>Feature sequence001 <1 658 gene locus_tag LOCUS_00010 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742186.1:ABC transporter permease 982 572 gene locus_tag LOCUS_00020 982 572 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_00020 1109 2584 gene locus_tag LOCUS_00030 1109 2584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230306.1 protein_id gnl|my_center|LOCUS_00030 2849 2586 gene locus_tag LOCUS_00040 2849 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4018 2864 gene locus_tag LOCUS_00050 4018 2864 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_00050 4364 4044 gene locus_tag LOCUS_00060 4364 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 5155 4361 gene locus_tag LOCUS_00070 5155 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 5288 5959 gene locus_tag LOCUS_00080 5288 5959 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223976.1 protein_id gnl|my_center|LOCUS_00080 6120 7289 gene locus_tag LOCUS_00090 6120 7289 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_00090 7282 7602 gene locus_tag LOCUS_00100 7282 7602 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_00100 7599 9002 gene locus_tag LOCUS_00110 7599 9002 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_00110 9148 8999 gene locus_tag LOCUS_00120 9148 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10687 9341 gene locus_tag LOCUS_00130 10687 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11177 10989 gene locus_tag LOCUS_00140 11177 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11143 12465 gene locus_tag LOCUS_00150 gene aprX 11143 12465 CDS product serine protease AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967303.1 protein_id gnl|my_center|LOCUS_00150 12689 13192 gene locus_tag LOCUS_00160 12689 13192 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_00160 13263 13808 gene locus_tag LOCUS_00170 13263 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15113 13878 gene locus_tag LOCUS_00180 15113 13878 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_00180 15396 15154 gene locus_tag LOCUS_00190 15396 15154 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_00190 16433 15459 gene locus_tag LOCUS_00200 16433 15459 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_00200 17377 16430 gene locus_tag LOCUS_00210 17377 16430 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223988.1 protein_id gnl|my_center|LOCUS_00210 18739 17531 gene locus_tag LOCUS_00220 18739 17531 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223990.1 protein_id gnl|my_center|LOCUS_00220 19194 19958 gene locus_tag LOCUS_00230 19194 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_00230 22862 20043 gene locus_tag LOCUS_00240 gene aceE 22862 20043 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_00240 23246 23668 gene locus_tag LOCUS_00250 23246 23668 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_00250 23732 24220 gene locus_tag LOCUS_00260 23732 24220 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_00260 24255 24327 gene locus_tag LOCUS_t00010 24255 24327 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24690 26198 gene locus_tag LOCUS_00270 24690 26198 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 protein_id gnl|my_center|LOCUS_00270 26803 26213 gene locus_tag LOCUS_00280 26803 26213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30076 26837 gene locus_tag LOCUS_00290 30076 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30385 32010 gene locus_tag LOCUS_00300 30385 32010 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408781.1 protein_id gnl|my_center|LOCUS_00300 32861 32043 gene locus_tag LOCUS_00310 32861 32043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33384 32938 gene locus_tag LOCUS_00320 33384 32938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33677 36730 gene locus_tag LOCUS_00330 33677 36730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36930 38435 gene locus_tag LOCUS_00340 36930 38435 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_00340 38435 39670 gene locus_tag LOCUS_00350 38435 39670 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_00350 39667 40452 gene locus_tag LOCUS_00360 39667 40452 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222499.1 protein_id gnl|my_center|LOCUS_00360 40452 41096 gene locus_tag LOCUS_00370 40452 41096 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222498.1 protein_id gnl|my_center|LOCUS_00370 41100 42137 gene locus_tag LOCUS_00380 41100 42137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978470.1 protein_id gnl|my_center|LOCUS_00380 42134 43411 gene locus_tag LOCUS_00390 42134 43411 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_00390 43417 44724 gene locus_tag LOCUS_00400 43417 44724 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222495.1 protein_id gnl|my_center|LOCUS_00400 44721 45671 gene locus_tag LOCUS_00410 44721 45671 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_00410 45674 46918 gene locus_tag LOCUS_00420 45674 46918 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222493.1 protein_id gnl|my_center|LOCUS_00420 46918 47466 gene locus_tag LOCUS_00430 46918 47466 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027085.1 protein_id gnl|my_center|LOCUS_00430 47463 48788 gene locus_tag LOCUS_00440 47463 48788 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027086.1 protein_id gnl|my_center|LOCUS_00440 48973 48704 gene locus_tag LOCUS_00450 48973 48704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50118 48922 gene locus_tag LOCUS_00460 gene metK 50118 48922 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_00460 50835 50200 gene locus_tag LOCUS_00470 50835 50200 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222488.1 protein_id gnl|my_center|LOCUS_00470 51242 51051 gene locus_tag LOCUS_00480 51242 51051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52469 51258 gene locus_tag LOCUS_00490 52469 51258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_00490 53331 52486 gene locus_tag LOCUS_00500 53331 52486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54626 53328 gene locus_tag LOCUS_00510 54626 53328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027079.1 protein_id gnl|my_center|LOCUS_00510 56149 54626 gene locus_tag LOCUS_00520 56149 54626 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027078.1 protein_id gnl|my_center|LOCUS_00520 58139 56169 gene locus_tag LOCUS_00530 58139 56169 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_00530 60331 58136 gene locus_tag LOCUS_00540 60331 58136 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_00540 62261 60342 gene locus_tag LOCUS_00550 gene asnB 62261 60342 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_00550 63854 62265 gene locus_tag LOCUS_00560 63854 62265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 65251 63851 gene locus_tag LOCUS_00570 65251 63851 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466569.1 protein_id gnl|my_center|LOCUS_00570 66578 65391 gene locus_tag LOCUS_00580 66578 65391 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484336.1 protein_id gnl|my_center|LOCUS_00580 67884 66568 gene locus_tag LOCUS_00590 67884 66568 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_00590 68162 69223 gene locus_tag LOCUS_00600 68162 69223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00600 69298 70359 gene locus_tag LOCUS_00610 69298 70359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00610 70399 70731 gene locus_tag LOCUS_00620 70399 70731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70810 71838 gene locus_tag LOCUS_00630 70810 71838 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_00630 71835 72971 gene locus_tag LOCUS_00640 71835 72971 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_00640 72968 73807 gene locus_tag LOCUS_00650 72968 73807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_00650 73906 74895 gene locus_tag LOCUS_00660 73906 74895 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_00660 76428 74965 gene locus_tag LOCUS_00670 76428 74965 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415150.1 protein_id gnl|my_center|LOCUS_00670 76610 78571 gene locus_tag LOCUS_00680 76610 78571 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_00680 78659 79699 gene locus_tag LOCUS_00690 78659 79699 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_00690 82025 79842 gene locus_tag LOCUS_00700 82025 79842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82883 82233 gene locus_tag LOCUS_00710 82883 82233 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224042.1 protein_id gnl|my_center|LOCUS_00710 83933 82920 gene locus_tag LOCUS_00720 gene lipA 83933 82920 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_00720 84909 83947 gene locus_tag LOCUS_00730 84909 83947 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224044.1 protein_id gnl|my_center|LOCUS_00730 85463 84927 gene locus_tag LOCUS_00740 85463 84927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224045.1 protein_id gnl|my_center|LOCUS_00740 86532 85840 gene locus_tag LOCUS_00750 86532 85840 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_00750 89095 86900 gene locus_tag LOCUS_00760 89095 86900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 89904 89218 gene locus_tag LOCUS_00770 89904 89218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 90275 89901 gene locus_tag LOCUS_00780 90275 89901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 90458 91855 gene locus_tag LOCUS_00790 90458 91855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_00790 92588 91845 gene locus_tag LOCUS_00800 gene lipB 92588 91845 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_00800 93501 92620 gene locus_tag LOCUS_00810 93501 92620 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284297.1 protein_id gnl|my_center|LOCUS_00810 95412 93589 gene locus_tag LOCUS_00820 gene sucB 95412 93589 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224050.1 protein_id gnl|my_center|LOCUS_00820 96843 95470 gene locus_tag LOCUS_00830 gene lpdA 96843 95470 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence002 243 551 gene locus_tag LOCUS_00840 243 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1165 863 gene locus_tag LOCUS_00850 1165 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_00850 1733 1170 gene locus_tag LOCUS_00860 1733 1170 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229990.1 protein_id gnl|my_center|LOCUS_00860 1810 2382 gene locus_tag LOCUS_00870 1810 2382 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181390343.1 protein_id gnl|my_center|LOCUS_00870 3697 2567 gene locus_tag LOCUS_00880 3697 2567 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_00880 3900 4778 gene locus_tag LOCUS_00890 3900 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4778 6553 gene locus_tag LOCUS_00900 4778 6553 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_00900 6584 6811 gene locus_tag LOCUS_00910 6584 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7445 6825 gene locus_tag LOCUS_00920 7445 6825 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899374.1 protein_id gnl|my_center|LOCUS_00920 9533 7755 gene locus_tag LOCUS_00930 9533 7755 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_00930 10542 9631 gene locus_tag LOCUS_00940 10542 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 11427 10642 gene locus_tag LOCUS_00950 gene nucS 11427 10642 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467679.1 protein_id gnl|my_center|LOCUS_00950 11336 11896 gene locus_tag LOCUS_00960 11336 11896 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_00960 12670 11897 gene locus_tag LOCUS_00970 12670 11897 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_00970 12875 13051 gene locus_tag LOCUS_00980 12875 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13102 13854 gene locus_tag LOCUS_00990 13102 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_00990 14544 13945 gene locus_tag LOCUS_01000 14544 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 14521 15456 gene locus_tag LOCUS_01010 14521 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 15506 16714 gene locus_tag LOCUS_01020 15506 16714 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_01020 17298 16738 gene locus_tag LOCUS_01030 17298 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 18193 17375 gene locus_tag LOCUS_01040 gene ehuA 18193 17375 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896768.1 protein_id gnl|my_center|LOCUS_01040 18833 18177 gene locus_tag LOCUS_01050 gene ehuD 18833 18177 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975970.1 protein_id gnl|my_center|LOCUS_01050 19444 18833 gene locus_tag LOCUS_01060 19444 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 20298 19459 gene locus_tag LOCUS_01070 gene ehuB 20298 19459 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878311.1 protein_id gnl|my_center|LOCUS_01070 21312 20494 gene locus_tag LOCUS_01080 gene ehuA 21312 20494 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895001.1 protein_id gnl|my_center|LOCUS_01080 21952 21296 gene locus_tag LOCUS_01090 gene ehuD 21952 21296 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729151.1 protein_id gnl|my_center|LOCUS_01090 22656 21949 gene locus_tag LOCUS_01100 gene ehuC 22656 21949 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729150.1 protein_id gnl|my_center|LOCUS_01100 23590 22691 gene locus_tag LOCUS_01110 gene ehuB 23590 22691 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729149.1 protein_id gnl|my_center|LOCUS_01110 25872 23848 gene locus_tag LOCUS_01120 25872 23848 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_01120 26306 27187 gene locus_tag LOCUS_01130 26306 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 27305 27934 gene locus_tag LOCUS_01140 27305 27934 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229511.1 protein_id gnl|my_center|LOCUS_01140 28142 30373 gene locus_tag LOCUS_01150 28142 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 30400 30711 gene locus_tag LOCUS_01160 30400 30711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 32031 30760 gene locus_tag LOCUS_01170 gene murA 32031 30760 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_01170 32196 32768 gene locus_tag LOCUS_01180 32196 32768 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_01180 33089 32778 gene locus_tag LOCUS_01190 33089 32778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 32983 33207 gene locus_tag LOCUS_01200 32983 33207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 33700 33266 gene locus_tag LOCUS_01210 33700 33266 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229520.1 protein_id gnl|my_center|LOCUS_01210 34091 33726 gene locus_tag LOCUS_01220 34091 33726 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_01220 35625 34189 gene locus_tag LOCUS_01230 gene atpD 35625 34189 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229522.1 protein_id gnl|my_center|LOCUS_01230 36615 35629 gene locus_tag LOCUS_01240 36615 35629 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_01240 38270 36630 gene locus_tag LOCUS_01250 gene atpA 38270 36630 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 protein_id gnl|my_center|LOCUS_01250 39160 38330 gene locus_tag LOCUS_01260 39160 38330 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229525.1 protein_id gnl|my_center|LOCUS_01260 39706 39167 gene locus_tag LOCUS_01270 39706 39167 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_01270 39973 39731 gene locus_tag LOCUS_01280 39973 39731 CDS product F-type H+-transporting ATPase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229527.1 protein_id gnl|my_center|LOCUS_01280 40834 40046 gene locus_tag LOCUS_01290 gene atpB 40834 40046 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_01290 41451 41023 gene locus_tag LOCUS_01300 41451 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229529.1 protein_id gnl|my_center|LOCUS_01300 42883 41633 gene locus_tag LOCUS_01310 42883 41633 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_01310 43574 42849 gene locus_tag LOCUS_01320 43574 42849 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_01320 43670 43990 gene locus_tag LOCUS_01330 43670 43990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 44887 44159 gene locus_tag LOCUS_01340 gene prmC 44887 44159 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_01340 45170 44988 gene locus_tag LOCUS_01350 45170 44988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 46247 45177 gene locus_tag LOCUS_01360 gene prfA 46247 45177 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_01360 46754 46338 gene locus_tag LOCUS_01370 46754 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 48785 46773 gene locus_tag LOCUS_01380 48785 46773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 50249 49338 gene locus_tag LOCUS_01390 gene thrB 50249 49338 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229540.1 protein_id gnl|my_center|LOCUS_01390 51310 50246 gene locus_tag LOCUS_01400 gene thrC 51310 50246 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229541.1 protein_id gnl|my_center|LOCUS_01400 52602 51307 gene locus_tag LOCUS_01410 52602 51307 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_01410 54039 52603 gene locus_tag LOCUS_01420 gene lysA 54039 52603 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229543.1 protein_id gnl|my_center|LOCUS_01420 55705 54044 gene locus_tag LOCUS_01430 gene argS 55705 54044 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229544.1 protein_id gnl|my_center|LOCUS_01430 56044 56892 gene locus_tag LOCUS_01440 56044 56892 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_01440 56889 57584 gene locus_tag LOCUS_01450 56889 57584 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_01450 59528 57675 gene locus_tag LOCUS_01460 59528 57675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 60884 59604 gene locus_tag LOCUS_01470 60884 59604 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111459.1 protein_id gnl|my_center|LOCUS_01470 62022 61144 gene locus_tag LOCUS_01480 62022 61144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_01480 62936 62088 gene locus_tag LOCUS_01490 62936 62088 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_01490 63377 62946 gene locus_tag LOCUS_01500 63377 62946 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111466.1 protein_id gnl|my_center|LOCUS_01500 64610 63420 gene locus_tag LOCUS_01510 64610 63420 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111467.1 protein_id gnl|my_center|LOCUS_01510 64843 65472 gene locus_tag LOCUS_01520 64843 65472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115206.1 protein_id gnl|my_center|LOCUS_01520 66223 65564 gene locus_tag LOCUS_01530 66223 65564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 69330 66220 gene locus_tag LOCUS_01540 69330 66220 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624304.1 protein_id gnl|my_center|LOCUS_01540 70727 69450 gene locus_tag LOCUS_01550 70727 69450 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908097.1 protein_id gnl|my_center|LOCUS_01550 73837 70832 gene locus_tag LOCUS_01560 73837 70832 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224566.1 protein_id gnl|my_center|LOCUS_01560 74038 74910 gene locus_tag LOCUS_01570 74038 74910 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079986.1 protein_id gnl|my_center|LOCUS_01570 74907 76412 gene locus_tag LOCUS_01580 74907 76412 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_01580 76576 77730 gene locus_tag LOCUS_01590 76576 77730 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_01590 77896 78705 gene locus_tag LOCUS_01600 77896 78705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 80599 78797 gene locus_tag LOCUS_01610 gene rmdA 80599 78797 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence003 1204 137 gene locus_tag LOCUS_01620 gene selD 1204 137 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_01620 3855 1201 gene locus_tag LOCUS_01630 3855 1201 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728362.1 protein_id gnl|my_center|LOCUS_01630 4066 6180 gene locus_tag LOCUS_01640 4066 6180 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_01640 6506 7483 gene locus_tag LOCUS_01650 6506 7483 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_01650 8109 7480 gene locus_tag LOCUS_01660 8109 7480 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_01660 8944 8111 gene locus_tag LOCUS_01670 8944 8111 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284345.1 protein_id gnl|my_center|LOCUS_01670 10130 8970 gene locus_tag LOCUS_01680 10130 8970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_01680 12215 10194 gene locus_tag LOCUS_01690 12215 10194 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_01690 13919 12321 gene locus_tag LOCUS_01700 13919 12321 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_01700 15073 13916 gene locus_tag LOCUS_01710 15073 13916 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224752.1 protein_id gnl|my_center|LOCUS_01710 16764 15070 gene locus_tag LOCUS_01720 16764 15070 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_01720 17705 16761 gene locus_tag LOCUS_01730 17705 16761 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095900.1 protein_id gnl|my_center|LOCUS_01730 18005 19462 gene locus_tag LOCUS_01740 18005 19462 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_01740 19656 21392 gene locus_tag LOCUS_01750 19656 21392 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224740.1 protein_id gnl|my_center|LOCUS_01750 21452 21907 gene locus_tag LOCUS_01760 21452 21907 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 protein_id gnl|my_center|LOCUS_01760 22884 21970 gene locus_tag LOCUS_01770 22884 21970 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 protein_id gnl|my_center|LOCUS_01770 23923 23213 gene locus_tag LOCUS_01780 23923 23213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_01780 25799 23934 gene locus_tag LOCUS_01790 25799 23934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_01790 26032 27360 gene locus_tag LOCUS_01800 26032 27360 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224729.1 protein_id gnl|my_center|LOCUS_01800 27580 27371 gene locus_tag LOCUS_01810 27580 27371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 29355 27727 gene locus_tag LOCUS_01820 29355 27727 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_01820 30316 29642 gene locus_tag LOCUS_01830 30316 29642 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_01830 31653 30313 gene locus_tag LOCUS_01840 gene dgt 31653 30313 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_01840 31543 31812 gene locus_tag LOCUS_01850 31543 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 32061 33740 gene locus_tag LOCUS_01860 32061 33740 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224721.1 protein_id gnl|my_center|LOCUS_01860 35773 33824 gene locus_tag LOCUS_01870 35773 33824 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_01870 36416 35817 gene locus_tag LOCUS_01880 36416 35817 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_01880 37639 36560 gene locus_tag LOCUS_01890 37639 36560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 37749 38894 gene locus_tag LOCUS_01900 gene xerD 37749 38894 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_01900 39447 38935 gene locus_tag LOCUS_01910 39447 38935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 39534 39989 gene locus_tag LOCUS_01920 39534 39989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 40479 40063 gene locus_tag LOCUS_01930 40479 40063 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_01930 40934 40476 gene locus_tag LOCUS_01940 40934 40476 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_01940 42232 40937 gene locus_tag LOCUS_01950 42232 40937 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_01950 43078 42257 gene locus_tag LOCUS_01960 gene sufC 43078 42257 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224699.1 protein_id gnl|my_center|LOCUS_01960 44319 43114 gene locus_tag LOCUS_01970 gene sufD 44319 43114 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_01970 45785 44316 gene locus_tag LOCUS_01980 gene sufB 45785 44316 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_01980 46600 45782 gene locus_tag LOCUS_01990 46600 45782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_01990 46774 48453 gene locus_tag LOCUS_02000 gene mptB 46774 48453 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_02000 48440 49405 gene locus_tag LOCUS_02010 48440 49405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_02010 49402 50217 gene locus_tag LOCUS_02020 49402 50217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224693.1 protein_id gnl|my_center|LOCUS_02020 50252 51241 gene locus_tag LOCUS_02030 50252 51241 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224691.1 protein_id gnl|my_center|LOCUS_02030 52010 51222 gene locus_tag LOCUS_02040 52010 51222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_02040 52975 52106 gene locus_tag LOCUS_02050 52975 52106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_02050 53239 52979 gene locus_tag LOCUS_02060 53239 52979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224687.1 protein_id gnl|my_center|LOCUS_02060 53412 54377 gene locus_tag LOCUS_02070 53412 54377 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_02070 55134 54457 gene locus_tag LOCUS_02080 55134 54457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 57506 55200 gene locus_tag LOCUS_02090 57506 55200 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_02090 58612 57611 gene locus_tag LOCUS_02100 58612 57611 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_02100 59591 58578 gene locus_tag LOCUS_02110 59591 58578 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_02110 59987 62089 gene locus_tag LOCUS_02120 gene tkt 59987 62089 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224677.1 protein_id gnl|my_center|LOCUS_02120 62172 63245 gene locus_tag LOCUS_02130 gene tal 62172 63245 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_02130 63253 64938 gene locus_tag LOCUS_02140 63253 64938 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_02140 64941 66464 gene locus_tag LOCUS_02150 gene zwf 64941 66464 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_02150 66461 67399 gene locus_tag LOCUS_02160 gene opcA 66461 67399 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_02160 67396 68175 gene locus_tag LOCUS_02170 gene pgl 67396 68175 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224672.1 protein_id gnl|my_center|LOCUS_02170 69214 68255 gene locus_tag LOCUS_02180 69214 68255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228047.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence004 <1 741 gene locus_tag LOCUS_02190 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223027.1:FAD-dependent oxidoreductase 889 2346 gene locus_tag LOCUS_02200 889 2346 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401380.1 protein_id gnl|my_center|LOCUS_02200 2596 5100 gene locus_tag LOCUS_02210 gene nirB 2596 5100 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_02210 5102 5455 gene locus_tag LOCUS_02220 gene nirD 5102 5455 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223030.1 protein_id gnl|my_center|LOCUS_02220 5452 6621 gene locus_tag LOCUS_02230 5452 6621 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_02230 6618 7319 gene locus_tag LOCUS_02240 6618 7319 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891750.1 protein_id gnl|my_center|LOCUS_02240 8866 7331 gene locus_tag LOCUS_02250 8866 7331 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 protein_id gnl|my_center|LOCUS_02250 9447 8911 gene locus_tag LOCUS_02260 9447 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10435 9452 gene locus_tag LOCUS_02270 10435 9452 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814089.1 protein_id gnl|my_center|LOCUS_02270 11078 10641 gene locus_tag LOCUS_02280 11078 10641 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815484.1 protein_id gnl|my_center|LOCUS_02280 11860 11078 gene locus_tag LOCUS_02290 11860 11078 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284474.1 protein_id gnl|my_center|LOCUS_02290 13089 11857 gene locus_tag LOCUS_02300 13089 11857 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_02300 13250 14098 gene locus_tag LOCUS_02310 13250 14098 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_02310 14872 14114 gene locus_tag LOCUS_02320 14872 14114 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731592.1 protein_id gnl|my_center|LOCUS_02320 14967 16190 gene locus_tag LOCUS_02330 14967 16190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_02330 16575 16300 gene locus_tag LOCUS_02340 16575 16300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18058 16634 gene locus_tag LOCUS_02350 18058 16634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020109.1 protein_id gnl|my_center|LOCUS_02350 19353 18220 gene locus_tag LOCUS_02360 19353 18220 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223033.1 protein_id gnl|my_center|LOCUS_02360 19696 20532 gene locus_tag LOCUS_02370 19696 20532 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223036.1 protein_id gnl|my_center|LOCUS_02370 20895 20605 gene locus_tag LOCUS_02380 20895 20605 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286299.1 protein_id gnl|my_center|LOCUS_02380 21077 24280 gene locus_tag LOCUS_02390 21077 24280 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_02390 24277 27594 gene locus_tag LOCUS_02400 24277 27594 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_02400 27687 28148 gene locus_tag LOCUS_02410 27687 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 29168 28161 gene locus_tag LOCUS_02420 29168 28161 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223043.1 protein_id gnl|my_center|LOCUS_02420 29320 30615 gene locus_tag LOCUS_02430 29320 30615 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_02430 30612 31985 gene locus_tag LOCUS_02440 30612 31985 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_02440 31982 32977 gene locus_tag LOCUS_02450 gene nudC 31982 32977 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223057.1 protein_id gnl|my_center|LOCUS_02450 34077 33037 gene locus_tag LOCUS_02460 34077 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 33979 34212 gene locus_tag LOCUS_02470 33979 34212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 34334 35209 gene locus_tag LOCUS_02480 34334 35209 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223070.1 protein_id gnl|my_center|LOCUS_02480 36035 35157 gene locus_tag LOCUS_02490 36035 35157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_02490 37015 36170 gene locus_tag LOCUS_02500 37015 36170 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_02500 37461 37048 gene locus_tag LOCUS_02510 37461 37048 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_02510 37501 38433 gene locus_tag LOCUS_02520 37501 38433 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_02520 38430 39167 gene locus_tag LOCUS_02530 38430 39167 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_02530 39164 40276 gene locus_tag LOCUS_02540 39164 40276 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_02540 41364 41636 gene locus_tag LOCUS_02550 41364 41636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562703.1 protein_id gnl|my_center|LOCUS_02550 41657 42091 gene locus_tag LOCUS_02560 41657 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 42095 46252 gene locus_tag LOCUS_02570 42095 46252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 46344 48422 gene locus_tag LOCUS_02580 46344 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223091.1 protein_id gnl|my_center|LOCUS_02580 48430 49047 gene locus_tag LOCUS_02590 48430 49047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223092.1 protein_id gnl|my_center|LOCUS_02590 49052 50053 gene locus_tag LOCUS_02600 49052 50053 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223093.1 protein_id gnl|my_center|LOCUS_02600 50092 51120 gene locus_tag LOCUS_02610 50092 51120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 51252 51479 gene locus_tag LOCUS_02620 51252 51479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 51610 53037 gene locus_tag LOCUS_02630 51610 53037 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_02630 53037 53822 gene locus_tag LOCUS_02640 53037 53822 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_02640 54711 53827 gene locus_tag LOCUS_02650 gene panB 54711 53827 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_02650 55015 55224 gene locus_tag LOCUS_02660 55015 55224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 55232 56509 gene locus_tag LOCUS_02670 55232 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 58236 56518 gene locus_tag LOCUS_02680 58236 56518 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_02680 60738 58396 gene locus_tag LOCUS_02690 gene secA2 60738 58396 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_02690 60979 62559 gene locus_tag LOCUS_02700 60979 62559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_02700 63696 62722 gene locus_tag LOCUS_02710 63696 62722 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730373.1 protein_id gnl|my_center|LOCUS_02710 63767 65077 gene locus_tag LOCUS_02720 63767 65077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_02720 65232 66575 gene locus_tag LOCUS_02730 gene glnA 65232 66575 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence005 1665 1180 gene locus_tag LOCUS_02740 1665 1180 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_02740 1941 2570 gene locus_tag LOCUS_02750 1941 2570 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_02750 3763 2648 gene locus_tag LOCUS_02760 gene ald 3763 2648 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_02760 5565 3979 gene locus_tag LOCUS_02770 5565 3979 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229675.1 protein_id gnl|my_center|LOCUS_02770 6151 5687 gene locus_tag LOCUS_02780 6151 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229665.1 protein_id gnl|my_center|LOCUS_02780 6870 6172 gene locus_tag LOCUS_02790 6870 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6922 7707 gene locus_tag LOCUS_02800 6922 7707 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_02800 7865 9478 gene locus_tag LOCUS_02810 7865 9478 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_02810 9482 11524 gene locus_tag LOCUS_02820 9482 11524 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_02820 11590 12741 gene locus_tag LOCUS_02830 11590 12741 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_02830 13954 12851 gene locus_tag LOCUS_02840 13954 12851 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_02840 14069 14413 gene locus_tag LOCUS_02850 14069 14413 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_02850 15393 14608 gene locus_tag LOCUS_02860 15393 14608 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 protein_id gnl|my_center|LOCUS_02860 15540 15938 gene locus_tag LOCUS_02870 15540 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 15935 16939 gene locus_tag LOCUS_02880 15935 16939 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256300.1 protein_id gnl|my_center|LOCUS_02880 18213 17005 gene locus_tag LOCUS_02890 18213 17005 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_02890 19615 18296 gene locus_tag LOCUS_02900 19615 18296 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_02900 20997 19816 gene locus_tag LOCUS_02910 20997 19816 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_02910 21206 22417 gene locus_tag LOCUS_02920 21206 22417 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229636.1 protein_id gnl|my_center|LOCUS_02920 22414 24633 gene locus_tag LOCUS_02930 22414 24633 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_02930 24721 26307 gene locus_tag LOCUS_02940 24721 26307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 26900 26322 gene locus_tag LOCUS_02950 26900 26322 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_02950 26976 27314 gene locus_tag LOCUS_02960 26976 27314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27404 28675 gene locus_tag LOCUS_02970 27404 28675 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_02970 30347 28794 gene locus_tag LOCUS_02980 30347 28794 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_02980 31791 30400 gene locus_tag LOCUS_02990 31791 30400 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_02990 32383 31883 gene locus_tag LOCUS_03000 32383 31883 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_03000 33706 32444 gene locus_tag LOCUS_03010 33706 32444 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_03010 33875 35344 gene locus_tag LOCUS_03020 33875 35344 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_03020 36277 35462 gene locus_tag LOCUS_03030 36277 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 37123 36407 gene locus_tag LOCUS_03040 37123 36407 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_03040 37880 37110 gene locus_tag LOCUS_03050 37880 37110 CDS product arylmalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229615.1 protein_id gnl|my_center|LOCUS_03050 38756 37983 gene locus_tag LOCUS_03060 38756 37983 CDS product arylmalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229614.1 protein_id gnl|my_center|LOCUS_03060 38858 39838 gene locus_tag LOCUS_03070 38858 39838 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_03070 39835 41247 gene locus_tag LOCUS_03080 39835 41247 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_03080 42250 41255 gene locus_tag LOCUS_03090 42250 41255 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112872.1 protein_id gnl|my_center|LOCUS_03090 43795 42425 gene locus_tag LOCUS_03100 43795 42425 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229605.1 protein_id gnl|my_center|LOCUS_03100 44036 45667 gene locus_tag LOCUS_03110 44036 45667 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230180.1 protein_id gnl|my_center|LOCUS_03110 48956 45768 gene locus_tag LOCUS_03120 48956 45768 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831681.1 protein_id gnl|my_center|LOCUS_03120 49155 50741 gene locus_tag LOCUS_03130 49155 50741 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_03130 50867 51829 gene locus_tag LOCUS_03140 50867 51829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 protein_id gnl|my_center|LOCUS_03140 52079 52537 gene locus_tag LOCUS_03150 52079 52537 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_03150 52550 52969 gene locus_tag LOCUS_03160 52550 52969 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 protein_id gnl|my_center|LOCUS_03160 55034 53103 gene locus_tag LOCUS_03170 55034 53103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 55900 55178 gene locus_tag LOCUS_03180 55900 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03180 55805 56047 gene locus_tag LOCUS_03190 55805 56047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 57942 56113 gene locus_tag LOCUS_03200 gene cysC 57942 56113 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224712.1 protein_id gnl|my_center|LOCUS_03200 58934 57942 gene locus_tag LOCUS_03210 gene cysD 58934 57942 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_03210 58971 59198 gene locus_tag LOCUS_03220 58971 59198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 59128 59421 gene locus_tag LOCUS_03230 59128 59421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 60304 59384 gene locus_tag LOCUS_03240 60304 59384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730901.1 protein_id gnl|my_center|LOCUS_03240 60416 61597 gene locus_tag LOCUS_03250 60416 61597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_03250 61630 62379 gene locus_tag LOCUS_03260 61630 62379 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_03260 >Feature sequence006 301 858 gene locus_tag LOCUS_03270 301 858 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_03270 1681 860 gene locus_tag LOCUS_03280 1681 860 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222100.1 protein_id gnl|my_center|LOCUS_03280 1865 3583 gene locus_tag LOCUS_03290 1865 3583 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804291.1 protein_id gnl|my_center|LOCUS_03290 4404 3661 gene locus_tag LOCUS_03300 4404 3661 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 protein_id gnl|my_center|LOCUS_03300 4991 4593 gene locus_tag LOCUS_03310 4991 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228554.1 protein_id gnl|my_center|LOCUS_03310 6291 5107 gene locus_tag LOCUS_03320 6291 5107 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_03320 6379 7233 gene locus_tag LOCUS_03330 6379 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222109.1 protein_id gnl|my_center|LOCUS_03330 7250 7888 gene locus_tag LOCUS_03340 7250 7888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222110.1 protein_id gnl|my_center|LOCUS_03340 9340 7982 gene locus_tag LOCUS_03350 9340 7982 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_03350 10010 9411 gene locus_tag LOCUS_03360 10010 9411 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222112.1 protein_id gnl|my_center|LOCUS_03360 12225 10189 gene locus_tag LOCUS_03370 12225 10189 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_03370 12258 12635 gene locus_tag LOCUS_03380 12258 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13336 13028 gene locus_tag LOCUS_03390 13336 13028 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_03390 13452 13817 gene locus_tag LOCUS_03400 13452 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13844 14221 gene locus_tag LOCUS_03410 13844 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 14436 15065 gene locus_tag LOCUS_03420 14436 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230562.1 protein_id gnl|my_center|LOCUS_03420 15106 16509 gene locus_tag LOCUS_03430 15106 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 16862 22516 gene locus_tag LOCUS_03440 16862 22516 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_03440 23864 22581 gene locus_tag LOCUS_03450 23864 22581 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226592.1 protein_id gnl|my_center|LOCUS_03450 24242 25012 gene locus_tag LOCUS_03460 24242 25012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_03460 25877 25128 gene locus_tag LOCUS_03470 25877 25128 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_03470 26921 25956 gene locus_tag LOCUS_03480 26921 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 27692 26925 gene locus_tag LOCUS_03490 27692 26925 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_03490 30233 27717 gene locus_tag LOCUS_03500 30233 27717 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_03500 31989 30298 gene locus_tag LOCUS_03510 31989 30298 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_03510 32853 32005 gene locus_tag LOCUS_03520 32853 32005 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_03520 34186 32960 gene locus_tag LOCUS_03530 34186 32960 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_03530 36187 34370 gene locus_tag LOCUS_03540 36187 34370 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230694.1 protein_id gnl|my_center|LOCUS_03540 36665 36282 gene locus_tag LOCUS_03550 36665 36282 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_03550 38106 36739 gene locus_tag LOCUS_03560 38106 36739 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930446.1 protein_id gnl|my_center|LOCUS_03560 38220 39452 gene locus_tag LOCUS_03570 38220 39452 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_03570 39449 40261 gene locus_tag LOCUS_03580 39449 40261 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_03580 40258 41673 gene locus_tag LOCUS_03590 40258 41673 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_03590 41724 43199 gene locus_tag LOCUS_03600 gene allB 41724 43199 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 protein_id gnl|my_center|LOCUS_03600 44077 43208 gene locus_tag LOCUS_03610 44077 43208 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_03610 44846 44082 gene locus_tag LOCUS_03620 44846 44082 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_03620 45091 46302 gene locus_tag LOCUS_03630 45091 46302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_03630 46320 47327 gene locus_tag LOCUS_03640 46320 47327 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_03640 47324 48376 gene locus_tag LOCUS_03650 47324 48376 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_03650 48373 49092 gene locus_tag LOCUS_03660 48373 49092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_03660 49089 49793 gene locus_tag LOCUS_03670 49089 49793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_03670 49806 50000 gene locus_tag LOCUS_03680 49806 50000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 49967 50608 gene locus_tag LOCUS_03690 49967 50608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 50605 52503 gene locus_tag LOCUS_03700 50605 52503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 52681 52956 gene locus_tag LOCUS_03710 52681 52956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 53824 53300 gene locus_tag LOCUS_03720 53824 53300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 55833 53923 gene locus_tag LOCUS_03730 55833 53923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 58848 55987 gene locus_tag LOCUS_03740 58848 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 59139 59663 gene locus_tag LOCUS_03750 59139 59663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 59664 60494 gene locus_tag LOCUS_03760 59664 60494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 60491 61864 gene locus_tag LOCUS_03770 