCUS_t00350 22907 22991 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23160 24455 gene locus_tag LOCUS_20930 gene tig 23160 24455 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036183.1 protein_id gnl|my_center|LOCUS_20930 24528 25154 gene locus_tag LOCUS_20940 gene clpP 24528 25154 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_20940 25282 26562 gene locus_tag LOCUS_20950 gene clpX 25282 26562 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 protein_id gnl|my_center|LOCUS_20950 26708 29164 gene locus_tag LOCUS_20960 gene lon 26708 29164 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 protein_id gnl|my_center|LOCUS_20960 29370 29642 gene locus_tag LOCUS_20970 29370 29642 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_20970 29655 29729 gene locus_tag LOCUS_t00360 29655 29729 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29761 29837 gene locus_tag LOCUS_t00370 29761 29837 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29921 29997 gene locus_tag LOCUS_t00380 29921 29997 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30066 30142 gene locus_tag LOCUS_t00390 30066 30142 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30331 32301 gene locus_tag LOCUS_20980 30331 32301 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 protein_id gnl|my_center|LOCUS_20980 33623 32412 gene locus_tag LOCUS_20990 33623 32412 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036189.1 protein_id gnl|my_center|LOCUS_20990 34384 33620 gene locus_tag LOCUS_21000 gene gloB 34384 33620 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036190.1 protein_id gnl|my_center|LOCUS_21000 34465 35049 gene locus_tag LOCUS_21010 34465 35049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036191.1 protein_id gnl|my_center|LOCUS_21010 35071 35523 gene locus_tag LOCUS_21020 gene rnhA 35071 35523 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_21020 35532 36257 gene locus_tag LOCUS_21030 gene dnaQ 35532 36257 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 protein_id gnl|my_center|LOCUS_21030 36999 36295 gene locus_tag LOCUS_21040 36999 36295 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_21040 37208 37298 gene locus_tag LOCUS_t00400 37208 37298 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 38876 37830 gene locus_tag LOCUS_21050 38876 37830 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_21050 38899 39648 gene locus_tag LOCUS_21060 38899 39648 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036197.1 protein_id gnl|my_center|LOCUS_21060 39648 40412 gene locus_tag LOCUS_21070 39648 40412 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_21070 40950 41213 gene locus_tag LOCUS_21080 40950 41213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 41638 41210 gene locus_tag LOCUS_21090 41638 41210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence030 1254 3377 gene locus_tag LOCUS_21100 1254 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3374 4276 gene locus_tag LOCUS_21110 3374 4276 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_21110 4278 5870 gene locus_tag LOCUS_21120 4278 5870 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037552.1 protein_id gnl|my_center|LOCUS_21120 5867 7072 gene locus_tag LOCUS_21130 5867 7072 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_21130 7194 9527 gene locus_tag LOCUS_21140 7194 9527 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054847.1 protein_id gnl|my_center|LOCUS_21140 12831 10048 gene locus_tag LOCUS_21150 12831 10048 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895598.1 protein_id gnl|my_center|LOCUS_21150 13924 13088 gene locus_tag LOCUS_21160 13924 13088 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_21160 14888 13932 gene locus_tag LOCUS_21170 14888 13932 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036066.1 protein_id gnl|my_center|LOCUS_21170 16095 14902 gene locus_tag LOCUS_21180 16095 14902 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_21180 18063 16210 gene locus_tag LOCUS_21190 18063 16210 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_21190 20249 18060 gene locus_tag LOCUS_21200 20249 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 21220 20279 gene locus_tag LOCUS_21210 21220 20279 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889314.1 protein_id gnl|my_center|LOCUS_21210 22500 21217 gene locus_tag LOCUS_21220 22500 21217 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_21220 24914 22722 gene locus_tag LOCUS_21230 24914 22722 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_21230 26066 25185 gene locus_tag LOCUS_21240 26066 25185 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562743.1 protein_id gnl|my_center|LOCUS_21240 28512 26152 gene locus_tag LOCUS_21250 28512 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 29458 28595 gene locus_tag LOCUS_21260 29458 28595 CDS product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336971.1 protein_id gnl|my_center|LOCUS_21260 29602 30372 gene locus_tag LOCUS_21270 gene xth 29602 30372 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_21270 30714 30460 gene locus_tag LOCUS_21280 30714 30460 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_21280 30790 31398 gene locus_tag LOCUS_21290 30790 31398 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057213.1 protein_id gnl|my_center|LOCUS_21290 31504 32163 gene locus_tag LOCUS_21300 gene rsmG 31504 32163 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 protein_id gnl|my_center|LOCUS_21300 32959 32378 gene locus_tag LOCUS_21310 32959 32378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 33572 34369 gene locus_tag LOCUS_21320 33572 34369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_21320 34369 35283 gene locus_tag LOCUS_21330 34369 35283 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_21330 35318 35620 gene locus_tag LOCUS_21340 35318 35620 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038926.1 protein_id gnl|my_center|LOCUS_21340 35828 36793 gene locus_tag LOCUS_21350 35828 36793 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038928.1 protein_id gnl|my_center|LOCUS_21350 36864 37586 gene locus_tag LOCUS_21360 36864 37586 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_21360 37589 37921 gene locus_tag LOCUS_21370 37589 37921 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_21370 38006 39853 gene locus_tag LOCUS_21380 38006 39853 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_21380 40315 40863 gene locus_tag LOCUS_21390 40315 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence031 1048 35 gene locus_tag LOCUS_21400 1048 35 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_21400 1236 2471 gene locus_tag LOCUS_21410 1236 2471 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_21410 3815 2553 gene locus_tag LOCUS_21420 3815 2553 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035355.1 protein_id gnl|my_center|LOCUS_21420 3950 6046 gene locus_tag LOCUS_21430 3950 6046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275121.1 protein_id gnl|my_center|LOCUS_21430 7141 6113 gene locus_tag LOCUS_21440 gene adhP 7141 6113 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_21440 7892 7254 gene locus_tag LOCUS_21450 gene eda 7892 7254 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_21450 8901 7879 gene locus_tag LOCUS_21460 8901 7879 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 protein_id gnl|my_center|LOCUS_21460 9174 11924 gene locus_tag LOCUS_21470 9174 11924 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_21470 12060 15866 gene locus_tag LOCUS_21480 12060 15866 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210762640.1 protein_id gnl|my_center|LOCUS_21480 17007 16411 gene locus_tag LOCUS_21490 17007 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 18692 17076 gene locus_tag LOCUS_21500 18692 17076 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275127.1 protein_id gnl|my_center|LOCUS_21500 19657 18689 gene locus_tag LOCUS_21510 19657 18689 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_21510 19817 20641 gene locus_tag LOCUS_21520 19817 20641 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035403.1 protein_id gnl|my_center|LOCUS_21520 20678 21682 gene locus_tag LOCUS_21530 20678 21682 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035404.1 protein_id gnl|my_center|LOCUS_21530 21695 22213 gene locus_tag LOCUS_21540 21695 22213 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275128.1 protein_id gnl|my_center|LOCUS_21540 22217 23500 gene locus_tag LOCUS_21550 22217 23500 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989684.1 protein_id gnl|my_center|LOCUS_21550 23689 24762 gene locus_tag LOCUS_21560 23689 24762 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509500.1 protein_id gnl|my_center|LOCUS_21560 24759 25721 gene locus_tag LOCUS_21570 gene kduD 24759 25721 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 protein_id gnl|my_center|LOCUS_21570 25791 26429 gene locus_tag LOCUS_21580 25791 26429 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035410.1 protein_id gnl|my_center|LOCUS_21580 26559 27158 gene locus_tag LOCUS_21590 gene folE 26559 27158 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945065.1 protein_id gnl|my_center|LOCUS_21590 27228 27605 gene locus_tag LOCUS_21600 27228 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 27686 27841 gene locus_tag LOCUS_21610 27686 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 30851 27936 gene locus_tag LOCUS_21620 30851 27936 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_21620 31756 31013 gene locus_tag LOCUS_21630 31756 31013 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_21630 32631 31855 gene locus_tag LOCUS_21640 32631 31855 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_21640 32712 33107 gene locus_tag LOCUS_21650 32712 33107 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039223.1 protein_id gnl|my_center|LOCUS_21650 33163 34464 gene locus_tag LOCUS_21660 gene egtB 33163 34464 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275134.1 protein_id gnl|my_center|LOCUS_21660 34466 35440 gene locus_tag LOCUS_21670 gene egtD 34466 35440 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_21670 35506 37665 gene locus_tag LOCUS_21680 35506 37665 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039221.1 protein_id gnl|my_center|LOCUS_21680 38908 37724 gene locus_tag LOCUS_21690 38908 37724 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence032 1216 326 gene locus_tag LOCUS_21700 1216 326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275307.1 protein_id gnl|my_center|LOCUS_21700 1399 2001 gene locus_tag LOCUS_21710 1399 2001 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_21710 4964 2136 gene locus_tag LOCUS_21720 4964 2136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 protein_id gnl|my_center|LOCUS_21720 6075 5212 gene locus_tag LOCUS_21730 6075 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 protein_id gnl|my_center|LOCUS_21730 7088 6195 gene locus_tag LOCUS_21740 7088 6195 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 protein_id gnl|my_center|LOCUS_21740 7103 7894 gene locus_tag LOCUS_21750 gene mtgA 7103 7894 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_21750 7953 8972 gene locus_tag LOCUS_21760 7953 8972 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 protein_id gnl|my_center|LOCUS_21760 8932 9363 gene locus_tag LOCUS_21770 8932 9363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_21770 11256 9379 gene locus_tag LOCUS_21780 11256 9379 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_21780 12103 11450 gene locus_tag LOCUS_21790 12103 11450 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_21790 13819 12215 gene locus_tag LOCUS_21800 13819 12215 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_21800 14753 13878 gene locus_tag LOCUS_21810 14753 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 15007 16035 gene locus_tag LOCUS_21820 15007 16035 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037982.1 protein_id gnl|my_center|LOCUS_21820 16032 17276 gene locus_tag LOCUS_21830 16032 17276 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_21830 17273 18337 gene locus_tag LOCUS_21840 17273 18337 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877730.1 protein_id gnl|my_center|LOCUS_21840 19426 18563 gene locus_tag LOCUS_21850 19426 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 22557 19534 gene locus_tag LOCUS_21860 22557 19534 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_21860 24092 22710 gene locus_tag LOCUS_21870 24092 22710 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_21870 24191 24415 gene locus_tag LOCUS_21880 24191 24415 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_21880 24412 24882 gene locus_tag LOCUS_21890 24412 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 25473 24907 gene locus_tag LOCUS_21900 25473 24907 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_21900 26048 25470 gene locus_tag LOCUS_21910 26048 25470 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_21910 26725 26045 gene locus_tag LOCUS_21920 26725 26045 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 protein_id gnl|my_center|LOCUS_21920 27063 30638 gene locus_tag LOCUS_21930 27063 30638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994010.1 protein_id gnl|my_center|LOCUS_21930 32060 30639 gene locus_tag LOCUS_21940 gene mdtD 32060 30639 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037970.1 protein_id gnl|my_center|LOCUS_21940 33275 32202 gene locus_tag LOCUS_21950 gene hemE 33275 32202 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037969.1 protein_id gnl|my_center|LOCUS_21950 33586 33335 gene locus_tag LOCUS_21960 33586 33335 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 protein_id gnl|my_center|LOCUS_21960 34758 33649 gene locus_tag LOCUS_21970 gene aroB 34758 33649 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 protein_id gnl|my_center|LOCUS_21970 35297 34755 gene locus_tag LOCUS_21980 35297 34755 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037966.1 protein_id gnl|my_center|LOCUS_21980 35396 35599 gene locus_tag LOCUS_21990 35396 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 36581 35745 gene locus_tag LOCUS_22000 36581 35745 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_22000 36606 37205 gene locus_tag LOCUS_22010 gene pdxH 36606 37205 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037965.1 protein_id gnl|my_center|LOCUS_22010 37241 37567 gene locus_tag LOCUS_22020 37241 37567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 37564 38361 gene locus_tag LOCUS_22030 37564 38361 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence033 1856 471 gene locus_tag LOCUS_22040 1856 471 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_22040 2085 3533 gene locus_tag LOCUS_22050 2085 3533 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_22050 3530 4627 gene locus_tag LOCUS_22060 3530 4627 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 protein_id gnl|my_center|LOCUS_22060 5517 6371 gene locus_tag LOCUS_22070 5517 6371 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 protein_id gnl|my_center|LOCUS_22070 6389 7177 gene locus_tag LOCUS_22080 6389 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 protein_id gnl|my_center|LOCUS_22080 7360 8628 gene locus_tag LOCUS_22090 gene gltP 7360 8628 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 protein_id gnl|my_center|LOCUS_22090 8729 9874 gene locus_tag LOCUS_22100 8729 9874 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_22100 10428 9934 gene locus_tag LOCUS_22110 10428 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039241.1 protein_id gnl|my_center|LOCUS_22110 12699 10528 gene locus_tag LOCUS_22120 12699 10528 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 protein_id gnl|my_center|LOCUS_22120 14057 12789 gene locus_tag LOCUS_22130 14057 12789 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_22130 14479 14126 gene locus_tag LOCUS_22140 gene folB 14479 14126 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_22140 15613 14588 gene locus_tag LOCUS_22150 gene tsaD 15613 14588 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038897.1 protein_id gnl|my_center|LOCUS_22150 15494 16015 gene locus_tag LOCUS_22160 15494 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 16151 16597 gene locus_tag LOCUS_22170 16151 16597 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_22170 16695 17573 gene locus_tag LOCUS_22180 16695 17573 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506326.1 protein_id gnl|my_center|LOCUS_22180 17631 19370 gene locus_tag LOCUS_22190 gene dnaG 17631 19370 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_22190 19398 19898 gene locus_tag LOCUS_22200 19398 19898 CDS product sulfur transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_22200 19927 20898 gene locus_tag LOCUS_22210 19927 20898 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994203.1 protein_id gnl|my_center|LOCUS_22210 21820 21014 gene locus_tag LOCUS_22220 21820 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 22855 21962 gene locus_tag LOCUS_22230 gene cyoE 22855 21962 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 protein_id gnl|my_center|LOCUS_22230 24023 22860 gene locus_tag LOCUS_22240 24023 22860 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_22240 24666 24034 gene locus_tag LOCUS_22250 24666 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_22250 25447 24734 gene locus_tag LOCUS_22260 25447 24734 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038907.1 protein_id gnl|my_center|LOCUS_22260 25508 25726 gene locus_tag LOCUS_22270 25508 25726 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 protein_id gnl|my_center|LOCUS_22270 26622 25747 gene locus_tag LOCUS_22280 26622 25747 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_22280 27226 26636 gene locus_tag LOCUS_22290 27226 26636 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 protein_id gnl|my_center|LOCUS_22290 27441 27223 gene locus_tag LOCUS_22300 27441 27223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 29057 27450 gene locus_tag LOCUS_22310 gene ctaD 29057 27450 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038912.1 protein_id gnl|my_center|LOCUS_22310 29947 29117 gene locus_tag LOCUS_22320 29947 29117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 29862 30080 gene locus_tag LOCUS_22330 29862 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 30561 30085 gene locus_tag LOCUS_22340 30561 30085 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506314.1 protein_id gnl|my_center|LOCUS_22340 30797 34054 gene locus_tag LOCUS_22350 gene putA 30797 34054 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_22350 34901 34173 gene locus_tag LOCUS_22360 34901 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 35246 34929 gene locus_tag LOCUS_22370 35246 34929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 35832 35233 gene locus_tag LOCUS_22380 gene pnuC 35832 35233 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_22380 37394 35967 gene locus_tag LOCUS_22390 37394 35967 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence034 <1 1103 gene locus_tag LOCUS_22400 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037521.