60491 61864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 61899 62333 gene locus_tag LOCUS_03780 61899 62333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 62430 62816 gene locus_tag LOCUS_03790 62430 62816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence007 1044 178 gene locus_tag LOCUS_03800 1044 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1701 1246 gene locus_tag LOCUS_03810 1701 1246 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_03810 1784 2761 gene locus_tag LOCUS_03820 1784 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2758 3978 gene locus_tag LOCUS_03830 2758 3978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112709.1 protein_id gnl|my_center|LOCUS_03830 4708 3995 gene locus_tag LOCUS_03840 4708 3995 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_03840 5444 4692 gene locus_tag LOCUS_03850 5444 4692 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384628.1 protein_id gnl|my_center|LOCUS_03850 6268 5447 gene locus_tag LOCUS_03860 6268 5447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 protein_id gnl|my_center|LOCUS_03860 7062 6265 gene locus_tag LOCUS_03870 7062 6265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 protein_id gnl|my_center|LOCUS_03870 8069 7065 gene locus_tag LOCUS_03880 8069 7065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384631.1 protein_id gnl|my_center|LOCUS_03880 8327 9022 gene locus_tag LOCUS_03890 8327 9022 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_03890 10288 9092 gene locus_tag LOCUS_03900 10288 9092 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_03900 10480 11961 gene locus_tag LOCUS_03910 gene zwf 10480 11961 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726838.1 protein_id gnl|my_center|LOCUS_03910 11958 13787 gene locus_tag LOCUS_03920 gene edd 11958 13787 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726837.1 protein_id gnl|my_center|LOCUS_03920 13784 14959 gene locus_tag LOCUS_03930 13784 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 14956 15582 gene locus_tag LOCUS_03940 gene eda 14956 15582 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_03940 15579 16541 gene locus_tag LOCUS_03950 15579 16541 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_03950 16608 17030 gene locus_tag LOCUS_03960 16608 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 17175 18371 gene locus_tag LOCUS_03970 17175 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18364 18771 gene locus_tag LOCUS_03980 18364 18771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 20748 18892 gene locus_tag LOCUS_03990 20748 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 22525 20933 gene locus_tag LOCUS_04000 22525 20933 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_04000 23253 22933 gene locus_tag LOCUS_04010 23253 22933 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_04010 23746 23282 gene locus_tag LOCUS_04020 23746 23282 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_04020 24877 23840 gene locus_tag LOCUS_04030 24877 23840 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223455.1 protein_id gnl|my_center|LOCUS_04030 24975 26465 gene locus_tag LOCUS_04040 24975 26465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 protein_id gnl|my_center|LOCUS_04040 27381 26488 gene locus_tag LOCUS_04050 27381 26488 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_04050 29302 27479 gene locus_tag LOCUS_04060 29302 27479 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_04060 29802 30287 gene locus_tag LOCUS_04070 29802 30287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_04070 31042 30275 gene locus_tag LOCUS_04080 31042 30275 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730620.1 protein_id gnl|my_center|LOCUS_04080 31139 32110 gene locus_tag LOCUS_04090 31139 32110 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222870.1 protein_id gnl|my_center|LOCUS_04090 32161 32739 gene locus_tag LOCUS_04100 32161 32739 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_04100 33147 32743 gene locus_tag LOCUS_04110 33147 32743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 33246 33935 gene locus_tag LOCUS_04120 33246 33935 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_04120 34042 34293 gene locus_tag LOCUS_04130 gene yefM 34042 34293 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_04130 34290 34550 gene locus_tag LOCUS_04140 gene yoeB 34290 34550 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_04140 35676 34705 gene locus_tag LOCUS_04150 35676 34705 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224034.1 protein_id gnl|my_center|LOCUS_04150 36694 35774 gene locus_tag LOCUS_04160 36694 35774 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_04160 37347 36706 gene locus_tag LOCUS_04170 37347 36706 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_04170 38417 37347 gene locus_tag LOCUS_04180 38417 37347 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_04180 39169 38414 gene locus_tag LOCUS_04190 39169 38414 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228742.1 protein_id gnl|my_center|LOCUS_04190 40425 39166 gene locus_tag LOCUS_04200 40425 39166 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_04200 40516 41103 gene locus_tag LOCUS_04210 40516 41103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_04210 42027 41098 gene locus_tag LOCUS_04220 42027 41098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 42379 42041 gene locus_tag LOCUS_04230 42379 42041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 44271 42634 gene locus_tag LOCUS_04240 44271 42634 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 protein_id gnl|my_center|LOCUS_04240 48482 44496 gene locus_tag LOCUS_04250 gene hrpA 48482 44496 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_04250 48582 48953 gene locus_tag LOCUS_04260 48582 48953 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728279.1 protein_id gnl|my_center|LOCUS_04260 49413 48961 gene locus_tag LOCUS_04270 49413 48961 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_04270 50309 49473 gene locus_tag LOCUS_04280 50309 49473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 protein_id gnl|my_center|LOCUS_04280 51547 50321 gene locus_tag LOCUS_04290 51547 50321 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223723.1 protein_id gnl|my_center|LOCUS_04290 51759 51980 gene locus_tag LOCUS_04300 51759 51980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223722.1 protein_id gnl|my_center|LOCUS_04300 52241 53269 gene locus_tag LOCUS_04310 52241 53269 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_04310 53429 54004 gene locus_tag LOCUS_04320 gene orn 53429 54004 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_04320 54081 54156 gene locus_tag LOCUS_t00020 54081 54156 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55706 54312 gene locus_tag LOCUS_04330 55706 54312 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 protein_id gnl|my_center|LOCUS_04330 56408 55707 gene locus_tag LOCUS_04340 56408 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 56542 57009 gene locus_tag LOCUS_04350 56542 57009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 57454 57056 gene locus_tag LOCUS_04360 57454 57056 CDS product DUF6292 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226102.1 protein_id gnl|my_center|LOCUS_04360 58250 57645 gene locus_tag LOCUS_04370 58250 57645 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 protein_id gnl|my_center|LOCUS_04370 58725 58321 gene locus_tag LOCUS_04380 58725 58321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 58694 58996 gene locus_tag LOCUS_04390 58694 58996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 59669 59415 gene locus_tag LOCUS_04400 59669 59415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 60883 59699 gene locus_tag LOCUS_04410 60883 59699 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_04410 61098 61173 gene locus_tag LOCUS_t00030 61098 61173 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 952 203 gene locus_tag LOCUS_04420 gene fabG 952 203 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_04420 2685 973 gene locus_tag LOCUS_04430 2685 973 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_04430 4796 2718 gene locus_tag LOCUS_04440 4796 2718 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_04440 6142 4808 gene locus_tag LOCUS_04450 gene accC 6142 4808 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_04450 6636 6154 gene locus_tag LOCUS_04460 gene accB 6636 6154 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039290.1 protein_id gnl|my_center|LOCUS_04460 8104 6620 gene locus_tag LOCUS_04470 8104 6620 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_04470 9255 8101 gene locus_tag LOCUS_04480 9255 8101 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039923.1 protein_id gnl|my_center|LOCUS_04480 10121 9264 gene locus_tag LOCUS_04490 gene couO 10121 9264 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_04490 10984 10115 gene locus_tag LOCUS_04500 10984 10115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084218.1 protein_id gnl|my_center|LOCUS_04500 11856 11026 gene locus_tag LOCUS_04510 gene panB 11856 11026 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_04510 12355 11876 gene locus_tag LOCUS_04520 12355 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 13686 12394 gene locus_tag LOCUS_04530 13686 12394 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_04530 14912 13869 gene locus_tag LOCUS_04540 14912 13869 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399877.1 protein_id gnl|my_center|LOCUS_04540 15939 14923 gene locus_tag LOCUS_04550 15939 14923 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086618.1 protein_id gnl|my_center|LOCUS_04550 17104 16052 gene locus_tag LOCUS_04560 17104 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17651 17121 gene locus_tag LOCUS_04570 17651 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 19195 17663 gene locus_tag LOCUS_04580 19195 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20169 19468 gene locus_tag LOCUS_04590 20169 19468 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_04590 20439 21227 gene locus_tag LOCUS_04600 20439 21227 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_04600 21350 22333 gene locus_tag LOCUS_04610 21350 22333 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_04610 22359 23822 gene locus_tag LOCUS_04620 22359 23822 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_04620 25153 23897 gene locus_tag LOCUS_04630 25153 23897 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591920.1 protein_id gnl|my_center|LOCUS_04630 25948 25181 gene locus_tag LOCUS_04640 25948 25181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112899.1 protein_id gnl|my_center|LOCUS_04640 26529 25945 gene locus_tag LOCUS_04650 26529 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 27837 26572 gene locus_tag LOCUS_04660 27837 26572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_04660 28960 27866 gene locus_tag LOCUS_04670 28960 27866 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_04670 30154 29003 gene locus_tag LOCUS_04680 30154 29003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_04680 31914 30184 gene locus_tag LOCUS_04690 31914 30184 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_04690 33107 31977 gene locus_tag LOCUS_04700 33107 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 34491 33382 gene locus_tag LOCUS_04710 34491 33382 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_04710 34606 35832 gene locus_tag LOCUS_04720 34606 35832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_04720 35975 36781 gene locus_tag LOCUS_04730 35975 36781 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728466.1 protein_id gnl|my_center|LOCUS_04730 37824 36832 gene locus_tag LOCUS_04740 37824 36832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_04740 38855 37821 gene locus_tag LOCUS_04750 38855 37821 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_04750 39562 38852 gene locus_tag LOCUS_04760 39562 38852 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_04760 40686 39559 gene locus_tag LOCUS_04770 40686 39559 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086624.1 protein_id gnl|my_center|LOCUS_04770 40761 41714 gene locus_tag LOCUS_04780 40761 41714 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015792534.1 protein_id gnl|my_center|LOCUS_04780 41741 42193 gene locus_tag LOCUS_04790 gene rpiB 41741 42193 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_04790 42296 43813 gene locus_tag LOCUS_04800 42296 43813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 44148 47291 gene locus_tag LOCUS_04810 44148 47291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 47448 47846 gene locus_tag LOCUS_04820 47448 47846 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969103.1 protein_id gnl|my_center|LOCUS_04820 47843 48100 gene locus_tag LOCUS_04830 47843 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 48194 49906 gene locus_tag LOCUS_04840 48194 49906 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484403.1 protein_id gnl|my_center|LOCUS_04840 50041 50208 gene locus_tag LOCUS_04850 50041 50208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 50809 50171 gene locus_tag LOCUS_04860 50809 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 50958 54047 gene locus_tag LOCUS_04870 50958 54047 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_04870 54040 54867 gene locus_tag LOCUS_04880 54040 54867 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_04880 55676 54909 gene locus_tag LOCUS_04890 55676 54909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 57150 55798 gene locus_tag LOCUS_04900 57150 55798 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729448.1 protein_id gnl|my_center|LOCUS_04900 57808 57266 gene locus_tag LOCUS_04910 57808 57266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 58314 58015 gene locus_tag LOCUS_04920 58314 58015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence009 1546 224 gene locus_tag LOCUS_04930 gene secY 1546 224 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_04930 2323 1880 gene locus_tag LOCUS_04940 gene rplO 2323 1880 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_04940 2505 2323 gene locus_tag LOCUS_04950 gene rpmD 2505 2323 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_04950 3142 2507 gene locus_tag LOCUS_04960 gene rpsE 3142 2507 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_04960 3740 3339 gene locus_tag LOCUS_04970 gene rplR 3740 3339 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_04970 4279 3740 gene locus_tag LOCUS_04980 gene rplF 4279 3740 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_04980 4694 4296 gene locus_tag LOCUS_04990 gene rpsH 4694 4296 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558871.1 protein_id gnl|my_center|LOCUS_04990 4974 4789 gene locus_tag LOCUS_05000 4974 4789 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_05000 5703 5131 gene locus_tag LOCUS_05010 gene rplE 5703 5131 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_05010 6019 5705 gene locus_tag LOCUS_05020 gene rplX 6019 5705 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_05020 6465 6097 gene locus_tag LOCUS_05030 gene rplN 6465 6097 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_05030 6845 6462 gene locus_tag LOCUS_05040 6845 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7093 6842 gene locus_tag LOCUS_05050 gene rpmC 7093 6842 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222608.1 protein_id gnl|my_center|LOCUS_05050 7512 7093 gene locus_tag LOCUS_05060 gene rplP 7512 7093 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_05060 8355 7516 gene locus_tag LOCUS_05070 gene rpsC 8355 7516 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222607.1 protein_id gnl|my_center|LOCUS_05070 8780 8355 gene locus_tag LOCUS_05080 gene rplV 8780 8355 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_05080 9099 8818 gene locus_tag LOCUS_05090 gene rpsS 9099 8818 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_05090 10122 9289 gene locus_tag LOCUS_05100 gene rplB 10122 9289 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102084.1 protein_id gnl|my_center|LOCUS_05100 10447 10139 gene locus_tag LOCUS_05110 gene rplW 10447 10139 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_05110 11133 10444 gene locus_tag LOCUS_05120 gene rplD 11133 10444 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_05120 11786 11130 gene locus_tag LOCUS_05130 gene rplC 11786 11130 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_05130 12123 11818 gene locus_tag LOCUS_05140 gene rpsJ 12123 11818 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003883485.1 protein_id gnl|my_center|LOCUS_05140 13708 12515 gene locus_tag LOCUS_05150 gene tuf 13708 12515 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222603.1 protein_id gnl|my_center|LOCUS_05150 16030 13928 gene locus_tag LOCUS_05160 gene fusA 16030 13928 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_05160 16561 16091 gene locus_tag LOCUS_05170 gene rpsG 16561 16091 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_05170 17111 16635 gene locus_tag LOCUS_05180 gene rpsL 17111 16635 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_05180 17433 18044 gene locus_tag LOCUS_05190 17433 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18041 18373 gene locus_tag LOCUS_05200 18041 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225988.1 protein_id gnl|my_center|LOCUS_05200 18391 19530 gene locus_tag LOCUS_05210 18391 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225989.1 protein_id gnl|my_center|LOCUS_05210 19536 21278 gene locus_tag LOCUS_05220 19536 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 21531 21935 gene locus_tag LOCUS_05230 21531 21935 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222214.1 protein_id gnl|my_center|LOCUS_05230 25931 22101 gene locus_tag LOCUS_05240 25931 22101 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_05240 29631 26152 gene locus_tag LOCUS_05250 29631 26152 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222586.1 protein_id gnl|my_center|LOCUS_05250 31046 30054 gene locus_tag LOCUS_05260 31046 30054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 31711 31061 gene locus_tag LOCUS_05270 31711 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 33168 31900 gene locus_tag LOCUS_05280 33168 31900 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222539.1 protein_id gnl|my_center|LOCUS_05280 34379 33168 gene locus_tag LOCUS_05290 34379 33168 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_05290 35548 34379 gene locus_tag LOCUS_05300 35548 34379 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_05300 36752 35766 gene locus_tag LOCUS_05310 36752 35766 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 protein_id gnl|my_center|LOCUS_05310 37795 36749 gene locus_tag LOCUS_05320 37795 36749 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_05320 39216 37792 gene locus_tag LOCUS_05330 39216 37792 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222534.1 protein_id gnl|my_center|LOCUS_05330 40120 39275 gene locus_tag LOCUS_05340 40120 39275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222533.1 protein_id gnl|my_center|LOCUS_05340 41047 40253 gene locus_tag LOCUS_05350 41047 40253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_05350 42255 41044 gene locus_tag LOCUS_05360 42255 41044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_05360 42951 42565 gene locus_tag LOCUS_05370 gene rplL 42951 42565 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222530.1 protein_id gnl|my_center|LOCUS_05370 43569 43042 gene locus_tag LOCUS_05380 gene rplJ 43569 43042 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222529.1 protein_id gnl|my_center|LOCUS_05380 43887 44723 gene locus_tag LOCUS_05390 43887 44723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 45513 44800 gene locus_tag LOCUS_05400 gene rplA 45513 44800 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222526.1 protein_id gnl|my_center|LOCUS_05400 46040 45609 gene locus_tag LOCUS_05410 gene rplK 46040 45609 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_05410 46951 46118 gene locus_tag LOCUS_05420 gene nusG 46951 46118 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_05420 47450 47019 gene locus_tag LOCUS_05430 gene secE 47450 47019 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222523.1 protein_id gnl|my_center|LOCUS_05430 47570 47497 gene locus_tag LOCUS_t00040 47570 47497 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 47729 48973 gene locus_tag LOCUS_05440 47729 48973 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_05440 49003 50019 gene locus_tag LOCUS_05450 49003 50019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228047.1 protein_id gnl|my_center|LOCUS_05450 50505 50089 gene locus_tag LOCUS_05460 50505 50089 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222518.1 protein_id gnl|my_center|LOCUS_05460 50951 50502 gene locus_tag LOCUS_05470 50951 50502 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_05470 51203 51036 gene locus_tag LOCUS_05480 gene rpmG 51203 51036 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_05480 51488 51414 gene locus_tag LOCUS_t00050 51488 51414 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 51609 51536 gene locus_tag LOCUS_t00060 51609 51536 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54368 51687 gene locus_tag LOCUS_05490 54368 51687 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_05490 54666 55796 gene locus_tag LOCUS_05500 54666 55796 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_05500 55889 56218 gene locus_tag LOCUS_05510 55889 56218 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_05510 56361 56675 gene locus_tag LOCUS_05520 56361 56675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence010 2851 1739 gene locus_tag LOCUS_05530 gene dapC 2851 1739 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_05530 3168 2848 gene locus_tag LOCUS_05540 3168 2848 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_05540 3497 4531 gene locus_tag LOCUS_05550 gene cofD 3497 4531 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_05550 4524 5864 gene locus_tag LOCUS_05560 4524 5864 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222932.1 protein_id gnl|my_center|LOCUS_05560 5861 6400 gene locus_tag LOCUS_05570 5861 6400 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_05570 6708 7073 gene locus_tag LOCUS_05580 6708 7073 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_05580 7337 7939 gene locus_tag LOCUS_05590 7337 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8835 7960 gene locus_tag LOCUS_05600 8835 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10033 8936 gene locus_tag LOCUS_05610 10033 8936 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_05610 10187 10600 gene locus_tag LOCUS_05620 10187 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222925.1 protein_id gnl|my_center|LOCUS_05620 11451 10675 gene locus_tag LOCUS_05630 11451 10675 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_05630 12712 11582 gene locus_tag LOCUS_05640 12712 11582 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_05640 14145 12751 gene locus_tag LOCUS_05650 gene tnpB 14145 12751 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 protein_id gnl|my_center|LOCUS_05650 14587 14138 gene locus_tag LOCUS_05660 14587 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 16169 15129 gene locus_tag LOCUS_05670 16169 15129 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_05670 16306 17259 gene locus_tag LOCUS_05680 16306 17259 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742155.1 protein_id gnl|my_center|LOCUS_05680 17537 20101 gene locus_tag LOCUS_05690 17537 20101 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222920.1 protein_id gnl|my_center|LOCUS_05690 20028 21176 gene locus_tag LOCUS_05700 20028 21176 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_05700 22529 21336 gene locus_tag LOCUS_05710 22529 21336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_05710 23188 22526 gene locus_tag LOCUS_05720 23188 22526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_05720 24306 23185 gene locus_tag LOCUS_05730 24306 23185 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_05730 24830 24303 gene locus_tag LOCUS_05740 24830 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 24935 25591 gene locus_tag LOCUS_05750 24935 25591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_05750 25588 26772 gene locus_tag LOCUS_05760 25588 26772 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_05760 27481 26810 gene locus_tag LOCUS_05770 27481 26810 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_05770 27985 27545 gene locus_tag LOCUS_05780 27985 27545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230122.1 protein_id gnl|my_center|LOCUS_05780 29752 28121 gene locus_tag LOCUS_05790 29752 28121 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_05790 29894 30673 gene locus_tag LOCUS_05800 29894 30673 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_05800 30670 32217 gene locus_tag LOCUS_05810 30670 32217 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230126.1 protein_id gnl|my_center|LOCUS_05810 32208 32852 gene locus_tag LOCUS_05820 32208 32852 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_05820 32881 33597 gene locus_tag LOCUS_05830 32881 33597 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230130.1 protein_id gnl|my_center|LOCUS_05830 34911 33667 gene locus_tag LOCUS_05840 34911 33667 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230131.1 protein_id gnl|my_center|LOCUS_05840 35343 35032 gene locus_tag LOCUS_05850 gene mihF 35343 35032 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_05850 35756 37381 gene locus_tag LOCUS_05860 35756 37381 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_05860 37396 38094 gene locus_tag LOCUS_05870 37396 38094 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230143.1 protein_id gnl|my_center|LOCUS_05870 38104 39015 gene locus_tag LOCUS_05880 38104 39015 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_05880 39012 40226 gene locus_tag LOCUS_05890 39012 40226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_05890 41696 40380 gene locus_tag LOCUS_05900 41696 40380 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_05900 42819 41902 gene locus_tag LOCUS_05910 42819 41902 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_05910 43421 42816 gene locus_tag LOCUS_05920 43421 42816 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_05920 43490 44650 gene locus_tag LOCUS_05930 43490 44650 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_05930 45050 44658 gene locus_tag LOCUS_05940 45050 44658 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_05940 45328 45047 gene locus_tag LOCUS_05950 45328 45047 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417995.1 protein_id gnl|my_center|LOCUS_05950 46125 45367 gene locus_tag LOCUS_05960 46125 45367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence011 805 134 gene locus_tag LOCUS_05970 805 134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467756.1 protein_id gnl|my_center|LOCUS_05970 1821 856 gene locus_tag LOCUS_05980 1821 856 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_05980 1982 2054 gene locus_tag LOCUS_t00070 1982 2054 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2125 3753 gene locus_tag LOCUS_05990 2125 3753 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229962.1 protein_id gnl|my_center|LOCUS_05990 3837 5315 gene locus_tag LOCUS_06000 gene glmU 3837 5315 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_06000 5312 6292 gene locus_tag LOCUS_06010 5312 6292 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_06010 7031 7693 gene locus_tag LOCUS_06020 7031 7693 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_06020 7694 8281 gene locus_tag LOCUS_06030 gene pth 7694 8281 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_06030 10064 8334 gene locus_tag LOCUS_06040 10064 8334 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229972.1 protein_id gnl|my_center|LOCUS_06040 12003 10216 gene locus_tag LOCUS_06050 12003 10216 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 protein_id gnl|my_center|LOCUS_06050 13042 12077 gene locus_tag LOCUS_06060 13042 12077 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_06060 14179 13118 gene locus_tag LOCUS_06070 14179 13118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229976.1 protein_id gnl|my_center|LOCUS_06070 15485 14619 gene locus_tag LOCUS_06080 gene rsmA 15485 14619 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_06080 17148 15520 gene locus_tag LOCUS_06090 17148 15520 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_06090 18223 17369 gene locus_tag LOCUS_06100 18223 17369 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_06100 20059 18257 gene locus_tag LOCUS_06110 gene metG 20059 18257 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_06110 20166 21470 gene locus_tag LOCUS_06120 20166 21470 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229985.1 protein_id gnl|my_center|LOCUS_06120 21512 22774 gene locus_tag LOCUS_06130 21512 22774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_06130 23803 22940 gene locus_tag LOCUS_06140 gene rsmI 23803 22940 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_06140 24028 25626 gene locus_tag LOCUS_06150 24028 25626 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229989.1 protein_id gnl|my_center|LOCUS_06150 25801 25640 gene locus_tag LOCUS_06160 25801 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 25794 26429 gene locus_tag LOCUS_06170 25794 26429 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_06170 28126 26441 gene locus_tag LOCUS_06180 28126 26441 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229992.1 protein_id gnl|my_center|LOCUS_06180 28320 29966 gene locus_tag LOCUS_06190 28320 29966 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229994.1 protein_id gnl|my_center|LOCUS_06190 31488 30052 gene locus_tag LOCUS_06200 31488 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_06200 32980 31586 gene locus_tag LOCUS_06210 32980 31586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_06210 33415 34158 gene locus_tag LOCUS_06220 33415 34158 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401662.1 protein_id gnl|my_center|LOCUS_06220 34251 35039 gene locus_tag LOCUS_06230 34251 35039 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230000.1 protein_id gnl|my_center|LOCUS_06230 35651 35052 gene locus_tag LOCUS_06240 35651 35052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110889.1 protein_id gnl|my_center|LOCUS_06240 37108 35717 gene locus_tag LOCUS_06250 37108 35717 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_06250 37945 37265 gene locus_tag LOCUS_06260 37945 37265 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_06260 40506 37942 gene locus_tag LOCUS_06270 40506 37942 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_06270 41935 40544 gene locus_tag LOCUS_06280 41935 40544 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_06280 42129 42713 gene locus_tag LOCUS_06290 42129 42713 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_06290 43408 43115 gene locus_tag LOCUS_06300 43408 43115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 43983 43405 gene locus_tag LOCUS_06310 43983 43405 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_06310 44221 44463 gene locus_tag LOCUS_06320 44221 44463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 44651 44577 gene locus_tag LOCUS_t00080 44651 44577 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 736 113 gene locus_tag LOCUS_06330 736 113 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_06330 952 2781 gene locus_tag LOCUS_06340 952 2781 CDS product TNT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231048.1 protein_id gnl|my_center|LOCUS_06340 4371 2782 gene locus_tag LOCUS_06350 4371 2782 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_06350 4629 5066 gene locus_tag LOCUS_06360 4629 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5063 7219 gene locus_tag LOCUS_06370 5063 7219 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231053.1 protein_id gnl|my_center|LOCUS_06370 7321 9150 gene locus_tag LOCUS_06380 gene murJ 7321 9150 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231054.1 protein_id gnl|my_center|LOCUS_06380 9542 11011 gene locus_tag LOCUS_06390 9542 11011 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231055.1 protein_id gnl|my_center|LOCUS_06390 11088 11771 gene locus_tag LOCUS_06400 gene sigM 11088 11771 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_06400 11768 12547 gene locus_tag LOCUS_06410 11768 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_06410 12685 13695 gene locus_tag LOCUS_06420 gene trxB 12685 13695 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_06420 13745 14074 gene locus_tag LOCUS_06430 gene trxA 13745 14074 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_06430 14335 15483 gene locus_tag LOCUS_06440 14335 15483 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_06440 16220 15564 gene locus_tag LOCUS_06450 16220 15564 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231060.1 protein_id gnl|my_center|LOCUS_06450 16605 17813 gene locus_tag LOCUS_06460 16605 17813 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_06460 17880 18809 gene locus_tag LOCUS_06470 17880 18809 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_06470 19935 18937 gene locus_tag LOCUS_06480 19935 18937 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_06480 20714 19932 gene locus_tag LOCUS_06490 20714 19932 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_06490 21893 21204 gene locus_tag LOCUS_06500 gene rsmG 21893 21204 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231065.1 protein_id gnl|my_center|LOCUS_06500 22787 22140 gene locus_tag LOCUS_06510 22787 22140 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_06510 24011 22836 gene locus_tag LOCUS_06520 gene yidC 24011 22836 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231068.1 protein_id gnl|my_center|LOCUS_06520 24379 24017 gene locus_tag LOCUS_06530 gene yidD 24379 24017 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284387.1 protein_id gnl|my_center|LOCUS_06530 24708 24376 gene locus_tag LOCUS_06540 gene rnpA 24708 24376 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_06540 24924 24781 gene locus_tag LOCUS_06550 gene rpmH 24924 24781 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_06550 25492 27060 gene locus_tag LOCUS_06560 gene dnaA 25492 27060 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_06560 28617 27106 gene locus_tag LOCUS_06570 gene mptB 28617 27106 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_06570 29251 28661 gene locus_tag LOCUS_06580 29251 28661 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 protein_id gnl|my_center|LOCUS_06580 30085 31221 gene locus_tag LOCUS_06590 gene dnaN 30085 31221 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_06590 31249 32142 gene locus_tag LOCUS_06600 gene gnd 31249 32142 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_06600 32183 33349 gene locus_tag LOCUS_06610 gene recF 32183 33349 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_06610 33453 34091 gene locus_tag LOCUS_06620 33453 34091 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_06620 34371 36338 gene locus_tag LOCUS_06630 gene gyrB 34371 36338 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_06630 36391 38898 gene locus_tag LOCUS_06640 gene gyrA 36391 38898 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_06640 38940 39713 gene locus_tag LOCUS_06650 38940 39713 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221962.1 protein_id gnl|my_center|LOCUS_06650 39773 39848 gene locus_tag LOCUS_t00090 39773 39848 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 41144 39924 gene locus_tag LOCUS_06660 41144 39924 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_06660 41947 41141 gene locus_tag LOCUS_06670 41947 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 42999 42184 gene locus_tag LOCUS_06680 42999 42184 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence013 1418 255 gene locus_tag LOCUS_06690 1418 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1562 2326 gene locus_tag LOCUS_06700 1562 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2305 3309 gene locus_tag LOCUS_06710 2305 3309 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_06710 3906 3367 gene locus_tag LOCUS_06720 3906 3367 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_06720 3971 5203 gene locus_tag LOCUS_06730 3971 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6142 5210 gene locus_tag LOCUS_06740 6142 5210 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_06740 6326 7354 gene locus_tag LOCUS_06750 gene fbaA 6326 7354 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_06750 7649 7365 gene locus_tag LOCUS_06760 7649 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9304 8087 gene locus_tag LOCUS_06770 9304 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467860.1 protein_id gnl|my_center|LOCUS_06770 9759 10166 gene locus_tag LOCUS_06780 9759 10166 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230816.1 protein_id gnl|my_center|LOCUS_06780 10755 10177 gene locus_tag LOCUS_06790 10755 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230807.1 protein_id gnl|my_center|LOCUS_06790 10945 12231 gene locus_tag LOCUS_06800 10945 12231 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_06800 12728 12384 gene locus_tag LOCUS_06810 12728 12384 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467851.1 protein_id gnl|my_center|LOCUS_06810 13564 12725 gene locus_tag LOCUS_06820 13564 12725 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230721.1 protein_id gnl|my_center|LOCUS_06820 14048 13611 gene locus_tag LOCUS_06830 14048 13611 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_06830 14745 14308 gene locus_tag LOCUS_06840 14745 14308 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230719.1 protein_id gnl|my_center|LOCUS_06840 15635 14763 gene locus_tag LOCUS_06850 15635 14763 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_06850 15836 16630 gene locus_tag LOCUS_06860 15836 16630 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284398.1 protein_id gnl|my_center|LOCUS_06860 16681 17610 gene locus_tag LOCUS_06870 gene mshD 16681 17610 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230716.1 protein_id gnl|my_center|LOCUS_06870 18386 17607 gene locus_tag LOCUS_06880 gene pstB 18386 17607 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_06880 19499 18414 gene locus_tag LOCUS_06890 gene pstA 19499 18414 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_06890 20443 19499 gene locus_tag LOCUS_06900 gene pstC 20443 19499 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_06900 21643 20555 gene locus_tag LOCUS_06910 gene pstS 21643 20555 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_06910 22602 21940 gene locus_tag LOCUS_06920 gene phoU 22602 21940 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_06920 24078 22843 gene locus_tag LOCUS_06930 24078 22843 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230710.1 protein_id gnl|my_center|LOCUS_06930 24323 24529 gene locus_tag LOCUS_06940 24323 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 25836 24808 gene locus_tag LOCUS_06950 25836 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 26718 25873 gene locus_tag LOCUS_06960 26718 25873 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230708.1 protein_id gnl|my_center|LOCUS_06960 28309 26879 gene locus_tag LOCUS_06970 28309 26879 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284768.1 protein_id gnl|my_center|LOCUS_06970 28647 32213 gene locus_tag LOCUS_06980 gene dnaE 28647 32213 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224037.1 protein_id gnl|my_center|LOCUS_06980 33435 32305 gene locus_tag LOCUS_06990 gene dusB 33435 32305 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_06990 33743 33432 gene locus_tag LOCUS_07000 33743 33432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 33660 34022 gene locus_tag LOCUS_07010 33660 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 34203 34036 gene locus_tag LOCUS_07020 34203 34036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 34979 34305 gene locus_tag LOCUS_07030 34979 34305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 35305 37119 gene locus_tag LOCUS_07040 gene fadD6 35305 37119 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074247.1 protein_id gnl|my_center|LOCUS_07040 38087 37116 gene locus_tag LOCUS_07050 38087 37116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 39391 38171 gene locus_tag LOCUS_07060 39391 38171 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_07060 39498 40397 gene locus_tag LOCUS_07070 39498 40397 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_07070 41996 40467 gene locus_tag LOCUS_07080 41996 40467 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_07080 42261 42686 gene locus_tag LOCUS_07090 42261 42686 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331941.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence014 313 3822 gene locus_tag LOCUS_07100 gene metH 313 3822 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_07100 3974 4237 gene locus_tag LOCUS_07110 3974 4237 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_07110 4248 5102 gene locus_tag LOCUS_07120 gene hisG 4248 5102 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226744.1 protein_id gnl|my_center|LOCUS_07120 5787 5125 gene locus_tag LOCUS_07130 5787 5125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_07130 6741 5812 gene locus_tag LOCUS_07140 6741 5812 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226743.1 protein_id gnl|my_center|LOCUS_07140 7865 6996 gene locus_tag LOCUS_07150 7865 6996 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_07150 8037 9149 gene locus_tag LOCUS_07160 8037 9149 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226740.1 protein_id gnl|my_center|LOCUS_07160 9441 10265 gene locus_tag LOCUS_07170 9441 10265 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_07170 11051 10287 gene locus_tag LOCUS_07180 11051 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 11676 11122 gene locus_tag LOCUS_07190 11676 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 12139 11717 gene locus_tag LOCUS_07200 12139 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 12453 12628 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgggcggtagcccggcggcgg 13254 15086 gene locus_tag LOCUS_07210 gene arc 13254 15086 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284603.1 protein_id gnl|my_center|LOCUS_07210 15388 16881 gene locus_tag LOCUS_07220 gene dop 15388 16881 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_07220 16965 17159 gene locus_tag LOCUS_07230 16965 17159 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226725.1 protein_id gnl|my_center|LOCUS_07230 17339 18190 gene locus_tag LOCUS_07240 gene prcB 17339 18190 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226724.1 protein_id gnl|my_center|LOCUS_07240 18254 19024 gene locus_tag LOCUS_07250 gene prcA 18254 19024 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_07250 20515 19070 gene locus_tag LOCUS_07260 20515 19070 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 protein_id gnl|my_center|LOCUS_07260 20652 22010 gene locus_tag LOCUS_07270 gene pafA 20652 22010 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226720.1 protein_id gnl|my_center|LOCUS_07270 22176 23186 gene locus_tag LOCUS_07280 gene exoA 22176 23186 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_07280 24085 23222 gene locus_tag LOCUS_07290 24085 23222 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_07290 24858 24082 gene locus_tag LOCUS_07300 24858 24082 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_07300 25885 24830 gene locus_tag LOCUS_07310 25885 24830 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_07310 26604 25873 gene locus_tag LOCUS_07320 26604 25873 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_07320 27074 26601 gene locus_tag LOCUS_07330 27074 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 28819 27071 gene locus_tag LOCUS_07340 28819 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30356 29088 gene locus_tag LOCUS_07350 30356 29088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 32960 30387 gene locus_tag LOCUS_07360 32960 30387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 33127 34665 gene locus_tag LOCUS_07370 33127 34665 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727141.1 protein_id gnl|my_center|LOCUS_07370 34662 35510 gene locus_tag LOCUS_07380 34662 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 35520 36407 gene locus_tag LOCUS_07390 35520 36407 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_07390 36565 37872 gene locus_tag LOCUS_07400 36565 37872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 39727 37874 gene locus_tag LOCUS_07410 39727 37874 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 protein_id gnl|my_center|LOCUS_07410 39815 40765 gene locus_tag LOCUS_07420 39815 40765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 40777 41604 gene locus_tag LOCUS_07430 40777 41604 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296730.1 protein_id gnl|my_center|LOCUS_07430 41601 41894 gene locus_tag LOCUS_07440 41601 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence015 765 289 gene locus_tag LOCUS_07450 765 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1663 917 gene locus_tag LOCUS_07460 1663 917 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223848.1 protein_id gnl|my_center|LOCUS_07460 2460 1657 gene locus_tag LOCUS_07470 2460 1657 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223847.1 protein_id gnl|my_center|LOCUS_07470 3578 2457 gene locus_tag LOCUS_07480 3578 2457 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 protein_id gnl|my_center|LOCUS_07480 5134 3575 gene locus_tag LOCUS_07490 gene ffh 5134 3575 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_07490 7823 5493 gene locus_tag LOCUS_07500 7823 5493 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223834.1 protein_id gnl|my_center|LOCUS_07500 8183 7845 gene locus_tag LOCUS_07510 8183 7845 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 protein_id gnl|my_center|LOCUS_07510 9490 8180 gene locus_tag LOCUS_07520 9490 8180 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_07520 9687 10568 gene locus_tag LOCUS_07530 9687 10568 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_07530 10645 11295 gene locus_tag LOCUS_07540 10645 11295 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223830.1 protein_id gnl|my_center|LOCUS_07540 11445 12839 gene locus_tag LOCUS_07550 11445 12839 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833082.1 protein_id gnl|my_center|LOCUS_07550 13975 12992 gene locus_tag LOCUS_07560 13975 12992 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_07560 14493 14023 gene locus_tag LOCUS_07570 14493 14023 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_07570 14586 15173 gene locus_tag LOCUS_07580 14586 15173 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043335393.1 protein_id gnl|my_center|LOCUS_07580 15319 15795 gene locus_tag LOCUS_07590 15319 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15992 16993 gene locus_tag LOCUS_07600 15992 16993 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_07600 17086 17850 gene locus_tag LOCUS_07610 17086 17850 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_07610 19507 17930 gene locus_tag LOCUS_07620 gene aceB 19507 17930 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 protein_id gnl|my_center|LOCUS_07620 19767 20549 gene locus_tag LOCUS_07630 19767 20549 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_07630 20778 21665 gene locus_tag LOCUS_07640 20778 21665 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804445.1 protein_id gnl|my_center|LOCUS_07640 21713 22588 gene locus_tag LOCUS_07650 21713 22588 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_07650 22776 24554 gene locus_tag LOCUS_07660 gene gcl 22776 24554 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_07660 24551 25693 gene locus_tag LOCUS_07670 24551 25693 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_07670 25690 26880 gene locus_tag LOCUS_07680 gene alc 25690 26880 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111443.1 protein_id gnl|my_center|LOCUS_07680 26910 27290 gene locus_tag LOCUS_07690 26910 27290 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226427.1 protein_id gnl|my_center|LOCUS_07690 27580 27302 gene locus_tag LOCUS_07700 27580 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742211.1 protein_id gnl|my_center|LOCUS_07700 28171 27692 gene locus_tag LOCUS_07710 28171 27692 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065587.1 protein_id gnl|my_center|LOCUS_07710 30885 28249 gene locus_tag LOCUS_07720 30885 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 32635 31082 gene locus_tag LOCUS_07730 32635 31082 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_07730 32827 33354 gene locus_tag LOCUS_07740 gene uraD 32827 33354 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_07740 33351 33677 gene locus_tag LOCUS_07750 gene uraH 33351 33677 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_07750 33730 34632 gene locus_tag LOCUS_07760 gene pucL 33730 34632 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_07760 34643 35548 gene locus_tag LOCUS_07770 34643 35548 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_07770 35601 36077 gene locus_tag LOCUS_07780 35601 36077 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_07780 36074 37429 gene locus_tag LOCUS_07790 36074 37429 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_07790 37438 39963 gene locus_tag LOCUS_07800 gene pucD 37438 39963 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_07800 40043 41983 gene locus_tag LOCUS_07810 40043 41983 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727573.