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 1171 2301 gene locus_tag LOCUS_22410 gene tgt 1171 2301 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037520.1 protein_id gnl|my_center|LOCUS_22410 2557 2886 gene locus_tag LOCUS_22420 gene yajC 2557 2886 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_22420 2947 4788 gene locus_tag LOCUS_22430 gene secD 2947 4788 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074057269.1 protein_id gnl|my_center|LOCUS_22430 4850 5818 gene locus_tag LOCUS_22440 gene secF 4850 5818 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448912.1 protein_id gnl|my_center|LOCUS_22440 6024 7286 gene locus_tag LOCUS_22450 gene fabV 6024 7286 CDS product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102929.1 protein_id gnl|my_center|LOCUS_22450 9431 7356 gene locus_tag LOCUS_22460 9431 7356 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_22460 10709 9525 gene locus_tag LOCUS_22470 10709 9525 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_22470 11284 10736 gene locus_tag LOCUS_22480 11284 10736 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_22480 11818 11345 gene locus_tag LOCUS_22490 11818 11345 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037432.1 protein_id gnl|my_center|LOCUS_22490 12135 12344 gene locus_tag LOCUS_22500 12135 12344 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037431.1 protein_id gnl|my_center|LOCUS_22500 12546 14105 gene locus_tag LOCUS_22510 12546 14105 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_22510 14129 14659 gene locus_tag LOCUS_22520 14129 14659 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037427.1 protein_id gnl|my_center|LOCUS_22520 16179 14803 gene locus_tag LOCUS_22530 gene dbpA 16179 14803 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_22530 17219 16242 gene locus_tag LOCUS_22540 17219 16242 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 protein_id gnl|my_center|LOCUS_22540 17395 18300 gene locus_tag LOCUS_22550 17395 18300 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268352.1 protein_id gnl|my_center|LOCUS_22550 18325 20226 gene locus_tag LOCUS_22560 18325 20226 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_22560 20350 20775 gene locus_tag LOCUS_22570 20350 20775 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 protein_id gnl|my_center|LOCUS_22570 21229 20786 gene locus_tag LOCUS_22580 21229 20786 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_22580 21684 21226 gene locus_tag LOCUS_22590 21684 21226 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037423.1 protein_id gnl|my_center|LOCUS_22590 21960 22571 gene locus_tag LOCUS_22600 21960 22571 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_22600 23471 22662 gene locus_tag LOCUS_22610 23471 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 23619 25214 gene locus_tag LOCUS_22620 23619 25214 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036597.1 protein_id gnl|my_center|LOCUS_22620 25238 25837 gene locus_tag LOCUS_22630 25238 25837 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_22630 26096 25929 gene locus_tag LOCUS_22640 26096 25929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 26297 26590 gene locus_tag LOCUS_22650 26297 26590 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_22650 26648 27481 gene locus_tag LOCUS_22660 26648 27481 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275395.1 protein_id gnl|my_center|LOCUS_22660 27498 28613 gene locus_tag LOCUS_22670 gene cfa 27498 28613 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_22670 30892 28724 gene locus_tag LOCUS_22680 30892 28724 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 protein_id gnl|my_center|LOCUS_22680 30912 31526 gene locus_tag LOCUS_22690 30912 31526 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_22690 33950 31539 gene locus_tag LOCUS_22700 33950 31539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 34842 34060 gene locus_tag LOCUS_22710 34842 34060 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_22710 36841 34976 gene locus_tag LOCUS_22720 36841 34976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_22720 37209 36892 gene locus_tag LOCUS_22730 37209 36892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 <37788 37271 gene locus_tag LOCUS_22740 <37788 37271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038852.1:trimeric intracellular cation channel family protein >Feature sequence035 1587 2120 gene locus_tag LOCUS_22750 1587 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2140 2763 gene locus_tag LOCUS_22760 gene leuE 2140 2763 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_22760 2786 3142 gene locus_tag LOCUS_22770 2786 3142 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811700.1 protein_id gnl|my_center|LOCUS_22770 3495 4934 gene locus_tag LOCUS_22780 3495 4934 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_22780 6457 5216 gene locus_tag LOCUS_22790 6457 5216 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_22790 7774 6605 gene locus_tag LOCUS_22800 7774 6605 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_22800 8049 9011 gene locus_tag LOCUS_22810 8049 9011 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 protein_id gnl|my_center|LOCUS_22810 9076 9906 gene locus_tag LOCUS_22820 9076 9906 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039294.1 protein_id gnl|my_center|LOCUS_22820 9970 9887 gene locus_tag LOCUS_t00410 9970 9887 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11032 9914 gene locus_tag LOCUS_22830 11032 9914 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275472.1 protein_id gnl|my_center|LOCUS_22830 12767 11151 gene locus_tag LOCUS_22840 12767 11151 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036728.1 protein_id gnl|my_center|LOCUS_22840 14301 12952 gene locus_tag LOCUS_22850 gene mnmE 14301 12952 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039299.1 protein_id gnl|my_center|LOCUS_22850 16959 14305 gene locus_tag LOCUS_22860 16959 14305 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039300.1 protein_id gnl|my_center|LOCUS_22860 18827 17115 gene locus_tag LOCUS_22870 gene yidC 18827 17115 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039301.1 protein_id gnl|my_center|LOCUS_22870 19180 18827 gene locus_tag LOCUS_22880 19180 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 19467 19327 gene locus_tag LOCUS_22890 gene rpmH 19467 19327 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805908.1 protein_id gnl|my_center|LOCUS_22890 19721 21049 gene locus_tag LOCUS_22900 gene dnaA 19721 21049 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035259.1 protein_id gnl|my_center|LOCUS_22900 21371 22471 gene locus_tag LOCUS_22910 gene dnaN 21371 22471 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_22910 23058 24158 gene locus_tag LOCUS_22920 gene recF 23058 24158 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035261.1 protein_id gnl|my_center|LOCUS_22920 24268 26727 gene locus_tag LOCUS_22930 gene gyrB 24268 26727 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035262.1 protein_id gnl|my_center|LOCUS_22930 26801 27643 gene locus_tag LOCUS_22940 26801 27643 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012436860.1 protein_id gnl|my_center|LOCUS_22940 27716 28522 gene locus_tag LOCUS_22950 27716 28522 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035264.1 protein_id gnl|my_center|LOCUS_22950 28676 29869 gene locus_tag LOCUS_22960 28676 29869 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035265.1 protein_id gnl|my_center|LOCUS_22960 30016 30687 gene locus_tag LOCUS_22970 30016 30687 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033836101.1 protein_id gnl|my_center|LOCUS_22970 30773 31516 gene locus_tag LOCUS_22980 gene exbB 30773 31516 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035267.1 protein_id gnl|my_center|LOCUS_22980 31562 31987 gene locus_tag LOCUS_22990 31562 31987 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035268.1 protein_id gnl|my_center|LOCUS_22990 32024 32401 gene locus_tag LOCUS_23000 32024 32401 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 protein_id gnl|my_center|LOCUS_23000 32586 32978 gene locus_tag LOCUS_23010 32586 32978 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 protein_id gnl|my_center|LOCUS_23010 34037 33282 gene locus_tag LOCUS_23020 34037 33282 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_23020 34312 34034 gene locus_tag LOCUS_23030 34312 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 35842 34382 gene locus_tag LOCUS_23040 gene cls 35842 34382 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 protein_id gnl|my_center|LOCUS_23040 35955 37046 gene locus_tag LOCUS_23050 35955 37046 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_23050 37428 37066 gene locus_tag LOCUS_23060 37428 37066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence036 763 215 gene locus_tag LOCUS_23070 763 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1879 1028 gene locus_tag LOCUS_23080 1879 1028 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_23080 3225 1879 gene locus_tag LOCUS_23090 3225 1879 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037401.1 protein_id gnl|my_center|LOCUS_23090 3559 3227 gene locus_tag LOCUS_23100 gene yidD 3559 3227 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037400.1 protein_id gnl|my_center|LOCUS_23100 3760 4911 gene locus_tag LOCUS_23110 3760 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23110 6303 5059 gene locus_tag LOCUS_23120 6303 5059 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_23120 6755 6300 gene locus_tag LOCUS_23130 6755 6300 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_23130 8229 6862 gene locus_tag LOCUS_23140 gene cysS 8229 6862 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_23140 8415 8957 gene locus_tag LOCUS_23150 8415 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037394.1 protein_id gnl|my_center|LOCUS_23150 9265 10272 gene locus_tag LOCUS_23160 9265 10272 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_23160 10343 11551 gene locus_tag LOCUS_23170 10343 11551 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037391.1 protein_id gnl|my_center|LOCUS_23170 11562 11981 gene locus_tag LOCUS_23180 11562 11981 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_23180 12024 13121 gene locus_tag LOCUS_23190 12024 13121 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 protein_id gnl|my_center|LOCUS_23190 13162 14478 gene locus_tag LOCUS_23200 13162 14478 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055042.1 protein_id gnl|my_center|LOCUS_23200 14483 15094 gene locus_tag LOCUS_23210 14483 15094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_23210 15091 16044 gene locus_tag LOCUS_23220 gene argC 15091 16044 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037387.1 protein_id gnl|my_center|LOCUS_23220 16076 17374 gene locus_tag LOCUS_23230 16076 17374 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037386.1 protein_id gnl|my_center|LOCUS_23230 17839 18108 gene locus_tag LOCUS_23240 17839 18108 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438175.1 protein_id gnl|my_center|LOCUS_23240 18113 19264 gene locus_tag LOCUS_23250 gene proB 18113 19264 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599274.1 protein_id gnl|my_center|LOCUS_23250 19326 20573 gene locus_tag LOCUS_23260 19326 20573 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037382.1 protein_id gnl|my_center|LOCUS_23260 21878 20664 gene locus_tag LOCUS_23270 21878 20664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 protein_id gnl|my_center|LOCUS_23270 22109 22033 gene locus_tag LOCUS_t00420 22109 22033 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22349 22273 gene locus_tag LOCUS_t00430 22349 22273 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23697 22546 gene locus_tag LOCUS_23280 gene cydB 23697 22546 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_23280 25281 23713 gene locus_tag LOCUS_23290 25281 23713 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 protein_id gnl|my_center|LOCUS_23290 25477 27183 gene locus_tag LOCUS_23300 gene cydD 25477 27183 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037376.1 protein_id gnl|my_center|LOCUS_23300 27180 28868 gene locus_tag LOCUS_23310 gene cydC 27180 28868 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037375.1 protein_id gnl|my_center|LOCUS_23310 29924 29019 gene locus_tag LOCUS_23320 29924 29019 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 protein_id gnl|my_center|LOCUS_23320 31153 30032 gene locus_tag LOCUS_23330 31153 30032 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_23330 32046 31339 gene locus_tag LOCUS_23340 32046 31339 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_23340 33082 32069 gene locus_tag LOCUS_23350 33082 32069 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275352.1 protein_id gnl|my_center|LOCUS_23350 33528 33076 gene locus_tag LOCUS_23360 33528 33076 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055068.1 protein_id gnl|my_center|LOCUS_23360 34150 33533 gene locus_tag LOCUS_23370 34150 33533 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_23370 36078 34159 gene locus_tag LOCUS_23380 36078 34159 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence037 854 195 gene locus_tag LOCUS_23390 854 195 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037291.1 protein_id gnl|my_center|LOCUS_23390 2813 897 gene locus_tag LOCUS_23400 gene edd 2813 897 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037290.1 protein_id gnl|my_center|LOCUS_23400 3684 2968 gene locus_tag LOCUS_23410 gene pgl 3684 2968 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037289.1 protein_id gnl|my_center|LOCUS_23410 4688 3681 gene locus_tag LOCUS_23420 gene glk 4688 3681 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037288.1 protein_id gnl|my_center|LOCUS_23420 6124 4685 gene locus_tag LOCUS_23430 gene zwf 6124 4685 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037287.1 protein_id gnl|my_center|LOCUS_23430 6473 7573 gene locus_tag LOCUS_23440 gene ugpC 6473 7573 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 protein_id gnl|my_center|LOCUS_23440 8434 7574 gene locus_tag LOCUS_23450 8434 7574 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_23450 8701 9093 gene locus_tag LOCUS_23460 gene sdhC 8701 9093 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037283.1 protein_id gnl|my_center|LOCUS_23460 9090 9473 gene locus_tag LOCUS_23470 gene sdhD 9090 9473 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_23470 9477 11267 gene locus_tag LOCUS_23480 gene sdhA 9477 11267 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037281.1 protein_id gnl|my_center|LOCUS_23480 11286 12071 gene locus_tag LOCUS_23490 11286 12071 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_23490 12184 12438 gene locus_tag LOCUS_23500 12184 12438 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_23500 12470 12817 gene locus_tag LOCUS_23510 12470 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 12892 14103 gene locus_tag LOCUS_23520 12892 14103 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_23520 14114 14806 gene locus_tag LOCUS_23530 gene lolD 14114 14806 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_23530 14942 15406 gene locus_tag LOCUS_23540 14942 15406 CDS product DUF6491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275334.1 protein_id gnl|my_center|LOCUS_23540 15631 16140 gene locus_tag LOCUS_23550 15631 16140 CDS product DUF6491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275334.1 protein_id gnl|my_center|LOCUS_23550 16547 16272 gene locus_tag LOCUS_23560 16547 16272 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037561.1 protein_id gnl|my_center|LOCUS_23560 17714 16578 gene locus_tag LOCUS_23570 gene mutY 17714 16578 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_23570 18958 17714 gene locus_tag LOCUS_23580 18958 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 19070 19369 gene locus_tag LOCUS_23590 19070 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 21381 19483 gene locus_tag LOCUS_23600 gene htpG 21381 19483 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037535.1 protein_id gnl|my_center|LOCUS_23600 21595 22173 gene locus_tag LOCUS_23610 gene rsmD 21595 22173 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_23610 22170 22676 gene locus_tag LOCUS_23620 gene coaD 22170 22676 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037533.1 protein_id gnl|my_center|LOCUS_23620 22721 23212 gene locus_tag LOCUS_23630 22721 23212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508077.1 protein_id gnl|my_center|LOCUS_23630 23339 23623 gene locus_tag LOCUS_23640 23339 23623 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 protein_id gnl|my_center|LOCUS_23640 23620 25365 gene locus_tag LOCUS_23650 gene ggt 23620 25365 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_23650 26916 25441 gene locus_tag LOCUS_23660 26916 25441 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388898.1 protein_id gnl|my_center|LOCUS_23660 27023 28252 gene locus_tag LOCUS_23670 27023 28252 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 protein_id gnl|my_center|LOCUS_23670 28249 29040 gene locus_tag LOCUS_23680 28249 29040 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_23680 29109 30374 gene locus_tag LOCUS_23690 29109 30374 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 protein_id gnl|my_center|LOCUS_23690 30472 31362 gene locus_tag LOCUS_23700 30472 31362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_23700 31461 32360 gene locus_tag LOCUS_23710 31461 32360 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918743.1 protein_id gnl|my_center|LOCUS_23710 32722 32420 gene locus_tag LOCUS_23720 32722 32420 CDS product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168046.1 protein_id gnl|my_center|LOCUS_23720 33466 32804 gene locus_tag LOCUS_23730 gene upp 33466 32804 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037528.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence038 500 1501 gene locus_tag LOCUS_23740 500 1501 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963451.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23740 1631 1843 gene locus_tag LOCUS_23750 1631 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088225.1 protein_id gnl|my_center|LOCUS_23750 1884 2930 gene locus_tag LOCUS_23760 1884 2930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811351.1 protein_id gnl|my_center|LOCUS_23760 2947 3522 gene locus_tag LOCUS_23770 2947 3522 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038763.1 protein_id gnl|my_center|LOCUS_23770 3602 4501 gene locus_tag LOCUS_23780 3602 4501 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035362.1 protein_id gnl|my_center|LOCUS_23780 4504 5160 gene locus_tag LOCUS_23790 4504 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5157 7676 gene locus_tag LOCUS_23800 gene ligD 5157 7676 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 protein_id gnl|my_center|LOCUS_23800 8202 7855 gene locus_tag LOCUS_23810 8202 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8492 8743 gene locus_tag LOCUS_23820 8492 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8882 9484 gene locus_tag LOCUS_23830 8882 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188758.1 protein_id gnl|my_center|LOCUS_23830 9487 10494 gene locus_tag LOCUS_23840 9487 10494 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_23840 10741 10562 gene locus_tag LOCUS_23850 10741 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10950 11609 gene locus_tag LOCUS_23860 10950 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275454.1 protein_id gnl|my_center|LOCUS_23860 11715 14087 gene locus_tag LOCUS_23870 gene katE 11715 14087 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113643.1 protein_id gnl|my_center|LOCUS_23870 14353 14613 gene locus_tag LOCUS_23880 14353 14613 CDS product DUF3247 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038725.1 protein_id gnl|my_center|LOCUS_23880 15119 14619 gene locus_tag LOCUS_23890 15119 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 15499 15320 gene locus_tag LOCUS_23900 15499 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 16808 15492 gene locus_tag LOCUS_23910 16808 15492 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506450.1 protein_id gnl|my_center|LOCUS_23910 17088 17465 gene locus_tag LOCUS_23920 17088 17465 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_23920 17455 18846 gene locus_tag LOCUS_23930 17455 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 19151 20518 gene locus_tag LOCUS_23940 19151 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 20883 21938 gene locus_tag LOCUS_23950 gene yahK 20883 21938 CDS product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 protein_id gnl|my_center|LOCUS_23950 22257 22009 gene locus_tag LOCUS_23960 22257 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 23537 22254 gene locus_tag LOCUS_23970 23537 22254 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_23970 24035 24667 gene locus_tag LOCUS_23980 24035 24667 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034199428.1 protein_id gnl|my_center|LOCUS_23980 24664 25305 gene locus_tag LOCUS_23990 24664 25305 CDS product DUF1109 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205048.1 protein_id gnl|my_center|LOCUS_23990 25536 25991 gene locus_tag LOCUS_24000 25536 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 26004 26732 gene locus_tag LOCUS_24010 26004 26732 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_24010 27649 26879 gene locus_tag LOCUS_24020 27649 26879 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811624.1 protein_id gnl|my_center|LOCUS_24020 30203 28029 gene locus_tag LOCUS_24030 30203 28029 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037044.1 protein_id gnl|my_center|LOCUS_24030 30418 32109 gene locus_tag LOCUS_24040 30418 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 32469 32164 gene locus_tag LOCUS_24050 32469 32164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 32695 33123 gene locus_tag LOCUS_24060 32695 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 33180 33377 gene locus_tag LOCUS_24070 33180 33377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence039 181 1125 gene locus_tag LOCUS_24080 181 1125 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931401.1 protein_id gnl|my_center|LOCUS_24080 2027 1122 gene locus_tag LOCUS_24090 2027 1122 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807275.1 protein_id gnl|my_center|LOCUS_24090 2153 2788 gene locus_tag LOCUS_24100 2153 2788 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807274.1 protein_id gnl|my_center|LOCUS_24100 2862 4079 gene locus_tag LOCUS_24110 2862 4079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_24110 4171 4461 gene locus_tag LOCUS_24120 4171 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4511 5578 gene locus_tag LOCUS_24130 4511 5578 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275111.1 protein_id gnl|my_center|LOCUS_24130 7177 5600 gene locus_tag LOCUS_24140 7177 5600 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 protein_id gnl|my_center|LOCUS_24140 7292 8500 gene locus_tag LOCUS_24150 gene sstT 7292 8500 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 protein_id gnl|my_center|LOCUS_24150 8503 9225 gene locus_tag LOCUS_24160 8503 9225 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_24160 9222 9527 gene locus_tag LOCUS_24170 9222 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 10311 9601 gene locus_tag LOCUS_24180 10311 9601 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038074.1 protein_id gnl|my_center|LOCUS_24180 10972 10424 gene locus_tag LOCUS_24190 10972 10424 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036494.1 protein_id gnl|my_center|LOCUS_24190 11005 11562 gene locus_tag LOCUS_24200 11005 11562 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035985.1 protein_id gnl|my_center|LOCUS_24200 11639 11905 gene locus_tag LOCUS_24210 11639 11905 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036497.1 protein_id gnl|my_center|LOCUS_24210 13158 11908 gene locus_tag LOCUS_24220 13158 11908 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093428.1 protein_id gnl|my_center|LOCUS_24220 13881 13300 gene locus_tag LOCUS_24230 13881 13300 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 protein_id gnl|my_center|LOCUS_24230 14249 14827 gene locus_tag LOCUS_24240 14249 14827 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_24240 14824 15360 gene locus_tag LOCUS_24250 14824 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 15373 16266 gene locus_tag LOCUS_24260 15373 16266 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 protein_id gnl|my_center|LOCUS_24260 16349 16681 gene locus_tag LOCUS_24270 16349 16681 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036505.1 protein_id gnl|my_center|LOCUS_24270 17899 16709 gene locus_tag LOCUS_24280 17899 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 18117 18704 gene locus_tag LOCUS_24290 18117 18704 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036512.1 protein_id gnl|my_center|LOCUS_24290 18825 19424 gene locus_tag LOCUS_24300 18825 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036513.1 protein_id gnl|my_center|LOCUS_24300 19428 19616 gene locus_tag LOCUS_24310 19428 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 20579 20767 gene locus_tag LOCUS_24320 20579 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 20838 22208 gene locus_tag LOCUS_24330 20838 22208 CDS product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 protein_id gnl|my_center|LOCUS_24330 24732 22174 gene locus_tag LOCUS_24340 gene mprF 24732 22174 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036515.1 protein_id gnl|my_center|LOCUS_24340 24886 25518 gene locus_tag LOCUS_24350 24886 25518 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275406.1 protein_id gnl|my_center|LOCUS_24350 25569 25916 gene locus_tag LOCUS_24360 25569 25916 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_24360 26331 26002 gene locus_tag LOCUS_24370 26331 26002 CDS product DUF3325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035505.1 protein_id gnl|my_center|LOCUS_24370 27944 26328 gene locus_tag LOCUS_24380 27944 26328 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_24380 28348 27941 gene locus_tag LOCUS_24390 28348 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 30591 28372 gene locus_tag LOCUS_24400 30591 28372 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035415.1 protein_id gnl|my_center|LOCUS_24400 32160 30877 gene locus_tag LOCUS_24410 32160 30877 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_24410 33236 32163 gene locus_tag LOCUS_24420 33236 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence040 96 4 gene locus_tag LOCUS_t00440 96 4 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 413 2332 gene locus_tag LOCUS_24430 gene dnaX 413 2332 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036204.1 protein_id gnl|my_center|LOCUS_24430 2339 2659 gene locus_tag LOCUS_24440 2339 2659 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036205.1 protein_id gnl|my_center|LOCUS_24440 2753 3352 gene locus_tag LOCUS_24450 gene recR 2753 3352 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_24450 3404 3754 gene locus_tag LOCUS_24460 3404 3754 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036207.1 protein_id gnl|my_center|LOCUS_24460 3751 5085 gene locus_tag LOCUS_24470 3751 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 5679 5152 gene locus_tag LOCUS_24480 5679 5152 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_24480 7652 5676 gene locus_tag LOCUS_24490 7652 5676 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_24490 8676 7720 gene locus_tag LOCUS_24500 8676 7720 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_24500 9604 8678 gene locus_tag LOCUS_24510 9604 8678 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_24510 9669 11516 gene locus_tag LOCUS_24520 9669 11516 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275429.1 protein_id gnl|my_center|LOCUS_24520 11583 12527 gene locus_tag LOCUS_24530 11583 12527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_24530 12524 14380 gene locus_tag LOCUS_24540 12524 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036215.1 protein_id gnl|my_center|LOCUS_24540 14960 14388 gene locus_tag LOCUS_24550 14960 14388 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 protein_id gnl|my_center|LOCUS_24550 15113 15583 gene locus_tag LOCUS_24560 15113 15583 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 protein_id gnl|my_center|LOCUS_24560 15690 15884 gene locus_tag LOCUS_24570 gene rpmF 15690 15884 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_24570 15975 16940 gene locus_tag LOCUS_24580 15975 16940 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_24580 17013 17795 gene locus_tag LOCUS_24590 17013 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 17891 18835 gene locus_tag LOCUS_24600 gene fabD 17891 18835 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 protein_id gnl|my_center|LOCUS_24600 18912 19655 gene locus_tag LOCUS_24610 gene fabG 18912 19655 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_24610 19804 20043 gene locus_tag LOCUS_24620 gene acpP 19804 20043 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_24620 20281 21543 gene locus_tag LOCUS_24630 gene fabF 20281 21543 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036221.1 protein_id gnl|my_center|LOCUS_24630 21713 23056 gene locus_tag LOCUS_24640 21713 23056 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_24640 23187 24248 gene locus_tag LOCUS_24650 gene mltG 23187 24248 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_24650 24245 25204 gene locus_tag LOCUS_24660 24245 25204 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 protein_id gnl|my_center|LOCUS_24660 25201 25554 gene locus_tag LOCUS_24670 25201 25554 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_24670 25712 25786 gene locus_tag LOCUS_t00450 25712 25786 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25966 26424 gene locus_tag LOCUS_24680 25966 26424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 27143 26475 gene locus_tag LOCUS_24690 27143 26475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703843.1 protein_id gnl|my_center|LOCUS_24690 27783 27589 gene locus_tag LOCUS_24700 27783 27589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 29126 27879 gene locus_tag LOCUS_24710 29126 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 30825 29209 gene locus_tag LOCUS_24720 30825 29209 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence041 <1 779 gene locus_tag LOCUS_24730 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704748.1:signal peptidase I 780 2138 gene locus_tag LOCUS_24740 780 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2125 3363 gene locus_tag LOCUS_24750 2125 3363 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810872.1 protein_id gnl|my_center|LOCUS_24750 3420 4325 gene locus_tag LOCUS_24760 3420 4325 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 protein_id gnl|my_center|LOCUS_24760 5575 4334 gene locus_tag LOCUS_24770 gene alr 5575 4334 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706424.1 protein_id gnl|my_center|LOCUS_24770 8468 5622 gene locus_tag LOCUS_24780 8468 5622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 protein_id gnl|my_center|LOCUS_24780 9638 8559 gene locus_tag LOCUS_24790 9638 8559 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_24790 11400 10126 gene locus_tag LOCUS_24800 11400 10126 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_24800 11466 12305 gene locus_tag LOCUS_24810 11466 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 14943 13846 gene locus_tag LOCUS_24820 gene rsgA 14943 13846 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038460.1 protein_id gnl|my_center|LOCUS_24820 15073 16344 gene locus_tag LOCUS_24830 15073 16344 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_24830 16354 17004 gene locus_tag LOCUS_24840 16354 17004 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_24840 17028 17699 gene locus_tag LOCUS_24850 17028 17699 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_24850 17777 18106 gene locus_tag LOCUS_24860 17777 18106 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_24860 19406 18147 gene locus_tag LOCUS_24870 19406 18147 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_24870 20223 19447 gene locus_tag LOCUS_24880 20223 19447 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_24880 20285 21211 gene locus_tag LOCUS_24890 gene grxD 20285 21211 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 protein_id gnl|my_center|LOCUS_24890 21949 21410 gene locus_tag LOCUS_24900 21949 21410 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 protein_id gnl|my_center|LOCUS_24900 22149 23558 gene locus_tag LOCUS_24910 22149 23558 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437413.1 protein_id gnl|my_center|LOCUS_24910 23555 24820 gene locus_tag LOCUS_24920 23555 24820 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 protein_id gnl|my_center|LOCUS_24920 24920 25864 gene locus_tag LOCUS_24930 24920 25864 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038480.1 protein_id gnl|my_center|LOCUS_24930 25934 26272 gene locus_tag LOCUS_24940 25934 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944410.1 protein_id gnl|my_center|LOCUS_24940 26273 26959 gene locus_tag LOCUS_24950 26273 26959 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_24950 28347 27517 gene locus_tag LOCUS_24960 gene fghA 28347 27517 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 protein_id gnl|my_center|LOCUS_24960 29504 28395 gene locus_tag LOCUS_24970 29504 28395 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008111.1 protein_id gnl|my_center|LOCUS_24970 29916 29641 gene locus_tag LOCUS_24980 29916 29641 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence042 2417 420 gene locus_tag LOCUS_24990 2417 420 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036316.1 protein_id gnl|my_center|LOCUS_24990 2616 2485 gene locus_tag LOCUS_25000 2616 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4648 2993 gene locus_tag LOCUS_25010 4648 2993 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_25010 5460 4645 gene locus_tag LOCUS_25020 5460 4645 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 protein_id gnl|my_center|LOCUS_25020 7227 5512 gene locus_tag LOCUS_25030 7227 5512 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275421.1 protein_id gnl|my_center|LOCUS_25030 7427 8143 gene locus_tag LOCUS_25040 7427 8143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 protein_id gnl|my_center|LOCUS_25040 8140 9417 gene locus_tag LOCUS_25050 8140 9417 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 protein_id gnl|my_center|LOCUS_25050 9975 9490 gene locus_tag LOCUS_25060 9975 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_25060 10279 10022 gene locus_tag LOCUS_25070 gene minE 10279 10022 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036323.1 protein_id gnl|my_center|LOCUS_25070 11091 10282 gene locus_tag LOCUS_25080 gene minD 11091 10282 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036324.1 protein_id gnl|my_center|LOCUS_25080 11886 11128 gene locus_tag LOCUS_25090 gene minC 11886 11128 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036325.1 protein_id gnl|my_center|LOCUS_25090 12478 11888 gene locus_tag LOCUS_25100 12478 11888 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036326.1 protein_id gnl|my_center|LOCUS_25100 12627 13826 gene locus_tag LOCUS_25110 12627 13826 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_25110 13826 14467 gene locus_tag LOCUS_25120 13826 14467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_25120 14823 15959 gene locus_tag LOCUS_25130 14823 15959 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 protein_id gnl|my_center|LOCUS_25130 16087 16503 gene locus_tag LOCUS_25140 16087 16503 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629014.1 protein_id gnl|my_center|LOCUS_25140 16508 17179 gene locus_tag LOCUS_25150 16508 17179 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 protein_id gnl|my_center|LOCUS_25150 18141 17341 gene locus_tag LOCUS_25160 18141 17341 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327997.1 protein_id gnl|my_center|LOCUS_25160 18790 18230 gene locus_tag LOCUS_25170 18790 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 20174 18873 gene locus_tag LOCUS_25180 20174 18873 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175182.1 protein_id gnl|my_center|LOCUS_25180 20358 20176 gene locus_tag LOCUS_25190 20358 20176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036333.1 protein_id gnl|my_center|LOCUS_25190 20537 20355 gene locus_tag LOCUS_25200 20537 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036334.1 protein_id gnl|my_center|LOCUS_25200 20821 20534 gene locus_tag LOCUS_25210 20821 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036335.1 protein_id gnl|my_center|LOCUS_25210 21713 20832 gene locus_tag LOCUS_25220 21713 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 21832 23031 gene locus_tag LOCUS_25230 gene purT 21832 23031 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036337.1 protein_id gnl|my_center|LOCUS_25230 24311 23109 gene locus_tag LOCUS_25240 24311 23109 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 protein_id gnl|my_center|LOCUS_25240 25120 24362 gene locus_tag LOCUS_25250 25120 24362 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275418.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25250 25281 25847 gene locus_tag LOCUS_25260 25281 25847 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036342.1 protein_id gnl|my_center|LOCUS_25260 27144 25930 gene locus_tag LOCUS_25270 27144 25930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036343.1 protein_id gnl|my_center|LOCUS_25270 27718 27212 gene locus_tag LOCUS_25280 27718 27212 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036344.1 protein_id gnl|my_center|LOCUS_25280 28644 27748 gene locus_tag LOCUS_25290 gene tesB 28644 27748 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_25290 29556 28774 gene locus_tag LOCUS_25300 29556 28774 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_25300 29595 30035 gene locus_tag LOCUS_25310 29595 30035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence043 626 847 gene locus_tag LOCUS_25320 626 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1966 962 gene locus_tag LOCUS_25330 1966 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2398 2054 gene locus_tag LOCUS_25340 2398 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3105 2473 gene locus_tag LOCUS_25350 3105 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3637 3173 gene locus_tag LOCUS_25360 3637 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4288 3776 gene locus_tag LOCUS_25370 4288 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4827 4366 gene locus_tag LOCUS_25380 4827 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5709 4915 gene locus_tag LOCUS_25390 5709 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7358 6009 gene locus_tag LOCUS_25400 gene gdhA 7358 6009 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_25400 8495 7434 gene locus_tag LOCUS_25410 gene leuB 8495 7434 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_25410 9146 8568 gene locus_tag LOCUS_25420 gene leuD 9146 8568 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_25420 10564 9146 gene locus_tag LOCUS_25430 gene leuC 10564 9146 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_25430 12156 10603 gene locus_tag LOCUS_25440 12156 10603 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038426.1 protein_id gnl|my_center|LOCUS_25440 13250 12153 gene locus_tag LOCUS_25450 13250 12153 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038425.1 protein_id gnl|my_center|LOCUS_25450 13249 13419 gene locus_tag LOCUS_25460 13249 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 13619 13362 gene locus_tag LOCUS_25470 13619 13362 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038424.1 protein_id gnl|my_center|LOCUS_25470 15330 13603 gene locus_tag LOCUS_25480 gene ilvG 15330 13603 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038423.1 protein_id gnl|my_center|LOCUS_25480 16350 15376 gene locus_tag LOCUS_25490 gene ilvC 16350 15376 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038422.1 protein_id gnl|my_center|LOCUS_25490 16619 16404 gene locus_tag LOCUS_25500 16619 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 16950 16597 gene locus_tag LOCUS_25510 16950 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 17167 17985 gene locus_tag LOCUS_25520 17167 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 19584 18244 gene locus_tag LOCUS_25530 19584 18244 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064527.1 protein_id gnl|my_center|LOCUS_25530 20681 19581 gene locus_tag LOCUS_25540 20681 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 23899 20678 gene locus_tag LOCUS_25550 23899 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 24695 23943 gene locus_tag LOCUS_25560 24695 23943 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665712.1 protein_id gnl|my_center|LOCUS_25560 25962 24706 gene locus_tag LOCUS_25570 25962 24706 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064524.1 protein_id gnl|my_center|LOCUS_25570 27665 25959 gene locus_tag LOCUS_25580 27665 25959 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665707.1 protein_id gnl|my_center|LOCUS_25580 29094 27652 gene locus_tag LOCUS_25590 29094 27652 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211368921.1 protein_id gnl|my_center|LOCUS_25590 29621 29091 gene locus_tag LOCUS_25600 29621 29091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25600 >Feature sequence044 462 88 gene locus_tag LOCUS_25610 462 88 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035949.1 protein_id gnl|my_center|LOCUS_25610 2179 452 gene locus_tag LOCUS_25620 2179 452 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035950.1 protein_id gnl|my_center|LOCUS_25620 2258 3085 gene locus_tag LOCUS_25630 gene rsmI 2258 3085 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_25630 5022 4258 gene locus_tag LOCUS_25640 5022 4258 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_25640 5353 5799 gene locus_tag LOCUS_25650 gene mraZ 5353 5799 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005910933.1 protein_id gnl|my_center|LOCUS_25650 5847 6800 gene locus_tag LOCUS_25660 gene rsmH 5847 6800 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 protein_id gnl|my_center|LOCUS_25660 6797 7060 gene locus_tag LOCUS_25670 gene ftsL 6797 7060 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_25670 7176 9035 gene locus_tag LOCUS_25680 7176 9035 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_25680 9044 10576 gene locus_tag LOCUS_25690 9044 10576 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_25690 10573 11955 gene locus_tag LOCUS_25700 gene murF 10573 11955 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035959.1 protein_id gnl|my_center|LOCUS_25700 11945 13030 gene locus_tag LOCUS_25710 gene mraY 11945 13030 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035960.1 protein_id gnl|my_center|LOCUS_25710 13030 14337 gene locus_tag LOCUS_25720 gene ftsW 13030 14337 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035961.1 protein_id gnl|my_center|LOCUS_25720 14337 15464 gene locus_tag LOCUS_25730 14337 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 15508 16944 gene locus_tag LOCUS_25740 gene murC 15508 16944 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035963.1 protein_id gnl|my_center|LOCUS_25740 17045 17773 gene locus_tag LOCUS_25750 17045 17773 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035965.1 protein_id gnl|my_center|LOCUS_25750 17770 19005 gene locus_tag LOCUS_25760 gene ftsA 17770 19005 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003485272.1 protein_id gnl|my_center|LOCUS_25760 19175 20410 gene locus_tag LOCUS_25770 gene ftsZ 19175 20410 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_25770 20677 21588 gene locus_tag LOCUS_25780 gene lpxC 20677 21588 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 protein_id gnl|my_center|LOCUS_25780 22206 21769 gene locus_tag LOCUS_25790 22206 21769 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035968.1 protein_id gnl|my_center|LOCUS_25790 22219 23169 gene locus_tag LOCUS_25800 22219 23169 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_25800 23327 26038 gene locus_tag LOCUS_25810 gene secA 23327 26038 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035970.1 protein_id gnl|my_center|LOCUS_25810 26617 27570 gene locus_tag LOCUS_25820 26617 27570 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 protein_id gnl|my_center|LOCUS_25820 28135 27560 gene locus_tag LOCUS_25830 28135 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275538.1 protein_id gnl|my_center|LOCUS_25830 29017 28187 gene locus_tag LOCUS_25840 gene metF 29017 28187 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035975.