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence016 1097 318 gene locus_tag LOCUS_07820 1097 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1672 1103 gene locus_tag LOCUS_07830 1672 1103 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_07830 1894 2481 gene locus_tag LOCUS_07840 gene sigR 1894 2481 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_07840 2478 2708 gene locus_tag LOCUS_07850 2478 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2705 3499 gene locus_tag LOCUS_07860 gene arsM 2705 3499 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869251.1 protein_id gnl|my_center|LOCUS_07860 6853 3572 gene locus_tag LOCUS_07870 6853 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7255 7821 gene locus_tag LOCUS_07880 7255 7821 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_07880 7907 8290 gene locus_tag LOCUS_07890 7907 8290 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_07890 9028 8312 gene locus_tag LOCUS_07900 9028 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07900 9813 9040 gene locus_tag LOCUS_07910 9813 9040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_07910 10832 9810 gene locus_tag LOCUS_07920 10832 9810 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_07920 11710 10829 gene locus_tag LOCUS_07930 11710 10829 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_07930 12976 11759 gene locus_tag LOCUS_07940 12976 11759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 protein_id gnl|my_center|LOCUS_07940 13369 14223 gene locus_tag LOCUS_07950 13369 14223 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_07950 15391 14531 gene locus_tag LOCUS_07960 15391 14531 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_07960 15725 15384 gene locus_tag LOCUS_07970 15725 15384 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 protein_id gnl|my_center|LOCUS_07970 16777 15746 gene locus_tag LOCUS_07980 16777 15746 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_07980 18374 16761 gene locus_tag LOCUS_07990 18374 16761 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_07990 19827 18406 gene locus_tag LOCUS_08000 gene boxB 19827 18406 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_08000 21573 19834 gene locus_tag LOCUS_08010 gene boxC 21573 19834 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_08010 21758 22438 gene locus_tag LOCUS_08020 21758 22438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_08020 22435 23376 gene locus_tag LOCUS_08030 22435 23376 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229376.1 protein_id gnl|my_center|LOCUS_08030 23384 24205 gene locus_tag LOCUS_08040 23384 24205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_08040 25323 24229 gene locus_tag LOCUS_08050 gene paaK 25323 24229 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_08050 25826 25323 gene locus_tag LOCUS_08060 gene paaJ 25826 25323 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_08060 26704 25820 gene locus_tag LOCUS_08070 gene paaC 26704 25820 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_08070 27001 26714 gene locus_tag LOCUS_08080 gene paaB 27001 26714 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_08080 28008 26998 gene locus_tag LOCUS_08090 gene paaA 28008 26998 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 protein_id gnl|my_center|LOCUS_08090 30071 28008 gene locus_tag LOCUS_08100 gene paaZ 30071 28008 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_08100 30144 30947 gene locus_tag LOCUS_08110 30144 30947 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113330.1 protein_id gnl|my_center|LOCUS_08110 31864 30956 gene locus_tag LOCUS_08120 31864 30956 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 protein_id gnl|my_center|LOCUS_08120 31990 32370 gene locus_tag LOCUS_08130 gene paaI 31990 32370 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223461.1 protein_id gnl|my_center|LOCUS_08130 32370 32897 gene locus_tag LOCUS_08140 32370 32897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08140 32795 33697 gene locus_tag LOCUS_08150 32795 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 33881 34519 gene locus_tag LOCUS_08160 33881 34519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_08160 35132 34557 gene locus_tag LOCUS_08170 35132 34557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 35433 35798 gene locus_tag LOCUS_08180 35433 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 35856 36644 gene locus_tag LOCUS_08190 35856 36644 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_08190 37985 37179 gene locus_tag LOCUS_08200 37985 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 38768 38139 gene locus_tag LOCUS_08210 38768 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 39929 38817 gene locus_tag LOCUS_08220 gene menC 39929 38817 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_08220 40090 39926 gene locus_tag LOCUS_08230 40090 39926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 40637 40137 gene locus_tag LOCUS_08240 40637 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 40587 40823 gene locus_tag LOCUS_08250 40587 40823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 41751 40795 gene locus_tag LOCUS_08260 gene speB 41751 40795 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence017 593 138 gene locus_tag LOCUS_08270 593 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 671 1429 gene locus_tag LOCUS_08280 671 1429 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_08280 1526 2032 gene locus_tag LOCUS_08290 1526 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2029 3399 gene locus_tag LOCUS_08300 gene accC 2029 3399 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_08300 3396 4862 gene locus_tag LOCUS_08310 3396 4862 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_08310 4859 5719 gene locus_tag LOCUS_08320 4859 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5716 7554 gene locus_tag LOCUS_08330 5716 7554 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_08330 7551 8624 gene locus_tag LOCUS_08340 7551 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8617 10623 gene locus_tag LOCUS_08350 8617 10623 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225129.1 protein_id gnl|my_center|LOCUS_08350 10620 11513 gene locus_tag LOCUS_08360 gene couO 10620 11513 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_08360 11740 12060 gene locus_tag LOCUS_08370 11740 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08370 12175 13158 gene locus_tag LOCUS_08380 12175 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13155 14153 gene locus_tag LOCUS_08390 13155 14153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929960.1 protein_id gnl|my_center|LOCUS_08390 14150 15397 gene locus_tag LOCUS_08400 14150 15397 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064850.1 protein_id gnl|my_center|LOCUS_08400 15443 16963 gene locus_tag LOCUS_08410 15443 16963 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_08410 16974 17270 gene locus_tag LOCUS_08420 16974 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17363 18460 gene locus_tag LOCUS_08430 17363 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18463 19293 gene locus_tag LOCUS_08440 18463 19293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728386.1 protein_id gnl|my_center|LOCUS_08440 19290 20123 gene locus_tag LOCUS_08450 19290 20123 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728356.1 protein_id gnl|my_center|LOCUS_08450 20120 20950 gene locus_tag LOCUS_08460 20120 20950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893826.1 protein_id gnl|my_center|LOCUS_08460 20947 21771 gene locus_tag LOCUS_08470 20947 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 21825 22016 gene locus_tag LOCUS_08480 21825 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 22016 23224 gene locus_tag LOCUS_08490 22016 23224 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_08490 24153 23242 gene locus_tag LOCUS_08500 24153 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 24276 25748 gene locus_tag LOCUS_08510 24276 25748 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 protein_id gnl|my_center|LOCUS_08510 25745 26269 gene locus_tag LOCUS_08520 25745 26269 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276064.1 protein_id gnl|my_center|LOCUS_08520 26279 26527 gene locus_tag LOCUS_08530 26279 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 28277 26826 gene locus_tag LOCUS_08540 28277 26826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 protein_id gnl|my_center|LOCUS_08540 28894 28274 gene locus_tag LOCUS_08550 28894 28274 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_08550 30797 29253 gene locus_tag LOCUS_08560 30797 29253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 31503 30844 gene locus_tag LOCUS_08570 gene nagL 31503 30844 CDS product mycothiol-dependent maleylpyruvate isomerase NagL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855155.1 protein_id gnl|my_center|LOCUS_08570 32351 31500 gene locus_tag LOCUS_08580 32351 31500 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 protein_id gnl|my_center|LOCUS_08580 33487 32348 gene locus_tag LOCUS_08590 33487 32348 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015576.1 protein_id gnl|my_center|LOCUS_08590 34318 33560 gene locus_tag LOCUS_08600 34318 33560 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_08600 34405 35193 gene locus_tag LOCUS_08610 34405 35193 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_08610 35640 35479 gene locus_tag LOCUS_08620 35640 35479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 35673 35951 gene locus_tag LOCUS_08630 35673 35951 CDS product DUF5372 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078070384.1 protein_id gnl|my_center|LOCUS_08630 36111 36593 gene locus_tag LOCUS_08640 36111 36593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 36655 36930 gene locus_tag LOCUS_08650 36655 36930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 36978 37331 gene locus_tag LOCUS_08660 36978 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 37313 39535 gene locus_tag LOCUS_08670 37313 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 >Feature sequence018 1326 919 gene locus_tag LOCUS_08680 1326 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2231 1323 gene locus_tag LOCUS_08690 2231 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2378 3286 gene locus_tag LOCUS_08700 2378 3286 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227302.1 protein_id gnl|my_center|LOCUS_08700 4899 3439 gene locus_tag LOCUS_08710 4899 3439 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_08710 9457 4892 gene locus_tag LOCUS_08720 gene gltB 9457 4892 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_08720 9939 11441 gene locus_tag LOCUS_08730 9939 11441 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_08730 12050 11448 gene locus_tag LOCUS_08740 12050 11448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_08740 12148 13173 gene locus_tag LOCUS_08750 12148 13173 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_08750 13713 13138 gene locus_tag LOCUS_08760 13713 13138 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_08760 14217 14636 gene locus_tag LOCUS_08770 gene hrp1 14217 14636 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_08770 14854 14696 gene locus_tag LOCUS_08780 gene rpmF 14854 14696 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063395.1 protein_id gnl|my_center|LOCUS_08780 15117 14854 gene locus_tag LOCUS_08790 15117 14854 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_08790 15386 15114 gene locus_tag LOCUS_08800 15386 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 16158 16307 gene locus_tag LOCUS_08810 16158 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 16292 16600 gene locus_tag LOCUS_08820 gene rpsN 16292 16600 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_08820 16597 16839 gene locus_tag LOCUS_08830 gene rpsR 16597 16839 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 protein_id gnl|my_center|LOCUS_08830 16896 18122 gene locus_tag LOCUS_08840 gene cobA 16896 18122 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_08840 19023 18130 gene locus_tag LOCUS_08850 19023 18130 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_08850 19397 19185 gene locus_tag LOCUS_08860 19397 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 19396 19605 gene locus_tag LOCUS_08870 19396 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 19772 20386 gene locus_tag LOCUS_08880 19772 20386 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_08880 20510 20890 gene locus_tag LOCUS_08890 gene gcvH 20510 20890 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_08890 21015 21479 gene locus_tag LOCUS_08900 21015 21479 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_08900 21476 22255 gene locus_tag LOCUS_08910 21476 22255 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_08910 22435 22908 gene locus_tag LOCUS_08920 22435 22908 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_08920 23126 23671 gene locus_tag LOCUS_08930 23126 23671 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226814.1 protein_id gnl|my_center|LOCUS_08930 24010 26946 gene locus_tag LOCUS_08940 gene gcvP 24010 26946 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_08940 28244 27015 gene locus_tag LOCUS_08950 28244 27015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027932.1 protein_id gnl|my_center|LOCUS_08950 29114 28356 gene locus_tag LOCUS_08960 29114 28356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 30334 29258 gene locus_tag LOCUS_08970 30334 29258 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_08970 31677 30331 gene locus_tag LOCUS_08980 31677 30331 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_08980 32658 32074 gene locus_tag LOCUS_08990 32658 32074 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_08990 33941 32745 gene locus_tag LOCUS_09000 33941 32745 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226796.1 protein_id gnl|my_center|LOCUS_09000 34243 35160 gene locus_tag LOCUS_09010 34243 35160 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226795.1 protein_id gnl|my_center|LOCUS_09010 35267 36238 gene locus_tag LOCUS_09020 gene egtD 35267 36238 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence019 185 607 gene locus_tag LOCUS_09030 185 607 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_09030 700 1104 gene locus_tag LOCUS_09040 700 1104 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_09040 1135 3378 gene locus_tag LOCUS_09050 gene katG 1135 3378 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_09050 3564 5132 gene locus_tag LOCUS_09060 3564 5132 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 protein_id gnl|my_center|LOCUS_09060 5177 5779 gene locus_tag LOCUS_09070 5177 5779 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_09070 5981 6331 gene locus_tag LOCUS_09080 5981 6331 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029650.1 protein_id gnl|my_center|LOCUS_09080 8076 6412 gene locus_tag LOCUS_09090 8076 6412 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224438.1 protein_id gnl|my_center|LOCUS_09090 9379 8351 gene locus_tag LOCUS_09100 9379 8351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_09100 9868 9578 gene locus_tag LOCUS_09110 9868 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 9851 10042 gene locus_tag LOCUS_09120 9851 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11514 10012 gene locus_tag LOCUS_09130 11514 10012 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_09130 11635 11964 gene locus_tag LOCUS_09140 11635 11964 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_09140 12879 12004 gene locus_tag LOCUS_09150 12879 12004 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_09150 13510 13013 gene locus_tag LOCUS_09160 13510 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224328.1 protein_id gnl|my_center|LOCUS_09160 14295 13507 gene locus_tag LOCUS_09170 14295 13507 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_09170 14511 15269 gene locus_tag LOCUS_09180 14511 15269 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_09180 15403 15912 gene locus_tag LOCUS_09190 15403 15912 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_09190 17169 16075 gene locus_tag LOCUS_09200 17169 16075 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224332.1 protein_id gnl|my_center|LOCUS_09200 17442 18467 gene locus_tag LOCUS_09210 17442 18467 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_09210 18685 20454 gene locus_tag LOCUS_09220 gene ggt 18685 20454 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_09220 20610 22109 gene locus_tag LOCUS_09230 20610 22109 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_09230 22106 23608 gene locus_tag LOCUS_09240 22106 23608 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_09240 23627 24712 gene locus_tag LOCUS_09250 gene mraY 23627 24712 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_09250 24715 26190 gene locus_tag LOCUS_09260 gene murD 24715 26190 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_09260 26248 27804 gene locus_tag LOCUS_09270 gene ftsW 26248 27804 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228038.1 protein_id gnl|my_center|LOCUS_09270 27816 28901 gene locus_tag LOCUS_09280 gene murG 27816 28901 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 protein_id gnl|my_center|LOCUS_09280 28894 30348 gene locus_tag LOCUS_09290 gene murC 28894 30348 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_09290 30352 31119 gene locus_tag LOCUS_09300 30352 31119 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_09300 31364 32656 gene locus_tag LOCUS_09310 gene ftsZ 31364 32656 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224820.1 protein_id gnl|my_center|LOCUS_09310 32989 33696 gene locus_tag LOCUS_09320 gene pgeF 32989 33696 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_09320 33693 34424 gene locus_tag LOCUS_09330 33693 34424 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_09330 34459 35067 gene locus_tag LOCUS_09340 gene sepF 34459 35067 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224823.1 protein_id gnl|my_center|LOCUS_09340 35086 35370 gene locus_tag LOCUS_09350 35086 35370 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224824.1 protein_id gnl|my_center|LOCUS_09350 35417 36298 gene locus_tag LOCUS_09360 35417 36298 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224825.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence020 1111 338 gene locus_tag LOCUS_09370 1111 338 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_09370 1840 1259 gene locus_tag LOCUS_09380 1840 1259 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222431.1 protein_id gnl|my_center|LOCUS_09380 2466 1837 gene locus_tag LOCUS_09390 2466 1837 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_09390 3764 2463 gene locus_tag LOCUS_09400 gene hemL 3764 2463 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_09400 4207 3815 gene locus_tag LOCUS_09410 4207 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4706 4221 gene locus_tag LOCUS_09420 4706 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222422.1 protein_id gnl|my_center|LOCUS_09420 5311 4703 gene locus_tag LOCUS_09430 5311 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222421.1 protein_id gnl|my_center|LOCUS_09430 6278 5334 gene locus_tag LOCUS_09440 gene hemB 6278 5334 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_09440 7969 6425 gene locus_tag LOCUS_09450 7969 6425 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_09450 9042 8095 gene locus_tag LOCUS_09460 gene hemC 9042 8095 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 protein_id gnl|my_center|LOCUS_09460 10405 9035 gene locus_tag LOCUS_09470 10405 9035 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222415.1 protein_id gnl|my_center|LOCUS_09470 11236 10406 gene locus_tag LOCUS_09480 11236 10406 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222414.1 protein_id gnl|my_center|LOCUS_09480 13069 11495 gene locus_tag LOCUS_09490 13069 11495 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_09490 13355 13116 gene locus_tag LOCUS_09500 13355 13116 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_09500 14921 13392 gene locus_tag LOCUS_09510 14921 13392 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_09510 15228 15992 gene locus_tag LOCUS_09520 15228 15992 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_09520 16200 17411 gene locus_tag LOCUS_09530 16200 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 17450 18670 gene locus_tag LOCUS_09540 17450 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 19816 18683 gene locus_tag LOCUS_09550 19816 18683 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222404.1 protein_id gnl|my_center|LOCUS_09550 20885 19836 gene locus_tag LOCUS_09560 20885 19836 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_09560 21496 21284 gene locus_tag LOCUS_09570 21496 21284 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_09570 22588 21761 gene locus_tag LOCUS_09580 gene proC 22588 21761 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_09580 23480 22626 gene locus_tag LOCUS_09590 23480 22626 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222400.1 protein_id gnl|my_center|LOCUS_09590 24403 23477 gene locus_tag LOCUS_09600 24403 23477 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_09600 25427 24543 gene locus_tag LOCUS_09610 25427 24543 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742120.1 protein_id gnl|my_center|LOCUS_09610 26115 25447 gene locus_tag LOCUS_09620 26115 25447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 27502 26603 gene locus_tag LOCUS_09630 27502 26603 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222397.1 protein_id gnl|my_center|LOCUS_09630 28410 27706 gene locus_tag LOCUS_09640 28410 27706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_09640 29678 28407 gene locus_tag LOCUS_09650 29678 28407 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285858.1 protein_id gnl|my_center|LOCUS_09650 29954 30712 gene locus_tag LOCUS_09660 29954 30712 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_09660 31325 30717 gene locus_tag LOCUS_09670 31325 30717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 33013 31325 gene locus_tag LOCUS_09680 33013 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 35730 33277 gene locus_tag LOCUS_09690 35730 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 36008 36292 gene locus_tag LOCUS_09700 36008 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence021 279 848 gene locus_tag LOCUS_09710 279 848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225031.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09710 922 2004 gene locus_tag LOCUS_09720 922 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09720 2441 3787 gene locus_tag LOCUS_09730 2441 3787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228110.1 protein_id gnl|my_center|LOCUS_09730 4943 3969 gene locus_tag LOCUS_09740 4943 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7290 4945 gene locus_tag LOCUS_09750 7290 4945 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_09750 7387 7644 gene locus_tag LOCUS_09760 7387 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 9789 7639 gene locus_tag LOCUS_09770 9789 7639 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_09770 10238 9786 gene locus_tag LOCUS_09780 10238 9786 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_09780 10659 13121 gene locus_tag LOCUS_09790 10659 13121 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_09790 13177 13608 gene locus_tag LOCUS_09800 13177 13608 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_09800 13617 13988 gene locus_tag LOCUS_09810 13617 13988 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_09810 13969 14595 gene locus_tag LOCUS_09820 13969 14595 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_09820 14608 15168 gene locus_tag LOCUS_09830 14608 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 16500 15286 gene locus_tag LOCUS_09840 16500 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 16725 17636 gene locus_tag LOCUS_09850 gene truB 16725 17636 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_09850 17723 18700 gene locus_tag LOCUS_09860 17723 18700 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_09860 18807 19289 gene locus_tag LOCUS_09870 18807 19289 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228105.1 protein_id gnl|my_center|LOCUS_09870 19292 19825 gene locus_tag LOCUS_09880 gene thpR 19292 19825 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228104.1 protein_id gnl|my_center|LOCUS_09880 19980 20249 gene locus_tag LOCUS_09890 gene rpsO 19980 20249 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_09890 20597 22837 gene locus_tag LOCUS_09900 20597 22837 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228103.1 protein_id gnl|my_center|LOCUS_09900 22935 24236 gene locus_tag LOCUS_09910 22935 24236 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_09910 24288 25196 gene locus_tag LOCUS_09920 24288 25196 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223526.1 protein_id gnl|my_center|LOCUS_09920 25928 25287 gene locus_tag LOCUS_09930 25928 25287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 27252 26122 gene locus_tag LOCUS_09940 27252 26122 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229361.1 protein_id gnl|my_center|LOCUS_09940 28133 27522 gene locus_tag LOCUS_09950 28133 27522 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_09950 28482 28114 gene locus_tag LOCUS_09960 28482 28114 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_09960 29074 28643 gene locus_tag LOCUS_09970 29074 28643 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_09970 31617 29071 gene locus_tag LOCUS_09980 31617 29071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_09980 31884 34058 gene locus_tag LOCUS_09990 31884 34058 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_09990 34071 34715 gene locus_tag LOCUS_10000 34071 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 34970 35677 gene locus_tag LOCUS_10010 gene dapB 34970 35677 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_10010 35688 36128 gene locus_tag LOCUS_10020 35688 36128 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285688.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence022 873 136 gene locus_tag LOCUS_10030 873 136 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_10030 1224 1664 gene locus_tag LOCUS_10040 1224 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1721 2470 gene locus_tag LOCUS_10050 1721 2470 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_10050 2868 2695 gene locus_tag LOCUS_10060 2868 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2842 4038 gene locus_tag LOCUS_10070 2842 4038 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229361.1 protein_id gnl|my_center|LOCUS_10070 4293 4078 gene locus_tag LOCUS_10080 4293 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4440 6272 gene locus_tag LOCUS_10090 4440 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6269 7105 gene locus_tag LOCUS_10100 6269 7105 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_10100 7393 8793 gene locus_tag LOCUS_10110 7393 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_10110 8790 9161 gene locus_tag LOCUS_10120 8790 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9538 9356 gene locus_tag LOCUS_10130 9538 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9537 11549 gene locus_tag LOCUS_10140 9537 11549 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10140 11551 12558 gene locus_tag LOCUS_10150 11551 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 12555 13835 gene locus_tag LOCUS_10160 12555 13835 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_10160 14257 13844 gene locus_tag LOCUS_10170 14257 13844 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_10170 14855 14481 gene locus_tag LOCUS_10180 14855 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15058 14846 gene locus_tag LOCUS_10190 15058 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 18977 15183 gene locus_tag LOCUS_10200 18977 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 22509 19000 gene locus_tag LOCUS_10210 22509 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 22808 24115 gene locus_tag LOCUS_10220 gene aepX 22808 24115 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_10220 24112 25251 gene locus_tag LOCUS_10230 gene aepY 24112 25251 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817136.1 protein_id gnl|my_center|LOCUS_10230 25266 26450 gene locus_tag LOCUS_10240 25266 26450 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_10240 26462 27709 gene locus_tag LOCUS_10250 26462 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 27660 27974 gene locus_tag LOCUS_10260 27660 27974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 27980 28840 gene locus_tag LOCUS_10270 27980 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 29638 28826 gene locus_tag LOCUS_10280 29638 28826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 29975 30703 gene locus_tag LOCUS_10290 29975 30703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 30713 31051 gene locus_tag LOCUS_10300 30713 31051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 31057 32184 gene locus_tag LOCUS_10310 31057 32184 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029019.1 protein_id gnl|my_center|LOCUS_10310 32181 32843 gene locus_tag LOCUS_10320 32181 32843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 32846 33472 gene locus_tag LOCUS_10330 32846 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 33453 33905 gene locus_tag LOCUS_10340 33453 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 33902 35806 gene locus_tag LOCUS_10350 33902 35806 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence023 1149 391 gene locus_tag LOCUS_10360 1149 391 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 protein_id gnl|my_center|LOCUS_10360 1220 2101 gene locus_tag LOCUS_10370 gene sigJ 1220 2101 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_10370 2564 2157 gene locus_tag LOCUS_10380 gene ndk 2564 2157 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_10380 3361 2957 gene locus_tag LOCUS_10390 3361 2957 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228490.1 protein_id gnl|my_center|LOCUS_10390 4914 3358 gene locus_tag LOCUS_10400 4914 3358 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_10400 5895 5038 gene locus_tag LOCUS_10410 5895 5038 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030730.1 protein_id gnl|my_center|LOCUS_10410 6168 6953 gene locus_tag LOCUS_10420 6168 6953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_10420 7075 7887 gene locus_tag LOCUS_10430 7075 7887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812446.1 protein_id gnl|my_center|LOCUS_10430 7884 9761 gene locus_tag LOCUS_10440 7884 9761 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063644.1 protein_id gnl|my_center|LOCUS_10440 9761 10648 gene locus_tag LOCUS_10450 9761 10648 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_10450 10645 11790 gene locus_tag LOCUS_10460 10645 11790 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_10460 11843 13156 gene locus_tag LOCUS_10470 11843 13156 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228794.1 protein_id gnl|my_center|LOCUS_10470 15982 13352 gene locus_tag LOCUS_10480 15982 13352 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228497.1 protein_id gnl|my_center|LOCUS_10480 15954 16136 gene locus_tag LOCUS_10490 15954 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 16189 16401 gene locus_tag LOCUS_10500 16189 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 16371 17201 gene locus_tag LOCUS_10510 gene fdhD 16371 17201 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_10510 17239 17919 gene locus_tag LOCUS_10520 17239 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 17861 18334 gene locus_tag LOCUS_10530 17861 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 19629 18331 gene locus_tag LOCUS_10540 gene clpX 19629 18331 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_10540 20594 19887 gene locus_tag LOCUS_10550 20594 19887 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_10550 21205 20591 gene locus_tag LOCUS_10560 21205 20591 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228512.1 protein_id gnl|my_center|LOCUS_10560 22677 21343 gene locus_tag LOCUS_10570 gene tig 22677 21343 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_10570 23016 24065 gene locus_tag LOCUS_10580 23016 24065 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027126.1 protein_id gnl|my_center|LOCUS_10580 24062 24700 gene locus_tag LOCUS_10590 24062 24700 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_10590 24893 24819 gene locus_tag LOCUS_t00100 24893 24819 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24973 25046 gene locus_tag LOCUS_t00110 24973 25046 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25271 25684 gene locus_tag LOCUS_10600 25271 25684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 25777 26229 gene locus_tag LOCUS_10610 25777 26229 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112171.1 protein_id gnl|my_center|LOCUS_10610 27012 26239 gene locus_tag LOCUS_10620 27012 26239 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 protein_id gnl|my_center|LOCUS_10620 27251 28024 gene locus_tag LOCUS_10630 27251 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228577.1 protein_id gnl|my_center|LOCUS_10630 28997 28041 gene locus_tag LOCUS_10640 28997 28041 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_10640 30033 29227 gene locus_tag LOCUS_10650 30033 29227 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_10650 30503 30033 gene locus_tag LOCUS_10660 30503 30033 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467526.1 protein_id gnl|my_center|LOCUS_10660 30551 31297 gene locus_tag LOCUS_10670 30551 31297 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_10670 31830 31417 gene locus_tag LOCUS_10680 31830 31417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 33280 31889 gene locus_tag LOCUS_10690 gene tnpB 33280 31889 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 protein_id gnl|my_center|LOCUS_10690 33917 33273 gene locus_tag LOCUS_10700 33917 33273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 34129 33917 gene locus_tag LOCUS_10710 34129 33917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 <35572 34438 gene locus_tag LOCUS_10720 <35572 34438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889386.1:aldehyde dehydrogenase family protein >Feature sequence024 67 828 gene locus_tag LOCUS_10730 67 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 927 1427 gene locus_tag LOCUS_10740 927 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230231.1 protein_id gnl|my_center|LOCUS_10740 1427 2038 gene locus_tag LOCUS_10750 1427 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2048 3553 gene locus_tag LOCUS_10760 2048 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4702 3623 gene locus_tag LOCUS_10770 4702 3623 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495700.1 protein_id gnl|my_center|LOCUS_10770 5401 4784 gene locus_tag LOCUS_10780 5401 4784 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_10780 5579 6262 gene locus_tag LOCUS_10790 5579 6262 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_10790 6833 6318 gene locus_tag LOCUS_10800 6833 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6718 7035 gene locus_tag LOCUS_10810 6718 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8376 7060 gene locus_tag LOCUS_10820 8376 7060 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_10820 9189 8470 gene locus_tag LOCUS_10830 gene trmB 9189 8470 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_10830 9776 9210 gene locus_tag LOCUS_10840 9776 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230973.1 protein_id gnl|my_center|LOCUS_10840 10857 10102 gene locus_tag LOCUS_10850 10857 10102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225510.1 protein_id gnl|my_center|LOCUS_10850 11836 10889 gene locus_tag LOCUS_10860 11836 10889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_10860 12676 12026 gene locus_tag LOCUS_10870 12676 12026 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_10870 13884 12673 gene locus_tag LOCUS_10880 13884 12673 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 protein_id gnl|my_center|LOCUS_10880 14139 15734 gene locus_tag LOCUS_10890 14139 15734 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 protein_id gnl|my_center|LOCUS_10890 15870 16346 gene locus_tag LOCUS_10900 15870 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16343 18211 gene locus_tag LOCUS_10910 16343 18211 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_10910 18410 19180 gene locus_tag LOCUS_10920 18410 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230960.1 protein_id gnl|my_center|LOCUS_10920 19469 21301 gene locus_tag LOCUS_10930 19469 21301 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_10930 23333 21729 gene locus_tag LOCUS_10940 23333 21729 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230951.1 protein_id gnl|my_center|LOCUS_10940 24885 23689 gene locus_tag LOCUS_10950 24885 23689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10950 25197 25433 gene locus_tag LOCUS_10960 25197 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25430 25831 gene locus_tag LOCUS_10970 25430 25831 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_10970 26947 26072 gene locus_tag LOCUS_10980 26947 26072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_10980 27963 26944 gene locus_tag LOCUS_10990 27963 26944 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_10990 29616 28081 gene locus_tag LOCUS_11000 gene hutH 29616 28081 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_11000 30542 29622 gene locus_tag LOCUS_11010 30542 29622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 protein_id gnl|my_center|LOCUS_11010 31279 30566 gene locus_tag LOCUS_11020 31279 30566 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_11020 31926 31276 gene locus_tag LOCUS_11030 31926 31276 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_11030 33044 31923 gene locus_tag LOCUS_11040 33044 31923 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_11040 34132 33119 gene locus_tag LOCUS_11050 34132 33119 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_11050 34816 34187 gene locus_tag LOCUS_11060 34816 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence025 1749 1180 gene locus_tag LOCUS_11070 gene pcaG 1749 1180 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_11070 2476 1739 gene locus_tag LOCUS_11080 gene pcaH 2476 1739 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_11080 3654 2479 gene locus_tag LOCUS_11090 3654 2479 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_11090 4421 3651 gene locus_tag LOCUS_11100 4421 3651 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_11100 5325 4510 gene locus_tag LOCUS_11110 5325 4510 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_11110 7028 5499 gene locus_tag LOCUS_11120 7028 5499 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832531.1 protein_id gnl|my_center|LOCUS_11120 8140 7067 gene locus_tag LOCUS_11130 gene pta 8140 7067 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582992.1 protein_id gnl|my_center|LOCUS_11130 9255 8143 gene locus_tag LOCUS_11140 gene ald 9255 8143 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_11140 10692 9313 gene locus_tag LOCUS_11150 10692 9313 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_11150 10911 12602 gene locus_tag LOCUS_11160 10911 12602 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_11160 12599 14062 gene locus_tag LOCUS_11170 12599 14062 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_11170 15582 14128 gene locus_tag LOCUS_11180 15582 14128 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_11180 16562 15639 gene locus_tag LOCUS_11190 16562 15639 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226007.1 protein_id gnl|my_center|LOCUS_11190 16735 17625 gene locus_tag LOCUS_11200 16735 17625 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_11200 17983 17729 gene locus_tag LOCUS_11210 17983 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 18669 18361 gene locus_tag LOCUS_11220 18669 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 20178 18844 gene locus_tag LOCUS_11230 gene ftsY 20178 18844 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223799.1 protein_id gnl|my_center|LOCUS_11230 23843 20250 gene locus_tag LOCUS_11240 gene smc 23843 20250 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_11240 24431 24111 gene locus_tag LOCUS_11250 24431 24111 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_11250 24580 25248 gene locus_tag LOCUS_11260 24580 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 26116 25262 gene locus_tag LOCUS_11270 gene mutM 26116 25262 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_11270 26872 26120 gene locus_tag LOCUS_11280 gene rnc 26872 26120 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_11280 27069 26887 gene locus_tag LOCUS_11290 gene rpmF 27069 26887 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_11290 27804 27187 gene locus_tag LOCUS_11300 27804 27187 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_11300 28556 27843 gene locus_tag LOCUS_11310 28556 27843 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223687.1 protein_id gnl|my_center|LOCUS_11310 29127 28639 gene locus_tag LOCUS_11320 gene coaD 29127 28639 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223683.1 protein_id gnl|my_center|LOCUS_11320 29212 29868 gene locus_tag LOCUS_11330 29212 29868 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018162528.1 protein_id gnl|my_center|LOCUS_11330 29883 30347 gene locus_tag LOCUS_11340 29883 30347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 30920 30351 gene locus_tag LOCUS_11350 gene rsmD 30920 30351 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_11350 31058 33190 gene locus_tag LOCUS_11360 31058 33190 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_11360 <34854 33340 gene locus_tag LOCUS_11370 <34854 33340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005074376.