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence045 425 81 gene locus_tag LOCUS_25850 425 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 427 603 gene locus_tag LOCUS_25860 427 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2679 790 gene locus_tag LOCUS_25870 gene mnmG 2679 790 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035631.1 protein_id gnl|my_center|LOCUS_25870 3857 3297 gene locus_tag LOCUS_25880 3857 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3996 4958 gene locus_tag LOCUS_25890 3996 4958 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 protein_id gnl|my_center|LOCUS_25890 4955 5557 gene locus_tag LOCUS_25900 4955 5557 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 protein_id gnl|my_center|LOCUS_25900 5586 6014 gene locus_tag LOCUS_25910 5586 6014 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035635.1 protein_id gnl|my_center|LOCUS_25910 6971 6081 gene locus_tag LOCUS_25920 gene bioC 6971 6081 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_25920 7777 6995 gene locus_tag LOCUS_25930 7777 6995 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 protein_id gnl|my_center|LOCUS_25930 8605 7838 gene locus_tag LOCUS_25940 gene bioH 8605 7838 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_25940 9833 8622 gene locus_tag LOCUS_25950 gene bioF 9833 8622 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035641.1 protein_id gnl|my_center|LOCUS_25950 11002 9974 gene locus_tag LOCUS_25960 gene bioB 11002 9974 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_25960 11097 11780 gene locus_tag LOCUS_25970 11097 11780 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_25970 11992 12081 gene locus_tag LOCUS_t00460 11992 12081 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13369 12476 gene locus_tag LOCUS_25980 gene ubiA 13369 12476 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_25980 13520 13596 gene locus_tag LOCUS_t00470 13520 13596 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14024 14857 gene locus_tag LOCUS_25990 14024 14857 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532382.1 protein_id gnl|my_center|LOCUS_25990 14861 15937 gene locus_tag LOCUS_26000 14861 15937 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268147.1 protein_id gnl|my_center|LOCUS_26000 16096 16701 gene locus_tag LOCUS_26010 gene lexA 16096 16701 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036298.1 protein_id gnl|my_center|LOCUS_26010 16702 17325 gene locus_tag LOCUS_26020 gene imuA 16702 17325 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962596.1 protein_id gnl|my_center|LOCUS_26020 17335 18756 gene locus_tag LOCUS_26030 17335 18756 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 protein_id gnl|my_center|LOCUS_26030 18753 21998 gene locus_tag LOCUS_26040 18753 21998 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237880.1 protein_id gnl|my_center|LOCUS_26040 23842 22307 gene locus_tag LOCUS_26050 23842 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 25552 24047 gene locus_tag LOCUS_26060 25552 24047 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_26060 25816 25562 gene locus_tag LOCUS_26070 25816 25562 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_26070 25996 26334 gene locus_tag LOCUS_26080 25996 26334 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 protein_id gnl|my_center|LOCUS_26080 26338 26706 gene locus_tag LOCUS_26090 26338 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 28428 27085 gene locus_tag LOCUS_26100 28428 27085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence046 2131 695 gene locus_tag LOCUS_26110 gene lpdA 2131 695 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036671.1 protein_id gnl|my_center|LOCUS_26110 3454 2261 gene locus_tag LOCUS_26120 gene sucB 3454 2261 CDS product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036672.1 protein_id gnl|my_center|LOCUS_26120 6328 3497 gene locus_tag LOCUS_26130 6328 3497 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994072.1 protein_id gnl|my_center|LOCUS_26130 7413 6508 gene locus_tag LOCUS_26140 7413 6508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036674.1 protein_id gnl|my_center|LOCUS_26140 8852 7410 gene locus_tag LOCUS_26150 8852 7410 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036675.1 protein_id gnl|my_center|LOCUS_26150 11166 8911 gene locus_tag LOCUS_26160 11166 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 11685 11308 gene locus_tag LOCUS_26170 11685 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 13744 11756 gene locus_tag LOCUS_26180 13744 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 15451 14036 gene locus_tag LOCUS_26190 gene purB 15451 14036 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 protein_id gnl|my_center|LOCUS_26190 15562 16959 gene locus_tag LOCUS_26200 15562 16959 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_26200 17702 17268 gene locus_tag LOCUS_26210 17702 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 18350 17763 gene locus_tag LOCUS_26220 18350 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 19223 18384 gene locus_tag LOCUS_26230 19223 18384 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 protein_id gnl|my_center|LOCUS_26230 20287 19274 gene locus_tag LOCUS_26240 20287 19274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_26240 21156 20284 gene locus_tag LOCUS_26250 21156 20284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_26250 21515 21153 gene locus_tag LOCUS_26260 21515 21153 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_26260 21760 21518 gene locus_tag LOCUS_26270 21760 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 21893 22462 gene locus_tag LOCUS_26280 21893 22462 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_26280 22563 23522 gene locus_tag LOCUS_26290 22563 23522 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921707.1 protein_id gnl|my_center|LOCUS_26290 23544 24893 gene locus_tag LOCUS_26300 23544 24893 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_26300 24886 25128 gene locus_tag LOCUS_26310 24886 25128 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036690.1 protein_id gnl|my_center|LOCUS_26310 25146 25790 gene locus_tag LOCUS_26320 25146 25790 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036691.1 protein_id gnl|my_center|LOCUS_26320 27037 25817 gene locus_tag LOCUS_26330 27037 25817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence047 412 591 gene locus_tag LOCUS_26340 412 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1639 596 gene locus_tag LOCUS_26350 1639 596 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036025.1 protein_id gnl|my_center|LOCUS_26350 2040 1639 gene locus_tag LOCUS_26360 gene apaG 2040 1639 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 protein_id gnl|my_center|LOCUS_26360 2871 2059 gene locus_tag LOCUS_26370 gene rsmA 2871 2059 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_26370 3848 2868 gene locus_tag LOCUS_26380 gene pdxA 3848 2868 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036028.1 protein_id gnl|my_center|LOCUS_26380 5211 3853 gene locus_tag LOCUS_26390 5211 3853 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036029.1 protein_id gnl|my_center|LOCUS_26390 7580 5208 gene locus_tag LOCUS_26400 gene lptD 7580 5208 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036030.1 protein_id gnl|my_center|LOCUS_26400 8666 7740 gene locus_tag LOCUS_26410 8666 7740 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_26410 9263 8709 gene locus_tag LOCUS_26420 9263 8709 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_26420 9858 9277 gene locus_tag LOCUS_26430 9858 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036033.1 protein_id gnl|my_center|LOCUS_26430 9976 11187 gene locus_tag LOCUS_26440 gene ubiH 9976 11187 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 protein_id gnl|my_center|LOCUS_26440 11184 12362 gene locus_tag LOCUS_26450 11184 12362 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_26450 12876 12472 gene locus_tag LOCUS_26460 12876 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 13237 12926 gene locus_tag LOCUS_26470 13237 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 14076 13354 gene locus_tag LOCUS_26480 14076 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275435.1 protein_id gnl|my_center|LOCUS_26480 15068 14157 gene locus_tag LOCUS_26490 15068 14157 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_26490 16264 15215 gene locus_tag LOCUS_26500 gene rlmM 16264 15215 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_26500 17080 16520 gene locus_tag LOCUS_26510 17080 16520 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_26510 18962 17211 gene locus_tag LOCUS_26520 18962 17211 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036057.1 protein_id gnl|my_center|LOCUS_26520 19062 19730 gene locus_tag LOCUS_26530 19062 19730 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036058.1 protein_id gnl|my_center|LOCUS_26530 19756 20022 gene locus_tag LOCUS_26540 19756 20022 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439155.1 protein_id gnl|my_center|LOCUS_26540 20033 20704 gene locus_tag LOCUS_26550 gene msrA 20033 20704 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036064.1 protein_id gnl|my_center|LOCUS_26550 20706 21218 gene locus_tag LOCUS_26560 20706 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 21510 21373 gene locus_tag LOCUS_26570 21510 21373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 22492 21533 gene locus_tag LOCUS_26580 22492 21533 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036066.1 protein_id gnl|my_center|LOCUS_26580 22952 22527 gene locus_tag LOCUS_26590 gene rnk 22952 22527 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036067.1 protein_id gnl|my_center|LOCUS_26590 24192 23287 gene locus_tag LOCUS_26600 24192 23287 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_26600 26090 24498 gene locus_tag LOCUS_26610 gene ahpF 26090 24498 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036069.1 protein_id gnl|my_center|LOCUS_26610 26877 26314 gene locus_tag LOCUS_26620 gene ahpC 26877 26314 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence048 178 3414 gene locus_tag LOCUS_26630 178 3414 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275461.1 protein_id gnl|my_center|LOCUS_26630 3411 6530 gene locus_tag LOCUS_26640 3411 6530 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038870.1 protein_id gnl|my_center|LOCUS_26640 6753 7430 gene locus_tag LOCUS_26650 6753 7430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089719.1 protein_id gnl|my_center|LOCUS_26650 7411 8397 gene locus_tag LOCUS_26660 7411 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 8394 9380 gene locus_tag LOCUS_26670 8394 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 9377 10636 gene locus_tag LOCUS_26680 9377 10636 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_26680 10633 11883 gene locus_tag LOCUS_26690 10633 11883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089718.1 protein_id gnl|my_center|LOCUS_26690 14163 12799 gene locus_tag LOCUS_26700 14163 12799 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 protein_id gnl|my_center|LOCUS_26700 14872 14288 gene locus_tag LOCUS_26710 14872 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 15618 14869 gene locus_tag LOCUS_26720 15618 14869 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_26720 16049 15702 gene locus_tag LOCUS_26730 16049 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038879.1 protein_id gnl|my_center|LOCUS_26730 16651 16271 gene locus_tag LOCUS_26740 16651 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038880.1 protein_id gnl|my_center|LOCUS_26740 17478 16798 gene locus_tag LOCUS_26750 17478 16798 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038882.1 protein_id gnl|my_center|LOCUS_26750 19611 17524 gene locus_tag LOCUS_26760 19611 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 20379 19621 gene locus_tag LOCUS_26770 20379 19621 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_26770 23396 20523 gene locus_tag LOCUS_26780 23396 20523 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_26780 25494 23938 gene locus_tag LOCUS_26790 25494 23938 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_26790 26342 25512 gene locus_tag LOCUS_26800 26342 25512 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_26800 <27415 26339 gene locus_tag LOCUS_26810 <27415 26339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720913.1:diaminopimelate decarboxylase >Feature sequence049 764 318 gene locus_tag LOCUS_26820 764 318 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198107.1 protein_id gnl|my_center|LOCUS_26820 1702 803 gene locus_tag LOCUS_26830 1702 803 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 protein_id gnl|my_center|LOCUS_26830 1898 3451 gene locus_tag LOCUS_26840 1898 3451 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_26840 3528 3848 gene locus_tag LOCUS_26850 3528 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3948 4583 gene locus_tag LOCUS_26860 3948 4583 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_26860 5759 4650 gene locus_tag LOCUS_26870 5759 4650 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 protein_id gnl|my_center|LOCUS_26870 6265 5918 gene locus_tag LOCUS_26880 gene arsC 6265 5918 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_26880 7410 6271 gene locus_tag LOCUS_26890 7410 6271 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_26890 8009 7524 gene locus_tag LOCUS_26900 8009 7524 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_26900 8242 8451 gene locus_tag LOCUS_26910 8242 8451 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 protein_id gnl|my_center|LOCUS_26910 9019 8531 gene locus_tag LOCUS_26920 9019 8531 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036613.1 protein_id gnl|my_center|LOCUS_26920 9560 9129 gene locus_tag LOCUS_26930 9560 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 9635 10426 gene locus_tag LOCUS_26940 9635 10426 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 protein_id gnl|my_center|LOCUS_26940 11260 10490 gene locus_tag LOCUS_26950 11260 10490 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_26950 11494 11264 gene locus_tag LOCUS_26960 11494 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036617.1 protein_id gnl|my_center|LOCUS_26960 11654 12478 gene locus_tag LOCUS_26970 11654 12478 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036618.1 protein_id gnl|my_center|LOCUS_26970 15071 12693 gene locus_tag LOCUS_26980 gene ppsA 15071 12693 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037312.1 protein_id gnl|my_center|LOCUS_26980 15266 16087 gene locus_tag LOCUS_26990 15266 16087 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037311.1 protein_id gnl|my_center|LOCUS_26990 16134 16616 gene locus_tag LOCUS_27000 16134 16616 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_27000 16687 17175 gene locus_tag LOCUS_27010 16687 17175 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_27010 17289 17903 gene locus_tag LOCUS_27020 17289 17903 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_27020 17965 19050 gene locus_tag LOCUS_27030 gene phaE 17965 19050 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037306.1 protein_id gnl|my_center|LOCUS_27030 19047 20114 gene locus_tag LOCUS_27040 19047 20114 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_27040 20111 20485 gene locus_tag LOCUS_27050 20111 20485 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 protein_id gnl|my_center|LOCUS_27050 20494 20979 gene locus_tag LOCUS_27060 20494 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037303.1 protein_id gnl|my_center|LOCUS_27060 21109 21324 gene locus_tag LOCUS_27070 21109 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037301.1 protein_id gnl|my_center|LOCUS_27070 21439 23796 gene locus_tag LOCUS_27080 21439 23796 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 protein_id gnl|my_center|LOCUS_27080 23999 23913 gene locus_tag LOCUS_t00480 23999 23913 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24120 24488 gene locus_tag LOCUS_27090 24120 24488 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216977.1 protein_id gnl|my_center|LOCUS_27090 24646 24571 gene locus_tag LOCUS_t00490 24646 24571 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24769 24694 gene locus_tag LOCUS_t00500 24769 24694 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24985 24910 gene locus_tag LOCUS_t00510 24985 24910 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25113 25038 gene locus_tag LOCUS_t00520 25113 25038 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25322 25705 gene locus_tag LOCUS_27100 25322 25705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 26039 26272 gene locus_tag LOCUS_27110 26039 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence050 <1 8935 gene locus_tag LOCUS_27120 <1 8935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024696519.1:calcium-binding protein 12316 9149 gene locus_tag LOCUS_27130 12316 9149 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037511.1 protein_id gnl|my_center|LOCUS_27130 13516 12335 gene locus_tag LOCUS_27140 13516 12335 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 protein_id gnl|my_center|LOCUS_27140 14177 13539 gene locus_tag LOCUS_27150 14177 13539 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037509.1 protein_id gnl|my_center|LOCUS_27150 14414 19393 gene locus_tag LOCUS_27160 14414 19393 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 protein_id gnl|my_center|LOCUS_27160 19722 20486 gene locus_tag LOCUS_27170 19722 20486 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036730.1 protein_id gnl|my_center|LOCUS_27170 20537 21493 gene locus_tag LOCUS_27180 20537 21493 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 protein_id gnl|my_center|LOCUS_27180 21490 22215 gene locus_tag LOCUS_27190 21490 22215 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036732.1 protein_id gnl|my_center|LOCUS_27190 22486 22698 gene locus_tag LOCUS_27200 22486 22698 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553156.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence051 311 709 gene locus_tag LOCUS_27210 gene nirD 311 709 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_27210 789 4067 gene locus_tag LOCUS_27220 789 4067 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 protein_id gnl|my_center|LOCUS_27220 4080 4307 gene locus_tag LOCUS_27230 4080 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4767 4396 gene locus_tag LOCUS_27240 4767 4396 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_27240 5090 4785 gene locus_tag LOCUS_27250 gene yhbY 5090 4785 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036888.1 protein_id gnl|my_center|LOCUS_27250 5128 5784 gene locus_tag LOCUS_27260 gene rlmE 5128 5784 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_27260 5840 7762 gene locus_tag LOCUS_27270 gene ftsH 5840 7762 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941435.1 protein_id gnl|my_center|LOCUS_27270 7941 8120 gene locus_tag LOCUS_27280 7941 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 8120 9016 gene locus_tag LOCUS_27290 gene folP 8120 9016 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 protein_id gnl|my_center|LOCUS_27290 9016 9969 gene locus_tag LOCUS_27300 gene miaA 9016 9969 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_27300 10021 10335 gene locus_tag LOCUS_27310 gene hfq 10021 10335 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_27310 10350 11660 gene locus_tag LOCUS_27320 gene hflX 10350 11660 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036894.1 protein_id gnl|my_center|LOCUS_27320 12818 11976 gene locus_tag LOCUS_27330 gene asd 12818 11976 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037685.1 protein_id gnl|my_center|LOCUS_27330 13462 12815 gene locus_tag LOCUS_27340 13462 12815 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 protein_id gnl|my_center|LOCUS_27340 13667 14593 gene locus_tag LOCUS_27350 gene prmB 13667 14593 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037683.1 protein_id gnl|my_center|LOCUS_27350 14590 15693 gene locus_tag LOCUS_27360 gene aroC 14590 15693 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037681.1 protein_id gnl|my_center|LOCUS_27360 15686 16735 gene locus_tag LOCUS_27370 15686 16735 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 protein_id gnl|my_center|LOCUS_27370 16818 17843 gene locus_tag LOCUS_27380 16818 17843 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037679.1 protein_id gnl|my_center|LOCUS_27380 18178 19974 gene locus_tag LOCUS_27390 18178 19974 CDS product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994017.1 protein_id gnl|my_center|LOCUS_27390 19971 20351 gene locus_tag LOCUS_27400 19971 20351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037677.1 protein_id gnl|my_center|LOCUS_27400 20412 21185 gene locus_tag LOCUS_27410 gene truA 20412 21185 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037676.1 protein_id gnl|my_center|LOCUS_27410 21182 21841 gene locus_tag LOCUS_27420 21182 21841 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037675.1 protein_id gnl|my_center|LOCUS_27420 <22737 21877 gene locus_tag LOCUS_27430 <22737 21877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037674.1:LysR family transcriptional regulator >Feature sequence052 <1 990 gene locus_tag LOCUS_27440 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275340.1:TonB-dependent receptor 1005 2105 gene locus_tag LOCUS_27450 1005 2105 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_27450 2102 3469 gene locus_tag LOCUS_27460 2102 3469 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_27460 3480 4091 gene locus_tag LOCUS_27470 gene ppa 3480 4091 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_27470 4343 4933 gene locus_tag LOCUS_27480 4343 4933 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_27480 4930 7911 gene locus_tag LOCUS_27490 4930 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 8338 7946 gene locus_tag LOCUS_27500 8338 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 9020 8394 gene locus_tag LOCUS_27510 9020 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9945 9241 gene locus_tag LOCUS_27520 9945 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 10901 9942 gene locus_tag LOCUS_27530 10901 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681687.1 protein_id gnl|my_center|LOCUS_27530 11214 10984 gene locus_tag LOCUS_27540 11214 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 11907 11422 gene locus_tag LOCUS_27550 11907 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 12458 11943 gene locus_tag LOCUS_27560 12458 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 12724 13185 gene locus_tag LOCUS_27570 12724 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038876.1 protein_id gnl|my_center|LOCUS_27570 14281 13259 gene locus_tag LOCUS_27580 14281 13259 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 protein_id gnl|my_center|LOCUS_27580 14849 14361 gene locus_tag LOCUS_27590 14849 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 14848 16062 gene locus_tag LOCUS_27600 14848 16062 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_27600 16174 19344 gene locus_tag LOCUS_27610 16174 19344 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036630.1 protein_id gnl|my_center|LOCUS_27610 19408 20145 gene locus_tag LOCUS_27620 19408 20145 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_27620 20139 21569 gene locus_tag LOCUS_27630 20139 21569 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_27630 22539 22402 gene locus_tag LOCUS_27640 22539 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence053 244 1923 gene locus_tag LOCUS_27650 244 1923 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 protein_id gnl|my_center|LOCUS_27650 1923 2417 gene locus_tag LOCUS_27660 1923 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 4355 2469 gene locus_tag LOCUS_27670 4355 2469 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038419.1 protein_id gnl|my_center|LOCUS_27670 5236 4484 gene locus_tag LOCUS_27680 5236 4484 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 protein_id gnl|my_center|LOCUS_27680 5978 5505 gene locus_tag LOCUS_27690 5978 5505 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_27690 7011 6235 gene locus_tag LOCUS_27700 gene hdhA 7011 6235 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483362.1 protein_id gnl|my_center|LOCUS_27700 7440 8012 gene locus_tag LOCUS_27710 7440 8012 CDS product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 protein_id gnl|my_center|LOCUS_27710 9272 8244 gene locus_tag LOCUS_27720 9272 8244 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035460.1 protein_id gnl|my_center|LOCUS_27720 9804 9292 gene locus_tag LOCUS_27730 gene secB 9804 9292 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035459.1 protein_id gnl|my_center|LOCUS_27730 10304 9909 gene locus_tag LOCUS_27740 10304 9909 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437015.1 protein_id gnl|my_center|LOCUS_27740 10839 10411 gene locus_tag LOCUS_27750 10839 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 protein_id gnl|my_center|LOCUS_27750 11323 10865 gene locus_tag LOCUS_27760 11323 10865 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437013.1 protein_id gnl|my_center|LOCUS_27760 11362 12156 gene locus_tag LOCUS_27770 11362 12156 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 protein_id gnl|my_center|LOCUS_27770 12253 13233 gene locus_tag LOCUS_27780 12253 13233 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035453.1 protein_id gnl|my_center|LOCUS_27780 13230 14492 gene locus_tag LOCUS_27790 13230 14492 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035452.1 protein_id gnl|my_center|LOCUS_27790 14535 14972 gene locus_tag LOCUS_27800 14535 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 15381 14992 gene locus_tag LOCUS_27810 15381 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 16518 15604 gene locus_tag LOCUS_27820 16518 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 18181 16901 gene locus_tag LOCUS_27830 18181 16901 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_27830 18288 19175 gene locus_tag LOCUS_27840 18288 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689331.1 protein_id gnl|my_center|LOCUS_27840 19865 19248 gene locus_tag LOCUS_27850 19865 19248 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237109.1 protein_id gnl|my_center|LOCUS_27850 20473 19910 gene locus_tag LOCUS_27860 20473 19910 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275138.1 protein_id gnl|my_center|LOCUS_27860 22044 20611 gene locus_tag LOCUS_27870 22044 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence054 402 938 gene locus_tag LOCUS_27880 gene ppa 402 938 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804918.1 protein_id gnl|my_center|LOCUS_27880 1092 2207 gene locus_tag LOCUS_27890 1092 2207 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038414.1 protein_id gnl|my_center|LOCUS_27890 5351 2511 gene locus_tag LOCUS_27900 5351 2511 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 protein_id gnl|my_center|LOCUS_27900 6302 5397 gene locus_tag LOCUS_27910 6302 5397 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 protein_id gnl|my_center|LOCUS_27910 8724 6415 gene locus_tag LOCUS_27920 8724 6415 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_27920 11069 9192 gene locus_tag LOCUS_27930 gene thiC 11069 9192 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038418.1 protein_id gnl|my_center|LOCUS_27930 11511 13067 gene locus_tag LOCUS_27940 11511 13067 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 protein_id gnl|my_center|LOCUS_27940 14970 13267 gene locus_tag LOCUS_27950 gene ggt 14970 13267 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_27950 15205 16029 gene locus_tag LOCUS_27960 15205 16029 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808263.1 protein_id gnl|my_center|LOCUS_27960 16034 16573 gene locus_tag LOCUS_27970 16034 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819516.1 protein_id gnl|my_center|LOCUS_27970 16570 17970 gene locus_tag LOCUS_27980 16570 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064518.1 protein_id gnl|my_center|LOCUS_27980 17967 18485 gene locus_tag LOCUS_27990 17967 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 18482 19084 gene locus_tag LOCUS_28000 18482 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 19086 19874 gene locus_tag LOCUS_28010 19086 19874 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064519.1 protein_id gnl|my_center|LOCUS_28010 19929 21683 gene locus_tag LOCUS_28020 gene mshL 19929 21683 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064520.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence055 <1 2484 gene locus_tag LOCUS_28030 <1 2484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994005.1:Hpt domain-containing protein 2504 3823 gene locus_tag LOCUS_28040 2504 3823 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038043.1 protein_id gnl|my_center|LOCUS_28040 3849 4319 gene locus_tag LOCUS_28050 3849 4319 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_28050 5292 4558 gene locus_tag LOCUS_28060 5292 4558 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_28060 5417 5965 gene locus_tag LOCUS_28070 gene nudE 5417 5965 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_28070 5962 6768 gene locus_tag LOCUS_28080 gene cysQ 5962 6768 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_28080 6765 7595 gene locus_tag LOCUS_28090 gene mazG 6765 7595 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_28090 7592 7924 gene locus_tag LOCUS_28100 7592 7924 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038005.1 protein_id gnl|my_center|LOCUS_28100 7964 8266 gene locus_tag LOCUS_28110 7964 8266 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192500.1 protein_id gnl|my_center|LOCUS_28110 8331 9299 gene locus_tag LOCUS_28120 8331 9299 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_28120 9303 9734 gene locus_tag LOCUS_28130 9303 9734 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_28130 9819 10925 gene locus_tag LOCUS_28140 gene gcvT 9819 10925 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 protein_id gnl|my_center|LOCUS_28140 11012 11407 gene locus_tag LOCUS_28150 gene gcvH 11012 11407 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038001.1 protein_id gnl|my_center|LOCUS_28150 12318 12691 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaggccaccgccaagaagg 14474 13125 gene locus_tag LOCUS_28160 14474 13125 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 protein_id gnl|my_center|LOCUS_28160 16267 14663 gene locus_tag LOCUS_28170 16267 14663 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_28170 16376 17677 gene locus_tag LOCUS_28180 16376 17677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_28180 18577 18101 gene locus_tag LOCUS_28190 18577 18101 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_28190 20884 18647 gene locus_tag LOCUS_28200 20884 18647 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence056 233 90 gene locus_tag LOCUS_28210 233 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1012 230 gene locus_tag LOCUS_28220 1012 230 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037057.1 protein_id gnl|my_center|LOCUS_28220 1965 1012 gene locus_tag LOCUS_28230 gene motD 1965 1012 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_28230 2709 1969 gene locus_tag LOCUS_28240 2709 1969 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_28240 4804 2831 gene locus_tag LOCUS_28250 4804 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 5432 4809 gene locus_tag LOCUS_28260 5432 4809 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037071.1 protein_id gnl|my_center|LOCUS_28260 5824 5432 gene locus_tag LOCUS_28270 gene cheY 5824 5432 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005996243.1 protein_id gnl|my_center|LOCUS_28270 6584 5838 gene locus_tag LOCUS_28280 6584 5838 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037072.1 protein_id gnl|my_center|LOCUS_28280 7465 6581 gene locus_tag LOCUS_28290 7465 6581 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 protein_id gnl|my_center|LOCUS_28290 9245 7452 gene locus_tag LOCUS_28300 9245 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 11451 9343 gene locus_tag LOCUS_28310 gene flhA 11451 9343 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945277.1 protein_id gnl|my_center|LOCUS_28310 12578 11448 gene locus_tag LOCUS_28320 gene flhB 12578 11448 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037076.1 protein_id gnl|my_center|LOCUS_28320 14788 12704 gene locus_tag LOCUS_28330 14788 12704 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113558.1 protein_id gnl|my_center|LOCUS_28330 15736 14945 gene locus_tag LOCUS_28340 gene fliR 15736 14945 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037080.1 protein_id gnl|my_center|LOCUS_28340 16014 15745 gene locus_tag LOCUS_28350 16014 15745 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037081.1 protein_id gnl|my_center|LOCUS_28350 17559 16777 gene locus_tag LOCUS_28360 gene fliP 17559 16777 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037082.1 protein_id gnl|my_center|LOCUS_28360 17987 17562 gene locus_tag LOCUS_28370 17987 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 18343 17984 gene locus_tag LOCUS_28380 gene fliN 18343 17984 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037084.1 protein_id gnl|my_center|LOCUS_28380 19352 18336 gene locus_tag LOCUS_28390 gene fliM 19352 18336 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_28390 19896 19363 gene locus_tag LOCUS_28400 19896 19363 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945280.1 protein_id gnl|my_center|LOCUS_28400 <20635 20030 gene locus_tag LOCUS_28410 <20635 20030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037087.1:flagellar hook-length control protein FliK >Feature sequence057 639 962 gene locus_tag LOCUS_28420 639 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3611 1746 gene locus_tag LOCUS_28430 gene ilvD 3611 1746 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035599.1 protein_id gnl|my_center|LOCUS_28430 3835 4395 gene locus_tag LOCUS_28440 3835 4395 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703514.1 protein_id gnl|my_center|LOCUS_28440 4400 5587 gene locus_tag LOCUS_28450 4400 5587 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037958.1 protein_id gnl|my_center|LOCUS_28450 5863 6198 gene locus_tag LOCUS_28460 5863 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330487.1 protein_id gnl|my_center|LOCUS_28460 7549 6251 gene locus_tag LOCUS_28470 7549 6251 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_28470 7478 7702 gene locus_tag LOCUS_28480 7478 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 9497 8478 gene locus_tag LOCUS_28490 9497 8478 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_28490 10639 9494 gene locus_tag LOCUS_28500 10639 9494 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150453795.1 protein_id gnl|my_center|LOCUS_28500 12222 10636 gene locus_tag LOCUS_28510 12222 10636 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_28510 13210 12212 gene locus_tag LOCUS_28520 13210 12212 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_28520 13884 13207 gene locus_tag LOCUS_28530 13884 13207 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_28530 14974 14078 gene locus_tag LOCUS_28540 14974 14078 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_28540 15644 15105 gene locus_tag LOCUS_28550 15644 15105 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_28550 16657 15848 gene locus_tag LOCUS_28560 16657 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 18841 17417 gene locus_tag LOCUS_28570 18841 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 19198 18968 gene locus_tag LOCUS_28580 19198 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence058 239 973 gene locus_tag LOCUS_28590 gene zipA 239 973 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036750.1 protein_id gnl|my_center|LOCUS_28590 1081 3561 gene locus_tag LOCUS_28600 gene ligA 1081 3561 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036752.1 protein_id gnl|my_center|LOCUS_28600 3558 4034 gene locus_tag LOCUS_28610 3558 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 4031 4975 gene locus_tag LOCUS_28620 gene epmA 4031 4975 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 protein_id gnl|my_center|LOCUS_28620 5159 5854 gene locus_tag LOCUS_28630 5159 5854 CDS product DUF3011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507405.1 protein_id gnl|my_center|LOCUS_28630 5877 6941 gene locus_tag LOCUS_28640 gene mtnA 5877 6941 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036755.1 protein_id gnl|my_center|LOCUS_28640 7176 9872 gene locus_tag LOCUS_28650 gene gyrA 7176 9872 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036756.1 protein_id gnl|my_center|LOCUS_28650 10205 10129 gene locus_tag LOCUS_t00530 10205 10129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10334 10258 gene locus_tag LOCUS_t00540 10334 10258 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11239 10397 gene locus_tag LOCUS_28660 11239 10397 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_28660 12045 11236 gene locus_tag LOCUS_28670 gene thiD 12045 11236 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275371.1 protein_id gnl|my_center|LOCUS_28670 12755 12081 gene locus_tag LOCUS_28680 12755 12081 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_28680 13275 12781 gene locus_tag LOCUS_28690 13275 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036910.1 protein_id gnl|my_center|LOCUS_28690 13546 13304 gene locus_tag LOCUS_28700 13546 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 14983 13583 gene locus_tag LOCUS_28710 14983 13583 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 protein_id gnl|my_center|LOCUS_28710 15547 15068 gene locus_tag LOCUS_28720 15547 15068 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 protein_id gnl|my_center|LOCUS_28720 16187 15627 gene locus_tag LOCUS_28730 16187 15627 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_28730 16352 17245 gene locus_tag LOCUS_28740 gene dapA 16352 17245 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036915.1 protein_id gnl|my_center|LOCUS_28740 17278 17793 gene locus_tag LOCUS_28750 17278 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036916.1 protein_id gnl|my_center|LOCUS_28750 18312 17989 gene locus_tag LOCUS_28760 18312 17989 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_28760 18490 19416 gene locus_tag LOCUS_28770 18490 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence059 1210 851 gene locus_tag LOCUS_28780 gene rplT 1210 851 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_28780 1419 1222 gene locus_tag LOCUS_28790 gene rpmI 1419 1222 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_28790 2182 1706 gene locus_tag LOCUS_28800 gene infC 2182 1706 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 protein_id gnl|my_center|LOCUS_28800 4201 2297 gene locus_tag LOCUS_28810 