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence026 1175 228 gene locus_tag LOCUS_11380 1175 228 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776432.1 protein_id gnl|my_center|LOCUS_11380 1413 1937 gene locus_tag LOCUS_11390 1413 1937 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230835.1 protein_id gnl|my_center|LOCUS_11390 1934 3520 gene locus_tag LOCUS_11400 1934 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3704 4387 gene locus_tag LOCUS_11410 3704 4387 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230838.1 protein_id gnl|my_center|LOCUS_11410 5497 4439 gene locus_tag LOCUS_11420 5497 4439 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_11420 5602 7746 gene locus_tag LOCUS_11430 5602 7746 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_11430 8428 7757 gene locus_tag LOCUS_11440 8428 7757 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_11440 8966 8415 gene locus_tag LOCUS_11450 gene pyrE 8966 8415 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_11450 9764 9036 gene locus_tag LOCUS_11460 9764 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230862.1 protein_id gnl|my_center|LOCUS_11460 12576 9916 gene locus_tag LOCUS_11470 gene clpB 12576 9916 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_11470 12807 14381 gene locus_tag LOCUS_11480 12807 14381 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_11480 14614 15717 gene locus_tag LOCUS_11490 14614 15717 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_11490 16726 15788 gene locus_tag LOCUS_11500 16726 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 17033 18208 gene locus_tag LOCUS_11510 17033 18208 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_11510 18812 18369 gene locus_tag LOCUS_11520 18812 18369 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_11520 19996 18812 gene locus_tag LOCUS_11530 gene dnaJ 19996 18812 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_11530 20790 20077 gene locus_tag LOCUS_11540 gene grpE 20790 20077 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_11540 22655 20787 gene locus_tag LOCUS_11550 gene dnaK 22655 20787 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_11550 23189 22893 gene locus_tag LOCUS_11560 23189 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 23279 23500 gene locus_tag LOCUS_11570 23279 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 23497 24036 gene locus_tag LOCUS_11580 23497 24036 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_11580 24611 24042 gene locus_tag LOCUS_11590 24611 24042 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_11590 24975 24646 gene locus_tag LOCUS_11600 gene abeS 24975 24646 CDS product multidrug efflux SMR transporter AbeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_11600 25119 27356 gene locus_tag LOCUS_11610 25119 27356 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 protein_id gnl|my_center|LOCUS_11610 27547 29436 gene locus_tag LOCUS_11620 27547 29436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731322.1 protein_id gnl|my_center|LOCUS_11620 30022 29441 gene locus_tag LOCUS_11630 gene dcd 30022 29441 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058109.1 protein_id gnl|my_center|LOCUS_11630 31511 30120 gene locus_tag LOCUS_11640 31511 30120 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_11640 31510 32457 gene locus_tag LOCUS_11650 31510 32457 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705341.1 protein_id gnl|my_center|LOCUS_11650 33653 32406 gene locus_tag LOCUS_11660 33653 32406 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230888.1 protein_id gnl|my_center|LOCUS_11660 33795 33866 gene locus_tag LOCUS_t00120 33795 33866 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 18 233 gene locus_tag LOCUS_11670 18 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 215 655 gene locus_tag LOCUS_11680 215 655 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413164.1 protein_id gnl|my_center|LOCUS_11680 1563 907 gene locus_tag LOCUS_11690 gene bluB 1563 907 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_11690 2317 1556 gene locus_tag LOCUS_11700 2317 1556 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_11700 2319 3434 gene locus_tag LOCUS_11710 2319 3434 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258096.1 protein_id gnl|my_center|LOCUS_11710 3431 4081 gene locus_tag LOCUS_11720 3431 4081 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 protein_id gnl|my_center|LOCUS_11720 4122 4445 gene locus_tag LOCUS_11730 4122 4445 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_11730 4442 5935 gene locus_tag LOCUS_11740 4442 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 6687 5932 gene locus_tag LOCUS_11750 gene cobM 6687 5932 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_11750 7979 6753 gene locus_tag LOCUS_11760 7979 6753 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228818.1 protein_id gnl|my_center|LOCUS_11760 8116 10092 gene locus_tag LOCUS_11770 8116 10092 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228817.1 protein_id gnl|my_center|LOCUS_11770 10199 10813 gene locus_tag LOCUS_11780 gene cobO 10199 10813 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_11780 10807 12255 gene locus_tag LOCUS_11790 10807 12255 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_11790 12248 13315 gene locus_tag LOCUS_11800 gene cobC 12248 13315 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228814.1 protein_id gnl|my_center|LOCUS_11800 14217 13459 gene locus_tag LOCUS_11810 14217 13459 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_11810 15254 14217 gene locus_tag LOCUS_11820 gene cobT 15254 14217 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228810.1 protein_id gnl|my_center|LOCUS_11820 15904 15251 gene locus_tag LOCUS_11830 15904 15251 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228809.1 protein_id gnl|my_center|LOCUS_11830 15977 16288 gene locus_tag LOCUS_11840 15977 16288 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_11840 16292 16771 gene locus_tag LOCUS_11850 16292 16771 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525198.1 protein_id gnl|my_center|LOCUS_11850 16804 17838 gene locus_tag LOCUS_11860 16804 17838 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_11860 17850 19340 gene locus_tag LOCUS_11870 17850 19340 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228807.1 protein_id gnl|my_center|LOCUS_11870 20161 19415 gene locus_tag LOCUS_11880 20161 19415 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_11880 20392 20174 gene locus_tag LOCUS_11890 20392 20174 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_11890 20687 21436 gene locus_tag LOCUS_11900 20687 21436 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228838.1 protein_id gnl|my_center|LOCUS_11900 21465 22721 gene locus_tag LOCUS_11910 21465 22721 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228837.1 protein_id gnl|my_center|LOCUS_11910 23125 22835 gene locus_tag LOCUS_11920 23125 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 23318 23641 gene locus_tag LOCUS_11930 23318 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 23638 24156 gene locus_tag LOCUS_11940 23638 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_11940 24153 24980 gene locus_tag LOCUS_11950 24153 24980 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_11950 25951 25001 gene locus_tag LOCUS_11960 25951 25001 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_11960 26475 26026 gene locus_tag LOCUS_11970 26475 26026 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284441.1 protein_id gnl|my_center|LOCUS_11970 27881 26697 gene locus_tag LOCUS_11980 27881 26697 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306094.1 protein_id gnl|my_center|LOCUS_11980 29284 27941 gene locus_tag LOCUS_11990 gene ccrA 29284 27941 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_11990 29189 29395 gene locus_tag LOCUS_12000 29189 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 29496 29861 gene locus_tag LOCUS_12010 29496 29861 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_12010 30375 29938 gene locus_tag LOCUS_12020 gene mce 30375 29938 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_12020 30625 31806 gene locus_tag LOCUS_12030 30625 31806 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_12030 31873 32835 gene locus_tag LOCUS_12040 gene meaB 31873 32835 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_12040 32902 33645 gene locus_tag LOCUS_12050 32902 33645 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence028 19 1140 gene locus_tag LOCUS_12060 gene ugpC 19 1140 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_12060 1381 2673 gene locus_tag LOCUS_12070 1381 2673 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930026.1 protein_id gnl|my_center|LOCUS_12070 2750 3730 gene locus_tag LOCUS_12080 2750 3730 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930288.1 protein_id gnl|my_center|LOCUS_12080 3727 4647 gene locus_tag LOCUS_12090 3727 4647 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776594.1 protein_id gnl|my_center|LOCUS_12090 4836 6158 gene locus_tag LOCUS_12100 4836 6158 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_12100 6203 7048 gene locus_tag LOCUS_12110 6203 7048 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_12110 7048 7908 gene locus_tag LOCUS_12120 7048 7908 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_12120 7913 8599 gene locus_tag LOCUS_12130 7913 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9543 8707 gene locus_tag LOCUS_12140 9543 8707 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_12140 10323 9598 gene locus_tag LOCUS_12150 10323 9598 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_12150 11532 10438 gene locus_tag LOCUS_12160 gene corA 11532 10438 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_12160 11654 12157 gene locus_tag LOCUS_12170 11654 12157 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_12170 12170 13258 gene locus_tag LOCUS_12180 12170 13258 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223005.1 protein_id gnl|my_center|LOCUS_12180 13689 13321 gene locus_tag LOCUS_12190 13689 13321 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_12190 13871 14035 gene locus_tag LOCUS_12200 13871 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162472554.1 protein_id gnl|my_center|LOCUS_12200 14051 14617 gene locus_tag LOCUS_12210 14051 14617 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_12210 14780 15655 gene locus_tag LOCUS_12220 14780 15655 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_12220 15652 15999 gene locus_tag LOCUS_12230 15652 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 16235 17770 gene locus_tag LOCUS_12240 16235 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 17939 18307 gene locus_tag LOCUS_12250 17939 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 20480 18375 gene locus_tag LOCUS_12260 20480 18375 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466954.1 protein_id gnl|my_center|LOCUS_12260 21457 20552 gene locus_tag LOCUS_12270 21457 20552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_12270 22782 21454 gene locus_tag LOCUS_12280 22782 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324690.1 protein_id gnl|my_center|LOCUS_12280 24428 22779 gene locus_tag LOCUS_12290 24428 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 24727 25392 gene locus_tag LOCUS_12300 24727 25392 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223015.1 protein_id gnl|my_center|LOCUS_12300 25447 25671 gene locus_tag LOCUS_12310 25447 25671 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_12310 26645 25875 gene locus_tag LOCUS_12320 26645 25875 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_12320 26706 27671 gene locus_tag LOCUS_12330 26706 27671 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_12330 27682 27891 gene locus_tag LOCUS_12340 27682 27891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 28563 27910 gene locus_tag LOCUS_12350 28563 27910 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_12350 28664 29689 gene locus_tag LOCUS_12360 28664 29689 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_12360 29873 31057 gene locus_tag LOCUS_12370 29873 31057 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223023.1 protein_id gnl|my_center|LOCUS_12370 31441 32619 gene locus_tag LOCUS_12380 gene moeZ 31441 32619 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence029 723 178 gene locus_tag LOCUS_12390 723 178 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228070.1 protein_id gnl|my_center|LOCUS_12390 853 2973 gene locus_tag LOCUS_12400 853 2973 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776647.1 protein_id gnl|my_center|LOCUS_12400 2970 5057 gene locus_tag LOCUS_12410 2970 5057 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228230.1 protein_id gnl|my_center|LOCUS_12410 5244 6689 gene locus_tag LOCUS_12420 gene rimO 5244 6689 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_12420 6686 7342 gene locus_tag LOCUS_12430 gene pgsA 6686 7342 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_12430 7349 7837 gene locus_tag LOCUS_12440 7349 7837 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_12440 7981 8379 gene locus_tag LOCUS_12450 7981 8379 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467438.1 protein_id gnl|my_center|LOCUS_12450 8548 9444 gene locus_tag LOCUS_12460 8548 9444 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228065.1 protein_id gnl|my_center|LOCUS_12460 9477 10205 gene locus_tag LOCUS_12470 9477 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228064.1 protein_id gnl|my_center|LOCUS_12470 11370 10303 gene locus_tag LOCUS_12480 11370 10303 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_12480 12271 11387 gene locus_tag LOCUS_12490 12271 11387 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_12490 12478 13209 gene locus_tag LOCUS_12500 12478 13209 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228057.1 protein_id gnl|my_center|LOCUS_12500 13373 14722 gene locus_tag LOCUS_12510 gene dinB 13373 14722 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_12510 14870 15271 gene locus_tag LOCUS_12520 14870 15271 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228055.1 protein_id gnl|my_center|LOCUS_12520 17836 15353 gene locus_tag LOCUS_12530 17836 15353 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228054.1 protein_id gnl|my_center|LOCUS_12530 19092 17833 gene locus_tag LOCUS_12540 19092 17833 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_12540 20188 19103 gene locus_tag LOCUS_12550 20188 19103 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_12550 20717 21148 gene locus_tag LOCUS_12560 gene mraZ 20717 21148 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_12560 21482 22456 gene locus_tag LOCUS_12570 gene rsmH 21482 22456 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_12570 22453 23082 gene locus_tag LOCUS_12580 22453 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 23079 25067 gene locus_tag LOCUS_12590 23079 25067 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467433.1 protein_id gnl|my_center|LOCUS_12590 25230 26624 gene locus_tag LOCUS_12600 gene pyk 25230 26624 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466825.1 protein_id gnl|my_center|LOCUS_12600 26651 27523 gene locus_tag LOCUS_12610 26651 27523 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_12610 27738 28604 gene locus_tag LOCUS_12620 27738 28604 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_12620 28601 28876 gene locus_tag LOCUS_12630 28601 28876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 28991 32074 gene locus_tag LOCUS_12640 28991 32074 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_12640 32612 31965 gene locus_tag LOCUS_12650 32612 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence030 143 2338 gene locus_tag LOCUS_12660 gene uvrB 143 2338 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_12660 3307 2372 gene locus_tag LOCUS_12670 3307 2372 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_12670 6254 3291 gene locus_tag LOCUS_12680 6254 3291 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_12680 6543 7517 gene locus_tag LOCUS_12690 6543 7517 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_12690 8470 7610 gene locus_tag LOCUS_12700 8470 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9711 8719 gene locus_tag LOCUS_12710 9711 8719 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_12710 10000 10965 gene locus_tag LOCUS_12720 10000 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 11001 11951 gene locus_tag LOCUS_12730 11001 11951 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130338486.1 protein_id gnl|my_center|LOCUS_12730 12872 12012 gene locus_tag LOCUS_12740 12872 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 protein_id gnl|my_center|LOCUS_12740 13906 13229 gene locus_tag LOCUS_12750 13906 13229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_12750 14015 15289 gene locus_tag LOCUS_12760 14015 15289 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227875.1 protein_id gnl|my_center|LOCUS_12760 15352 18207 gene locus_tag LOCUS_12770 gene uvrA 15352 18207 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_12770 18565 18200 gene locus_tag LOCUS_12780 18565 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 18876 19088 gene locus_tag LOCUS_12790 18876 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 19902 19075 gene locus_tag LOCUS_12800 19902 19075 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_12800 20754 19906 gene locus_tag LOCUS_12810 20754 19906 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980238.1 protein_id gnl|my_center|LOCUS_12810 21712 20747 gene locus_tag LOCUS_12820 21712 20747 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_12820 22519 21755 gene locus_tag LOCUS_12830 22519 21755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_12830 23523 22516 gene locus_tag LOCUS_12840 23523 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 24163 23516 gene locus_tag LOCUS_12850 24163 23516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_12850 25106 24186 gene locus_tag LOCUS_12860 25106 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 26010 25126 gene locus_tag LOCUS_12870 26010 25126 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227997.1 protein_id gnl|my_center|LOCUS_12870 26009 26455 gene locus_tag LOCUS_12880 26009 26455 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227869.1 protein_id gnl|my_center|LOCUS_12880 26868 26500 gene locus_tag LOCUS_12890 26868 26500 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790921.1 protein_id gnl|my_center|LOCUS_12890 26921 27679 gene locus_tag LOCUS_12900 gene infC 26921 27679 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_12900 27763 27957 gene locus_tag LOCUS_12910 gene rpmI 27763 27957 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227847.1 protein_id gnl|my_center|LOCUS_12910 28029 28409 gene locus_tag LOCUS_12920 gene rplT 28029 28409 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_12920 28487 29233 gene locus_tag LOCUS_12930 28487 29233 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084642168.1 protein_id gnl|my_center|LOCUS_12930 29365 30420 gene locus_tag LOCUS_12940 gene pheS 29365 30420 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence031 637 242 gene locus_tag LOCUS_12950 637 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1008 604 gene locus_tag LOCUS_12960 1008 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1515 1442 gene locus_tag LOCUS_t00130 1515 1442 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1638 1566 gene locus_tag LOCUS_t00140 1638 1566 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2484 1711 gene locus_tag LOCUS_12970 2484 1711 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_12970 4033 2564 gene locus_tag LOCUS_12980 gene gltX 4033 2564 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 protein_id gnl|my_center|LOCUS_12980 4193 5413 gene locus_tag LOCUS_12990 4193 5413 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223595.1 protein_id gnl|my_center|LOCUS_12990 6201 5443 gene locus_tag LOCUS_13000 6201 5443 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_13000 8041 6413 gene locus_tag LOCUS_13010 gene cimA 8041 6413 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_13010 9391 8342 gene locus_tag LOCUS_13020 9391 8342 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_13020 11211 9616 gene locus_tag LOCUS_13030 gene serA 11211 9616 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223590.1 protein_id gnl|my_center|LOCUS_13030 11666 11385 gene locus_tag LOCUS_13040 11666 11385 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223584.1 protein_id gnl|my_center|LOCUS_13040 12653 11760 gene locus_tag LOCUS_13050 12653 11760 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_13050 14053 13046 gene locus_tag LOCUS_13060 gene ilvC 14053 13046 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_13060 14651 14142 gene locus_tag LOCUS_13070 gene ilvN 14651 14142 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_13070 16632 14779 gene locus_tag LOCUS_13080 16632 14779 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_13080 16645 17355 gene locus_tag LOCUS_13090 16645 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17355 19208 gene locus_tag LOCUS_13100 gene ilvD 17355 19208 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_13100 19989 19291 gene locus_tag LOCUS_13110 19989 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 20136 21317 gene locus_tag LOCUS_13120 20136 21317 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223577.1 protein_id gnl|my_center|LOCUS_13120 22953 21442 gene locus_tag LOCUS_13130 gene gatB 22953 21442 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_13130 24467 22959 gene locus_tag LOCUS_13140 gene gatA 24467 22959 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_13140 24887 24507 gene locus_tag LOCUS_13150 gene gatC 24887 24507 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_13150 25131 25781 gene locus_tag LOCUS_13160 25131 25781 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_13160 28179 26116 gene locus_tag LOCUS_13170 gene ligA 28179 26116 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223566.1 protein_id gnl|my_center|LOCUS_13170 28336 28584 gene locus_tag LOCUS_13180 28336 28584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 28571 29002 gene locus_tag LOCUS_13190 28571 29002 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_13190 29744 29106 gene locus_tag LOCUS_13200 29744 29106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223565.1 protein_id gnl|my_center|LOCUS_13200 30889 29852 gene locus_tag LOCUS_13210 30889 29852 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284403.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence032 1951 137 gene locus_tag LOCUS_13220 1951 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3421 2081 gene locus_tag LOCUS_13230 3421 2081 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224086.1 protein_id gnl|my_center|LOCUS_13230 3491 5278 gene locus_tag LOCUS_13240 3491 5278 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_13240 7058 5340 gene locus_tag LOCUS_13250 7058 5340 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028848093.1 protein_id gnl|my_center|LOCUS_13250 8203 7055 gene locus_tag LOCUS_13260 8203 7055 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224082.1 protein_id gnl|my_center|LOCUS_13260 8972 8196 gene locus_tag LOCUS_13270 8972 8196 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224081.1 protein_id gnl|my_center|LOCUS_13270 9737 9108 gene locus_tag LOCUS_13280 9737 9108 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_13280 9896 10309 gene locus_tag LOCUS_13290 9896 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_13290 10319 11368 gene locus_tag LOCUS_13300 gene trpD 10319 11368 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_13300 12520 11498 gene locus_tag LOCUS_13310 12520 11498 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224075.1 protein_id gnl|my_center|LOCUS_13310 12597 14183 gene locus_tag LOCUS_13320 12597 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 15131 14208 gene locus_tag LOCUS_13330 15131 14208 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_13330 15300 17234 gene locus_tag LOCUS_13340 gene asnB 15300 17234 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224072.1 protein_id gnl|my_center|LOCUS_13340 18730 17327 gene locus_tag LOCUS_13350 18730 17327 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_13350 18951 19607 gene locus_tag LOCUS_13360 18951 19607 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 protein_id gnl|my_center|LOCUS_13360 19604 20368 gene locus_tag LOCUS_13370 19604 20368 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 protein_id gnl|my_center|LOCUS_13370 20391 21101 gene locus_tag LOCUS_13380 20391 21101 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_13380 21098 22153 gene locus_tag LOCUS_13390 21098 22153 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_13390 23150 22215 gene locus_tag LOCUS_13400 23150 22215 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224071.1 protein_id gnl|my_center|LOCUS_13400 23378 23548 gene locus_tag LOCUS_13410 23378 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 24008 23640 gene locus_tag LOCUS_13420 24008 23640 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224070.1 protein_id gnl|my_center|LOCUS_13420 24303 24905 gene locus_tag LOCUS_13430 24303 24905 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224069.1 protein_id gnl|my_center|LOCUS_13430 24902 25936 gene locus_tag LOCUS_13440 gene cobT 24902 25936 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224062.1 protein_id gnl|my_center|LOCUS_13440 27060 25957 gene locus_tag LOCUS_13450 27060 25957 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_13450 28008 27121 gene locus_tag LOCUS_13460 28008 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 28129 29631 gene locus_tag LOCUS_13470 28129 29631 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_13470 29633 30763 gene locus_tag LOCUS_13480 29633 30763 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224054.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence033 295 2229 gene locus_tag LOCUS_13490 gene dxs 295 2229 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_13490 2358 2963 gene locus_tag LOCUS_13500 2358 2963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_13500 2960 4099 gene locus_tag LOCUS_13510 2960 4099 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_13510 5504 4242 gene locus_tag LOCUS_13520 5504 4242 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_13520 6274 5558 gene locus_tag LOCUS_13530 6274 5558 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156987.1 protein_id gnl|my_center|LOCUS_13530 7326 6805 gene locus_tag LOCUS_13540 7326 6805 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_13540 7421 8578 gene locus_tag LOCUS_13550 gene hemE 7421 8578 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_13550 8607 9983 gene locus_tag LOCUS_13560 gene hemG 8607 9983 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_13560 10026 10736 gene locus_tag LOCUS_13570 10026 10736 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_13570 10853 12259 gene locus_tag LOCUS_13580 10853 12259 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224515.1 protein_id gnl|my_center|LOCUS_13580 12721 12287 gene locus_tag LOCUS_13590 gene msrB 12721 12287 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_13590 13037 12732 gene locus_tag LOCUS_13600 13037 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284340.1 protein_id gnl|my_center|LOCUS_13600 14575 13094 gene locus_tag LOCUS_13610 14575 13094 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209441393.1 protein_id gnl|my_center|LOCUS_13610 15395 14733 gene locus_tag LOCUS_13620 15395 14733 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224523.1 protein_id gnl|my_center|LOCUS_13620 17280 15565 gene locus_tag LOCUS_13630 17280 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 18942 17368 gene locus_tag LOCUS_13640 18942 17368 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224537.1 protein_id gnl|my_center|LOCUS_13640 19831 19058 gene locus_tag LOCUS_13650 19831 19058 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_13650 20002 21093 gene locus_tag LOCUS_13660 gene zapE 20002 21093 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224547.1 protein_id gnl|my_center|LOCUS_13660 21047 21550 gene locus_tag LOCUS_13670 21047 21550 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_13670 22772 21567 gene locus_tag LOCUS_13680 gene rocD 22772 21567 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_13680 22970 25066 gene locus_tag LOCUS_13690 22970 25066 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224556.1 protein_id gnl|my_center|LOCUS_13690 25056 25823 gene locus_tag LOCUS_13700 25056 25823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_13700 25931 26884 gene locus_tag LOCUS_13710 25931 26884 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_13710 27254 26886 gene locus_tag LOCUS_13720 gene crcB 27254 26886 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224558.1 protein_id gnl|my_center|LOCUS_13720 27607 27251 gene locus_tag LOCUS_13730 27607 27251 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224559.1 protein_id gnl|my_center|LOCUS_13730 28047 27616 gene locus_tag LOCUS_13740 28047 27616 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_13740 29329 28070 gene locus_tag LOCUS_13750 29329 28070 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence034 37 387 gene locus_tag LOCUS_13760 37 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 384 2576 gene locus_tag LOCUS_13770 gene katG 384 2576 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083865574.1 protein_id gnl|my_center|LOCUS_13770 3139 2627 gene locus_tag LOCUS_13780 3139 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3131 4630 gene locus_tag LOCUS_13790 3131 4630 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_13790 4783 5097 gene locus_tag LOCUS_13800 4783 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5097 5342 gene locus_tag LOCUS_13810 5097 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5899 5354 gene locus_tag LOCUS_13820 5899 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6274 5909 gene locus_tag LOCUS_13830 6274 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7480 6275 gene locus_tag LOCUS_13840 7480 6275 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_13840 7707 7513 gene locus_tag LOCUS_13850 7707 7513 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_13850 8882 7704 gene locus_tag LOCUS_13860 8882 7704 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_13860 9700 8879 gene locus_tag LOCUS_13870 9700 8879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_13870 10596 9700 gene locus_tag LOCUS_13880 10596 9700 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088940.1 protein_id gnl|my_center|LOCUS_13880 11601 10600 gene locus_tag LOCUS_13890 11601 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12465 11671 gene locus_tag LOCUS_13900 12465 11671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_13900 12705 12469 gene locus_tag LOCUS_13910 12705 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 13231 12713 gene locus_tag LOCUS_13920 13231 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14535 13228 gene locus_tag LOCUS_13930 14535 13228 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_13930 14704 15453 gene locus_tag LOCUS_13940 14704 15453 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_13940 16206 15505 gene locus_tag LOCUS_13950 16206 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 17430 16426 gene locus_tag LOCUS_13960 17430 16426 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228756.1 protein_id gnl|my_center|LOCUS_13960 17604 18191 gene locus_tag LOCUS_13970 17604 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 18571 18209 gene locus_tag LOCUS_13980 18571 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 18751 20076 gene locus_tag LOCUS_13990 18751 20076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_13990 20884 20114 gene locus_tag LOCUS_14000 20884 20114 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_14000 21021 20881 gene locus_tag LOCUS_14010 21021 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 21607 20999 gene locus_tag LOCUS_14020 21607 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 22936 21635 gene locus_tag LOCUS_14030 22936 21635 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393658.1 protein_id gnl|my_center|LOCUS_14030 24621 22933 gene locus_tag LOCUS_14040 24621 22933 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887122.1 protein_id gnl|my_center|LOCUS_14040 25004 24618 gene locus_tag LOCUS_14050 25004 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 25407 25060 gene locus_tag LOCUS_14060 25407 25060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 25734 26045 gene locus_tag LOCUS_14070 25734 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 26042 27760 gene locus_tag LOCUS_14080 26042 27760 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 protein_id gnl|my_center|LOCUS_14080 27886 28761 gene locus_tag LOCUS_14090 27886 28761 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence035 1098 274 gene locus_tag LOCUS_14100 1098 274 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 protein_id gnl|my_center|LOCUS_14100 1291 2280 gene locus_tag LOCUS_14110 1291 2280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_14110 2359 3486 gene locus_tag LOCUS_14120 2359 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3576 5012 gene locus_tag LOCUS_14130 gene eutA 3576 5012 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 protein_id gnl|my_center|LOCUS_14130 6783 5020 gene locus_tag LOCUS_14140 6783 5020 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_14140 7415 6786 gene locus_tag LOCUS_14150 7415 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9184 7412 gene locus_tag LOCUS_14160 9184 7412 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_14160 10077 9181 gene locus_tag LOCUS_14170 10077 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 11135 10068 gene locus_tag LOCUS_14180 11135 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12662 11403 gene locus_tag LOCUS_14190 12662 11403 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_14190 13401 12946 gene locus_tag LOCUS_14200 13401 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14618 13398 gene locus_tag LOCUS_14210 14618 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15650 14625 gene locus_tag LOCUS_14220 15650 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16036 15647 gene locus_tag LOCUS_14230 16036 15647 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 protein_id gnl|my_center|LOCUS_14230 17033 16053 gene locus_tag LOCUS_14240 17033 16053 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_14240 17186 18271 gene locus_tag LOCUS_14250 17186 18271 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_14250 19534 18326 gene locus_tag LOCUS_14260 19534 18326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_14260 21025 20000 gene locus_tag LOCUS_14270 gene rbsR 21025 20000 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_14270 21259 22047 gene locus_tag LOCUS_14280 21259 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 22878 22135 gene locus_tag LOCUS_14290 22878 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 23108 23947 gene locus_tag LOCUS_14300 23108 23947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_14300 23944 24381 gene locus_tag LOCUS_14310 23944 24381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113296.1 protein_id gnl|my_center|LOCUS_14310 24378 24845 gene locus_tag LOCUS_14320 24378 24845 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083333.1 protein_id gnl|my_center|LOCUS_14320 24838 25908 gene locus_tag LOCUS_14330 24838 25908 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083334.1 protein_id gnl|my_center|LOCUS_14330 26042 27208 gene locus_tag LOCUS_14340 26042 27208 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086688.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence036 50 574 gene locus_tag LOCUS_14350 50 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 786 1766 gene locus_tag LOCUS_14360 786 1766 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_14360 1741 2640 gene locus_tag LOCUS_14370 1741 2640 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_14370 2728 3060 gene locus_tag LOCUS_14380 2728 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3566 4441 gene locus_tag LOCUS_14390 gene rpsB 3566 4441 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_14390 4565 5380 gene locus_tag LOCUS_14400 gene tsf 4565 5380 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_14400 5479 6222 gene locus_tag LOCUS_14410 gene pyrH 5479 6222 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_14410 6241 6798 gene locus_tag LOCUS_14420 gene frr 6241 6798 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_14420 6821 7654 gene locus_tag LOCUS_14430 6821 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8500 7670 gene locus_tag LOCUS_14440 8500 7670 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223867.1 protein_id gnl|my_center|LOCUS_14440 8732 9853 gene locus_tag LOCUS_14450 gene rlmN 8732 9853 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223876.1 protein_id gnl|my_center|LOCUS_14450 10171 9914 gene locus_tag LOCUS_14460 10171 9914 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223923.1 protein_id gnl|my_center|LOCUS_14460 10414 11646 gene locus_tag LOCUS_14470 gene dxr 10414 11646 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_14470 11647 12885 gene locus_tag LOCUS_14480 11647 12885 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_14480 12976 14154 gene locus_tag LOCUS_14490 gene ispG 12976 14154 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_14490 14247 15101 gene locus_tag LOCUS_14500 14247 15101 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466751.1 protein_id gnl|my_center|LOCUS_14500 15172 16962 gene locus_tag LOCUS_14510 15172 16962 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_14510 16979 17830 gene locus_tag LOCUS_14520 gene map 16979 17830 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223934.1 protein_id gnl|my_center|LOCUS_14520 19363 17915 gene locus_tag LOCUS_14530 19363 17915 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_14530 19533 20387 gene locus_tag LOCUS_14540 19533 20387 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_14540 20425 20868 gene locus_tag LOCUS_14550 20425 20868 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_14550 22082 20901 gene locus_tag LOCUS_14560 22082 20901 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223945.1 protein_id gnl|my_center|LOCUS_14560 22136 22858 gene locus_tag LOCUS_14570 22136 22858 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_14570 24426 22894 gene locus_tag LOCUS_14580 24426 22894 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_14580 25642 24680 gene locus_tag LOCUS_14590 25642 24680 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_14590 25932 26843 gene locus_tag LOCUS_14600 25932 26843 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 protein_id gnl|my_center|LOCUS_14600 <27696 26863 gene locus_tag LOCUS_14610 <27696 26863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223956.1:peroxide stress protein YaaA >Feature sequence037 2238 424 gene locus_tag LOCUS_14620 gene acs 2238 424 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_14620 2980 2231 gene locus_tag LOCUS_14630 2980 2231 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_14630 3121 3966 gene locus_tag LOCUS_14640 3121 3966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_14640 3963 5960 gene locus_tag LOCUS_14650 3963 5960 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_14650 6099 6971 gene locus_tag LOCUS_14660 6099 6971 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_14660 6973 8025 gene locus_tag LOCUS_14670 6973 8025 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_14670 8065 9255 gene locus_tag LOCUS_14680 8065 9255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_14680 9252 10103 gene locus_tag LOCUS_14690 9252 10103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_14690 10117 11295 gene locus_tag LOCUS_14700 10117 11295 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_14700 12438 11665 gene locus_tag LOCUS_14710 12438 11665 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_14710 13619 12447 gene locus_tag LOCUS_14720 gene dnaJ 13619 12447 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228403.1 protein_id gnl|my_center|LOCUS_14720 14701 13676 gene locus_tag LOCUS_14730 gene hrcA 14701 13676 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_14730 14789 15529 gene locus_tag LOCUS_14740 14789 15529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_14740 16934 15639 gene locus_tag LOCUS_14750 gene hemW 16934 15639 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_14750 17191 18882 gene locus_tag LOCUS_14760 17191 18882 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_14760 18250 18339 gene locus_tag LOCUS_t00150 18250 18339 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 19040 19735 gene locus_tag LOCUS_14770 19040 19735 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_14770 19743 20723 gene locus_tag LOCUS_14780 gene cysD 19743 20723 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_14780 20857 22125 gene locus_tag LOCUS_14790 20857 22125 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_14790 22215 22952 gene locus_tag LOCUS_14800 22215 22952 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_14800 22975 23760 gene locus_tag LOCUS_14810 22975 23760 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_14810 24216 23839 gene locus_tag LOCUS_14820 24216 23839 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228442.1 protein_id gnl|my_center|LOCUS_14820 24635 24222 gene locus_tag LOCUS_14830 24635 24222 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228443.1 protein_id gnl|my_center|LOCUS_14830 24827 24645 gene locus_tag LOCUS_14840 24827 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228444.1 protein_id gnl|my_center|LOCUS_14840 24883 25848 gene locus_tag LOCUS_14850 24883 25848 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_14850 26166 26984 gene locus_tag LOCUS_14860 26166 26984 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228446.1 protein_id gnl|my_center|LOCUS_14860 <27589 26994 gene locus_tag LOCUS_14870 <27589 26994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900516.1:translation elongation factor 4 >Feature sequence038 <1 800 gene locus_tag LOCUS_14880 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228504.1:OFA family MFS transporter 824 958 gene locus_tag LOCUS_14890 824 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 986 1867 gene locus_tag LOCUS_14900 986 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1872 3692 gene locus_tag LOCUS_14910 gene aor 1872 3692 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_14910 3689 6586 gene locus_tag LOCUS_14920 gene fdhF 3689 6586 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_14920 6583 8304 gene locus_tag LOCUS_14930 6583 8304 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_14930 8312 9556 gene locus_tag LOCUS_14940 8312 9556 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_14940 9560 11506 gene locus_tag LOCUS_14950 9560 11506 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_14950 11523 12452 gene locus_tag LOCUS_14960 11523 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 12449 13282 gene locus_tag LOCUS_14970 12449 13282 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_14970 13294 13950 gene locus_tag LOCUS_14980 13294 13950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_14980 13962 15035 gene locus_tag LOCUS_14990 13962 15035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_14990 15682 16026 gene locus_tag LOCUS_15000 15682 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 16023 16358 gene locus_tag LOCUS_15010 16023 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 16701 16955 gene locus_tag LOCUS_15020 16701 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15020 17164 16979 gene locus_tag LOCUS_15030 17164 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 18263 17271 gene locus_tag LOCUS_15040 gene cbbX 18263 17271 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 protein_id gnl|my_center|LOCUS_15040 18693 18268 gene locus_tag LOCUS_15050 18693 18268 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_15050 20175 18721 gene locus_tag LOCUS_15060 20175 18721 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_15060 20284 21192 gene locus_tag LOCUS_15070 20284 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 21228 22217 gene locus_tag LOCUS_15080 21228 22217 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393614.1 protein_id gnl|my_center|LOCUS_15080 23158 22250 gene locus_tag LOCUS_15090 23158 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 24533 23352 gene locus_tag LOCUS_15100 24533 23352 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727698.1 protein_id gnl|my_center|LOCUS_15100 25198 24530 gene locus_tag LOCUS_15110 25198 24530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_15110 25450 26154 gene locus_tag LOCUS_15120 gene rpe 25450 26154 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124991.