gene thrS 4201 2297 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944299.1 protein_id gnl|my_center|LOCUS_28810 4694 4620 gene locus_tag LOCUS_t00550 4694 4620 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6856 4841 gene locus_tag LOCUS_28820 gene uvrB 6856 4841 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037621.1 protein_id gnl|my_center|LOCUS_28820 7079 7588 gene locus_tag LOCUS_28830 7079 7588 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_28830 7670 7746 gene locus_tag LOCUS_t00560 7670 7746 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8249 7845 gene locus_tag LOCUS_28840 gene tppA 8249 7845 CDS product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_28840 11962 8252 gene locus_tag LOCUS_28850 11962 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 12510 11959 gene locus_tag LOCUS_28860 12510 11959 CDS product PilX N-terminal domain-containing pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168929235.1 protein_id gnl|my_center|LOCUS_28860 13367 12507 gene locus_tag LOCUS_28870 13367 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 13795 13364 gene locus_tag LOCUS_28880 gene pilV 13795 13364 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_28880 14328 13849 gene locus_tag LOCUS_28890 14328 13849 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_28890 14210 14479 gene locus_tag LOCUS_28900 14210 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 14523 15527 gene locus_tag LOCUS_28910 gene algZ 14523 15527 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_28910 16998 15610 gene locus_tag LOCUS_28920 gene ppnN 16998 15610 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 protein_id gnl|my_center|LOCUS_28920 17745 17278 gene locus_tag LOCUS_28930 17745 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence060 4321 695 gene locus_tag LOCUS_28940 gene recB 4321 695 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039260.1 protein_id gnl|my_center|LOCUS_28940 7674 4318 gene locus_tag LOCUS_28950 gene recC 7674 4318 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039261.1 protein_id gnl|my_center|LOCUS_28950 8753 7722 gene locus_tag LOCUS_28960 8753 7722 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_28960 9007 9795 gene locus_tag LOCUS_28970 9007 9795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039268.1 protein_id gnl|my_center|LOCUS_28970 9795 10544 gene locus_tag LOCUS_28980 9795 10544 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039269.1 protein_id gnl|my_center|LOCUS_28980 10652 11167 gene locus_tag LOCUS_28990 gene mlaD 10652 11167 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039270.1 protein_id gnl|my_center|LOCUS_28990 11170 11838 gene locus_tag LOCUS_29000 11170 11838 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_29000 11828 12136 gene locus_tag LOCUS_29010 11828 12136 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439719.1 protein_id gnl|my_center|LOCUS_29010 12138 13184 gene locus_tag LOCUS_29020 12138 13184 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039273.1 protein_id gnl|my_center|LOCUS_29020 13457 13275 gene locus_tag LOCUS_29030 13457 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 14087 13542 gene locus_tag LOCUS_29040 14087 13542 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039274.1 protein_id gnl|my_center|LOCUS_29040 14320 17448 gene locus_tag LOCUS_29050 14320 17448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence061 166 660 gene locus_tag LOCUS_29060 166 660 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_29060 728 1474 gene locus_tag LOCUS_29070 gene map 728 1474 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586860.1 protein_id gnl|my_center|LOCUS_29070 1526 1885 gene locus_tag LOCUS_29080 1526 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_29080 2010 2378 gene locus_tag LOCUS_29090 2010 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3650 3009 gene locus_tag LOCUS_29100 3650 3009 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 protein_id gnl|my_center|LOCUS_29100 4573 3647 gene locus_tag LOCUS_29110 4573 3647 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 protein_id gnl|my_center|LOCUS_29110 5512 4691 gene locus_tag LOCUS_29120 5512 4691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035877.1 protein_id gnl|my_center|LOCUS_29120 6637 5525 gene locus_tag LOCUS_29130 6637 5525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035878.1 protein_id gnl|my_center|LOCUS_29130 6722 7996 gene locus_tag LOCUS_29140 6722 7996 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_29140 8608 8177 gene locus_tag LOCUS_29150 8608 8177 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_29150 10465 8771 gene locus_tag LOCUS_29160 10465 8771 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035881.1 protein_id gnl|my_center|LOCUS_29160 10921 10538 gene locus_tag LOCUS_29170 10921 10538 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439261.1 protein_id gnl|my_center|LOCUS_29170 11002 11781 gene locus_tag LOCUS_29180 gene pssA 11002 11781 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_29180 11778 12236 gene locus_tag LOCUS_29190 11778 12236 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035884.1 protein_id gnl|my_center|LOCUS_29190 12233 12730 gene locus_tag LOCUS_29200 gene rimI 12233 12730 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_29200 13564 12740 gene locus_tag LOCUS_29210 13564 12740 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_29210 13627 13716 gene locus_tag LOCUS_t00570 13627 13716 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16479 13654 gene locus_tag LOCUS_29220 16479 13654 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035888.1 protein_id gnl|my_center|LOCUS_29220 16712 16512 gene locus_tag LOCUS_29230 16712 16512 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417846.1 protein_id gnl|my_center|LOCUS_29230 17147 16722 gene locus_tag LOCUS_29240 17147 16722 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence062 1719 658 gene locus_tag LOCUS_29250 1719 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1649 2368 gene locus_tag LOCUS_29260 1649 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3718 2417 gene locus_tag LOCUS_29270 3718 2417 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 protein_id gnl|my_center|LOCUS_29270 3885 5276 gene locus_tag LOCUS_29280 3885 5276 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 protein_id gnl|my_center|LOCUS_29280 5409 6536 gene locus_tag LOCUS_29290 5409 6536 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037487.1 protein_id gnl|my_center|LOCUS_29290 6730 7941 gene locus_tag LOCUS_29300 gene potA 6730 7941 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275346.1 protein_id gnl|my_center|LOCUS_29300 7938 8864 gene locus_tag LOCUS_29310 7938 8864 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037482.1 protein_id gnl|my_center|LOCUS_29310 8861 9706 gene locus_tag LOCUS_29320 8861 9706 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037481.1 protein_id gnl|my_center|LOCUS_29320 9863 11230 gene locus_tag LOCUS_29330 9863 11230 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_29330 12605 11301 gene locus_tag LOCUS_29340 12605 11301 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_29340 13677 12658 gene locus_tag LOCUS_29350 13677 12658 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_29350 14937 13684 gene locus_tag LOCUS_29360 14937 13684 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 protein_id gnl|my_center|LOCUS_29360 15812 14934 gene locus_tag LOCUS_29370 15812 14934 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_29370 16484 15882 gene locus_tag LOCUS_29380 16484 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence063 1003 125 gene locus_tag LOCUS_29390 1003 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2931 1003 gene locus_tag LOCUS_29400 2931 1003 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_29400 3399 2932 gene locus_tag LOCUS_29410 gene ccmE 3399 2932 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037368.1 protein_id gnl|my_center|LOCUS_29410 3575 3396 gene locus_tag LOCUS_29420 3575 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 4324 3572 gene locus_tag LOCUS_29430 4324 3572 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 protein_id gnl|my_center|LOCUS_29430 4921 4466 gene locus_tag LOCUS_29440 gene azu 4921 4466 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_29440 5804 5052 gene locus_tag LOCUS_29450 5804 5052 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_29450 8332 5801 gene locus_tag LOCUS_29460 8332 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 9388 8345 gene locus_tag LOCUS_29470 9388 8345 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 protein_id gnl|my_center|LOCUS_29470 10116 9502 gene locus_tag LOCUS_29480 10116 9502 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008023.1 protein_id gnl|my_center|LOCUS_29480 10793 10221 gene locus_tag LOCUS_29490 10793 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 11569 10913 gene locus_tag LOCUS_29500 gene ccmA 11569 10913 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037364.1 protein_id gnl|my_center|LOCUS_29500 11731 12879 gene locus_tag LOCUS_29510 11731 12879 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_29510 12876 13214 gene locus_tag LOCUS_29520 12876 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 13207 14004 gene locus_tag LOCUS_29530 13207 14004 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_29530 14111 14542 gene locus_tag LOCUS_29540 14111 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_29540 15223 14585 gene locus_tag LOCUS_29550 15223 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_29550 15568 15227 gene locus_tag LOCUS_29560 15568 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence064 1206 535 gene locus_tag LOCUS_29570 1206 535 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053924.1 protein_id gnl|my_center|LOCUS_29570 1331 3334 gene locus_tag LOCUS_29580 1331 3334 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_29580 5048 4440 gene locus_tag LOCUS_29590 5048 4440 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_29590 6498 5137 gene locus_tag LOCUS_29600 gene mpl 6498 5137 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038392.1 protein_id gnl|my_center|LOCUS_29600 7360 6797 gene locus_tag LOCUS_29610 7360 6797 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_29610 7510 8766 gene locus_tag LOCUS_29620 7510 8766 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 protein_id gnl|my_center|LOCUS_29620 8784 8993 gene locus_tag LOCUS_29630 8784 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 9515 9027 gene locus_tag LOCUS_29640 9515 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275517.1 protein_id gnl|my_center|LOCUS_29640 9791 11836 gene locus_tag LOCUS_29650 9791 11836 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_29650 12623 11799 gene locus_tag LOCUS_29660 12623 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13771 12671 gene locus_tag LOCUS_29670 13771 12671 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972288.1 protein_id gnl|my_center|LOCUS_29670 15330 14338 gene locus_tag LOCUS_29680 15330 14338 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972287.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence065 5985 4798 gene locus_tag LOCUS_29690 gene prpF 5985 4798 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_29690 6721 6017 gene locus_tag LOCUS_29700 6721 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 9434 6816 gene locus_tag LOCUS_29710 gene acnD 9434 6816 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_29710 10865 9705 gene locus_tag LOCUS_29720 gene prpC 10865 9705 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_29720 11490 10891 gene locus_tag LOCUS_29730 11490 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 12409 11522 gene locus_tag LOCUS_29740 gene prpB 12409 11522 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036231.1 protein_id gnl|my_center|LOCUS_29740 12522 13745 gene locus_tag LOCUS_29750 12522 13745 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854964.1 protein_id gnl|my_center|LOCUS_29750 13775 14854 gene locus_tag LOCUS_29760 gene blaCAU 13775 14854 CDS product CAU/MBL1b family subclass B3 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920000.1 protein_id gnl|my_center|LOCUS_29760 15090 14956 gene locus_tag LOCUS_29770 15090 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence066 574 1713 gene locus_tag LOCUS_29780 574 1713 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_29780 3142 1727 gene locus_tag LOCUS_29790 3142 1727 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036624.1 protein_id gnl|my_center|LOCUS_29790 3961 3359 gene locus_tag LOCUS_29800 3961 3359 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 protein_id gnl|my_center|LOCUS_29800 5933 3990 gene locus_tag LOCUS_29810 gene asnB 5933 3990 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_29810 8218 5942 gene locus_tag LOCUS_29820 8218 5942 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_29820 8900 8262 gene locus_tag LOCUS_29830 8900 8262 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 protein_id gnl|my_center|LOCUS_29830 9674 9138 gene locus_tag LOCUS_29840 9674 9138 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_29840 10577 9723 gene locus_tag LOCUS_29850 10577 9723 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_29850 11165 10581 gene locus_tag LOCUS_29860 gene orn 11165 10581 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037314.1 protein_id gnl|my_center|LOCUS_29860 11775 11263 gene locus_tag LOCUS_29870 gene tadA 11775 11263 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037315.1 protein_id gnl|my_center|LOCUS_29870 12236 11772 gene locus_tag LOCUS_29880 12236 11772 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973490.1 protein_id gnl|my_center|LOCUS_29880 12389 12300 gene locus_tag LOCUS_t00580 12389 12300 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13451 12459 gene locus_tag LOCUS_29890 13451 12459 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_29890 14905 13625 gene locus_tag LOCUS_29900 gene serS 14905 13625 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036776.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence067 3779 3186 gene locus_tag LOCUS_29910 3779 3186 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450537.1 protein_id gnl|my_center|LOCUS_29910 4534 3776 gene locus_tag LOCUS_29920 4534 3776 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 protein_id gnl|my_center|LOCUS_29920 4851 4531 gene locus_tag LOCUS_29930 gene grxD 4851 4531 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037633.1 protein_id gnl|my_center|LOCUS_29930 4974 5552 gene locus_tag LOCUS_29940 4974 5552 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037634.1 protein_id gnl|my_center|LOCUS_29940 5952 5617 gene locus_tag LOCUS_29950 5952 5617 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945875.1 protein_id gnl|my_center|LOCUS_29950 7201 6056 gene locus_tag LOCUS_29960 7201 6056 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 protein_id gnl|my_center|LOCUS_29960 7701 7198 gene locus_tag LOCUS_29970 gene purE 7701 7198 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037636.1 protein_id gnl|my_center|LOCUS_29970 7761 8030 gene locus_tag LOCUS_29980 7761 8030 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_29980 8030 8902 gene locus_tag LOCUS_29990 gene nadC 8030 8902 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 protein_id gnl|my_center|LOCUS_29990 8965 9891 gene locus_tag LOCUS_30000 8965 9891 CDS product DUF2272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275327.1 protein_id gnl|my_center|LOCUS_30000 9999 10346 gene locus_tag LOCUS_30010 9999 10346 CDS product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050912576.1 protein_id gnl|my_center|LOCUS_30010 10829 10413 gene locus_tag LOCUS_30020 10829 10413 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_30020 11562 10927 gene locus_tag LOCUS_30030 11562 10927 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 protein_id gnl|my_center|LOCUS_30030 12458 11715 gene locus_tag LOCUS_30040 12458 11715 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_30040 13713 12451 gene locus_tag LOCUS_30050 13713 12451 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037466.1 protein_id gnl|my_center|LOCUS_30050 14336 13716 gene locus_tag LOCUS_30060 gene petA 14336 13716 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037467.1 protein_id gnl|my_center|LOCUS_30060 <15184 14509 gene locus_tag LOCUS_30070 <15184 14509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037468.1:lytic transglycosylase domain-containing protein >Feature sequence068 287 631 gene locus_tag LOCUS_30080 287 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 645 1874 gene locus_tag LOCUS_30090 645 1874 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_30090 1871 2281 gene locus_tag LOCUS_30100 1871 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2287 2538 gene locus_tag LOCUS_30110 2287 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2535 3761 gene locus_tag LOCUS_30120 2535 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3948 5021 gene locus_tag LOCUS_30130 gene nirK 3948 5021 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705926.1 protein_id gnl|my_center|LOCUS_30130 5036 5803 gene locus_tag LOCUS_30140 5036 5803 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200985.1 protein_id gnl|my_center|LOCUS_30140 5800 6396 gene locus_tag LOCUS_30150 5800 6396 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206326.1 protein_id gnl|my_center|LOCUS_30150 7209 6637 gene locus_tag LOCUS_30160 7209 6637 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_30160 8849 7683 gene locus_tag LOCUS_30170 8849 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 10519 9146 gene locus_tag LOCUS_30180 10519 9146 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206293.1 protein_id gnl|my_center|LOCUS_30180 11011 11523 gene locus_tag LOCUS_30190 11011 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 11525 11746 gene locus_tag LOCUS_30200 11525 11746 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_30200 11805 12803 gene locus_tag LOCUS_30210 11805 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence069 1401 2255 gene locus_tag LOCUS_30220 1401 2255 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 protein_id gnl|my_center|LOCUS_30220 3538 2369 gene locus_tag LOCUS_30230 3538 2369 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086627.1 protein_id gnl|my_center|LOCUS_30230 6495 3814 gene locus_tag LOCUS_30240 gene metH 6495 3814 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036697.1 protein_id gnl|my_center|LOCUS_30240 7625 6492 gene locus_tag LOCUS_30250 7625 6492 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036698.1 protein_id gnl|my_center|LOCUS_30250 8601 7672 gene locus_tag LOCUS_30260 8601 7672 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_30260 8808 9956 gene locus_tag LOCUS_30270 8808 9956 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_30270 10558 12711 gene locus_tag LOCUS_30280 10558 12711 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244161.1 protein_id gnl|my_center|LOCUS_30280 12708 14129 gene locus_tag LOCUS_30290 12708 14129 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_30290 14247 14654 gene locus_tag LOCUS_30300 14247 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence070 917 42 gene locus_tag LOCUS_30310 917 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508038.1 protein_id gnl|my_center|LOCUS_30310 916 1398 gene locus_tag LOCUS_30320 916 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1445 1801 gene locus_tag LOCUS_30330 1445 1801 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 protein_id gnl|my_center|LOCUS_30330 2022 2921 gene locus_tag LOCUS_30340 gene dapA 2022 2921 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_30340 3439 3005 gene locus_tag LOCUS_30350 3439 3005 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275103.1 protein_id gnl|my_center|LOCUS_30350 3822 5102 gene locus_tag LOCUS_30360 3822 5102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037495.1 protein_id gnl|my_center|LOCUS_30360 5707 5246 gene locus_tag LOCUS_30370 5707 5246 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037494.1 protein_id gnl|my_center|LOCUS_30370 7106 5778 gene locus_tag LOCUS_30380 7106 5778 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438097.1 protein_id gnl|my_center|LOCUS_30380 7390 7103 gene locus_tag LOCUS_30390 7390 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 7274 7930 gene locus_tag LOCUS_30400 7274 7930 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339032.1 