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence039 167 814 gene locus_tag LOCUS_15130 167 814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283998.1 protein_id gnl|my_center|LOCUS_15130 819 2165 gene locus_tag LOCUS_15140 819 2165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229769.1 protein_id gnl|my_center|LOCUS_15140 2177 2590 gene locus_tag LOCUS_15150 2177 2590 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229768.1 protein_id gnl|my_center|LOCUS_15150 2651 2953 gene locus_tag LOCUS_15160 2651 2953 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229766.1 protein_id gnl|my_center|LOCUS_15160 3157 5067 gene locus_tag LOCUS_15170 gene typA 3157 5067 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229765.1 protein_id gnl|my_center|LOCUS_15170 5155 6861 gene locus_tag LOCUS_15180 5155 6861 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229764.1 protein_id gnl|my_center|LOCUS_15180 7333 8958 gene locus_tag LOCUS_15190 7333 8958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_15190 9164 10090 gene locus_tag LOCUS_15200 9164 10090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_15200 10083 11030 gene locus_tag LOCUS_15210 10083 11030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_15210 11039 12079 gene locus_tag LOCUS_15220 11039 12079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_15220 12069 13082 gene locus_tag LOCUS_15230 12069 13082 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_15230 13419 14279 gene locus_tag LOCUS_15240 13419 14279 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_15240 14272 15111 gene locus_tag LOCUS_15250 gene mshB 14272 15111 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_15250 15108 15518 gene locus_tag LOCUS_15260 15108 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229757.1 protein_id gnl|my_center|LOCUS_15260 16397 16035 gene locus_tag LOCUS_15270 gene vapC30 16397 16035 CDS product type II toxin-antitoxin system toxin ribonuclease C30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403236.1 protein_id gnl|my_center|LOCUS_15270 16651 16397 gene locus_tag LOCUS_15280 16651 16397 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 protein_id gnl|my_center|LOCUS_15280 16848 16705 gene locus_tag LOCUS_15290 16848 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 17531 16968 gene locus_tag LOCUS_15300 17531 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 19243 17531 gene locus_tag LOCUS_15310 19243 17531 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_15310 19561 19244 gene locus_tag LOCUS_15320 19561 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 20371 20021 gene locus_tag LOCUS_15330 20371 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 20573 21394 gene locus_tag LOCUS_15340 20573 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229756.1 protein_id gnl|my_center|LOCUS_15340 22160 21369 gene locus_tag LOCUS_15350 22160 21369 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229755.1 protein_id gnl|my_center|LOCUS_15350 22557 22970 gene locus_tag LOCUS_15360 22557 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 23295 26711 gene locus_tag LOCUS_15370 23295 26711 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229754.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence040 433 1524 gene locus_tag LOCUS_15380 433 1524 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020579.1 protein_id gnl|my_center|LOCUS_15380 1517 1816 gene locus_tag LOCUS_15390 1517 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1991 4330 gene locus_tag LOCUS_15400 1991 4330 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968355.1 protein_id gnl|my_center|LOCUS_15400 5079 4327 gene locus_tag LOCUS_15410 5079 4327 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_15410 5135 5737 gene locus_tag LOCUS_15420 5135 5737 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_15420 5953 7287 gene locus_tag LOCUS_15430 5953 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 7290 8015 gene locus_tag LOCUS_15440 7290 8015 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_15440 9467 8121 gene locus_tag LOCUS_15450 9467 8121 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_15450 9592 10422 gene locus_tag LOCUS_15460 gene folD 9592 10422 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_15460 10430 10801 gene locus_tag LOCUS_15470 10430 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 10851 13184 gene locus_tag LOCUS_15480 10851 13184 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_15480 13316 13918 gene locus_tag LOCUS_15490 13316 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 13968 14918 gene locus_tag LOCUS_15500 13968 14918 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 protein_id gnl|my_center|LOCUS_15500 15979 15173 gene locus_tag LOCUS_15510 15979 15173 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222751.1 protein_id gnl|my_center|LOCUS_15510 16353 16021 gene locus_tag LOCUS_15520 16353 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222747.1 protein_id gnl|my_center|LOCUS_15520 17762 16539 gene locus_tag LOCUS_15530 17762 16539 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_15530 18261 18001 gene locus_tag LOCUS_15540 18261 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_15540 18441 18638 gene locus_tag LOCUS_15550 18441 18638 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_15550 19076 18786 gene locus_tag LOCUS_15560 19076 18786 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222733.1 protein_id gnl|my_center|LOCUS_15560 19948 19079 gene locus_tag LOCUS_15570 19948 19079 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_15570 20145 22172 gene locus_tag LOCUS_15580 20145 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 22204 22821 gene locus_tag LOCUS_15590 22204 22821 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_15590 <26376 22977 gene locus_tag LOCUS_15600 <26376 22977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222728.1:error-prone DNA polymerase >Feature sequence041 725 162 gene locus_tag LOCUS_15610 725 162 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 protein_id gnl|my_center|LOCUS_15610 724 2010 gene locus_tag LOCUS_15620 724 2010 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228093.1 protein_id gnl|my_center|LOCUS_15620 5180 2571 gene locus_tag LOCUS_15630 5180 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6235 5285 gene locus_tag LOCUS_15640 6235 5285 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228092.1 protein_id gnl|my_center|LOCUS_15640 6756 6235 gene locus_tag LOCUS_15650 6756 6235 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_15650 6934 7686 gene locus_tag LOCUS_15660 gene thyX 6934 7686 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_15660 7713 8132 gene locus_tag LOCUS_15670 7713 8132 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228089.1 protein_id gnl|my_center|LOCUS_15670 8201 9700 gene locus_tag LOCUS_15680 8201 9700 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228086.1 protein_id gnl|my_center|LOCUS_15680 9758 10777 gene locus_tag LOCUS_15690 gene dapA 9758 10777 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878175.1 protein_id gnl|my_center|LOCUS_15690 10774 12474 gene locus_tag LOCUS_15700 10774 12474 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 protein_id gnl|my_center|LOCUS_15700 13556 12540 gene locus_tag LOCUS_15710 13556 12540 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_15710 13662 14153 gene locus_tag LOCUS_15720 13662 14153 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222215.1 protein_id gnl|my_center|LOCUS_15720 14189 15043 gene locus_tag LOCUS_15730 14189 15043 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_15730 15047 16144 gene locus_tag LOCUS_15740 15047 16144 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_15740 16128 17249 gene locus_tag LOCUS_15750 16128 17249 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_15750 17474 18016 gene locus_tag LOCUS_15760 17474 18016 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_15760 18013 20454 gene locus_tag LOCUS_15770 18013 20454 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_15770 20451 21302 gene locus_tag LOCUS_15780 20451 21302 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_15780 21293 21946 gene locus_tag LOCUS_15790 21293 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 22792 21959 gene locus_tag LOCUS_15800 22792 21959 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_15800 23083 25362 gene locus_tag LOCUS_15810 23083 25362 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_15810 25518 26201 gene locus_tag LOCUS_15820 25518 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence042 1506 2345 gene locus_tag LOCUS_15830 1506 2345 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_15830 2347 3279 gene locus_tag LOCUS_15840 2347 3279 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227918.1 protein_id gnl|my_center|LOCUS_15840 3864 3340 gene locus_tag LOCUS_15850 3864 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4077 5303 gene locus_tag LOCUS_15860 4077 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8160 5365 gene locus_tag LOCUS_15870 gene polA 8160 5365 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_15870 9435 8203 gene locus_tag LOCUS_15880 9435 8203 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111150.1 protein_id gnl|my_center|LOCUS_15880 9488 9928 gene locus_tag LOCUS_15890 9488 9928 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227928.1 protein_id gnl|my_center|LOCUS_15890 10127 11395 gene locus_tag LOCUS_15900 10127 11395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_15900 12396 11602 gene locus_tag LOCUS_15910 12396 11602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_15910 13250 12393 gene locus_tag LOCUS_15920 13250 12393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_15920 14232 13240 gene locus_tag LOCUS_15930 14232 13240 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_15930 15595 14243 gene locus_tag LOCUS_15940 15595 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 16426 15812 gene locus_tag LOCUS_15950 16426 15812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_15950 16603 16678 gene locus_tag LOCUS_t00160 16603 16678 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17395 16808 gene locus_tag LOCUS_15960 17395 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 17636 17794 gene locus_tag LOCUS_15970 17636 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 18071 19165 gene locus_tag LOCUS_15980 18071 19165 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_15980 19793 19233 gene locus_tag LOCUS_15990 19793 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 20492 19902 gene locus_tag LOCUS_16000 20492 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 22065 20590 gene locus_tag LOCUS_16010 22065 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23227 22070 gene locus_tag LOCUS_16020 gene nagA 23227 22070 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_16020 24164 23271 gene locus_tag LOCUS_16030 24164 23271 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_16030 24290 25072 gene locus_tag LOCUS_16040 24290 25072 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_16040 25591 25079 gene locus_tag LOCUS_16050 25591 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 <26228 25605 gene locus_tag LOCUS_16060 <26228 25605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407734.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence043 1003 119 gene locus_tag LOCUS_16070 1003 119 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_16070 1566 1000 gene locus_tag LOCUS_16080 gene nuoI 1566 1000 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_16080 2980 1553 gene locus_tag LOCUS_16090 gene nuoH 2980 1553 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222459.1 protein_id gnl|my_center|LOCUS_16090 5499 2977 gene locus_tag LOCUS_16100 5499 2977 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_16100 5672 5496 gene locus_tag LOCUS_16110 5672 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 6916 5615 gene locus_tag LOCUS_16120 gene nuoF 6916 5615 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_16120 7792 7073 gene locus_tag LOCUS_16130 gene nuoE 7792 7073 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222456.1 protein_id gnl|my_center|LOCUS_16130 9198 7789 gene locus_tag LOCUS_16140 9198 7789 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_16140 10013 9195 gene locus_tag LOCUS_16150 10013 9195 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_16150 10662 10021 gene locus_tag LOCUS_16160 10662 10021 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_16160 11085 10693 gene locus_tag LOCUS_16170 11085 10693 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222453.1 protein_id gnl|my_center|LOCUS_16170 12709 11411 gene locus_tag LOCUS_16180 12709 11411 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_16180 13454 12765 gene locus_tag LOCUS_16190 13454 12765 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222451.1 protein_id gnl|my_center|LOCUS_16190 13858 13649 gene locus_tag LOCUS_16200 13858 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 13740 14840 gene locus_tag LOCUS_16210 13740 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 14983 15444 gene locus_tag LOCUS_16220 14983 15444 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_16220 15611 26125 gene locus_tag LOCUS_16230 15611 26125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence044 1207 353 gene locus_tag LOCUS_16240 1207 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2095 1403 gene locus_tag LOCUS_16250 2095 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 2357 2097 gene locus_tag LOCUS_16260 2357 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 3628 2420 gene locus_tag LOCUS_16270 3628 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 6263 3618 gene locus_tag LOCUS_16280 6263 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 7077 6373 gene locus_tag LOCUS_16290 7077 6373 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811281.1 protein_id gnl|my_center|LOCUS_16290 8266 7088 gene locus_tag LOCUS_16300 8266 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 10440 8263 gene locus_tag LOCUS_16310 10440 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11013 10552 gene locus_tag LOCUS_16320 11013 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12629 11010 gene locus_tag LOCUS_16330 12629 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 14115 12799 gene locus_tag LOCUS_16340 14115 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14263 14547 gene locus_tag LOCUS_16350 14263 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14843 15112 gene locus_tag LOCUS_16360 14843 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 15055 15294 gene locus_tag LOCUS_16370 15055 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 15403 16662 gene locus_tag LOCUS_16380 15403 16662 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_16380 16666 18174 gene locus_tag LOCUS_16390 16666 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 18254 19189 gene locus_tag LOCUS_16400 18254 19189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_16400 19182 19961 gene locus_tag LOCUS_16410 19182 19961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_16410 19978 21075 gene locus_tag LOCUS_16420 19978 21075 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461035.1 protein_id gnl|my_center|LOCUS_16420 22099 21167 gene locus_tag LOCUS_16430 22099 21167 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393321.1 protein_id gnl|my_center|LOCUS_16430 22345 23661 gene locus_tag LOCUS_16440 22345 23661 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_16440 24214 23897 gene locus_tag LOCUS_16450 24214 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 24268 25752 gene locus_tag LOCUS_16460 24268 25752 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229437.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence045 437 2134 gene locus_tag LOCUS_16470 437 2134 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_16470 2172 3038 gene locus_tag LOCUS_16480 gene folD 2172 3038 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_16480 3035 3991 gene locus_tag LOCUS_16490 gene folP 3035 3991 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_16490 3982 4983 gene locus_tag LOCUS_16500 3982 4983 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 protein_id gnl|my_center|LOCUS_16500 5868 4984 gene locus_tag LOCUS_16510 5868 4984 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383353.1 protein_id gnl|my_center|LOCUS_16510 6150 7361 gene locus_tag LOCUS_16520 6150 7361 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529882.1 protein_id gnl|my_center|LOCUS_16520 7373 8320 gene locus_tag LOCUS_16530 7373 8320 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_16530 8327 9508 gene locus_tag LOCUS_16540 8327 9508 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_16540 9529 10437 gene locus_tag LOCUS_16550 gene sucD 9529 10437 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_16550 10465 11433 gene locus_tag LOCUS_16560 10465 11433 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529883.1 protein_id gnl|my_center|LOCUS_16560 11436 12734 gene locus_tag LOCUS_16570 11436 12734 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223710.1 protein_id gnl|my_center|LOCUS_16570 12731 15535 gene locus_tag LOCUS_16580 gene ppc 12731 15535 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_16580 15601 16260 gene locus_tag LOCUS_16590 15601 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 17016 16141 gene locus_tag LOCUS_16600 17016 16141 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_16600 18108 17026 gene locus_tag LOCUS_16610 18108 17026 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 protein_id gnl|my_center|LOCUS_16610 18318 19178 gene locus_tag LOCUS_16620 18318 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 19328 19834 gene locus_tag LOCUS_16630 19328 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 19912 20271 gene locus_tag LOCUS_16640 19912 20271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 20528 21508 gene locus_tag LOCUS_16650 20528 21508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_16650 22695 21595 gene locus_tag LOCUS_16660 22695 21595 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181780048.1 protein_id gnl|my_center|LOCUS_16660 23847 22906 gene locus_tag LOCUS_16670 23847 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 24094 23777 gene locus_tag LOCUS_16680 24094 23777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 24510 23983 gene locus_tag LOCUS_16690 24510 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 25568 24507 gene locus_tag LOCUS_16700 25568 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence046 703 275 gene locus_tag LOCUS_16710 703 275 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_16710 1159 920 gene locus_tag LOCUS_16720 1159 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1764 1216 gene locus_tag LOCUS_16730 1764 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1726 2280 gene locus_tag LOCUS_16740 1726 2280 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_16740 2413 3060 gene locus_tag LOCUS_16750 2413 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3607 3029 gene locus_tag LOCUS_16760 3607 3029 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_16760 4517 3609 gene locus_tag LOCUS_16770 4517 3609 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_16770 5508 4639 gene locus_tag LOCUS_16780 5508 4639 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_16780 6704 5517 gene locus_tag LOCUS_16790 6704 5517 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_16790 8783 7047 gene locus_tag LOCUS_16800 8783 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 9008 10750 gene locus_tag LOCUS_16810 gene kstD 9008 10750 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224391.1 protein_id gnl|my_center|LOCUS_16810 10747 11874 gene locus_tag LOCUS_16820 10747 11874 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 protein_id gnl|my_center|LOCUS_16820 11877 12221 gene locus_tag LOCUS_16830 11877 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 12214 13281 gene locus_tag LOCUS_16840 12214 13281 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224388.1 protein_id gnl|my_center|LOCUS_16840 13292 14149 gene locus_tag LOCUS_16850 13292 14149 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_16850 14311 15885 gene locus_tag LOCUS_16860 14311 15885 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_16860 15932 16576 gene locus_tag LOCUS_16870 15932 16576 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083071.1 protein_id gnl|my_center|LOCUS_16870 16577 17509 gene locus_tag LOCUS_16880 16577 17509 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111061.1 protein_id gnl|my_center|LOCUS_16880 17623 19131 gene locus_tag LOCUS_16890 17623 19131 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111060.1 protein_id gnl|my_center|LOCUS_16890 20007 19084 gene locus_tag LOCUS_16900 20007 19084 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_16900 20610 20155 gene locus_tag LOCUS_16910 20610 20155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112773.1 protein_id gnl|my_center|LOCUS_16910 21266 20658 gene locus_tag LOCUS_16920 21266 20658 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224385.1 protein_id gnl|my_center|LOCUS_16920 21428 22297 gene locus_tag LOCUS_16930 21428 22297 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_16930 24154 22313 gene locus_tag LOCUS_16940 24154 22313 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226992.1 protein_id gnl|my_center|LOCUS_16940 24241 24819 gene locus_tag LOCUS_16950 24241 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 <25652 24825 gene locus_tag LOCUS_16960 <25652 24825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226994.1:50S ribosome-binding GTPase >Feature sequence047 165 515 gene locus_tag LOCUS_16970 165 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1326 541 gene locus_tag LOCUS_16980 1326 541 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222762.1 protein_id gnl|my_center|LOCUS_16980 3151 1364 gene locus_tag LOCUS_16990 gene sdhA 3151 1364 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222763.1 protein_id gnl|my_center|LOCUS_16990 3588 3178 gene locus_tag LOCUS_17000 3588 3178 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222764.1 protein_id gnl|my_center|LOCUS_17000 4007 3585 gene locus_tag LOCUS_17010 gene sdhC 4007 3585 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_17010 4500 5465 gene locus_tag LOCUS_17020 4500 5465 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_17020 5582 7171 gene locus_tag LOCUS_17030 5582 7171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_17030 7168 8382 gene locus_tag LOCUS_17040 7168 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8379 9671 gene locus_tag LOCUS_17050 8379 9671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_17050 9686 10081 gene locus_tag LOCUS_17060 9686 10081 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839697.1 protein_id gnl|my_center|LOCUS_17060 10155 11450 gene locus_tag LOCUS_17070 10155 11450 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_17070 12658 11531 gene locus_tag LOCUS_17080 12658 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222774.1 protein_id gnl|my_center|LOCUS_17080 14157 12913 gene locus_tag LOCUS_17090 14157 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222777.1 protein_id gnl|my_center|LOCUS_17090 14310 16847 gene locus_tag LOCUS_17100 14310 16847 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_17100 17006 17752 gene locus_tag LOCUS_17110 gene lprA 17006 17752 CDS product TLR2 agonist LprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406562.1 protein_id gnl|my_center|LOCUS_17110 17752 19284 gene locus_tag LOCUS_17120 17752 19284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082328.1 protein_id gnl|my_center|LOCUS_17120 19348 20640 gene locus_tag LOCUS_17130 gene hisS 19348 20640 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_17130 21340 20651 gene locus_tag LOCUS_17140 gene upp 21340 20651 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_17140 21450 22097 gene locus_tag LOCUS_17150 21450 22097 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878216.1 protein_id gnl|my_center|LOCUS_17150 22975 22199 gene locus_tag LOCUS_17160 22975 22199 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385801.1 protein_id gnl|my_center|LOCUS_17160 23085 23687 gene locus_tag LOCUS_17170 23085 23687 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_17170 23691 25076 gene locus_tag LOCUS_17180 23691 25076 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence048 2315 135 gene locus_tag LOCUS_17190 2315 135 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_17190 2455 2964 gene locus_tag LOCUS_17200 2455 2964 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_17200 2961 3653 gene locus_tag LOCUS_17210 2961 3653 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_17210 3650 4114 gene locus_tag LOCUS_17220 3650 4114 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_17220 4192 6273 gene locus_tag LOCUS_17230 4192 6273 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_17230 6286 6912 gene locus_tag LOCUS_17240 6286 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8166 6922 gene locus_tag LOCUS_17250 8166 6922 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_17250 9131 8169 gene locus_tag LOCUS_17260 9131 8169 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_17260 10273 9218 gene locus_tag LOCUS_17270 10273 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 10504 11385 gene locus_tag LOCUS_17280 10504 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157210040.1 protein_id gnl|my_center|LOCUS_17280 11385 12563 gene locus_tag LOCUS_17290 11385 12563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890808.1 protein_id gnl|my_center|LOCUS_17290 12640 13665 gene locus_tag LOCUS_17300 12640 13665 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_17300 13665 14834 gene locus_tag LOCUS_17310 13665 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 15660 14839 gene locus_tag LOCUS_17320 15660 14839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_17320 16385 15657 gene locus_tag LOCUS_17330 16385 15657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_17330 17202 16417 gene locus_tag LOCUS_17340 17202 16417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_17340 18321 17278 gene locus_tag LOCUS_17350 18321 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 19221 18493 gene locus_tag LOCUS_17360 19221 18493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 protein_id gnl|my_center|LOCUS_17360 21005 19221 gene locus_tag LOCUS_17370 21005 19221 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195813.1 protein_id gnl|my_center|LOCUS_17370 21934 21050 gene locus_tag LOCUS_17380 21934 21050 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_17380 23154 21931 gene locus_tag LOCUS_17390 23154 21931 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097941129.1 protein_id gnl|my_center|LOCUS_17390 23315 24859 gene locus_tag LOCUS_17400 23315 24859 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896797.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence049 3663 2977 gene locus_tag LOCUS_17410 gene raiA 3663 2977 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_17410 4947 4273 gene locus_tag LOCUS_17420 4947 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6833 5082 gene locus_tag LOCUS_17430 6833 5082 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229728.1 protein_id gnl|my_center|LOCUS_17430 8602 6830 gene locus_tag LOCUS_17440 gene mtrB 8602 6830 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229729.1 protein_id gnl|my_center|LOCUS_17440 9301 8624 gene locus_tag LOCUS_17450 gene mtrA 9301 8624 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005150760.1 protein_id gnl|my_center|LOCUS_17450 10052 9414 gene locus_tag LOCUS_17460 10052 9414 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_17460 11717 10182 gene locus_tag LOCUS_17470 gene ahcY 11717 10182 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_17470 11878 14223 gene locus_tag LOCUS_17480 11878 14223 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229743.1 protein_id gnl|my_center|LOCUS_17480 15233 14301 gene locus_tag LOCUS_17490 15233 14301 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_17490 16364 15270 gene locus_tag LOCUS_17500 16364 15270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_17500 17917 16361 gene locus_tag LOCUS_17510 17917 16361 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_17510 18987 17971 gene locus_tag LOCUS_17520 18987 17971 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_17520 20525 19293 gene locus_tag LOCUS_17530 gene manA 20525 19293 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229748.1 protein_id gnl|my_center|LOCUS_17530 21645 20557 gene locus_tag LOCUS_17540 21645 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283989.1 protein_id gnl|my_center|LOCUS_17540 21853 21635 gene locus_tag LOCUS_17550 21853 21635 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_17550 23261 21894 gene locus_tag LOCUS_17560 23261 21894 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_17560 23902 23543 gene locus_tag LOCUS_17570 23902 23543 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_17570 24052 24519 gene locus_tag LOCUS_17580 24052 24519 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence050 1042 287 gene locus_tag LOCUS_17590 1042 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1576 1064 gene locus_tag LOCUS_17600 1576 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224118.1 protein_id gnl|my_center|LOCUS_17600 2255 1629 gene locus_tag LOCUS_17610 2255 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2652 3350 gene locus_tag LOCUS_17620 2652 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4110 3367 gene locus_tag LOCUS_17630 4110 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5905 4682 gene locus_tag LOCUS_17640 5905 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10089 5902 gene locus_tag LOCUS_17650 10089 5902 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_17650 11368 10187 gene locus_tag LOCUS_17660 11368 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 12995 11454 gene locus_tag LOCUS_17670 12995 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 14494 13073 gene locus_tag LOCUS_17680 14494 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 15108 14692 gene locus_tag LOCUS_17690 gene vapC29 15108 14692 CDS product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 protein_id gnl|my_center|LOCUS_17690 15332 15105 gene locus_tag LOCUS_17700 15332 15105 CDS product antitoxin VapB29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403213.1 protein_id gnl|my_center|LOCUS_17700 15402 16082 gene locus_tag LOCUS_17710 gene tenA 15402 16082 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_17710 16152 16424 gene locus_tag LOCUS_17720 16152 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 17025 16417 gene locus_tag LOCUS_17730 17025 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 17819 17229 gene locus_tag LOCUS_17740 17819 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 18179 17901 gene locus_tag LOCUS_17750 18179 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 18891 18490 gene locus_tag LOCUS_17760 18891 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 19286 18888 gene locus_tag LOCUS_17770 19286 18888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 20908 19736 gene locus_tag LOCUS_17780 20908 19736 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_17780 21060 20905 gene locus_tag LOCUS_17790 21060 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 21399 21166 gene locus_tag LOCUS_17800 21399 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 21719 21396 gene locus_tag LOCUS_17810 21719 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 21892 22110 gene locus_tag LOCUS_17820 21892 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 22107 22658 gene locus_tag LOCUS_17830 22107 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22682 23542 gene locus_tag LOCUS_17840 22682 23542 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_17840 23658 24083 gene locus_tag LOCUS_17850 23658 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence051 1129 560 gene locus_tag LOCUS_17860 1129 560 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224685.1 protein_id gnl|my_center|LOCUS_17860 1931 1188 gene locus_tag LOCUS_17870 1931 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2922 2005 gene locus_tag LOCUS_17880 2922 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3885 2995 gene locus_tag LOCUS_17890 3885 2995 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_17890 4072 4905 gene locus_tag LOCUS_17900 4072 4905 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_17900 5140 5490 gene locus_tag LOCUS_17910 5140 5490 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_17910 5887 6504 gene locus_tag LOCUS_17920 5887 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6905 6549 gene locus_tag LOCUS_17930 6905 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 8521 7130 gene locus_tag LOCUS_17940 8521 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9123 8746 gene locus_tag LOCUS_17950 9123 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9669 9226 gene locus_tag LOCUS_17960 9669 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 10240 9743 gene locus_tag LOCUS_17970 10240 9743 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_17970 10614 10237 gene locus_tag LOCUS_17980 10614 10237 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 protein_id gnl|my_center|LOCUS_17980 11848 10703 gene locus_tag LOCUS_17990 11848 10703 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226112.1 protein_id gnl|my_center|LOCUS_17990 12128 11853 gene locus_tag LOCUS_18000 12128 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 12347 13759 gene locus_tag LOCUS_18010 12347 13759 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_18010 14692 13829 gene locus_tag LOCUS_18020 14692 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 15312 14689 gene locus_tag LOCUS_18030 15312 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 15326 15796 gene locus_tag LOCUS_18040 15326 15796 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_18040 15793 17343 gene locus_tag LOCUS_18050 15793 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 17410 18111 gene locus_tag LOCUS_18060 17410 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262539.1 protein_id gnl|my_center|LOCUS_18060 19323 18421 gene locus_tag LOCUS_18070 19323 18421 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228125.1 protein_id gnl|my_center|LOCUS_18070 19525 20088 gene locus_tag LOCUS_18080 gene rimP 19525 20088 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_18080 20085 21152 gene locus_tag LOCUS_18090 gene nusA 20085 21152 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_18090 21640 24513 gene locus_tag LOCUS_18100 21640 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence052 138 1103 gene locus_tag LOCUS_18110 138 1103 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222157.1 protein_id gnl|my_center|LOCUS_18110 1727 1116 gene locus_tag LOCUS_18120 1727 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2974 1796 gene locus_tag LOCUS_18130 2974 1796 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305229.1 protein_id gnl|my_center|LOCUS_18130 4145 3186 gene locus_tag LOCUS_18140 4145 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4578 4201 gene locus_tag LOCUS_18150 4578 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6033 4765 gene locus_tag LOCUS_18160 gene serS 6033 4765 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_18160 7006 6089 gene locus_tag LOCUS_18170 7006 6089 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_18170 7036 8133 gene locus_tag LOCUS_18180 7036 8133 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222137.1 protein_id gnl|my_center|LOCUS_18180 8139 8489 gene locus_tag LOCUS_18190 8139 8489 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_18190 9313 8645 gene locus_tag LOCUS_18200 9313 8645 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222133.1 protein_id gnl|my_center|LOCUS_18200 10021 9404 gene locus_tag LOCUS_18210 10021 9404 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222132.1 protein_id gnl|my_center|LOCUS_18210 11046 10126 gene locus_tag LOCUS_18220 gene pheA 11046 10126 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_18220 11259 11813 gene locus_tag LOCUS_18230 11259 11813 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_18230 12043 12975 gene locus_tag LOCUS_18240 gene coaA 12043 12975 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_18240 13067 13891 gene locus_tag LOCUS_18250 13067 13891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_18250 14051 14188 gene locus_tag LOCUS_18260 14051 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 14341 14832 gene locus_tag LOCUS_18270 14341 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223700.1 protein_id gnl|my_center|LOCUS_18270 15058 15945 gene locus_tag LOCUS_18280 15058 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 16717 15953 gene locus_tag LOCUS_18290 16717 15953 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_18290 16796 17407 gene locus_tag LOCUS_18300 16796 17407 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226549.1 protein_id gnl|my_center|LOCUS_18300 17391 19037 gene locus_tag LOCUS_18310 17391 19037 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_18310 19030 19914 gene locus_tag LOCUS_18320 19030 19914 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080429.1 protein_id gnl|my_center|LOCUS_18320 20783 20049 gene locus_tag LOCUS_18330 20783 20049 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_18330 20804 21799 gene locus_tag LOCUS_18340 20804 21799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_18340 21880 22899 gene locus_tag LOCUS_18350 21880 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 23550 22858 gene locus_tag LOCUS_18360 23550 22858 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence053 211 1425 gene locus_tag LOCUS_18370 211 1425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229433.1 protein_id gnl|my_center|LOCUS_18370 1684 3090 gene locus_tag LOCUS_18380 1684 3090 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229434.1 protein_id gnl|my_center|LOCUS_18380 3253 3774 gene locus_tag LOCUS_18390 3253 3774 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229438.1 protein_id gnl|my_center|LOCUS_18390 5269 3791 gene locus_tag LOCUS_18400 5269 3791 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_18400 5351 6013 gene locus_tag LOCUS_18410 5351 6013 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229440.1 protein_id gnl|my_center|LOCUS_18410 6151 6663 gene locus_tag LOCUS_18420 6151 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6915 6694 gene locus_tag LOCUS_18430 6915 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 7094 7168 gene locus_tag LOCUS_t00170 7094 7168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7461 7189 gene locus_tag LOCUS_18440 7461 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7703 7467 gene locus_tag LOCUS_18450 7703 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413717.1 protein_id gnl|my_center|LOCUS_18450 12089 8064 gene locus_tag LOCUS_18460 12089 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14559 12358 gene locus_tag LOCUS_18470 14559 12358 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_18470 15319 15047 gene locus_tag LOCUS_18480 15319 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 15680 15862 gene locus_tag LOCUS_18490 15680 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 16132 16680 gene locus_tag LOCUS_18500 16132 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 16723 17196 gene locus_tag LOCUS_18510 gene bcp 16723 17196 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_18510 17897 17280 gene locus_tag LOCUS_18520 gene rdgB 17897 17280 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_18520 18682 17894 gene locus_tag LOCUS_18530 gene rph 18682 17894 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229452.1 protein_id gnl|my_center|LOCUS_18530 19386 19042 gene locus_tag LOCUS_18540 19386 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 20356 19589 gene locus_tag LOCUS_18550 20356 19589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_18550 21259 20417 gene locus_tag LOCUS_18560 gene murI 21259 20417 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 protein_id gnl|my_center|LOCUS_18560 21888 21256 gene locus_tag LOCUS_18570 21888 21256 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229455.1 protein_id gnl|my_center|LOCUS_18570 22927 21977 gene locus_tag LOCUS_18580 22927 21977 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_18580 23217 22924 gene locus_tag LOCUS_18590 23217 22924 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_18590 23621 23295 gene locus_tag LOCUS_18600 23621 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence054 353 1666 gene locus_tag LOCUS_18610 353 1666 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_18610 1887 1696 gene locus_tag LOCUS_18620 1887 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 2480 1884 gene locus_tag LOCUS_18630 2480 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 3112 2690 gene locus_tag LOCUS_18640 3112 2690 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_18640 3337 4740 gene locus_tag LOCUS_18650 3337 4740 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_18650 6252 4744 gene locus_tag LOCUS_18660 gene glpK 6252 4744 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_18660 6355 8079 gene locus_tag LOCUS_18670 6355 8079 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_18670 8334 8152 gene locus_tag LOCUS_18680 8334 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 9444 8431 gene locus_tag LOCUS_18690 9444 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10012 9488 gene locus_tag LOCUS_18700 10012 9488 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222842.1 protein_id gnl|my_center|LOCUS_18700 10428 10018 gene locus_tag LOCUS_18710 10428 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 12326 10530 gene locus_tag LOCUS_18720 12326 10530 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_18720 12552 13256 gene locus_tag LOCUS_18730 12552 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222848.1 protein_id gnl|my_center|LOCUS_18730 13879 13253 gene locus_tag LOCUS_18740 13879 13253 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_18740 15102 14140 gene locus_tag LOCUS_18750 15102 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 15172 15537 gene locus_tag LOCUS_18760 15172 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 15809 15579 gene locus_tag LOCUS_18770 15809 15579 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222857.1 protein_id gnl|my_center|LOCUS_18770 17428 15806 gene locus_tag LOCUS_18780 17428 15806 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_18780 17539 18336 gene locus_tag LOCUS_18790 17539 18336 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286032.1 protein_id gnl|my_center|LOCUS_18790 18365 18991 gene locus_tag LOCUS_18800 18365 18991 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_18800 18995 19936 gene locus_tag LOCUS_18810 18995 19936 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_18810 20036 20494 gene locus_tag LOCUS_18820 20036 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 20482 20823 gene locus_tag LOCUS_18830 20482 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 20830 22881 gene locus_tag LOCUS_18840 20830 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 22878 23237 gene locus_tag LOCUS_18850 22878 23237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105220.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence055 662 2236 gene locus_tag LOCUS_18860 gene phoD 662 2236 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_18860 2362 3219 gene locus_tag LOCUS_18870 2362 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 3207 3707 gene locus_tag LOCUS_18880 3207 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 5025 3754 gene locus_tag LOCUS_18890 5025 3754 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_18890 5994 5131 gene locus_tag LOCUS_18900 5994 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6298 5981 gene locus_tag LOCUS_18910 6298 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6926 6243 gene locus_tag LOCUS_18920 6926 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 7440 6952 gene locus_tag LOCUS_18930 7440 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7757 7437 gene locus_tag LOCUS_18940 7757 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8264 8191 gene locus_tag LOCUS_t00180 8264 8191 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8456 9370 gene locus_tag LOCUS_18950 8456 9370 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_18950 9577 10425 gene locus_tag LOCUS_18960 9577 10425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_18960 10425 11288 gene locus_tag LOCUS_18970 10425 11288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229372.1 protein_id gnl|my_center|LOCUS_18970 11285 12541 gene locus_tag LOCUS_18980 11285 12541 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223673.1 protein_id gnl|my_center|LOCUS_18980 12538 13560 gene locus_tag LOCUS_18990 12538 13560 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224302.1 protein_id gnl|my_center|LOCUS_18990 13679 14671 gene locus_tag LOCUS_19000 13679 14671 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229369.1 protein_id gnl|my_center|LOCUS_19000 14668 15750 gene locus_tag LOCUS_19010 14668 15750 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976390.1 protein_id gnl|my_center|LOCUS_19010 15750 16808 gene locus_tag LOCUS_19020 15750 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 16808 18058 gene locus_tag LOCUS_19030 16808 18058 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222539.1 protein_id gnl|my_center|LOCUS_19030 18055 18558 gene locus_tag LOCUS_19040 18055 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 18954 18706 gene locus_tag LOCUS_19050 18954 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 20805 19078 gene locus_tag LOCUS_19060 gene dosT 20805 19078 CDS product two-component system sensor histidine kinase DosT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899138.1 protein_id gnl|my_center|LOCUS_19060 21506 20862 gene locus_tag LOCUS_19070 21506 20862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077716.1 protein_id gnl|my_center|LOCUS_19070 21687 22619 gene locus_tag LOCUS_19080 21687 22619 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence056 902 829 gene locus_tag LOCUS_t00190 902 829 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1108 1317 gene locus_tag LOCUS_19090 1108 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2078 1314 gene locus_tag LOCUS_19100 2078 1314 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228360.1 protein_id gnl|my_center|LOCUS_19100 2618 2103 gene locus_tag LOCUS_19110 2618 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 protein_id gnl|my_center|LOCUS_19110 4542 2653 gene locus_tag LOCUS_19120 gene dnaG 4542 2653 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_19120 4680 4877 gene locus_tag LOCUS_19130 4680 4877 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408803.1 protein_id gnl|my_center|LOCUS_19130 4970 5896 gene locus_tag LOCUS_19140 4970 5896 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228363.1 protein_id gnl|my_center|LOCUS_19140 6491 5904 gene locus_tag LOCUS_19150 6491 5904 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228365.1 protein_id gnl|my_center|LOCUS_19150 7824 6706 gene locus_tag LOCUS_19160 7824 6706 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_19160 9186 7873 gene locus_tag LOCUS_19170 9186 7873 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 protein_id gnl|my_center|LOCUS_19170 9830 9189 gene locus_tag LOCUS_19180 9830 9189 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_19180 11273 9888 gene locus_tag LOCUS_19190 11273 9888 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_19190 11385 11840 gene locus_tag LOCUS_19200 11385 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11872 12291 gene locus_tag LOCUS_19210 11872 12291 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_19210 13130 12387 gene locus_tag LOCUS_19220 13130 12387 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_19220 14155 13127 gene locus_tag LOCUS_19230 14155 13127 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285799.1 protein_id gnl|my_center|LOCUS_19230 14699 14265 gene locus_tag LOCUS_19240 14699 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228388.1 protein_id gnl|my_center|LOCUS_19240 15512 14703 gene locus_tag LOCUS_19250 15512 14703 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_19250 16288 15512 gene locus_tag LOCUS_19260 gene recO 16288 15512 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_19260 17355 16447 gene locus_tag LOCUS_19270 gene era 17355 16447 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_19270 17699 17355 gene locus_tag LOCUS_19280 17699 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228397.1 protein_id gnl|my_center|LOCUS_19280 19035 17692 gene locus_tag LOCUS_19290 19035 17692 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_19290 19606 19058 gene locus_tag LOCUS_19300 gene ybeY 19606 19058 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 protein_id gnl|my_center|LOCUS_19300 21546 19603 gene locus_tag LOCUS_19310 21546 19603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 21466 21894 gene locus_tag LOCUS_19320 21466 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 22184 21837 gene locus_tag LOCUS_19330 22184 21837 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228401.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence057 99 614 gene locus_tag LOCUS_19340 99 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229365.1 protein_id gnl|my_center|LOCUS_19340 611 1129 gene locus_tag LOCUS_19350 611 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224308.1 protein_id gnl|my_center|LOCUS_19350 1312 2229 gene locus_tag LOCUS_19360 1312 2229 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226066.1 protein_id gnl|my_center|LOCUS_19360 2229 3287 gene locus_tag LOCUS_19370 gene dmpG 2229 3287 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226067.1 protein_id gnl|my_center|LOCUS_19370 3569 4522 gene locus_tag LOCUS_19380 3569 4522 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_19380 4519 5322 gene locus_tag LOCUS_19390 4519 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5749 5279 gene locus_tag LOCUS_19400 5749 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 6477 5746 gene locus_tag LOCUS_19410 6477 5746 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_19410 6701 7804 gene locus_tag LOCUS_19420 6701 7804 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_19420 7961 9376 gene locus_tag LOCUS_19430 7961 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 10598 9405 gene locus_tag LOCUS_19440 10598 9405 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_19440 10786 10595 gene locus_tag LOCUS_19450 10786 10595 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893914.1 protein_id gnl|my_center|LOCUS_19450 11757 10957 gene locus_tag LOCUS_19460 11757 10957 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_19460 12180 11929 gene locus_tag LOCUS_19470 12180 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 12665 12186 gene locus_tag LOCUS_19480 12665 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 12797 14653 gene locus_tag LOCUS_19490 12797 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 14740 15102 gene locus_tag LOCUS_19500 14740 15102 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_19500 15601 15978 gene locus_tag LOCUS_19510 15601 15978 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226054.1 protein_id gnl|my_center|LOCUS_19510 16578 15979 gene locus_tag LOCUS_19520 16578 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 16723 17646 gene locus_tag LOCUS_19530 16723 17646 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_19530 18548 17655 gene locus_tag LOCUS_19540 gene pqqB 18548 17655 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_19540 19630 18545 gene locus_tag LOCUS_19550 gene pqqE 19630 18545 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229608.1 protein_id gnl|my_center|LOCUS_19550 19938 19696 gene locus_tag LOCUS_19560 gene pqqD 19938 19696 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229607.1 protein_id gnl|my_center|LOCUS_19560 20648 19947 gene locus_tag LOCUS_19570 gene pqqC 20648 19947 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467700.1 protein_id gnl|my_center|LOCUS_19570 20939 20724 gene locus_tag LOCUS_19580 20939 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 20980 21642 gene locus_tag LOCUS_19590 20980 21642 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_19590 22204 21572 gene locus_tag LOCUS_19600 22204 21572 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228754.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence058 797 405 gene locus_tag LOCUS_19610 797 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1422 799 gene locus_tag LOCUS_19620 1422 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2440 2162 gene locus_tag LOCUS_19630 2440 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3101 2640 gene locus_tag LOCUS_19640 3101 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3218 4243 gene locus_tag LOCUS_19650 3218 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4156 5148 gene locus_tag LOCUS_19660 4156 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5397 6584 gene locus_tag LOCUS_19670 5397 6584 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223366.1 protein_id gnl|my_center|LOCUS_19670 7254 10070 gene locus_tag LOCUS_19680 7254 10070 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_19680 10048 10371 gene locus_tag LOCUS_19690 10048 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 10421 11572 gene locus_tag LOCUS_19700 10421 11572 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_19700 11747 12076 gene locus_tag LOCUS_19710 11747 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 12345 13028 gene locus_tag LOCUS_19720 12345 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 13038 13961 gene locus_tag LOCUS_19730 13038 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 14107 14700 gene locus_tag LOCUS_19740 14107 14700 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_19740 15162 14869 gene locus_tag LOCUS_19750 15162 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 15227 15403 gene locus_tag LOCUS_19760 15227 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 17301 16546 gene locus_tag LOCUS_19770 17301 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 17836 17294 gene locus_tag LOCUS_19780 17836 17294 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_19780 17986 18654 gene locus_tag LOCUS_19790 17986 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 18806 19771 gene locus_tag LOCUS_19800 18806 19771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776808.1 protein_id gnl|my_center|LOCUS_19800 19768 21003 gene locus_tag LOCUS_19810 19768 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 21279 21644 gene locus_tag LOCUS_19820 21279 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19820 21682 21882 gene locus_tag LOCUS_19830 21682 21882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 22049 22405 gene locus_tag LOCUS_19840 22049 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence059 413 1192 gene locus_tag LOCUS_19850 413 1192 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 protein_id gnl|my_center|LOCUS_19850 3366 1318 gene locus_tag LOCUS_19860 gene tkt 3366 1318 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_19860 4484 3363 gene locus_tag LOCUS_19870 gene tal 4484 3363 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_19870 6113 4572 gene locus_tag LOCUS_19880 6113 4572 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168723.1 protein_id gnl|my_center|LOCUS_19880 6605 6126 gene locus_tag LOCUS_19890 gene derI1 6605 6126 CDS product D-erythrulose 4-phosphate isomerase DerI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728942.1 protein_id gnl|my_center|LOCUS_19890 8335 6602 gene locus_tag LOCUS_19900 gene derK 8335 6602 CDS product D-erythrulose 4-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728941.1 protein_id gnl|my_center|LOCUS_19900 9021 8332 gene locus_tag LOCUS_19910 9021 8332 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_19910 10727 9018 gene locus_tag LOCUS_19920 gene glpD 10727 9018 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_19920 11766 10786 gene locus_tag LOCUS_19930 11766 10786 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533072.1 protein_id gnl|my_center|LOCUS_19930 12954 11815 gene locus_tag LOCUS_19940 12954 11815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533073.1 protein_id gnl|my_center|LOCUS_19940 14507 12951 gene locus_tag LOCUS_19950 14507 12951 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533074.1 protein_id gnl|my_center|LOCUS_19950 15151 14507 gene locus_tag LOCUS_19960 15151 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 15415 17046 gene locus_tag LOCUS_19970 gene glpD 15415 17046 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_19970 17047 18534 gene locus_tag LOCUS_19980 17047 18534 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_19980 18531 19328 gene locus_tag LOCUS_19990 18531 19328 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389112.1 protein_id gnl|my_center|LOCUS_19990 19309 20103 gene locus_tag LOCUS_20000 19309 20103 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 protein_id gnl|my_center|LOCUS_20000 20301 20945 gene locus_tag LOCUS_20010 20301 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence060 <1 799 gene locus_tag LOCUS_20020 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230238.1:ATP-binding cassette domain-containing protein 837 1658 gene locus_tag LOCUS_20030 837 1658 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_20030 1659 2354 gene locus_tag LOCUS_20040 1659 2354 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_20040 2479 3351 gene locus_tag LOCUS_20050 2479 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3417 3839 gene locus_tag LOCUS_20060 3417 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4141 3842 gene locus_tag LOCUS_20070 4141 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4715 4479 gene locus_tag LOCUS_20080 4715 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4906 5292 gene locus_tag LOCUS_20090 4906 5292 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_20090 5909 5376 gene locus_tag LOCUS_20100 5909 5376 CDS product DUF2771 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230215.1 protein_id gnl|my_center|LOCUS_20100 7555 5912 gene locus_tag LOCUS_20110 7555 5912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230214.1 protein_id gnl|my_center|LOCUS_20110 8833 7997 gene locus_tag LOCUS_20120 8833 7997 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 protein_id gnl|my_center|LOCUS_20120 8912 9712 gene locus_tag LOCUS_20130 8912 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 9709 12675 gene locus_tag LOCUS_20140 9709 12675 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_20140 13165 12764 gene locus_tag LOCUS_20150 13165 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 13079 13510 gene locus_tag LOCUS_20160 13079 13510 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_20160 14526 13747 gene locus_tag LOCUS_20170 14526 13747 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_20170 15262 14639 gene locus_tag LOCUS_20180 15262 14639 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230204.1 protein_id gnl|my_center|LOCUS_20180 16924 15437 gene locus_tag LOCUS_20190 16924 15437 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_20190 17146 18021 gene locus_tag LOCUS_20200 17146 18021 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_20200 18029 18640 gene locus_tag LOCUS_20210 18029 18640 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230199.1 protein_id gnl|my_center|LOCUS_20210 19379 18894 gene locus_tag LOCUS_20220 19379 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 20356 19376 gene locus_tag LOCUS_20230 20356 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 21049 20360 gene locus_tag LOCUS_20240 21049 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849223.1 protein_id gnl|my_center|LOCUS_20240 <22273 21049 gene locus_tag LOCUS_20250 <22273 21049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230660.1:membrane protein >Feature sequence061 1685 15 gene locus_tag LOCUS_20260 1685 15 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804291.1 protein_id gnl|my_center|LOCUS_20260 2842 1682 gene locus_tag LOCUS_20270 2842 1682 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_20270 5339 2889 gene locus_tag LOCUS_20280 5339 2889 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_20280 6054 5425 gene locus_tag LOCUS_20290 6054 5425 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_20290 7112 6051 gene locus_tag LOCUS_20300 7112 6051 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_20300 8223 7441 gene locus_tag LOCUS_20310 8223 7441 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_20310 8357 8722 gene locus_tag LOCUS_20320 8357 8722 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229318.1 protein_id gnl|my_center|LOCUS_20320 8728 9903 gene locus_tag LOCUS_20330 8728 9903 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_20330 12398 10038 gene locus_tag LOCUS_20340 gene atsD 12398 10038 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_20340 13411 12506 gene locus_tag LOCUS_20350 13411 12506 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776450.1 protein_id gnl|my_center|LOCUS_20350 14615 13404 gene locus_tag LOCUS_20360 14615 13404 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 protein_id gnl|my_center|LOCUS_20360 15556 14612 gene locus_tag LOCUS_20370 15556 14612 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_20370 16785 15865 gene locus_tag LOCUS_20380 16785 15865 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_20380 17415 16798 gene locus_tag LOCUS_20390 17415 16798 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229313.1 protein_id gnl|my_center|LOCUS_20390 17560 19056 gene locus_tag LOCUS_20400 17560 19056 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229314.1 protein_id gnl|my_center|LOCUS_20400 19056 20705 gene locus_tag LOCUS_20410 gene betA 19056 20705 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_20410 20909 20718 gene locus_tag LOCUS_20420 20909 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 21687 21001 gene locus_tag LOCUS_20430 21687 21001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 21757 21987 gene locus_tag LOCUS_20440 21757 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence062 642 1772 gene locus_tag LOCUS_20450 642 1772 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_20450 1878 2477 gene locus_tag LOCUS_20460 1878 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_20460 3478 2573 gene locus_tag LOCUS_20470 3478 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467854.1 protein_id gnl|my_center|LOCUS_20470 3684 3872 gene locus_tag LOCUS_20480 3684 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4299 4511 gene locus_tag LOCUS_20490 4299 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4456 4662 gene locus_tag LOCUS_20500 4456 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5159 4731 gene locus_tag LOCUS_20510 gene arfB 5159 4731 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_20510 6340 5261 gene locus_tag LOCUS_20520 gene purM 6340 5261 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230742.1 protein_id gnl|my_center|LOCUS_20520 8027 6381 gene locus_tag LOCUS_20530 gene purF 8027 6381 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_20530 8512 8120 gene locus_tag LOCUS_20540 8512 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230744.1 protein_id gnl|my_center|LOCUS_20540 8783 8496 gene locus_tag LOCUS_20550 8783 8496 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_20550 9952 9029 gene locus_tag LOCUS_20560 9952 9029 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_20560 10063 10908 gene locus_tag LOCUS_20570 10063 10908 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_20570 11340 10948 gene locus_tag LOCUS_20580 11340 10948 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_20580 11391 11993 gene locus_tag LOCUS_20590 11391 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 12134 13018 gene locus_tag LOCUS_20600 12134 13018 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230751.1 protein_id gnl|my_center|LOCUS_20600 13150 14166 gene locus_tag LOCUS_20610 13150 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 14369 15694 gene locus_tag LOCUS_20620 gene mgtE 14369 15694 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_20620 18121 15713 gene locus_tag LOCUS_20630 gene purL 18121 15713 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230755.1 protein_id gnl|my_center|LOCUS_20630 18960 18289 gene locus_tag LOCUS_20640 gene purQ 18960 18289 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_20640 19196 18957 gene locus_tag LOCUS_20650 gene purS 19196 18957 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230759.1 protein_id gnl|my_center|LOCUS_20650 19359 20363 gene locus_tag LOCUS_20660 19359 20363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_20660 20623 20444 gene locus_tag LOCUS_20670 20623 20444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 20574 22067 gene locus_tag LOCUS_20680 20574 22067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence063 396 1 gene locus_tag LOCUS_20690 396 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1373 429 gene locus_tag LOCUS_20700 gene meaB 1373 429 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_20700 3595 1415 gene locus_tag LOCUS_20710 gene scpA 3595 1415 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_20710 5477 3582 gene locus_tag LOCUS_20720 5477 3582 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_20720 5617 7377 gene locus_tag LOCUS_20730 5617 7377 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222824.1 protein_id gnl|my_center|LOCUS_20730 7518 8237 gene locus_tag LOCUS_20740 7518 8237 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_20740 8463 10148 gene locus_tag LOCUS_20750 8463 10148 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_20750 10172 10960 gene locus_tag LOCUS_20760 10172 10960 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_20760 10957 12594 gene locus_tag LOCUS_20770 10957 12594 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222818.1 protein_id gnl|my_center|LOCUS_20770 13922 12633 gene locus_tag LOCUS_20780 13922 12633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234253.1 protein_id gnl|my_center|LOCUS_20780 14175 16100 gene locus_tag LOCUS_20790 14175 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 16417 16223 gene locus_tag LOCUS_20800 16417 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 16518 16973 gene locus_tag LOCUS_20810 16518 16973 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_20810 18046 16988 gene locus_tag LOCUS_20820 18046 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 19145 18270 gene locus_tag LOCUS_20830 19145 18270 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_20830 20586 19138 gene locus_tag LOCUS_20840 20586 19138 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_20840 21860 20847 gene locus_tag LOCUS_20850 gene deoC 21860 20847 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence064 161 715 gene locus_tag LOCUS_20860 161 715 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742243.1 protein_id gnl|my_center|LOCUS_20860 1825 716 gene locus_tag LOCUS_20870 1825 716 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_20870 3392 1977 gene locus_tag LOCUS_20880 3392 1977 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_20880 3459 4172 gene locus_tag LOCUS_20890 3459 4172 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_20890 4373 5512 gene locus_tag LOCUS_20900 4373 5512 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_20900 5969 5502 gene locus_tag LOCUS_20910 5969 5502 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223628.1 protein_id gnl|my_center|LOCUS_20910 6278 6126 gene locus_tag LOCUS_20920 6278 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 7288 6269 gene locus_tag LOCUS_20930 7288 6269 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_20930 7991 7281 gene locus_tag LOCUS_20940 7991 7281 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223626.1 protein_id gnl|my_center|LOCUS_20940 8108 8752 gene locus_tag LOCUS_20950 gene cofC 8108 8752 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_20950 8826 11111 gene locus_tag LOCUS_20960 8826 11111 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742242.1 protein_id gnl|my_center|LOCUS_20960 11130 12137 gene locus_tag LOCUS_20970 11130 12137 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_20970 13111 12323 gene locus_tag LOCUS_20980 13111 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20980 13979 13377 gene locus_tag LOCUS_20990 gene leuD 13979 13377 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_20990 15442 13997 gene locus_tag LOCUS_21000 gene leuC 15442 13997 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_21000 15567 16286 gene locus_tag LOCUS_21010 15567 16286 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 protein_id gnl|my_center|LOCUS_21010 16333 19953 gene locus_tag LOCUS_21020 16333 19953 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_21020 21451 20021 gene locus_tag LOCUS_21030 21451 20021 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113127.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence065 180 1262 gene locus_tag LOCUS_21040 180 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230526.1 protein_id gnl|my_center|LOCUS_21040 1262 2428 gene locus_tag LOCUS_21050 1262 2428 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230525.1 protein_id gnl|my_center|LOCUS_21050 2422 3258 gene locus_tag LOCUS_21060 2422 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3255 4007 gene locus_tag LOCUS_21070 3255 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4075 4350 gene locus_tag LOCUS_21080 4075 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4350 4751 gene locus_tag LOCUS_21090 4350 4751 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230521.1 protein_id gnl|my_center|LOCUS_21090 4805 5140 gene locus_tag LOCUS_21100 4805 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5543 6148 gene locus_tag LOCUS_21110 5543 6148 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230520.1 protein_id gnl|my_center|LOCUS_21110 8608 6251 gene locus_tag LOCUS_21120 8608 6251 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230519.1 protein_id gnl|my_center|LOCUS_21120 8819 11086 gene locus_tag LOCUS_21130 8819 11086 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_21130 11198 11893 gene locus_tag LOCUS_21140 11198 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230516.1 protein_id gnl|my_center|LOCUS_21140 12199 15018 gene locus_tag LOCUS_21150 gene topA 12199 15018 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_21150 15207 15758 gene locus_tag LOCUS_21160 15207 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 15909 18029 gene locus_tag LOCUS_21170 15909 18029 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_21170 18026 19201 gene locus_tag LOCUS_21180 18026 19201 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_21180 19260 19679 gene locus_tag LOCUS_21190 19260 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 19676 20011 gene locus_tag LOCUS_21200 19676 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 21618 20044 gene locus_tag LOCUS_21210 21618 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742225.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence066 172 1839 gene locus_tag LOCUS_21220 172 1839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_21220 1866 2831 gene locus_tag LOCUS_21230 1866 2831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815564.1 protein_id gnl|my_center|LOCUS_21230 2815 3690 gene locus_tag LOCUS_21240 2815 3690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_21240 3687 4685 gene locus_tag LOCUS_21250 3687 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21250 4682 5659 gene locus_tag LOCUS_21260 4682 5659 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_21260 6155 5670 gene locus_tag LOCUS_21270 6155 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8070 6172 gene locus_tag LOCUS_21280 8070 6172 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225646.1 protein_id gnl|my_center|LOCUS_21280 9465 8080 gene locus_tag LOCUS_21290 9465 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9650 9916 gene locus_tag LOCUS_21300 9650 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9913 10266 gene locus_tag LOCUS_21310 9913 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 10263 10526 gene locus_tag LOCUS_21320 10263 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11304 10543 gene locus_tag LOCUS_21330 11304 10543 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879181.1 protein_id gnl|my_center|LOCUS_21330 11410 12153 gene locus_tag LOCUS_21340 11410 12153 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389182.1 protein_id gnl|my_center|LOCUS_21340 12888 12154 gene locus_tag LOCUS_21350 12888 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 13700 12885 gene locus_tag LOCUS_21360 13700 12885 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_21360 13699 13899 gene locus_tag LOCUS_21370 13699 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 14085 14357 gene locus_tag LOCUS_21380 14085 14357 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_21380 14370 15506 gene locus_tag LOCUS_21390 gene hypD 14370 15506 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_21390 15493 16614 gene locus_tag LOCUS_21400 gene hypE 15493 16614 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_21400 16709 17329 gene locus_tag LOCUS_21410 16709 17329 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225650.1 protein_id gnl|my_center|LOCUS_21410 17326 17592 gene locus_tag LOCUS_21420 17326 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 17598 18272 gene locus_tag LOCUS_21430 17598 18272 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_21430 20662 18398 gene locus_tag LOCUS_21440 gene hypF 20662 18398 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_21440 21542 21240 gene locus_tag LOCUS_21450 21542 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence067 2524 659 gene locus_tag LOCUS_21460 gene recD 2524 659 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775929.1 protein_id gnl|my_center|LOCUS_21460 5790 2521 gene locus_tag LOCUS_21470 gene recB 5790 2521 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092099.1 protein_id gnl|my_center|LOCUS_21470 9179 5787 gene locus_tag LOCUS_21480 gene recC 9179 5787 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900193.1 protein_id gnl|my_center|LOCUS_21480 9493 9224 gene locus_tag LOCUS_21490 9493 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109937.1 protein_id gnl|my_center|LOCUS_21490 10252 9575 gene locus_tag LOCUS_21500 10252 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 11120 10281 gene locus_tag LOCUS_21510 11120 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 12902 11262 gene locus_tag LOCUS_21520 12902 11262 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729746.1 protein_id gnl|my_center|LOCUS_21520 13072 13524 gene locus_tag LOCUS_21530 13072 13524 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_21530 13613 14125 gene locus_tag LOCUS_21540 13613 14125 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229399.1 protein_id gnl|my_center|LOCUS_21540 14125 15183 gene locus_tag LOCUS_21550 14125 15183 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_21550 15456 15193 gene locus_tag LOCUS_21560 15456 15193 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224868.1 protein_id gnl|my_center|LOCUS_21560 17064 15583 gene locus_tag LOCUS_21570 17064 15583 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_21570 17859 18572 gene locus_tag LOCUS_21580 17859 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 18948 18535 gene locus_tag LOCUS_21590 18948 18535 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_21590 18984 19733 gene locus_tag LOCUS_21600 18984 19733 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_21600 20018 20257 gene locus_tag LOCUS_21610 20018 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 20383 21060 gene locus_tag LOCUS_21620 20383 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence068 62 835 gene locus_tag LOCUS_21630 62 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 905 1183 gene locus_tag LOCUS_21640 905 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1277 2755 gene locus_tag LOCUS_21650 1277 2755 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224832.1 protein_id gnl|my_center|LOCUS_21650 2868 3428 gene locus_tag LOCUS_21660 gene lspA 2868 3428 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_21660 3425 4348 gene locus_tag LOCUS_21670 3425 4348 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_21670 5538 4453 gene locus_tag LOCUS_21680 5538 4453 CDS product AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224837.1 protein_id gnl|my_center|LOCUS_21680 5641 7317 gene locus_tag LOCUS_21690 5641 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21690 7314 8990 gene locus_tag LOCUS_21700 7314 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21700 9651 9001 gene locus_tag LOCUS_21710 9651 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 11641 9833 gene locus_tag LOCUS_21720 11641 9833 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_21720 11789 12196 gene locus_tag LOCUS_21730 11789 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224319.1 protein_id gnl|my_center|LOCUS_21730 12260 13048 gene locus_tag LOCUS_21740 12260 13048 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224320.1 protein_id gnl|my_center|LOCUS_21740 13066 13509 gene locus_tag LOCUS_21750 13066 13509 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_21750 13509 14669 gene locus_tag LOCUS_21760 13509 14669 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_21760 14669 15199 gene locus_tag LOCUS_21770 14669 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 15297 16172 gene locus_tag LOCUS_21780 15297 16172 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_21780 16269 17168 gene locus_tag LOCUS_21790 16269 17168 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_21790 18042 17185 gene locus_tag LOCUS_21800 18042 17185 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224445.1 protein_id gnl|my_center|LOCUS_21800 18374 18775 gene locus_tag LOCUS_21810 18374 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 18776 19414 gene locus_tag LOCUS_21820 18776 19414 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231032.1 protein_id gnl|my_center|LOCUS_21820 19414 20754 gene locus_tag LOCUS_21830 19414 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence069 585 914 gene locus_tag LOCUS_21840 585 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 911 1135 gene locus_tag LOCUS_21850 911 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1347 1132 gene locus_tag LOCUS_21860 1347 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1434 1643 gene locus_tag LOCUS_21870 1434 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2130 2897 gene locus_tag LOCUS_21880 2130 2897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230902.1 protein_id gnl|my_center|LOCUS_21880 3005 4858 gene locus_tag LOCUS_21890 3005 4858 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_21890 4971 5960 gene locus_tag LOCUS_21900 4971 5960 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080582.1 protein_id gnl|my_center|LOCUS_21900 6118 6408 gene locus_tag LOCUS_21910 6118 6408 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_21910 8505 6505 gene locus_tag LOCUS_21920 8505 6505 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_21920 8668 8522 gene locus_tag LOCUS_21930 8668 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 8657 8863 gene locus_tag LOCUS_21940 8657 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 9441 8971 gene locus_tag LOCUS_21950 9441 8971 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_21950 10059 9823 gene locus_tag LOCUS_21960 10059 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 12556 10154 gene locus_tag LOCUS_21970 12556 10154 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_21970 13441 12683 gene locus_tag LOCUS_21980 13441 12683 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_21980 14265 13438 gene locus_tag LOCUS_21990 14265 13438 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_21990 15175 14345 gene locus_tag LOCUS_22000 15175 14345 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_22000 16771 15353 gene locus_tag LOCUS_22010 16771 15353 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467877.1 protein_id gnl|my_center|LOCUS_22010 17231 18502 gene locus_tag LOCUS_22020 gene pdhA 17231 18502 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_22020 18502 19548 gene locus_tag LOCUS_22030 18502 19548 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230924.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence070 71 1030 gene locus_tag LOCUS_22040 71 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2143 1118 gene locus_tag LOCUS_22050 2143 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2500 3492 gene locus_tag LOCUS_22060 2500 3492 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813492.1 protein_id gnl|my_center|LOCUS_22060 3544 4566 gene locus_tag LOCUS_22070 3544 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6143 4941 gene locus_tag LOCUS_22080 6143 4941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22080 7949 6417 gene locus_tag LOCUS_22090 7949 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 10516 7946 gene locus_tag LOCUS_22100 10516 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 10800 11204 gene locus_tag LOCUS_22110 10800 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 11999 11268 gene locus_tag LOCUS_22120 11999 11268 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_22120 12730 12032 gene locus_tag LOCUS_22130 12730 12032 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227083.1 protein_id gnl|my_center|LOCUS_22130 13186 12770 gene locus_tag LOCUS_22140 13186 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 13436 14074 gene locus_tag LOCUS_22150 13436 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 14529 14137 gene locus_tag LOCUS_22160 14529 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 14743 14531 gene locus_tag LOCUS_22170 14743 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 14898 14680 gene locus_tag LOCUS_22180 14898 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 15214 14903 gene locus_tag LOCUS_22190 15214 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 15361 15897 gene locus_tag LOCUS_22200 15361 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 16650 15967 gene locus_tag LOCUS_22210 16650 15967 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_22210 17804 16641 gene locus_tag LOCUS_22220 17804 16641 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_22220 18005 18325 gene locus_tag LOCUS_22230 18005 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 18319 18567 gene locus_tag LOCUS_22240 18319 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 18910 18551 gene locus_tag LOCUS_22250 18910 18551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22250 18927 19145 gene locus_tag LOCUS_22260 18927 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 19245 19772 gene locus_tag LOCUS_22270 19245 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 20722 20330 gene locus_tag LOCUS_22280 20722 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence071 <1 654 gene locus_tag LOCUS_22290 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046235568.1:aldolase/citrate lyase family protein 644 1867 gene locus_tag LOCUS_22300 gene sbnH 644 1867 CDS product staphyloferrin B biosynthesis decarboxylase SbnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 protein_id gnl|my_center|LOCUS_22300 2035 1868 gene locus_tag LOCUS_22310 2035 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3807 2170 gene locus_tag LOCUS_22320 3807 2170 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_22320 4801 3896 gene locus_tag LOCUS_22330 4801 3896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230270.1 protein_id gnl|my_center|LOCUS_22330 5278 8100 gene locus_tag LOCUS_22340 5278 8100 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467795.1 protein_id gnl|my_center|LOCUS_22340 8100 8531 gene locus_tag LOCUS_22350 8100 8531 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_22350 8584 8967 gene locus_tag LOCUS_22360 8584 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11291 9006 gene locus_tag LOCUS_22370 11291 9006 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_22370 11474 11665 gene locus_tag LOCUS_22380 11474 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230250.1 protein_id gnl|my_center|LOCUS_22380 11805 13202 gene locus_tag LOCUS_22390 11805 13202 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_22390 13213 13692 gene locus_tag LOCUS_22400 gene moaC 13213 13692 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_22400 13692 14621 gene locus_tag LOCUS_22410 13692 14621 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230247.1 protein_id gnl|my_center|LOCUS_22410 15464 14823 gene locus_tag LOCUS_22420 15464 14823 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_22420 16169 15864 gene locus_tag LOCUS_22430 16169 15864 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 protein_id gnl|my_center|LOCUS_22430 17255 16182 gene locus_tag LOCUS_22440 gene moaA 17255 16182 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_22440 17364 17762 gene locus_tag LOCUS_22450 17364 17762 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_22450 17768 18523 gene locus_tag LOCUS_22460 gene modA 17768 18523 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230240.1 protein_id gnl|my_center|LOCUS_22460 18520 19353 gene locus_tag LOCUS_22470 18520 19353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230239.1 protein_id gnl|my_center|LOCUS_22470 19353 20465 gene locus_tag LOCUS_22480 19353 20465 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230238.