protein_id gnl|my_center|LOCUS_30400 7917 9314 gene locus_tag LOCUS_30410 7917 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 9553 10632 gene locus_tag LOCUS_30420 9553 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 10637 13696 gene locus_tag LOCUS_30430 10637 13696 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_30430 13696 13998 gene locus_tag LOCUS_30440 13696 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence071 3257 51 gene locus_tag LOCUS_30450 gene putA 3257 51 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_30450 3561 4034 gene locus_tag LOCUS_30460 3561 4034 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506314.1 protein_id gnl|my_center|LOCUS_30460 4109 4990 gene locus_tag LOCUS_30470 gene coxB 4109 4990 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038913.1 protein_id gnl|my_center|LOCUS_30470 5055 6665 gene locus_tag LOCUS_30480 gene ctaD 5055 6665 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038912.1 protein_id gnl|my_center|LOCUS_30480 6677 6811 gene locus_tag LOCUS_30490 6677 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 6808 7395 gene locus_tag LOCUS_30500 6808 7395 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 protein_id gnl|my_center|LOCUS_30500 7417 8292 gene locus_tag LOCUS_30510 7417 8292 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_30510 8594 8376 gene locus_tag LOCUS_30520 8594 8376 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 protein_id gnl|my_center|LOCUS_30520 8652 9362 gene locus_tag LOCUS_30530 8652 9362 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038907.1 protein_id gnl|my_center|LOCUS_30530 9381 9965 gene locus_tag LOCUS_30540 9381 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_30540 9976 11139 gene locus_tag LOCUS_30550 9976 11139 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_30550 11144 12037 gene locus_tag LOCUS_30560 gene cyoE 11144 12037 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 protein_id gnl|my_center|LOCUS_30560 13090 12119 gene locus_tag LOCUS_30570 13090 12119 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994203.1 protein_id gnl|my_center|LOCUS_30570 13619 13122 gene locus_tag LOCUS_30580 13619 13122 CDS product sulfur transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_30580 14038 13640 gene locus_tag LOCUS_30590 14038 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence072 1632 1961 gene locus_tag LOCUS_30600 gene trxA 1632 1961 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038858.1 protein_id gnl|my_center|LOCUS_30600 2183 3913 gene locus_tag LOCUS_30610 2183 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 4858 3989 gene locus_tag LOCUS_30620 4858 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057678768.1 protein_id gnl|my_center|LOCUS_30620 6635 4917 gene locus_tag LOCUS_30630 gene aceK 6635 4917 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038861.1 protein_id gnl|my_center|LOCUS_30630 9039 6814 gene locus_tag LOCUS_30640 9039 6814 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_30640 9833 9345 gene locus_tag LOCUS_30650 9833 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038864.1 protein_id gnl|my_center|LOCUS_30650 10177 9878 gene locus_tag LOCUS_30660 10177 9878 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038865.1 protein_id gnl|my_center|LOCUS_30660 11092 10280 gene locus_tag LOCUS_30670 gene queF 11092 10280 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038866.1 protein_id gnl|my_center|LOCUS_30670 12618 11302 gene locus_tag LOCUS_30680 12618 11302 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence073 1983 871 gene locus_tag LOCUS_30690 1983 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30690 4472 1980 gene locus_tag LOCUS_30700 4472 1980 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 protein_id gnl|my_center|LOCUS_30700 4663 5115 gene locus_tag LOCUS_30710 4663 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 5294 6262 gene locus_tag LOCUS_30720 5294 6262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202932.1 protein_id gnl|my_center|LOCUS_30720 7481 6279 gene locus_tag LOCUS_30730 7481 6279 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018972380.1 protein_id gnl|my_center|LOCUS_30730 7989 7537 gene locus_tag LOCUS_30740 7989 7537 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_30740 7892 8809 gene locus_tag LOCUS_30750 7892 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 8861 9802 gene locus_tag LOCUS_30760 gene rlmF 8861 9802 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266817.1 protein_id gnl|my_center|LOCUS_30760 9869 10636 gene locus_tag LOCUS_30770 9869 10636 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054659530.1 protein_id gnl|my_center|LOCUS_30770 10807 11784 gene locus_tag LOCUS_30780 10807 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30780 11777 11971 gene locus_tag LOCUS_30790 11777 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30790 12068 13987 gene locus_tag LOCUS_30800 12068 13987 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438954.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence074 2620 1253 gene locus_tag LOCUS_30810 2620 1253 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_30810 3926 2652 gene locus_tag LOCUS_30820 gene kynU 3926 2652 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_30820 4586 4065 gene locus_tag LOCUS_30830 4586 4065 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_30830 5268 4606 gene locus_tag LOCUS_30840 gene can 5268 4606 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_30840 6046 5336 gene locus_tag LOCUS_30850 6046 5336 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 protein_id gnl|my_center|LOCUS_30850 6368 6054 gene locus_tag LOCUS_30860 6368 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036742.1 protein_id gnl|my_center|LOCUS_30860 6670 6365 gene locus_tag LOCUS_30870 6670 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036743.1 protein_id gnl|my_center|LOCUS_30870 8174 6780 gene locus_tag LOCUS_30880 gene asnS 8174 6780 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036745.1 protein_id gnl|my_center|LOCUS_30880 8320 8658 gene locus_tag LOCUS_30890 8320 8658 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507399.1 protein_id gnl|my_center|LOCUS_30890 8909 9340 gene locus_tag LOCUS_30900 gene rpsF 8909 9340 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036747.1 protein_id gnl|my_center|LOCUS_30900 9352 9582 gene locus_tag LOCUS_30910 gene rpsR 9352 9582 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991243.1 protein_id gnl|my_center|LOCUS_30910 9744 10193 gene locus_tag LOCUS_30920 gene rplI 9744 10193 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991240.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence075 1024 242 gene locus_tag LOCUS_30930 1024 242 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_30930 1190 1888 gene locus_tag LOCUS_30940 1190 1888 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004429231.1 protein_id gnl|my_center|LOCUS_30940 2072 2887 gene locus_tag LOCUS_30950 2072 2887 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036720.1 protein_id gnl|my_center|LOCUS_30950 2884 3786 gene locus_tag LOCUS_30960 2884 3786 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 protein_id gnl|my_center|LOCUS_30960 4624 4055 gene locus_tag LOCUS_30970 4624 4055 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 protein_id gnl|my_center|LOCUS_30970 4675 5202 gene locus_tag LOCUS_30980 4675 5202 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_30980 5334 7526 gene locus_tag LOCUS_30990 gene rlmKL 5334 7526 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036729.1 protein_id gnl|my_center|LOCUS_30990 7683 10079 gene locus_tag LOCUS_31000 7683 10079 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_31000 10082 11377 gene locus_tag LOCUS_31010 10082 11377 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_31010 11857 11441 gene locus_tag LOCUS_31020 gene rnfB 11857 11441 CDS product Rnf electron transport complex subunit RnfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036529.1 protein_id gnl|my_center|LOCUS_31020 12453 11863 gene locus_tag LOCUS_31030 12453 11863 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036530.1 protein_id gnl|my_center|LOCUS_31030 <13591 12583 gene locus_tag LOCUS_31040 <13591 12583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036531.1:methionine--tRNA ligase >Feature sequence076 112 585 gene locus_tag LOCUS_31050 112 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 789 2078 gene locus_tag LOCUS_31060 789 2078 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 protein_id gnl|my_center|LOCUS_31060 2293 4299 gene locus_tag LOCUS_31070 gene tkt 2293 4299 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038323.1 protein_id gnl|my_center|LOCUS_31070 4519 4899 gene locus_tag LOCUS_31080 4519 4899 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_31080 7258 5303 gene locus_tag LOCUS_31090 7258 5303 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275287.1 protein_id gnl|my_center|LOCUS_31090 7377 7751 gene locus_tag LOCUS_31100 7377 7751 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_31100 7738 9000 gene locus_tag LOCUS_31110 7738 9000 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038311.1 protein_id gnl|my_center|LOCUS_31110 9000 9593 gene locus_tag LOCUS_31120 9000 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038310.1 protein_id gnl|my_center|LOCUS_31120 10849 10031 gene locus_tag LOCUS_31130 10849 10031 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_31130 11637 10993 gene locus_tag LOCUS_31140 11637 10993 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_31140 11880 12881 gene locus_tag LOCUS_31150 gene gap 11880 12881 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence077 636 28 gene locus_tag LOCUS_31160 636 28 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037411.1 protein_id gnl|my_center|LOCUS_31160 1606 707 gene locus_tag LOCUS_31170 1606 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1695 2147 gene locus_tag LOCUS_31180 1695 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2847 2167 gene locus_tag LOCUS_31190 2847 2167 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037412.1 protein_id gnl|my_center|LOCUS_31190 3572 2850 gene locus_tag LOCUS_31200 3572 2850 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037413.1 protein_id gnl|my_center|LOCUS_31200 4943 3600 gene locus_tag LOCUS_31210 4943 3600 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_31210 5621 4983 gene locus_tag LOCUS_31220 5621 4983 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_31220 6192 5626 gene locus_tag LOCUS_31230 gene efp 6192 5626 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037416.1 protein_id gnl|my_center|LOCUS_31230 6294 7331 gene locus_tag LOCUS_31240 gene epmB 6294 7331 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_31240 9678 7534 gene locus_tag LOCUS_31250 9678 7534 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 protein_id gnl|my_center|LOCUS_31250 10532 9675 gene locus_tag LOCUS_31260 10532 9675 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_31260 11410 10655 gene locus_tag LOCUS_31270 11410 10655 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037420.1 protein_id gnl|my_center|LOCUS_31270 11531 12358 gene locus_tag LOCUS_31280 11531 12358 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence078 1622 1236 gene locus_tag LOCUS_31290 1622 1236 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 protein_id gnl|my_center|LOCUS_31290 2853 1738 gene locus_tag LOCUS_31300 2853 1738 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035306.1 protein_id gnl|my_center|LOCUS_31300 2983 3303 gene locus_tag LOCUS_31310 2983 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012436881.1 protein_id gnl|my_center|LOCUS_31310 3404 3802 gene locus_tag LOCUS_31320 3404 3802 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014505965.1 protein_id gnl|my_center|LOCUS_31320 4028 8482 gene locus_tag LOCUS_31330 gene gltB 4028 8482 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035290.1 protein_id gnl|my_center|LOCUS_31330 8580 10025 gene locus_tag LOCUS_31340 8580 10025 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035289.1 protein_id gnl|my_center|LOCUS_31340 10337 11257 gene locus_tag LOCUS_31350 10337 11257 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812450.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence079 1688 1503 gene locus_tag LOCUS_31360 1688 1503 CDS product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115004114.1 protein_id gnl|my_center|LOCUS_31360 2780 1917 gene locus_tag LOCUS_31370 2780 1917 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036251.1 protein_id gnl|my_center|LOCUS_31370 3886 2777 gene locus_tag LOCUS_31380 gene hflK 3886 2777 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 protein_id gnl|my_center|LOCUS_31380 4033 5028 gene locus_tag LOCUS_31390 4033 5028 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_31390 5048 5500 gene locus_tag LOCUS_31400 gene pilH 5048 5500 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_31400 6544 5645 gene locus_tag LOCUS_31410 6544 5645 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 protein_id gnl|my_center|LOCUS_31410 7110 6670 gene locus_tag LOCUS_31420 7110 6670 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_31420 7261 7743 gene locus_tag LOCUS_31430 7261 7743 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036246.1 protein_id gnl|my_center|LOCUS_31430 7775 8350 gene locus_tag LOCUS_31440 7775 8350 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036245.1 protein_id gnl|my_center|LOCUS_31440 8861 8676 gene locus_tag LOCUS_31450 8861 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 11262 8935 gene locus_tag LOCUS_31460 gene pbpC 11262 8935 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence080 1224 10 gene locus_tag LOCUS_31470 gene kbl 1224 10 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 protein_id gnl|my_center|LOCUS_31470 1386 2813 gene locus_tag LOCUS_31480 1386 2813 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403196.1 protein_id gnl|my_center|LOCUS_31480 2826 3848 gene locus_tag LOCUS_31490 2826 3848 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036154.1 protein_id gnl|my_center|LOCUS_31490 3852 4706 gene locus_tag LOCUS_31500 gene cysT 3852 4706 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036155.1 protein_id gnl|my_center|LOCUS_31500 4703 5644 gene locus_tag LOCUS_31510 gene cysW 4703 5644 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036156.1 protein_id gnl|my_center|LOCUS_31510 5654 6697 gene locus_tag LOCUS_31520 5654 6697 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036157.1 protein_id gnl|my_center|LOCUS_31520 6820 7515 gene locus_tag LOCUS_31530 6820 7515 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036158.1 protein_id gnl|my_center|LOCUS_31530 8624 7602 gene locus_tag LOCUS_31540 gene tdh 8624 7602 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666275.1 protein_id gnl|my_center|LOCUS_31540 8771 10936 gene locus_tag LOCUS_31550 8771 10936 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence081 1899 1 gene locus_tag LOCUS_31560 1899 1 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438954.1 protein_id gnl|my_center|LOCUS_31560 2578 1934 gene locus_tag LOCUS_31570 2578 1934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_31570 2732 4360 gene locus_tag LOCUS_31580 2732 4360 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275119.1 protein_id gnl|my_center|LOCUS_31580 4538 6172 gene locus_tag LOCUS_31590 4538 6172 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506028.1 protein_id gnl|my_center|LOCUS_31590 6195 7529 gene locus_tag LOCUS_31600 6195 7529 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_31600 7666 8394 gene locus_tag LOCUS_31610 7666 8394 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035350.1 protein_id gnl|my_center|LOCUS_31610 8411 9400 gene locus_tag LOCUS_31620 8411 9400 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_31620 9435 10337 gene locus_tag LOCUS_31630 9435 10337 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence082 1203 136 gene locus_tag LOCUS_31640 1203 136 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_31640 1789 1190 gene locus_tag LOCUS_31650 gene pnuC 1789 1190 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_31650 3290 1911 gene locus_tag LOCUS_31660 3290 1911 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_31660 3504 4196 gene locus_tag LOCUS_31670 3504 4196 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 protein_id gnl|my_center|LOCUS_31670 4233 4556 gene locus_tag LOCUS_31680 4233 4556 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035277.1 protein_id gnl|my_center|LOCUS_31680 6120 4705 gene locus_tag LOCUS_31690 6120 4705 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275102.1 protein_id gnl|my_center|LOCUS_31690 7497 6223 gene locus_tag LOCUS_31700 7497 6223 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014505949.1 protein_id gnl|my_center|LOCUS_31700 7589 8245 gene locus_tag LOCUS_31710 7589 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_31710 8305 10020 gene locus_tag LOCUS_31720 8305 10020 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_31720 10052 10219 gene locus_tag LOCUS_31730 10052 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence083 494 231 gene locus_tag LOCUS_31740 494 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1525 974 gene locus_tag LOCUS_31750 1525 974 CDS product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036733.1 protein_id gnl|my_center|LOCUS_31750 2012 1542 gene locus_tag LOCUS_31760 2012 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2773 2087 gene locus_tag LOCUS_31770 2773 2087 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_31770 4248 2770 gene locus_tag LOCUS_31780 gene sbcB 4248 2770 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036735.1 protein_id gnl|my_center|LOCUS_31780 5656 4283 gene locus_tag LOCUS_31790 5656 4283 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_31790 6949 5675 gene locus_tag LOCUS_31800 gene kynU 6949 5675 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_31800 7580 7062 gene locus_tag LOCUS_31810 7580 7062 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_31810 8259 7597 gene locus_tag LOCUS_31820 gene can 8259 7597 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_31820 9037 8327 gene locus_tag LOCUS_31830 9037 8327 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 protein_id gnl|my_center|LOCUS_31830 9359 9045 gene locus_tag LOCUS_31840 9359 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036742.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence084 568 1521 gene locus_tag LOCUS_31850 568 1521 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114264.1 protein_id gnl|my_center|LOCUS_31850 1598 4024 gene locus_tag LOCUS_31860 gene mrcB 1598 4024 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038055.1 protein_id gnl|my_center|LOCUS_31860 4030 4548 gene locus_tag LOCUS_31870 4030 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 protein_id gnl|my_center|LOCUS_31870 4601 6424 gene locus_tag LOCUS_31880 4601 6424 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267921.1 protein_id gnl|my_center|LOCUS_31880 6421 7662 gene locus_tag LOCUS_31890 6421 7662 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267920.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence085 1049 564 gene locus_tag LOCUS_31900 gene ybeY 1049 564 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_31900 1579 1385 gene locus_tag LOCUS_31910 1579 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1697 2002 gene locus_tag LOCUS_31920 1697 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2966 1983 gene locus_tag LOCUS_31930 2966 1983 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_31930 3144 3872 gene locus_tag LOCUS_31940 3144 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3865 4830 gene locus_tag LOCUS_31950 3865 4830 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 protein_id gnl|my_center|LOCUS_31950 4830 5777 gene locus_tag LOCUS_31960 4830 5777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704458.1 protein_id gnl|my_center|LOCUS_31960 5774 6862 gene locus_tag LOCUS_31970 5774 6862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 protein_id gnl|my_center|LOCUS_31970 8558 7134 gene locus_tag LOCUS_31980 gene miaB 8558 7134 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_31980 8557 8769 gene locus_tag LOCUS_31990 8557 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence086 3157 884 gene locus_tag LOCUS_32000 3157 884 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_32000 5075 4320 gene locus_tag LOCUS_32010 gene anr 5075 4320 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_32010 6492 5095 gene locus_tag LOCUS_32020 gene hemN 6492 5095 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 protein_id gnl|my_center|LOCUS_32020 6697 7617 gene locus_tag LOCUS_32030 gene rocF 6697 7617 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039000.1 protein_id gnl|my_center|LOCUS_32030 7745 7897 gene locus_tag LOCUS_32040 7745 7897 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 protein_id gnl|my_center|LOCUS_32040 7953 8087 gene locus_tag LOCUS_32050 7953 8087 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 protein_id gnl|my_center|LOCUS_32050 8288 8509 gene locus_tag LOCUS_32060 8288 8509 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038998.