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence072 95 1324 gene locus_tag LOCUS_22490 95 1324 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_22490 3776 1356 gene locus_tag LOCUS_22500 3776 1356 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_22500 4749 3790 gene locus_tag LOCUS_22510 4749 3790 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_22510 6155 4746 gene locus_tag LOCUS_22520 6155 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_22520 6628 6347 gene locus_tag LOCUS_22530 6628 6347 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063731.1 protein_id gnl|my_center|LOCUS_22530 6789 6968 gene locus_tag LOCUS_22540 6789 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 7176 7379 gene locus_tag LOCUS_22550 7176 7379 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_22550 8064 7579 gene locus_tag LOCUS_22560 8064 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227878.1 protein_id gnl|my_center|LOCUS_22560 9077 8196 gene locus_tag LOCUS_22570 9077 8196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727900.1 protein_id gnl|my_center|LOCUS_22570 10621 9089 gene locus_tag LOCUS_22580 10621 9089 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 protein_id gnl|my_center|LOCUS_22580 11259 10618 gene locus_tag LOCUS_22590 11259 10618 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 protein_id gnl|my_center|LOCUS_22590 11313 12932 gene locus_tag LOCUS_22600 11313 12932 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_22600 12934 13824 gene locus_tag LOCUS_22610 12934 13824 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_22610 13821 15788 gene locus_tag LOCUS_22620 13821 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 15933 16799 gene locus_tag LOCUS_22630 15933 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 17912 16848 gene locus_tag LOCUS_22640 17912 16848 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_22640 18883 17987 gene locus_tag LOCUS_22650 18883 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 19050 19325 gene locus_tag LOCUS_22660 19050 19325 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 protein_id gnl|my_center|LOCUS_22660 19453 19527 gene locus_tag LOCUS_t00200 19453 19527 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20479 19610 gene locus_tag LOCUS_22670 20479 19610 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence073 769 11 gene locus_tag LOCUS_22680 769 11 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_22680 1136 3307 gene locus_tag LOCUS_22690 1136 3307 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_22690 4962 3637 gene locus_tag LOCUS_22700 4962 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222070.1 protein_id gnl|my_center|LOCUS_22700 5262 6224 gene locus_tag LOCUS_22710 5262 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 6221 7612 gene locus_tag LOCUS_22720 6221 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 8072 8371 gene locus_tag LOCUS_22730 8072 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9648 8518 gene locus_tag LOCUS_22740 9648 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 10413 9784 gene locus_tag LOCUS_22750 10413 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 14189 10395 gene locus_tag LOCUS_22760 14189 10395 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091628724.1 protein_id gnl|my_center|LOCUS_22760 15372 14182 gene locus_tag LOCUS_22770 15372 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842871.1 protein_id gnl|my_center|LOCUS_22770 15724 16812 gene locus_tag LOCUS_22780 15724 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 17028 18989 gene locus_tag LOCUS_22790 17028 18989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 19141 19377 gene locus_tag LOCUS_22800 19141 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 19431 19646 gene locus_tag LOCUS_22810 19431 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 19804 19938 gene locus_tag LOCUS_22820 19804 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence074 722 147 gene locus_tag LOCUS_22830 722 147 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_22830 1015 2829 gene locus_tag LOCUS_22840 1015 2829 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_22840 2930 3358 gene locus_tag LOCUS_22850 2930 3358 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_22850 4891 3371 gene locus_tag LOCUS_22860 gene mptB 4891 3371 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_22860 5179 6168 gene locus_tag LOCUS_22870 5179 6168 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226477.1 protein_id gnl|my_center|LOCUS_22870 7880 6219 gene locus_tag LOCUS_22880 gene ptsP 7880 6219 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_22880 8209 7916 gene locus_tag LOCUS_22890 8209 7916 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_22890 9718 8246 gene locus_tag LOCUS_22900 9718 8246 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226341.1 protein_id gnl|my_center|LOCUS_22900 10206 9715 gene locus_tag LOCUS_22910 10206 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11158 10208 gene locus_tag LOCUS_22920 gene pfkB 11158 10208 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_22920 11916 11155 gene locus_tag LOCUS_22930 11916 11155 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_22930 12011 12193 gene locus_tag LOCUS_22940 12011 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 12245 12673 gene locus_tag LOCUS_22950 12245 12673 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403547.1 protein_id gnl|my_center|LOCUS_22950 13383 12685 gene locus_tag LOCUS_22960 13383 12685 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_22960 13346 13531 gene locus_tag LOCUS_22970 13346 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 14364 13528 gene locus_tag LOCUS_22980 14364 13528 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_22980 15410 14364 gene locus_tag LOCUS_22990 15410 14364 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_22990 15684 16616 gene locus_tag LOCUS_23000 15684 16616 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_23000 16660 17643 gene locus_tag LOCUS_23010 16660 17643 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226470.1 protein_id gnl|my_center|LOCUS_23010 17738 17998 gene locus_tag LOCUS_23020 17738 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 18928 17978 gene locus_tag LOCUS_23030 18928 17978 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226465.1 protein_id gnl|my_center|LOCUS_23030 20262 18928 gene locus_tag LOCUS_23040 20262 18928 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226464.1 protein_id gnl|my_center|LOCUS_23040 20385 20469 gene locus_tag LOCUS_t00210 20385 20469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 376 1536 gene locus_tag LOCUS_23050 376 1536 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_23050 2822 1596 gene locus_tag LOCUS_23060 2822 1596 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_23060 3043 4206 gene locus_tag LOCUS_23070 3043 4206 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_23070 5192 4287 gene locus_tag LOCUS_23080 5192 4287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_23080 6103 5192 gene locus_tag LOCUS_23090 6103 5192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_23090 6238 7008 gene locus_tag LOCUS_23100 6238 7008 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_23100 6998 7864 gene locus_tag LOCUS_23110 6998 7864 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_23110 7861 8595 gene locus_tag LOCUS_23120 7861 8595 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_23120 8592 9659 gene locus_tag LOCUS_23130 8592 9659 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_23130 9665 10054 gene locus_tag LOCUS_23140 9665 10054 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_23140 10160 10690 gene locus_tag LOCUS_23150 10160 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 11922 10771 gene locus_tag LOCUS_23160 11922 10771 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_23160 12544 11933 gene locus_tag LOCUS_23170 gene kstR2 12544 11933 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_23170 13334 12552 gene locus_tag LOCUS_23180 13334 12552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_23180 14482 13331 gene locus_tag LOCUS_23190 14482 13331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_23190 14578 16176 gene locus_tag LOCUS_23200 14578 16176 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_23200 16173 17021 gene locus_tag LOCUS_23210 16173 17021 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_23210 17024 18205 gene locus_tag LOCUS_23220 17024 18205 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_23220 18214 19197 gene locus_tag LOCUS_23230 18214 19197 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 protein_id gnl|my_center|LOCUS_23230 19197 20264 gene locus_tag LOCUS_23240 19197 20264 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence076 594 373 gene locus_tag LOCUS_23250 594 373 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_23250 813 1619 gene locus_tag LOCUS_23260 813 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1872 2738 gene locus_tag LOCUS_23270 1872 2738 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978157.1 protein_id gnl|my_center|LOCUS_23270 4377 2905 gene locus_tag LOCUS_23280 gene argS 4377 2905 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 5490 7187 gene locus_tag LOCUS_23290 5490 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 7280 8419 gene locus_tag LOCUS_23300 gene metK 7280 8419 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_23300 8492 9472 gene locus_tag LOCUS_23310 8492 9472 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_23310 9475 13053 gene locus_tag LOCUS_23320 gene metH 9475 13053 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_23320 13073 14530 gene locus_tag LOCUS_23330 gene ahcY 13073 14530 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227086.1 protein_id gnl|my_center|LOCUS_23330 14574 15458 gene locus_tag LOCUS_23340 14574 15458 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731390.1 protein_id gnl|my_center|LOCUS_23340 15905 15624 gene locus_tag LOCUS_23350 15905 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 16093 15902 gene locus_tag LOCUS_23360 16093 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 16016 16282 gene locus_tag LOCUS_23370 16016 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 16282 16617 gene locus_tag LOCUS_23380 16282 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 17234 16593 gene locus_tag LOCUS_23390 17234 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 19021 17714 gene locus_tag LOCUS_23400 19021 17714 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225685.1 protein_id gnl|my_center|LOCUS_23400 19866 19519 gene locus_tag LOCUS_23410 19866 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence077 <1 2017 gene locus_tag LOCUS_23420 <1 2017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228600.1:cytochrome c oxidase assembly protein 2275 2682 gene locus_tag LOCUS_23430 2275 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2850 4529 gene locus_tag LOCUS_23440 gene ettA 2850 4529 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228599.1 protein_id gnl|my_center|LOCUS_23440 4570 6567 gene locus_tag LOCUS_23450 4570 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6727 11688 gene locus_tag LOCUS_23460 6727 11688 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228597.1 protein_id gnl|my_center|LOCUS_23460 11711 12379 gene locus_tag LOCUS_23470 11711 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228595.1 protein_id gnl|my_center|LOCUS_23470 14029 12419 gene locus_tag LOCUS_23480 14029 12419 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228593.1 protein_id gnl|my_center|LOCUS_23480 14495 14094 gene locus_tag LOCUS_23490 14495 14094 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_23490 15520 14540 gene locus_tag LOCUS_23500 15520 14540 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_23500 15726 16391 gene locus_tag LOCUS_23510 15726 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 16460 16708 gene locus_tag LOCUS_23520 16460 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228588.1 protein_id gnl|my_center|LOCUS_23520 16695 17180 gene locus_tag LOCUS_23530 16695 17180 CDS product DUF5130 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228587.1 protein_id gnl|my_center|LOCUS_23530 19842 17269 gene locus_tag LOCUS_23540 gene pepN 19842 17269 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence078 980 153 gene locus_tag LOCUS_23550 gene pyrF 980 153 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_23550 4416 1081 gene locus_tag LOCUS_23560 gene carB 4416 1081 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_23560 5534 4416 gene locus_tag LOCUS_23570 gene carA 5534 4416 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_23570 6058 5531 gene locus_tag LOCUS_23580 6058 5531 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224616.1 protein_id gnl|my_center|LOCUS_23580 7358 6045 gene locus_tag LOCUS_23590 7358 6045 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224615.1 protein_id gnl|my_center|LOCUS_23590 8400 7468 gene locus_tag LOCUS_23600 8400 7468 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224614.1 protein_id gnl|my_center|LOCUS_23600 8987 8397 gene locus_tag LOCUS_23610 gene pyrR 8987 8397 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224613.1 protein_id gnl|my_center|LOCUS_23610 9447 9941 gene locus_tag LOCUS_23620 9447 9941 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_23620 10437 10051 gene locus_tag LOCUS_23630 gene nusB 10437 10051 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_23630 11060 10497 gene locus_tag LOCUS_23640 gene efp 11060 10497 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_23640 12243 11131 gene locus_tag LOCUS_23650 12243 11131 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_23650 12315 12827 gene locus_tag LOCUS_23660 12315 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23660 14364 12847 gene locus_tag LOCUS_23670 14364 12847 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224607.1 protein_id gnl|my_center|LOCUS_23670 15397 14417 gene locus_tag LOCUS_23680 15397 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 15974 15543 gene locus_tag LOCUS_23690 gene aroQ 15974 15543 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_23690 17080 15971 gene locus_tag LOCUS_23700 gene aroB 17080 15971 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_23700 17613 17077 gene locus_tag LOCUS_23710 17613 17077 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_23710 18862 17669 gene locus_tag LOCUS_23720 gene aroC 18862 17669 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224602.1 protein_id gnl|my_center|LOCUS_23720 19536 18892 gene locus_tag LOCUS_23730 19536 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence079 268 351 gene locus_tag LOCUS_t00220 268 351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2052 550 gene locus_tag LOCUS_23740 2052 550 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899906.1 protein_id gnl|my_center|LOCUS_23740 2142 3191 gene locus_tag LOCUS_23750 2142 3191 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222013.1 protein_id gnl|my_center|LOCUS_23750 4132 3254 gene locus_tag LOCUS_23760 4132 3254 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_23760 5201 4125 gene locus_tag LOCUS_23770 5201 4125 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_23770 5765 6418 gene locus_tag LOCUS_23780 5765 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222031.1 protein_id gnl|my_center|LOCUS_23780 6435 7091 gene locus_tag LOCUS_23790 6435 7091 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_23790 8390 7080 gene locus_tag LOCUS_23800 8390 7080 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_23800 8494 9717 gene locus_tag LOCUS_23810 8494 9717 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_23810 10527 9868 gene locus_tag LOCUS_23820 10527 9868 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_23820 10614 10802 gene locus_tag LOCUS_23830 10614 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11412 11026 gene locus_tag LOCUS_23840 11412 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222039.1 protein_id gnl|my_center|LOCUS_23840 11614 11420 gene locus_tag LOCUS_23850 11614 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 12024 13400 gene locus_tag LOCUS_23860 12024 13400 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_23860 13423 14313 gene locus_tag LOCUS_23870 13423 14313 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_23870 15625 14600 gene locus_tag LOCUS_23880 15625 14600 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_23880 16171 15626 gene locus_tag LOCUS_23890 16171 15626 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284846.1 protein_id gnl|my_center|LOCUS_23890 16890 16168 gene locus_tag LOCUS_23900 16890 16168 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_23900 17504 16959 gene locus_tag LOCUS_23910 17504 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222046.1 protein_id gnl|my_center|LOCUS_23910 18210 17536 gene locus_tag LOCUS_23920 18210 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 18403 18200 gene locus_tag LOCUS_23930 18403 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence080 926 483 gene locus_tag LOCUS_23940 926 483 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_23940 1826 948 gene locus_tag LOCUS_23950 1826 948 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079434.1 protein_id gnl|my_center|LOCUS_23950 3075 1891 gene locus_tag LOCUS_23960 3075 1891 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_23960 4236 3088 gene locus_tag LOCUS_23970 4236 3088 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_23970 4337 5017 gene locus_tag LOCUS_23980 4337 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 5014 8229 gene locus_tag LOCUS_23990 5014 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8403 8585 gene locus_tag LOCUS_24000 8403 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 8582 8902 gene locus_tag LOCUS_24010 8582 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 10075 8912 gene locus_tag LOCUS_24020 10075 8912 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_24020 10728 10072 gene locus_tag LOCUS_24030 10728 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 11631 10849 gene locus_tag LOCUS_24040 11631 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 11834 12259 gene locus_tag LOCUS_24050 11834 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 12435 12953 gene locus_tag LOCUS_24060 12435 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 12950 13297 gene locus_tag LOCUS_24070 12950 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 13784 13272 gene locus_tag LOCUS_24080 13784 13272 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729409.1 protein_id gnl|my_center|LOCUS_24080 14366 13794 gene locus_tag LOCUS_24090 14366 13794 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222739.1 protein_id gnl|my_center|LOCUS_24090 14616 14428 gene locus_tag LOCUS_24100 14616 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 14698 15735 gene locus_tag LOCUS_24110 14698 15735 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226002.1 protein_id gnl|my_center|LOCUS_24110 16010 15732 gene locus_tag LOCUS_24120 16010 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 16214 16696 gene locus_tag LOCUS_24130 gene rraA 16214 16696 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_24130 16847 17029 gene locus_tag LOCUS_24140 16847 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 17084 17884 gene locus_tag LOCUS_24150 17084 17884 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 protein_id gnl|my_center|LOCUS_24150 18127 18780 gene locus_tag LOCUS_24160 18127 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223177.1 protein_id gnl|my_center|LOCUS_24160 19015 19620 gene locus_tag LOCUS_24170 19015 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence081 1305 94 gene locus_tag LOCUS_24180 gene eccE 1305 94 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304772.1 protein_id gnl|my_center|LOCUS_24180 1529 1302 gene locus_tag LOCUS_24190 1529 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1497 1766 gene locus_tag LOCUS_24200 1497 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1928 3553 gene locus_tag LOCUS_24210 gene eccB 1928 3553 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081911197.1 protein_id gnl|my_center|LOCUS_24210 5334 3616 gene locus_tag LOCUS_24220 5334 3616 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222633.1 protein_id gnl|my_center|LOCUS_24220 6799 5396 gene locus_tag LOCUS_24230 gene eccD 6799 5396 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_24230 7060 11085 gene locus_tag LOCUS_24240 7060 11085 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_24240 11087 12955 gene locus_tag LOCUS_24250 11087 12955 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222636.1 protein_id gnl|my_center|LOCUS_24250 13287 13598 gene locus_tag LOCUS_24260 13287 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 13644 13928 gene locus_tag LOCUS_24270 13644 13928 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 protein_id gnl|my_center|LOCUS_24270 14485 13982 gene locus_tag LOCUS_24280 14485 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 15457 14543 gene locus_tag LOCUS_24290 15457 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 15701 16153 gene locus_tag LOCUS_24300 gene rplM 15701 16153 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_24300 16264 16731 gene locus_tag LOCUS_24310 gene rpsI 16264 16731 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222642.1 protein_id gnl|my_center|LOCUS_24310 16880 18214 gene locus_tag LOCUS_24320 gene glmM 16880 18214 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_24320 18367 18708 gene locus_tag LOCUS_24330 18367 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence082 673 188 gene locus_tag LOCUS_24340 673 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227041.1 protein_id gnl|my_center|LOCUS_24340 1736 843 gene locus_tag LOCUS_24350 1736 843 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_24350 2413 1733 gene locus_tag LOCUS_24360 2413 1733 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_24360 3366 2491 gene locus_tag LOCUS_24370 3366 2491 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_24370 4184 3429 gene locus_tag LOCUS_24380 4184 3429 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_24380 4488 5990 gene locus_tag LOCUS_24390 gene miaB 4488 5990 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_24390 6012 6503 gene locus_tag LOCUS_24400 6012 6503 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224254.1 protein_id gnl|my_center|LOCUS_24400 8052 6589 gene locus_tag LOCUS_24410 8052 6589 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_24410 8218 8916 gene locus_tag LOCUS_24420 8218 8916 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_24420 8913 9893 gene locus_tag LOCUS_24430 gene miaA 8913 9893 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_24430 9896 10726 gene locus_tag LOCUS_24440 gene dapF 9896 10726 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_24440 10815 12263 gene locus_tag LOCUS_24450 gene hflX 10815 12263 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_24450 12247 13332 gene locus_tag LOCUS_24460 12247 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224263.1 protein_id gnl|my_center|LOCUS_24460 14133 13372 gene locus_tag LOCUS_24470 gene lexA 14133 13372 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_24470 14371 14892 gene locus_tag LOCUS_24480 14371 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15191 15673 gene locus_tag LOCUS_24490 gene nrdR 15191 15673 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224266.1 protein_id gnl|my_center|LOCUS_24490 15739 19650 gene locus_tag LOCUS_24500 15739 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence083 647 360 gene locus_tag LOCUS_24510 647 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413177.1 protein_id gnl|my_center|LOCUS_24510 665 862 gene locus_tag LOCUS_24520 665 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1567 1121 gene locus_tag LOCUS_24530 1567 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3323 2526 gene locus_tag LOCUS_24540 3323 2526 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_24540 3405 3770 gene locus_tag LOCUS_24550 3405 3770 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_24550 4140 3901 gene locus_tag LOCUS_24560 4140 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4803 4627 gene locus_tag LOCUS_24570 4803 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 5465 5154 gene locus_tag LOCUS_24580 5465 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5700 5984 gene locus_tag LOCUS_24590 5700 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 6899 5895 gene locus_tag LOCUS_24600 6899 5895 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_24600 7156 8547 gene locus_tag LOCUS_24610 7156 8547 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 protein_id gnl|my_center|LOCUS_24610 8544 9608 gene locus_tag LOCUS_24620 8544 9608 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950940.1 protein_id gnl|my_center|LOCUS_24620 9691 9972 gene locus_tag LOCUS_24630 9691 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 10536 10036 gene locus_tag LOCUS_24640 10536 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 12192 11029 gene locus_tag LOCUS_24650 12192 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 12460 13731 gene locus_tag LOCUS_24660 12460 13731 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_24660 14606 14956 gene locus_tag LOCUS_24670 14606 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 16163 14979 gene locus_tag LOCUS_24680 16163 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 16362 16577 gene locus_tag LOCUS_24690 16362 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 16787 17017 gene locus_tag LOCUS_24700 16787 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 17020 17244 gene locus_tag LOCUS_24710 17020 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 17413 17246 gene locus_tag LOCUS_24720 17413 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 17583 17410 gene locus_tag LOCUS_24730 17583 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 18185 17610 gene locus_tag LOCUS_24740 18185 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 18484 18182 gene locus_tag LOCUS_24750 18484 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 19071 18481 gene locus_tag LOCUS_24760 19071 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 19252 19043 gene locus_tag LOCUS_24770 19252 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence084 19 402 gene locus_tag LOCUS_24780 gene groES 19 402 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_24780 497 2107 gene locus_tag LOCUS_24790 gene groL 497 2107 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222677.1 protein_id gnl|my_center|LOCUS_24790 2499 2197 gene locus_tag LOCUS_24800 2499 2197 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_24800 2788 3837 gene locus_tag LOCUS_24810 2788 3837 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_24810 3861 4808 gene locus_tag LOCUS_24820 3861 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222680.1 protein_id gnl|my_center|LOCUS_24820 4956 5492 gene locus_tag LOCUS_24830 4956 5492 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073605.1 protein_id gnl|my_center|LOCUS_24830 5646 6320 gene locus_tag LOCUS_24840 5646 6320 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_24840 6322 7287 gene locus_tag LOCUS_24850 6322 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 7908 7432 gene locus_tag LOCUS_24860 7908 7432 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_24860 8083 9612 gene locus_tag LOCUS_24870 gene guaB 8083 9612 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_24870 9866 11002 gene locus_tag LOCUS_24880 9866 11002 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222686.1 protein_id gnl|my_center|LOCUS_24880 11131 12369 gene locus_tag LOCUS_24890 11131 12369 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_24890 12486 14204 gene locus_tag LOCUS_24900 12486 14204 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_24900 14290 15843 gene locus_tag LOCUS_24910 gene guaA 14290 15843 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_24910 16069 15857 gene locus_tag LOCUS_24920 16069 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 16637 16062 gene locus_tag LOCUS_24930 16637 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 16701 16865 gene locus_tag LOCUS_24940 16701 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 17111 18385 gene locus_tag LOCUS_24950 17111 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_24950 18458 19219 gene locus_tag LOCUS_24960 18458 19219 CDS product DUF4393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064586.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence085 335 1888 gene locus_tag LOCUS_24970 335 1888 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_24970 2596 1955 gene locus_tag LOCUS_24980 2596 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3463 2684 gene locus_tag LOCUS_24990 3463 2684 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804214.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24990 4179 3454 gene locus_tag LOCUS_25000 4179 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 5269 4217 gene locus_tag LOCUS_25010 5269 4217 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916594.1 protein_id gnl|my_center|LOCUS_25010 6557 5394 gene locus_tag LOCUS_25020 6557 5394 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_25020 7938 6688 gene locus_tag LOCUS_25030 7938 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8164 8253 gene locus_tag LOCUS_t00230 8164 8253 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9753 8977 gene locus_tag LOCUS_25040 9753 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11538 9760 gene locus_tag LOCUS_25050 11538 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 12517 11834 gene locus_tag LOCUS_25060 12517 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 12715 13035 gene locus_tag LOCUS_25070 12715 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 15319 12998 gene locus_tag LOCUS_25080 15319 12998 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230662.1 protein_id gnl|my_center|LOCUS_25080 17595 15901 gene locus_tag LOCUS_25090 gene ilvD 17595 15901 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_25090 17866 18273 gene locus_tag LOCUS_25100 17866 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence086 139 684 gene locus_tag LOCUS_25110 139 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1887 685 gene locus_tag LOCUS_25120 1887 685 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059698.1 protein_id gnl|my_center|LOCUS_25120 2032 4665 gene locus_tag LOCUS_25130 2032 4665 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_25130 4665 6611 gene locus_tag LOCUS_25140 4665 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 6560 9361 gene locus_tag LOCUS_25150 6560 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9358 10602 gene locus_tag LOCUS_25160 9358 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 10649 12187 gene locus_tag LOCUS_25170 10649 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 12243 14144 gene locus_tag LOCUS_25180 12243 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 14508 14188 gene locus_tag LOCUS_25190 gene crcB 14508 14188 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_25190 14867 15172 gene locus_tag LOCUS_25200 14867 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25200 15876 15526 gene locus_tag LOCUS_25210 15876 15526 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_25210 15995 16465 gene locus_tag LOCUS_25220 15995 16465 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229885.1 protein_id gnl|my_center|LOCUS_25220 16497 16733 gene locus_tag LOCUS_25230 16497 16733 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182462.1 protein_id gnl|my_center|LOCUS_25230 16733 18097 gene locus_tag LOCUS_25240 16733 18097 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence087 2499 1639 gene locus_tag LOCUS_25250 2499 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3452 2562 gene locus_tag LOCUS_25260 3452 2562 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_25260 4168 3467 gene locus_tag LOCUS_25270 4168 3467 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228467.1 protein_id gnl|my_center|LOCUS_25270 4823 4188 gene locus_tag LOCUS_25280 4823 4188 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_25280 5206 4820 gene locus_tag LOCUS_25290 gene rsfS 5206 4820 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_25290 6002 5358 gene locus_tag LOCUS_25300 gene nadD 6002 5358 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655767.1 protein_id gnl|my_center|LOCUS_25300 6143 8260 gene locus_tag LOCUS_25310 6143 8260 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_25310 9319 8333 gene locus_tag LOCUS_25320 9319 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_25320 10468 9353 gene locus_tag LOCUS_25330 gene proB 10468 9353 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228477.1 protein_id gnl|my_center|LOCUS_25330 11958 10468 gene locus_tag LOCUS_25340 gene obgE 11958 10468 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_25340 12306 12049 gene locus_tag LOCUS_25350 gene rpmA 12306 12049 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_25350 12635 12321 gene locus_tag LOCUS_25360 gene rplU 12635 12321 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_25360 15843 12778 gene locus_tag LOCUS_25370 15843 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 16815 18299 gene locus_tag LOCUS_25380 16815 18299 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285809.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence088 1035 160 gene locus_tag LOCUS_25390 1035 160 CDS product IS5-like element IS470 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029009.1 protein_id gnl|my_center|LOCUS_25390 1509 2015 gene locus_tag LOCUS_25400 1509 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2019 2885 gene locus_tag LOCUS_25410 2019 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231001.1 protein_id gnl|my_center|LOCUS_25410 2967 3044 gene locus_tag LOCUS_t00240 2967 3044 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4582 3170 gene locus_tag LOCUS_25420 4582 3170 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227938.1 protein_id gnl|my_center|LOCUS_25420 4776 4582 gene locus_tag LOCUS_25430 4776 4582 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029765.1 protein_id gnl|my_center|LOCUS_25430 5932 4886 gene locus_tag LOCUS_25440 5932 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 6936 5983 gene locus_tag LOCUS_25450 6936 5983 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467412.1 protein_id gnl|my_center|LOCUS_25450 7490 7026 gene locus_tag LOCUS_25460 7490 7026 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_25460 10104 7771 gene locus_tag LOCUS_25470 10104 7771 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_25470 11075 10104 gene locus_tag LOCUS_25480 11075 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 11560 11072 gene locus_tag LOCUS_25490 11560 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 11889 11557 gene locus_tag LOCUS_25500 11889 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 12440 11886 gene locus_tag LOCUS_25510 12440 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477113.1 protein_id gnl|my_center|LOCUS_25510 12748 12440 gene locus_tag LOCUS_25520 12748 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 13160 12750 gene locus_tag LOCUS_25530 13160 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 13345 13160 gene locus_tag LOCUS_25540 13345 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13557 13342 gene locus_tag LOCUS_25550 13557 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 13760 13557 gene locus_tag LOCUS_25560 13760 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 14050 13760 gene locus_tag LOCUS_25570 14050 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 14222 15034 gene locus_tag LOCUS_25580 14222 15034 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029278.1 protein_id gnl|my_center|LOCUS_25580 15025 15834 gene locus_tag LOCUS_25590 15025 15834 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897093.1 protein_id gnl|my_center|LOCUS_25590 16091 15870 gene locus_tag LOCUS_25600 16091 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 17191 16298 gene locus_tag LOCUS_25610 gene folP 17191 16298 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223256.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence089 737 198 gene locus_tag LOCUS_25620 gene ruvX 737 198 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_25620 3390 724 gene locus_tag LOCUS_25630 gene alaS 3390 724 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224582.1 protein_id gnl|my_center|LOCUS_25630 3808 3482 gene locus_tag LOCUS_25640 3808 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224581.1 protein_id gnl|my_center|LOCUS_25640 4209 3805 gene locus_tag LOCUS_25650 4209 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5269 4307 gene locus_tag LOCUS_25660 5269 4307 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_25660 6637 5279 gene locus_tag LOCUS_25670 6637 5279 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_25670 7795 6695 gene locus_tag LOCUS_25680 7795 6695 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_25680 8694 7828 gene locus_tag LOCUS_25690 8694 7828 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_25690 9966 8782 gene locus_tag LOCUS_25700 9966 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224572.1 protein_id gnl|my_center|LOCUS_25700 9999 10508 gene locus_tag LOCUS_25710 9999 10508 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_25710 12309 10531 gene locus_tag LOCUS_25720 gene aspS 12309 10531 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_25720 12504 13094 gene locus_tag LOCUS_25730 12504 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 13226 14062 gene locus_tag LOCUS_25740 13226 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 14234 14632 gene locus_tag LOCUS_25750 14234 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 14849 16564 gene locus_tag LOCUS_25760 14849 16564 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_25760 17249 16638 gene locus_tag LOCUS_25770 17249 16638 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_25770 17725 17321 gene locus_tag LOCUS_25780 17725 17321 CDS product DUF6153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225372.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence090 1373 972 gene locus_tag LOCUS_25790 1373 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1354 2514 gene locus_tag LOCUS_25800 gene dapE 1354 2514 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_25800 2602 3387 gene locus_tag LOCUS_25810 2602 3387 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_25810 3578 3898 gene locus_tag LOCUS_25820 3578 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 4608 3940 gene locus_tag LOCUS_25830 4608 3940 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_25830 4743 5321 gene locus_tag LOCUS_25840 4743 5321 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229389.1 protein_id gnl|my_center|LOCUS_25840 5318 6232 gene locus_tag LOCUS_25850 5318 6232 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831595.1 protein_id gnl|my_center|LOCUS_25850 6333 6632 gene locus_tag LOCUS_25860 6333 6632 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222965.1 protein_id gnl|my_center|LOCUS_25860 6610 7161 gene locus_tag LOCUS_25870 6610 7161 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_25870 7435 7602 gene locus_tag LOCUS_25880 7435 7602 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_25880 7697 9160 gene locus_tag LOCUS_25890 7697 9160 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_25890 9179 9910 gene locus_tag LOCUS_25900 9179 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 10628 9978 gene locus_tag LOCUS_25910 10628 9978 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_25910 10846 11439 gene locus_tag LOCUS_25920 gene sigE 10846 11439 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_25920 11436 12137 gene locus_tag LOCUS_25930 11436 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222976.1 protein_id gnl|my_center|LOCUS_25930 12476 13756 gene locus_tag LOCUS_25940 12476 13756 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286309.1 protein_id gnl|my_center|LOCUS_25940 13816 14220 gene locus_tag LOCUS_25950 gene tatB 13816 14220 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222978.1 protein_id gnl|my_center|LOCUS_25950 15377 14232 gene locus_tag LOCUS_25960 15377 14232 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_25960 15509 16402 gene locus_tag LOCUS_25970 15509 16402 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222983.1 protein_id gnl|my_center|LOCUS_25970 16504 16665 gene locus_tag LOCUS_25980 16504 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence091 805 122 gene locus_tag LOCUS_25990 805 122 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_25990 905 1681 gene locus_tag LOCUS_26000 905 1681 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_26000 2026 3426 gene locus_tag LOCUS_26010 2026 3426 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_26010 4899 3460 gene locus_tag LOCUS_26020 4899 3460 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229805.1 protein_id gnl|my_center|LOCUS_26020 5295 4984 gene locus_tag LOCUS_26030 5295 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6994 5231 gene locus_tag LOCUS_26040 6994 5231 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_26040 8624 7086 gene locus_tag LOCUS_26050 8624 7086 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229796.1 protein_id gnl|my_center|LOCUS_26050 8602 9588 gene locus_tag LOCUS_26060 8602 9588 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_26060 10767 9700 gene locus_tag LOCUS_26070 gene glpX 10767 9700 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_26070 11241 10963 gene locus_tag LOCUS_26080 11241 10963 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_26080 12685 11438 gene locus_tag LOCUS_26090 gene xseA 12685 11438 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229790.1 protein_id gnl|my_center|LOCUS_26090 13347 12682 gene locus_tag LOCUS_26100 13347 12682 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229789.1 protein_id gnl|my_center|LOCUS_26100 13630 14622 gene locus_tag LOCUS_26110 13630 14622 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_26110 15053 14640 gene locus_tag LOCUS_26120 15053 14640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_26120 15402 15034 gene locus_tag LOCUS_26130 15402 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_26130 16411 15410 gene locus_tag LOCUS_26140 16411 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 17347 16430 gene locus_tag LOCUS_26150 17347 16430 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229786.