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence087 <1 3433 gene locus_tag LOCUS_32070 <1 3433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114080.1:PAS domain-containing hybrid sensor histidine kinase/response regulator 3809 3453 gene locus_tag LOCUS_32080 3809 3453 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_32080 4291 3920 gene locus_tag LOCUS_32090 4291 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 4647 4288 gene locus_tag LOCUS_32100 4647 4288 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_32100 5033 4644 gene locus_tag LOCUS_32110 5033 4644 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546528.1 protein_id gnl|my_center|LOCUS_32110 5131 5334 gene locus_tag LOCUS_32120 5131 5334 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_32120 5344 6417 gene locus_tag LOCUS_32130 5344 6417 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence088 62 784 gene locus_tag LOCUS_32140 62 784 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 protein_id gnl|my_center|LOCUS_32140 1329 805 gene locus_tag LOCUS_32150 1329 805 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_32150 3094 1337 gene locus_tag LOCUS_32160 gene aspS 3094 1337 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038145.1 protein_id gnl|my_center|LOCUS_32160 3253 4458 gene locus_tag LOCUS_32170 3253 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 5133 4492 gene locus_tag LOCUS_32180 5133 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038147.1 protein_id gnl|my_center|LOCUS_32180 6695 5448 gene locus_tag LOCUS_32190 6695 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 7656 6766 gene locus_tag LOCUS_32200 gene bla 7656 6766 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038154.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence089 <1 875 gene locus_tag LOCUS_32210 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039107.1:TolC family protein 872 1864 gene locus_tag LOCUS_32220 872 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1854 5057 gene locus_tag LOCUS_32230 1854 5057 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275504.1 protein_id gnl|my_center|LOCUS_32230 5172 5804 gene locus_tag LOCUS_32240 5172 5804 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_32240 5863 6549 gene locus_tag LOCUS_32250 5863 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 6765 7001 gene locus_tag LOCUS_32260 gene rpmB 6765 7001 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_32260 7015 7179 gene locus_tag LOCUS_32270 gene rpmG 7015 7179 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809462.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence090 503 1045 gene locus_tag LOCUS_32280 503 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1096 1377 gene locus_tag LOCUS_32290 1096 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1460 1924 gene locus_tag LOCUS_32300 1460 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2019 2777 gene locus_tag LOCUS_32310 2019 2777 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_32310 3079 3432 gene locus_tag LOCUS_32320 3079 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3569 4126 gene locus_tag LOCUS_32330 3569 4126 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_32330 4211 4510 gene locus_tag LOCUS_32340 4211 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 4511 4876 gene locus_tag LOCUS_32350 4511 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 5009 5371 gene locus_tag LOCUS_32360 5009 5371 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490264.1 protein_id gnl|my_center|LOCUS_32360 5873 5457 gene locus_tag LOCUS_32370 5873 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509657.1 protein_id gnl|my_center|LOCUS_32370 <7191 5954 gene locus_tag LOCUS_32380 <7191 5954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036313.1:multidrug effflux MFS transporter >Feature sequence091 3154 2162 gene locus_tag LOCUS_32390 3154 2162 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267791.1 protein_id gnl|my_center|LOCUS_32390 3758 3129 gene locus_tag LOCUS_32400 3758 3129 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 protein_id gnl|my_center|LOCUS_32400 4127 5137 gene locus_tag LOCUS_32410 4127 5137 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_32410 5134 7089 gene locus_tag LOCUS_32420 5134 7089 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence092 3 2156 gene locus_tag LOCUS_32430 3 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 2206 4290 gene locus_tag LOCUS_32440 2206 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 6029 4287 gene locus_tag LOCUS_32450 6029 4287 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920557.1 protein_id gnl|my_center|LOCUS_32450 6709 6029 gene locus_tag LOCUS_32460 6709 6029 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640564.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence093 4133 2013 gene locus_tag LOCUS_32470 4133 2013 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 protein_id gnl|my_center|LOCUS_32470 6052 4787 gene locus_tag LOCUS_32480 6052 4787 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_32480 6338 6703 gene locus_tag LOCUS_32490 6338 6703 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035759.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence094 150 785 gene locus_tag LOCUS_32500 150 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 935 1243 gene locus_tag LOCUS_32510 935 1243 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037055.1 protein_id gnl|my_center|LOCUS_32510 1240 1605 gene locus_tag LOCUS_32520 1240 1605 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_32520 1647 3638 gene locus_tag LOCUS_32530 1647 3638 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_32530 3898 5058 gene locus_tag LOCUS_32540 3898 5058 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038445.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence095 1218 406 gene locus_tag LOCUS_32550 1218 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3298 1334 gene locus_tag LOCUS_32560 3298 1334 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_32560 <6249 3448 gene locus_tag LOCUS_32570 <6249 3448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035779.1:TonB-dependent receptor >Feature sequence096 66 713 gene locus_tag LOCUS_32580 66 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2152 827 gene locus_tag LOCUS_32590 2152 827 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438824.1 protein_id gnl|my_center|LOCUS_32590 3037 2441 gene locus_tag LOCUS_32600 3037 2441 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 protein_id gnl|my_center|LOCUS_32600 3100 3555 gene locus_tag LOCUS_32610 3100 3555 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 protein_id gnl|my_center|LOCUS_32610 4594 3635 gene locus_tag LOCUS_32620 4594 3635 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 protein_id gnl|my_center|LOCUS_32620 <6151 4671 gene locus_tag LOCUS_32630 <6151 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036550.1:DNA polymerase III subunit alpha >Feature sequence097 2968 443 gene locus_tag LOCUS_32640 2968 443 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037035.1 protein_id gnl|my_center|LOCUS_32640 4048 2972 gene locus_tag LOCUS_32650 4048 2972 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_32650 4641 4045 gene locus_tag LOCUS_32660 gene cheD 4641 4045 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037037.1 protein_id gnl|my_center|LOCUS_32660 5483 4638 gene locus_tag LOCUS_32670 5483 4638 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037038.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence098 134 406 gene locus_tag LOCUS_32680 134 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074058919.1 protein_id gnl|my_center|LOCUS_32680 403 795 gene locus_tag LOCUS_32690 403 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2077 3342 gene locus_tag LOCUS_32700 2077 3342 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038665.1 protein_id gnl|my_center|LOCUS_32700 3619 3410 gene locus_tag LOCUS_32710 3619 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 4380 3907 gene locus_tag LOCUS_32720 4380 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 5233 4424 gene locus_tag LOCUS_32730 5233 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence099 382 705 gene locus_tag LOCUS_32740 382 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 2558 786 gene locus_tag LOCUS_32750 2558 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035345.1 protein_id gnl|my_center|LOCUS_32750 4687 2555 gene locus_tag LOCUS_32760 4687 2555 CDS product DUF4175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640602.1 protein_id gnl|my_center|LOCUS_32760 <5522 4684 gene locus_tag LOCUS_32770 <5522 4684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035347.1:BatA domain-containing protein >Feature sequence100 2 1660 gene locus_tag LOCUS_32780 2 1660 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102996.1 protein_id gnl|my_center|LOCUS_32780 1691 3097 gene locus_tag LOCUS_32790 1691 3097 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102997.1 protein_id gnl|my_center|LOCUS_32790 3191 4216 gene locus_tag LOCUS_32800 3191 4216 CDS product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266162.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence101 157 579 gene locus_tag LOCUS_32810 157 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1033 1665 gene locus_tag LOCUS_32820 gene catB 1033 1665 CDS product type B chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073960.1 protein_id gnl|my_center|LOCUS_32820 1912 2328 gene locus_tag LOCUS_32830 1912 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3269 2325 gene locus_tag LOCUS_32840 3269 2325 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931401.1 protein_id gnl|my_center|LOCUS_32840 3418 3792 gene locus_tag LOCUS_32850 3418 3792 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_32850 3808 4353 gene locus_tag LOCUS_32860 3808 4353 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494172.1 protein_id gnl|my_center|LOCUS_32860 4746 5069 gene locus_tag LOCUS_32870 4746 5069 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989541.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence102 994 2883 gene locus_tag LOCUS_32880 gene speA 994 2883 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_32880 3803 3051 gene locus_tag LOCUS_32890 3803 3051 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 protein_id gnl|my_center|LOCUS_32890 4080 4556 gene locus_tag LOCUS_32900 4080 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 5031 4687 gene locus_tag LOCUS_32910 5031 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence103 1068 511 gene locus_tag LOCUS_32920 1068 511 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_32920 1226 4138 gene locus_tag LOCUS_32930 1226 4138 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052103386.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence104 1734 373 gene locus_tag LOCUS_32940 gene rimO 1734 373 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037694.1 protein_id gnl|my_center|LOCUS_32940 1879 2538 gene locus_tag LOCUS_32950 1879 2538 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037696.1 protein_id gnl|my_center|LOCUS_32950 2535 2957 gene locus_tag LOCUS_32960 2535 2957 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037697.1 protein_id gnl|my_center|LOCUS_32960 2988 3155 gene locus_tag LOCUS_32970 2988 3155 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037698.1 protein_id gnl|my_center|LOCUS_32970 3800 3228 gene locus_tag LOCUS_32980 gene dcd 3800 3228 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_32980 <4731 3907 gene locus_tag LOCUS_32990 <4731 3907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040941024.1:iron-sulfur cluster carrier protein ApbC >Feature sequence105 495 1535 gene locus_tag LOCUS_33000 495 1535 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_33000 1677 2885 gene locus_tag LOCUS_33010 1677 2885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_33010 3036 3629 gene locus_tag LOCUS_33020 3036 3629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_33020 3970 3686 gene locus_tag LOCUS_33030 3970 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence106 3 248 gene locus_tag LOCUS_33040 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 379 1152 gene locus_tag LOCUS_33050 379 1152 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507623.1 protein_id gnl|my_center|LOCUS_33050 1237 1728 gene locus_tag LOCUS_33060 1237 1728 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_33060 1759 2223 gene locus_tag LOCUS_33070 1759 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence107 290 880 gene locus_tag LOCUS_33080 290 880 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038689.1 protein_id gnl|my_center|LOCUS_33080 966 1649 gene locus_tag LOCUS_33090 966 1649 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 protein_id gnl|my_center|LOCUS_33090 2159 1758 gene locus_tag LOCUS_33100 2159 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 2589 2278 gene locus_tag LOCUS_33110 2589 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3451 2660 gene locus_tag LOCUS_33120 3451 2660 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038691.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence108 605 117 gene locus_tag LOCUS_33130 605 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3851 843 gene locus_tag LOCUS_33140 3851 843 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039153.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence109 51 266 gene locus_tag LOCUS_33150 51 266 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383123.1 protein_id gnl|my_center|LOCUS_33150 579 896 gene locus_tag LOCUS_33160 579 896 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768387.1 protein_id gnl|my_center|LOCUS_33160 986 1279 gene locus_tag LOCUS_33170 986 1279 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105515.1 protein_id gnl|my_center|LOCUS_33170 1316 1636 gene locus_tag LOCUS_33180 1316 1636 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316115.1 protein_id gnl|my_center|LOCUS_33180 1633 3588 gene locus_tag LOCUS_33190 1633 3588 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269381.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence110 1422 2504 gene locus_tag LOCUS_33200 gene lptF 1422 2504 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence111 706 473 gene locus_tag LOCUS_33210 706 473 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114662.1 protein_id gnl|my_center|LOCUS_33210 1207 782 gene locus_tag LOCUS_33220 1207 782 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_33220 1360 2364 gene locus_tag LOCUS_33230 1360 2364 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 protein_id gnl|my_center|LOCUS_33230 2685 2464 gene locus_tag LOCUS_33240 2685 2464 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379418.1 protein_id gnl|my_center|LOCUS_33240 3002 2787 gene locus_tag LOCUS_33250 3002 2787 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence112 43 2343 gene locus_tag LOCUS_33260 43 2343 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054358.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence113 285 1352 gene locus_tag LOCUS_33270 gene dinB 285 1352 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406165.1 protein_id gnl|my_center|LOCUS_33270 2338 1379 gene locus_tag LOCUS_33280 2338 1379 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245435.1 protein_id gnl|my_center|LOCUS_33280 <3044 2353 gene locus_tag LOCUS_33290 <3044 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104817.1:proline--tRNA ligase >Feature sequence114 3 593 gene locus_tag LOCUS_33300 3 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 741 1970 gene locus_tag LOCUS_33310 741 1970 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247215.1 protein_id gnl|my_center|LOCUS_33310 2584 1952 gene locus_tag LOCUS_33320 2584 1952 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence115 <2743 74 gene locus_tag LOCUS_33330 <2743 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039298.1:TonB-dependent receptor >Feature sequence116 <1 695 gene locus_tag LOCUS_33340 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035938.1:thiamine-phosphate kinase 2515 1136 gene locus_tag LOCUS_33350 2515 1136 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence117 14 655 gene locus_tag LOCUS_33360 14 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266299.1 protein_id gnl|my_center|LOCUS_33360 2376 844 gene locus_tag LOCUS_33370 2376 844 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403858.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence118 >Feature sequence119 1729 410 gene locus_tag LOCUS_33380 1729 410 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence120 888 502 gene locus_tag LOCUS_33390 888 502 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_33390 1193 1819 gene locus_tag LOCUS_33400 1193 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2073 1873 gene locus_tag LOCUS_33410 2073 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence121 1538 729 gene locus_tag LOCUS_33420 gene trpA 1538 729 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037671.1 protein_id gnl|my_center|LOCUS_33420 2136 1540 gene locus_tag LOCUS_33430 2136 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437952.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence122 >Feature sequence123 1388 1819 gene locus_tag LOCUS_33440 1388 1819 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438075.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence124 >Feature sequence125 <1 656 gene locus_tag LOCUS_33450 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114721.1:MBL fold metallo-hydrolase 822 1667 gene locus_tag LOCUS_33460 822 1667 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918743.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence126 1258 437 gene locus_tag LOCUS_33470 1258 437 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 protein_id gnl|my_center|LOCUS_33470 1705 1304 gene locus_tag LOCUS_33480 1705 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence127 986 288 gene locus_tag LOCUS_33490 986 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_33490 1077 1280 gene locus_tag LOCUS_33500 1077 1280 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence128 >Feature sequence129 723 1349 gene locus_tag LOCUS_33510 723 1349 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_33510 >Feature sequence130 <1 530 gene locus_tag LOCUS_33520 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114659.1:HAD family hydrolase <1448 565 gene locus_tag LOCUS_33530 <1448 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103011.1:aminopeptidase >Feature sequence131 <1 864 gene locus_tag LOCUS_33540 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037106.1:flagellin 1012 857 gene locus_tag LOCUS_33550 1012 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence132 1415 186 gene locus_tag LOCUS_33560 1415 186 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105418.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence133 >Feature sequence134 >Feature sequence135 226 861 gene locus_tag LOCUS_33570 gene nth 226 861 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence136 >Feature sequence137 501 1229 gene locus_tag LOCUS_33580 501 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence138 <1 1060 gene locus_tag LOCUS_33590 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037143.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence139 >Feature sequence140 955 50 gene locus_tag LOCUS_33600 955 50 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence141 238 618 gene locus_tag LOCUS_33610 238 618 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence142 >Feature sequence143 >Feature sequence144 3 839 gene locus_tag LOCUS_33620 3 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620