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence092 <1 925 gene locus_tag LOCUS_26160 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222355.1:pyridoxal phosphate-dependent aminotransferase 1204 2175 gene locus_tag LOCUS_26170 1204 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3636 2611 gene locus_tag LOCUS_26180 3636 2611 CDS product D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222349.1 protein_id gnl|my_center|LOCUS_26180 3742 4725 gene locus_tag LOCUS_26190 gene mntA 3742 4725 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_26190 4722 5468 gene locus_tag LOCUS_26200 4722 5468 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_26200 5465 6406 gene locus_tag LOCUS_26210 5465 6406 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_26210 6403 7272 gene locus_tag LOCUS_26220 6403 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 7837 7265 gene locus_tag LOCUS_26230 7837 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 8103 7825 gene locus_tag LOCUS_26240 8103 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26240 8409 8158 gene locus_tag LOCUS_26250 8409 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26250 9011 8409 gene locus_tag LOCUS_26260 9011 8409 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_26260 9096 9527 gene locus_tag LOCUS_26270 9096 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 9680 10930 gene locus_tag LOCUS_26280 9680 10930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315434.1 protein_id gnl|my_center|LOCUS_26280 11187 11396 gene locus_tag LOCUS_26290 11187 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 12701 11490 gene locus_tag LOCUS_26300 12701 11490 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229434.1 protein_id gnl|my_center|LOCUS_26300 13735 13382 gene locus_tag LOCUS_26310 13735 13382 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387149.1 protein_id gnl|my_center|LOCUS_26310 13985 14221 gene locus_tag LOCUS_26320 13985 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 14288 15355 gene locus_tag LOCUS_26330 14288 15355 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_26330 15352 16182 gene locus_tag LOCUS_26340 15352 16182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_26340 16179 17216 gene locus_tag LOCUS_26350 16179 17216 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence093 993 562 gene locus_tag LOCUS_26360 993 562 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_26360 1838 1008 gene locus_tag LOCUS_26370 1838 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2761 1940 gene locus_tag LOCUS_26380 2761 1940 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_26380 2999 3325 gene locus_tag LOCUS_26390 2999 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 5218 3413 gene locus_tag LOCUS_26400 gene ctaD 5218 3413 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224924.1 protein_id gnl|my_center|LOCUS_26400 5603 5310 gene locus_tag LOCUS_26410 5603 5310 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222241.1 protein_id gnl|my_center|LOCUS_26410 5694 6332 gene locus_tag LOCUS_26420 5694 6332 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_26420 7132 6491 gene locus_tag LOCUS_26430 7132 6491 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_26430 7744 7160 gene locus_tag LOCUS_26440 7744 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227048.1 protein_id gnl|my_center|LOCUS_26440 9264 8032 gene locus_tag LOCUS_26450 gene fahA 9264 8032 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_26450 9743 9273 gene locus_tag LOCUS_26460 9743 9273 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_26460 13047 9787 gene locus_tag LOCUS_26470 13047 9787 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_26470 15004 13112 gene locus_tag LOCUS_26480 15004 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 15629 15144 gene locus_tag LOCUS_26490 15629 15144 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_26490 15535 15741 gene locus_tag LOCUS_26500 15535 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 16332 15823 gene locus_tag LOCUS_26510 16332 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 16780 16340 gene locus_tag LOCUS_26520 16780 16340 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence094 873 3095 gene locus_tag LOCUS_26530 873 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4198 3140 gene locus_tag LOCUS_26540 4198 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 5719 4439 gene locus_tag LOCUS_26550 5719 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 7701 5920 gene locus_tag LOCUS_26560 gene leuA 7701 5920 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_26560 7943 8332 gene locus_tag LOCUS_26570 7943 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230600.1 protein_id gnl|my_center|LOCUS_26570 9409 8342 gene locus_tag LOCUS_26580 9409 8342 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_26580 11370 9406 gene locus_tag LOCUS_26590 11370 9406 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_26590 12378 11617 gene locus_tag LOCUS_26600 12378 11617 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_26600 12818 12408 gene locus_tag LOCUS_26610 12818 12408 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 protein_id gnl|my_center|LOCUS_26610 12926 13786 gene locus_tag LOCUS_26620 12926 13786 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_26620 14207 13872 gene locus_tag LOCUS_26630 14207 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 14822 14595 gene locus_tag LOCUS_26640 14822 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 14716 15543 gene locus_tag LOCUS_26650 gene htpX 14716 15543 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222504.1 protein_id gnl|my_center|LOCUS_26650 16430 15549 gene locus_tag LOCUS_26660 gene rfbA 16430 15549 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222507.1 protein_id gnl|my_center|LOCUS_26660 16928 16437 gene locus_tag LOCUS_26670 16928 16437 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence095 <1 2826 gene locus_tag LOCUS_26680 <1 2826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:385..387,aa:Sec) note codon on position 129 is selenocysteine opal codon. note partial CDS similar to WP_010880647.1:formate dehydrogenase subunit alpha 2833 3705 gene locus_tag LOCUS_26690 2833 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3708 4541 gene locus_tag LOCUS_26700 3708 4541 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_26700 4538 5506 gene locus_tag LOCUS_26710 4538 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5529 6671 gene locus_tag LOCUS_26720 5529 6671 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_26720 6704 6798 gene locus_tag LOCUS_t00250 6704 6798 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 6832 8142 gene locus_tag LOCUS_26730 gene selA 6832 8142 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_26730 8144 9916 gene locus_tag LOCUS_26740 gene selB 8144 9916 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_26740 10152 10409 gene locus_tag LOCUS_26750 10152 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26750 10493 10780 gene locus_tag LOCUS_26760 10493 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 12099 11371 gene locus_tag LOCUS_26770 12099 11371 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_26770 12701 12096 gene locus_tag LOCUS_26780 gene sigK 12701 12096 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_26780 16984 12773 gene locus_tag LOCUS_26790 16984 12773 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence096 1547 723 gene locus_tag LOCUS_26800 1547 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3307 1790 gene locus_tag LOCUS_26810 gene sulP 3307 1790 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_26810 4416 3304 gene locus_tag LOCUS_26820 4416 3304 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_26820 7267 4439 gene locus_tag LOCUS_26830 7267 4439 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_26830 8845 7301 gene locus_tag LOCUS_26840 gene nrfD 8845 7301 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_26840 9020 10006 gene locus_tag LOCUS_26850 9020 10006 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_26850 10014 10556 gene locus_tag LOCUS_26860 10014 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 10575 10868 gene locus_tag LOCUS_26870 gene catC 10575 10868 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 protein_id gnl|my_center|LOCUS_26870 11435 10875 gene locus_tag LOCUS_26880 gene mug 11435 10875 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_26880 13530 11476 gene locus_tag LOCUS_26890 13530 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 13938 14081 gene locus_tag LOCUS_26900 13938 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 16091 14193 gene locus_tag LOCUS_26910 16091 14193 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_26910 16189 16584 gene locus_tag LOCUS_26920 16189 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 16581 16814 gene locus_tag LOCUS_26930 16581 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence097 1080 34 gene locus_tag LOCUS_26940 gene tsaD 1080 34 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_26940 1688 1080 gene locus_tag LOCUS_26950 1688 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2350 1685 gene locus_tag LOCUS_26960 gene tsaB 2350 1685 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_26960 3137 2400 gene locus_tag LOCUS_26970 3137 2400 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893548.1 protein_id gnl|my_center|LOCUS_26970 3324 4388 gene locus_tag LOCUS_26980 gene dctP 3324 4388 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_26980 4448 5038 gene locus_tag LOCUS_26990 4448 5038 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970022.1 protein_id gnl|my_center|LOCUS_26990 6252 5086 gene locus_tag LOCUS_27000 6252 5086 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001762563.1 protein_id gnl|my_center|LOCUS_27000 6366 7811 gene locus_tag LOCUS_27010 6366 7811 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_27010 7876 9345 gene locus_tag LOCUS_27020 7876 9345 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222661.1 protein_id gnl|my_center|LOCUS_27020 9338 10669 gene locus_tag LOCUS_27030 9338 10669 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222660.1 protein_id gnl|my_center|LOCUS_27030 11250 10798 gene locus_tag LOCUS_27040 gene tsaE 11250 10798 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_27040 12371 11247 gene locus_tag LOCUS_27050 12371 11247 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 protein_id gnl|my_center|LOCUS_27050 13519 12368 gene locus_tag LOCUS_27060 gene alr 13519 12368 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_27060 15031 13556 gene locus_tag LOCUS_27070 15031 13556 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_27070 16364 15162 gene locus_tag LOCUS_27080 16364 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence098 <1 789 gene locus_tag LOCUS_27090 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742098.1:DEAD/DEAH box helicase 945 1460 gene locus_tag LOCUS_27100 gene def 945 1460 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_27100 2548 1457 gene locus_tag LOCUS_27110 2548 1457 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224208.1 protein_id gnl|my_center|LOCUS_27110 3480 2716 gene locus_tag LOCUS_27120 3480 2716 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224206.1 protein_id gnl|my_center|LOCUS_27120 3902 3480 gene locus_tag LOCUS_27130 3902 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 4316 4891 gene locus_tag LOCUS_27140 4316 4891 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_27140 5133 4813 gene locus_tag LOCUS_27150 5133 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 5621 5034 gene locus_tag LOCUS_27160 5621 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 6275 6009 gene locus_tag LOCUS_27170 6275 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27170 6634 6272 gene locus_tag LOCUS_27180 6634 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 8549 6855 gene locus_tag LOCUS_27190 8549 6855 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_27190 9514 8603 gene locus_tag LOCUS_27200 9514 8603 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_27200 9593 10675 gene locus_tag LOCUS_27210 9593 10675 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_27210 10705 11502 gene locus_tag LOCUS_27220 10705 11502 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_27220 12000 11584 gene locus_tag LOCUS_27230 12000 11584 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 protein_id gnl|my_center|LOCUS_27230 12085 14010 gene locus_tag LOCUS_27240 gene pknB 12085 14010 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_27240 15646 14213 gene locus_tag LOCUS_27250 15646 14213 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence099 141 3494 gene locus_tag LOCUS_27260 141 3494 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_27260 4946 3576 gene locus_tag LOCUS_27270 4946 3576 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 protein_id gnl|my_center|LOCUS_27270 5195 7459 gene locus_tag LOCUS_27280 5195 7459 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_27280 7472 7930 gene locus_tag LOCUS_27290 7472 7930 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_27290 8147 8980 gene locus_tag LOCUS_27300 8147 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 8980 10761 gene locus_tag LOCUS_27310 8980 10761 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_27310 12373 10793 gene locus_tag LOCUS_27320 gene mimR 12373 10793 CDS product transcriptional regulator MimR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728053.1 protein_id gnl|my_center|LOCUS_27320 13484 12657 gene locus_tag LOCUS_27330 13484 12657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_27330 14593 13895 gene locus_tag LOCUS_27340 14593 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 14774 15613 gene locus_tag LOCUS_27350 14774 15613 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973698.1 protein_id gnl|my_center|LOCUS_27350 <16145 15582 gene locus_tag LOCUS_27360 <16145 15582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228506.1:carotenoid oxygenase family protein >Feature sequence100 2063 273 gene locus_tag LOCUS_27370 gene asbB 2063 273 CDS product petrobactin biosynthesis protein AsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053144.1 protein_id gnl|my_center|LOCUS_27370 3739 2063 gene locus_tag LOCUS_27380 gene sbnE 3739 2063 CDS product L-2,3-diaminopropanoate--citrate ligase SbnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179886.1 protein_id gnl|my_center|LOCUS_27380 5001 3736 gene locus_tag LOCUS_27390 gene sbnD 5001 3736 CDS product staphyloferrin B export MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610051.1 protein_id gnl|my_center|LOCUS_27390 6797 5001 gene locus_tag LOCUS_27400 6797 5001 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005008480.1 protein_id gnl|my_center|LOCUS_27400 7845 6808 gene locus_tag LOCUS_27410 gene sbnB 7845 6808 CDS product N-[(2S)-2-amino-2-carboxyethyl]-L-glutamate dehydrogenase SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078461.1 protein_id gnl|my_center|LOCUS_27410 8899 7874 gene locus_tag LOCUS_27420 gene sbnA 8899 7874 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570807.1 protein_id gnl|my_center|LOCUS_27420 9209 9069 gene locus_tag LOCUS_27430 9209 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 9402 9190 gene locus_tag LOCUS_27440 9402 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9551 9769 gene locus_tag LOCUS_27450 9551 9769 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230277.1 protein_id gnl|my_center|LOCUS_27450 9883 10515 gene locus_tag LOCUS_27460 9883 10515 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029661.1 protein_id gnl|my_center|LOCUS_27460 12240 10609 gene locus_tag LOCUS_27470 gene groL 12240 10609 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230279.1 protein_id gnl|my_center|LOCUS_27470 13680 12502 gene locus_tag LOCUS_27480 13680 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 14348 13740 gene locus_tag LOCUS_27490 14348 13740 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230281.1 protein_id gnl|my_center|LOCUS_27490 14433 15662 gene locus_tag LOCUS_27500 14433 15662 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 protein_id gnl|my_center|LOCUS_27500 15718 15903 gene locus_tag LOCUS_27510 15718 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence101 1910 1422 gene locus_tag LOCUS_27520 gene ectA 1910 1422 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_27520 2697 2083 gene locus_tag LOCUS_27530 2697 2083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_27530 6422 2787 gene locus_tag LOCUS_27540 6422 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 6626 8131 gene locus_tag LOCUS_27550 6626 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8197 9567 gene locus_tag LOCUS_27560 gene radA 8197 9567 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_27560 12191 9657 gene locus_tag LOCUS_27570 gene otsB 12191 9657 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_27570 12463 12248 gene locus_tag LOCUS_27580 12463 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 13823 12414 gene locus_tag LOCUS_27590 13823 12414 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_27590 15402 13879 gene locus_tag LOCUS_27600 15402 13879 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_27600 15595 15670 gene locus_tag LOCUS_t00260 15595 15670 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence102 2690 3307 gene locus_tag LOCUS_27610 2690 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27610 3202 3588 gene locus_tag LOCUS_27620 3202 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3591 4049 gene locus_tag LOCUS_27630 3591 4049 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_27630 4046 4447 gene locus_tag LOCUS_27640 4046 4447 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_27640 4465 5295 gene locus_tag LOCUS_27650 gene fabG 4465 5295 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_27650 5320 6531 gene locus_tag LOCUS_27660 5320 6531 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_27660 7093 6629 gene locus_tag LOCUS_27670 7093 6629 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_27670 7177 8730 gene locus_tag LOCUS_27680 7177 8730 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_27680 8764 9978 gene locus_tag LOCUS_27690 8764 9978 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_27690 10735 10049 gene locus_tag LOCUS_27700 10735 10049 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225231.1 protein_id gnl|my_center|LOCUS_27700 11509 10781 gene locus_tag LOCUS_27710 11509 10781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262679.1 protein_id gnl|my_center|LOCUS_27710 12275 11490 gene locus_tag LOCUS_27720 12275 11490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_27720 13384 12272 gene locus_tag LOCUS_27730 13384 12272 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878327.1 protein_id gnl|my_center|LOCUS_27730 14310 13381 gene locus_tag LOCUS_27740 14310 13381 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807975.1 protein_id gnl|my_center|LOCUS_27740 15777 14314 gene locus_tag LOCUS_27750 15777 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence103 836 204 gene locus_tag LOCUS_27760 gene hisH 836 204 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 protein_id gnl|my_center|LOCUS_27760 1977 841 gene locus_tag LOCUS_27770 1977 841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_27770 2265 2717 gene locus_tag LOCUS_27780 gene soxR 2265 2717 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_27780 2984 3988 gene locus_tag LOCUS_27790 2984 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 4015 5016 gene locus_tag LOCUS_27800 4015 5016 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 protein_id gnl|my_center|LOCUS_27800 5082 5600 gene locus_tag LOCUS_27810 5082 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5766 5605 gene locus_tag LOCUS_27820 5766 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6366 5767 gene locus_tag LOCUS_27830 gene hisB 6366 5767 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224129.1 protein_id gnl|my_center|LOCUS_27830 7454 6363 gene locus_tag LOCUS_27840 7454 6363 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_27840 8797 7469 gene locus_tag LOCUS_27850 gene hisD 8797 7469 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_27850 8948 9748 gene locus_tag LOCUS_27860 8948 9748 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_27860 10779 9847 gene locus_tag LOCUS_27870 gene nadC 10779 9847 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_27870 12446 10779 gene locus_tag LOCUS_27880 12446 10779 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831489.1 protein_id gnl|my_center|LOCUS_27880 13462 12443 gene locus_tag LOCUS_27890 gene nadA 13462 12443 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_27890 13609 14238 gene locus_tag LOCUS_27900 13609 14238 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224101.1 protein_id gnl|my_center|LOCUS_27900 14303 15019 gene locus_tag LOCUS_27910 14303 15019 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_27910 15867 15400 gene locus_tag LOCUS_27920 15867 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence104 184 1941 gene locus_tag LOCUS_27930 184 1941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230757.1 protein_id gnl|my_center|LOCUS_27930 1989 3572 gene locus_tag LOCUS_27940 1989 3572 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_27940 5204 3693 gene locus_tag LOCUS_27950 5204 3693 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_27950 5540 6175 gene locus_tag LOCUS_27960 5540 6175 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_27960 7167 6253 gene locus_tag LOCUS_27970 7167 6253 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_27970 7481 8293 gene locus_tag LOCUS_27980 7481 8293 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_27980 9212 8304 gene locus_tag LOCUS_27990 9212 8304 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029509.1 protein_id gnl|my_center|LOCUS_27990 10707 9292 gene locus_tag LOCUS_28000 gene purB 10707 9292 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_28000 11372 10779 gene locus_tag LOCUS_28010 11372 10779 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230780.1 protein_id gnl|my_center|LOCUS_28010 12159 11404 gene locus_tag LOCUS_28020 12159 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230781.1 protein_id gnl|my_center|LOCUS_28020 12661 12152 gene locus_tag LOCUS_28030 12661 12152 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_28030 12855 13925 gene locus_tag LOCUS_28040 12855 13925 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230783.1 protein_id gnl|my_center|LOCUS_28040 14190 14017 gene locus_tag LOCUS_28050 14190 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 15528 14344 gene locus_tag LOCUS_28060 15528 14344 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230787.1 protein_id gnl|my_center|LOCUS_28060 15424 15639 gene locus_tag LOCUS_28070 15424 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence105 <1 1000 gene locus_tag LOCUS_28080 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074038115.1:HNH endonuclease signature motif containing protein 1064 2335 gene locus_tag LOCUS_28090 1064 2335 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_28090 2374 6201 gene locus_tag LOCUS_28100 2374 6201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_28100 6435 10226 gene locus_tag LOCUS_28110 6435 10226 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_28110 11833 10289 gene locus_tag LOCUS_28120 11833 10289 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_28120 13581 12388 gene locus_tag LOCUS_28130 13581 12388 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_28130 14273 14016 gene locus_tag LOCUS_28140 14273 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 14572 14348 gene locus_tag LOCUS_28150 14572 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 14593 15207 gene locus_tag LOCUS_28160 14593 15207 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_28160 15619 15191 gene locus_tag LOCUS_28170 15619 15191 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence106 <1 655 gene locus_tag LOCUS_28180 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222008.1:DUF3662 and FHA domain-containing protein 755 1186 gene locus_tag LOCUS_28190 755 1186 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_28190 1183 2565 gene locus_tag LOCUS_28200 1183 2565 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_28200 2565 4049 gene locus_tag LOCUS_28210 2565 4049 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_28210 4046 5536 gene locus_tag LOCUS_28220 4046 5536 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_28220 5538 6968 gene locus_tag LOCUS_28230 5538 6968 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222004.1 protein_id gnl|my_center|LOCUS_28230 6997 9036 gene locus_tag LOCUS_28240 gene pknB 6997 9036 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_28240 9820 9179 gene locus_tag LOCUS_28250 9820 9179 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221999.1 protein_id gnl|my_center|LOCUS_28250 9961 11244 gene locus_tag LOCUS_28260 9961 11244 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_28260 11315 12658 gene locus_tag LOCUS_28270 11315 12658 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_28270 12893 12741 gene locus_tag LOCUS_28280 12893 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221992.1 protein_id gnl|my_center|LOCUS_28280 13738 12893 gene locus_tag LOCUS_28290 13738 12893 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221991.1 protein_id gnl|my_center|LOCUS_28290 14013 14279 gene locus_tag LOCUS_28300 gene crgA 14013 14279 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221990.1 protein_id gnl|my_center|LOCUS_28300 14360 14785 gene locus_tag LOCUS_28310 14360 14785 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091389441.1 protein_id gnl|my_center|LOCUS_28310 <15632 14763 gene locus_tag LOCUS_28320 <15632 14763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013221988.1:rhomboid family intramembrane serine protease >Feature sequence107 116 1435 gene locus_tag LOCUS_28330 116 1435 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_28330 1490 1888 gene locus_tag LOCUS_28340 1490 1888 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081656034.1 protein_id gnl|my_center|LOCUS_28340 1907 2536 gene locus_tag LOCUS_28350 1907 2536 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222360.1 protein_id gnl|my_center|LOCUS_28350 2598 2978 gene locus_tag LOCUS_28360 2598 2978 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_28360 3130 3642 gene locus_tag LOCUS_28370 3130 3642 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_28370 3712 4413 gene locus_tag LOCUS_28380 3712 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4557 4862 gene locus_tag LOCUS_28390 4557 4862 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222364.1 protein_id gnl|my_center|LOCUS_28390 4868 5413 gene locus_tag LOCUS_28400 4868 5413 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_28400 6397 5498 gene locus_tag LOCUS_28410 gene purU 6397 5498 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_28410 6913 6401 gene locus_tag LOCUS_28420 6913 6401 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_28420 7082 8083 gene locus_tag LOCUS_28430 7082 8083 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_28430 8407 9576 gene locus_tag LOCUS_28440 8407 9576 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222387.1 protein_id gnl|my_center|LOCUS_28440 9790 11115 gene locus_tag LOCUS_28450 gene mshA 9790 11115 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_28450 11112 11633 gene locus_tag LOCUS_28460 11112 11633 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_28460 11732 12673 gene locus_tag LOCUS_28470 11732 12673 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_28470 12943 12713 gene locus_tag LOCUS_28480 12943 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 13071 13910 gene locus_tag LOCUS_28490 13071 13910 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_28490 14318 13938 gene locus_tag LOCUS_28500 14318 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 15316 14315 gene locus_tag LOCUS_28510 15316 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 15522 15403 gene locus_tag LOCUS_28520 15522 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence108 1626 178 gene locus_tag LOCUS_28530 1626 178 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_28530 2140 1682 gene locus_tag LOCUS_28540 2140 1682 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_28540 2417 2220 gene locus_tag LOCUS_28550 2417 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082597.1 protein_id gnl|my_center|LOCUS_28550 2590 3429 gene locus_tag LOCUS_28560 2590 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229131.1 protein_id gnl|my_center|LOCUS_28560 3670 5076 gene locus_tag LOCUS_28570 3670 5076 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 protein_id gnl|my_center|LOCUS_28570 5078 6229 gene locus_tag LOCUS_28580 5078 6229 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_28580 6959 6243 gene locus_tag LOCUS_28590 6959 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 7052 7531 gene locus_tag LOCUS_28600 7052 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 7540 7788 gene locus_tag LOCUS_28610 7540 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 7984 8907 gene locus_tag LOCUS_28620 7984 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8924 9178 gene locus_tag LOCUS_28630 8924 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10819 9332 gene locus_tag LOCUS_28640 10819 9332 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_28640 12061 10847 gene locus_tag LOCUS_28650 12061 10847 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 protein_id gnl|my_center|LOCUS_28650 12930 12058 gene locus_tag LOCUS_28660 gene murQ 12930 12058 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_28660 13847 12927 gene locus_tag LOCUS_28670 13847 12927 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929853.1 protein_id gnl|my_center|LOCUS_28670 14572 13844 gene locus_tag LOCUS_28680 14572 13844 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_28680 14675 14941 gene locus_tag LOCUS_28690 14675 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 14929 15333 gene locus_tag LOCUS_28700 14929 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence109 128 421 gene locus_tag LOCUS_28710 128 421 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_28710 504 429 gene locus_tag LOCUS_t00270 504 429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 789 2354 gene locus_tag LOCUS_28720 789 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2524 2964 gene locus_tag LOCUS_28730 2524 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222080.1 protein_id gnl|my_center|LOCUS_28730 2967 3821 gene locus_tag LOCUS_28740 2967 3821 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222081.1 protein_id gnl|my_center|LOCUS_28740 3997 5334 gene locus_tag LOCUS_28750 3997 5334 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222082.1 protein_id gnl|my_center|LOCUS_28750 5469 5624 gene locus_tag LOCUS_28760 5469 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 5634 6638 gene locus_tag LOCUS_28770 gene tgmB 5634 6638 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027302.1 protein_id gnl|my_center|LOCUS_28770 6653 7504 gene locus_tag LOCUS_28780 6653 7504 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_28780 7708 8523 gene locus_tag LOCUS_28790 7708 8523 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284934.1 protein_id gnl|my_center|LOCUS_28790 8583 9044 gene locus_tag LOCUS_28800 8583 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222086.1 protein_id gnl|my_center|LOCUS_28800 9059 10849 gene locus_tag LOCUS_28810 9059 10849 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_28810 10865 11272 gene locus_tag LOCUS_28820 10865 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 11315 11725 gene locus_tag LOCUS_28830 11315 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 11712 12002 gene locus_tag LOCUS_28840 11712 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 12202 12486 gene locus_tag LOCUS_28850 12202 12486 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_28850 12491 13630 gene locus_tag LOCUS_28860 12491 13630 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222089.1 protein_id gnl|my_center|LOCUS_28860 13714 14595 gene locus_tag LOCUS_28870 13714 14595 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence110 845 189 gene locus_tag LOCUS_28880 845 189 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_28880 2237 1017 gene locus_tag LOCUS_28890 2237 1017 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_28890 3488 2265 gene locus_tag LOCUS_28900 3488 2265 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_28900 3499 7197 gene locus_tag LOCUS_28910 gene mfd 3499 7197 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229948.1 protein_id gnl|my_center|LOCUS_28910 7289 8287 gene locus_tag LOCUS_28920 7289 8287 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_28920 8352 9299 gene locus_tag LOCUS_28930 8352 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630323.1 protein_id gnl|my_center|LOCUS_28930 9296 10318 gene locus_tag LOCUS_28940 9296 10318 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229944.1 protein_id gnl|my_center|LOCUS_28940 10373 11275 gene locus_tag LOCUS_28950 10373 11275 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229932.1 protein_id gnl|my_center|LOCUS_28950 11426 11935 gene locus_tag LOCUS_28960 11426 11935 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229930.1 protein_id gnl|my_center|LOCUS_28960 12051 13337 gene locus_tag LOCUS_28970 gene eno 12051 13337 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_28970 13542 13865 gene locus_tag LOCUS_28980 13542 13865 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229928.1 protein_id gnl|my_center|LOCUS_28980 13875 14384 gene locus_tag LOCUS_28990 13875 14384 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 protein_id gnl|my_center|LOCUS_28990 14409 15365 gene locus_tag LOCUS_29000 14409 15365 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence111 1134 157 gene locus_tag LOCUS_29010 1134 157 CDS product DUF4393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064586.1 protein_id gnl|my_center|LOCUS_29010 2093 1185 gene locus_tag LOCUS_29020 2093 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3355 2093 gene locus_tag LOCUS_29030 3355 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_29030 3648 4208 gene locus_tag LOCUS_29040 3648 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 4213 5211 gene locus_tag LOCUS_29050 4213 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 5855 5283 gene locus_tag LOCUS_29060 5855 5283 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230219.1 protein_id gnl|my_center|LOCUS_29060 5960 6676 gene locus_tag LOCUS_29070 5960 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6705 7274 gene locus_tag LOCUS_29080 6705 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 10224 7333 gene locus_tag LOCUS_29090 10224 7333 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_29090 10694 10299 gene locus_tag LOCUS_29100 10694 10299 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_29100 12431 10803 gene locus_tag LOCUS_29110 12431 10803 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_29110 12568 14193 gene locus_tag LOCUS_29120 gene pruA 12568 14193 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_29120 14226 15155 gene locus_tag LOCUS_29130 14226 15155 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence112 <1 1115 gene locus_tag LOCUS_29140 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230475.1:zinc-dependent metalloprotease 1091 2155 gene locus_tag LOCUS_29150 gene tilS 1091 2155 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_29150 2159 2716 gene locus_tag LOCUS_29160 gene hpt 2159 2716 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_29160 2877 3242 gene locus_tag LOCUS_29170 2877 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467819.1 protein_id gnl|my_center|LOCUS_29170 3306 5045 gene locus_tag LOCUS_29180 3306 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5049 5819 gene locus_tag LOCUS_29190 5049 5819 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230470.1 protein_id gnl|my_center|LOCUS_29190 5820 6683 gene locus_tag LOCUS_29200 5820 6683 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230469.1 protein_id gnl|my_center|LOCUS_29200 6887 9235 gene locus_tag LOCUS_29210 gene ftsH 6887 9235 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230468.1 protein_id gnl|my_center|LOCUS_29210 9183 10841 gene locus_tag LOCUS_29220 9183 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 10877 11680 gene locus_tag LOCUS_29230 gene folP 10877 11680 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_29230 11677 12063 gene locus_tag LOCUS_29240 gene folB 11677 12063 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_29240 12060 12563 gene locus_tag LOCUS_29250 gene folK 12060 12563 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 protein_id gnl|my_center|LOCUS_29250 12560 13051 gene locus_tag LOCUS_29260 12560 13051 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_29260 13152 14681 gene locus_tag LOCUS_29270 13152 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence113 420 4 gene locus_tag LOCUS_29280 gene vapc11 420 4 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_29280 623 414 gene locus_tag LOCUS_29290 623 414 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_29290 756 1115 gene locus_tag LOCUS_29300 756 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1146 2363 gene locus_tag LOCUS_29310 1146 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3425 2466 gene locus_tag LOCUS_29320 3425 2466 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_29320 4242 3454 gene locus_tag LOCUS_29330 4242 3454 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_29330 4632 5087 gene locus_tag LOCUS_29340 4632 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 5195 7408 gene locus_tag LOCUS_29350 5195 7408 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_29350 7574 7386 gene locus_tag LOCUS_29360 7574 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 7602 8378 gene locus_tag LOCUS_29370 7602 8378 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466697.1 protein_id gnl|my_center|LOCUS_29370 8375 9892 gene locus_tag LOCUS_29380 8375 9892 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223546.1 protein_id gnl|my_center|LOCUS_29380 10353 9904 gene locus_tag LOCUS_29390 10353 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 10832 10368 gene locus_tag LOCUS_29400 10832 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29400 11066 11278 gene locus_tag LOCUS_29410 11066 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 11548 12801 gene locus_tag LOCUS_29420 11548 12801 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_29420 13396 12830 gene locus_tag LOCUS_29430 13396 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence114 334 1140 gene locus_tag LOCUS_29440 334 1140 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_29440 2510 1152 gene locus_tag LOCUS_29450 2510 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4221 2518 gene locus_tag LOCUS_29460 gene cobT 4221 2518 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566423.1 protein_id gnl|my_center|LOCUS_29460 5183 4218 gene locus_tag LOCUS_29470 gene cobS 5183 4218 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_29470 6123 5317 gene locus_tag LOCUS_29480 6123 5317 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_29480 6301 8100 gene locus_tag LOCUS_29490 gene xsc 6301 8100 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_29490 8294 9622 gene locus_tag LOCUS_29500 gene allB 8294 9622 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_29500 10382 9690 gene locus_tag LOCUS_29510 10382 9690 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_29510 11368 10454 gene locus_tag LOCUS_29520 11368 10454 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727598.1 protein_id gnl|my_center|LOCUS_29520 12552 11365 gene locus_tag LOCUS_29530 12552 11365 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727599.1 protein_id gnl|my_center|LOCUS_29530 13892 12567 gene locus_tag LOCUS_29540 13892 12567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727600.1 protein_id gnl|my_center|LOCUS_29540 14573 14085 gene locus_tag LOCUS_29550 14573 14085 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226425.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence115 1254 61 gene locus_tag LOCUS_29560 1254 61 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_29560 3288 1303 gene locus_tag LOCUS_29570 3288 1303 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_29570 4367 3354 gene locus_tag LOCUS_29580 4367 3354 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_29580 5445 4594 gene locus_tag LOCUS_29590 5445 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 6243 5470 gene locus_tag LOCUS_29600 6243 5470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_29600 7154 6243 gene locus_tag LOCUS_29610 7154 6243 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727457.1 protein_id gnl|my_center|LOCUS_29610 8493 7288 gene locus_tag LOCUS_29620 gene lhgO 8493 7288 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_29620 9068 8490 gene locus_tag LOCUS_29630 9068 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 10009 9068 gene locus_tag LOCUS_29640 10009 9068 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_29640 10105 10851 gene locus_tag LOCUS_29650 10105 10851 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015034.1 protein_id gnl|my_center|LOCUS_29650 12544 10865 gene locus_tag LOCUS_29660 12544 10865 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_29660 13814 12678 gene locus_tag LOCUS_29670 13814 12678 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930220.1 protein_id gnl|my_center|LOCUS_29670 14099 13857 gene locus_tag LOCUS_29680 14099 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 14381 14112 gene locus_tag LOCUS_29690 14381 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence116 1820 174 gene locus_tag LOCUS_29700 1820 174 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_29700 2218 3249 gene locus_tag LOCUS_29710 2218 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3302 4171 gene locus_tag LOCUS_29720 3302 4171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728387.1 protein_id gnl|my_center|LOCUS_29720 4168 4950 gene locus_tag LOCUS_29730 4168 4950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728355.1 protein_id gnl|my_center|LOCUS_29730 4947 5756 gene locus_tag LOCUS_29740 4947 5756 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728356.1 protein_id gnl|my_center|LOCUS_29740 5802 7265 gene locus_tag LOCUS_29750 5802 7265 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_29750 7278 8471 gene locus_tag LOCUS_29760 7278 8471 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_29760 9185 8988 gene locus_tag LOCUS_29770 9185 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 9263 9727 gene locus_tag LOCUS_29780 9263 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 9834 10769 gene locus_tag LOCUS_29790 9834 10769 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_29790 10849 11706 gene locus_tag LOCUS_29800 gene cdtA 10849 11706 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_29800 11768 12640 gene locus_tag LOCUS_29810 gene cdtB 11768 12640 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_29810 12637 14256 gene locus_tag LOCUS_29820 gene cdtC 12637 14256 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence117 <1 1407 gene locus_tag LOCUS_29830 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222462.1:NADH-quinone oxidoreductase subunit L 1404 2966 gene locus_tag LOCUS_29840 1404 2966 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 protein_id gnl|my_center|LOCUS_29840 2963 4543 gene locus_tag LOCUS_29850 gene nuoN 2963 4543 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 protein_id gnl|my_center|LOCUS_29850 4663 5685 gene locus_tag LOCUS_29860 4663 5685 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_29860 5737 6999 gene locus_tag LOCUS_29870 5737 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222469.1 protein_id gnl|my_center|LOCUS_29870 7776 7165 gene locus_tag LOCUS_29880 7776 7165 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849840.1 protein_id gnl|my_center|LOCUS_29880 9029 7773 gene locus_tag LOCUS_29890 9029 7773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_29890 9264 10529 gene locus_tag LOCUS_29900 9264 10529 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_29900 10529 11548 gene locus_tag LOCUS_29910 10529 11548 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_29910 12113 11685 gene locus_tag LOCUS_29920 12113 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 12883 12212 gene locus_tag LOCUS_29930 12883 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29930 12961 13293 gene locus_tag LOCUS_29940 12961 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence118 147 674 gene locus_tag LOCUS_29950 147 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2926 755 gene locus_tag LOCUS_29960 2926 755 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_29960 3080 4009 gene locus_tag LOCUS_29970 gene pdxS 3080 4009 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_29970 4288 4037 gene locus_tag LOCUS_29980 4288 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 4613 4431 gene locus_tag LOCUS_29990 4613 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223142.1 protein_id gnl|my_center|LOCUS_29990 5173 4610 gene locus_tag LOCUS_30000 5173 4610 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_30000 5240 5929 gene locus_tag LOCUS_30010 5240 5929 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_30010 5926 6249 gene locus_tag LOCUS_30020 5926 6249 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227128.1 protein_id gnl|my_center|LOCUS_30020 6783 6313 gene locus_tag LOCUS_30030 6783 6313 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_30030 6909 8123 gene locus_tag LOCUS_30040 6909 8123 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229485.1 protein_id gnl|my_center|LOCUS_30040 8149 8772 gene locus_tag LOCUS_30050 gene pdxT 8149 8772 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_30050 8831 9580 gene locus_tag LOCUS_30060 8831 9580 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227126.1 protein_id gnl|my_center|LOCUS_30060 9656 10156 gene locus_tag LOCUS_30070 9656 10156 CDS product DUF4262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878153.1 protein_id gnl|my_center|LOCUS_30070 10246 10875 gene locus_tag LOCUS_30080 gene ruvC 10246 10875 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_30080 10880 11488 gene locus_tag LOCUS_30090 gene ruvA 10880 11488 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_30090 11497 12564 gene locus_tag LOCUS_30100 gene ruvB 11497 12564 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_30100 12719 13114 gene locus_tag LOCUS_30110 gene yajC 12719 13114 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284470.1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence119 245 1171 gene locus_tag LOCUS_30120 gene xerD 245 1171 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_30120 1350 2306 gene locus_tag LOCUS_30130 1350 2306 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_30130 2303 2719 gene locus_tag LOCUS_30140 2303 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_30140 2719 3558 gene locus_tag LOCUS_30150 2719 3558 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_30150 3555 4259 gene locus_tag LOCUS_30160 3555 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 4249 5016 gene locus_tag LOCUS_30170 4249 5016 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227800.1 protein_id gnl|my_center|LOCUS_30170 6190 4970 gene locus_tag LOCUS_30180 6190 4970 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_30180 6676 6194 gene locus_tag LOCUS_30190 6676 6194 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_30190 6783 7502 gene locus_tag LOCUS_30200 gene cmk 6783 7502 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_30200 7504 8178 gene locus_tag LOCUS_30210 7504 8178 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227792.1 protein_id gnl|my_center|LOCUS_30210 8175 9611 gene locus_tag LOCUS_30220 gene der 8175 9611 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_30220 10013 9633 gene locus_tag LOCUS_30230 10013 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 10167 10532 gene locus_tag LOCUS_30240 10167 10532 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_30240 10672 11652 gene locus_tag LOCUS_30250 10672 11652 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_30250 11649 12491 gene locus_tag LOCUS_30260 11649 12491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_30260 13549 12560 gene locus_tag LOCUS_30270 13549 12560 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730367.1 protein_id gnl|my_center|LOCUS_30270 14108 13728 gene locus_tag LOCUS_30280 14108 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 14302 14378 gene locus_tag LOCUS_t00280 14302 14378 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence120 96 356 gene locus_tag LOCUS_30290 96 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 340 1794 gene locus_tag LOCUS_30300 340 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1797 3146 gene locus_tag LOCUS_30310 1797 3146 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_30310 3520 3720 gene locus_tag LOCUS_30320 3520 3720 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_30320 3859 4131 gene locus_tag LOCUS_30330 3859 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 4331 4170 gene locus_tag LOCUS_30340 4331 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4419 5486 gene locus_tag LOCUS_30350 4419 5486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_30350 5536 8316 gene locus_tag LOCUS_30360 5536 8316 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113179.1 protein_id gnl|my_center|LOCUS_30360 8313 8723 gene locus_tag LOCUS_30370 8313 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 8720 10240 gene locus_tag LOCUS_30380 8720 10240 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_30380 10237 10755 gene locus_tag LOCUS_30390 10237 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 10752 11018 gene locus_tag LOCUS_30400 10752 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 11015 11335 gene locus_tag LOCUS_30410 11015 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 13818 11485 gene locus_tag LOCUS_30420 13818 11485 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence121 1021 116 gene locus_tag LOCUS_30430 1021 116 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258820.1 protein_id gnl|my_center|LOCUS_30430 1780 1118 gene locus_tag LOCUS_30440 1780 1118 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_30440 2110 1892 gene locus_tag LOCUS_30450 2110 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1991 3187 gene locus_tag LOCUS_30460 1991 3187 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_30460 3184 4425 gene locus_tag LOCUS_30470 3184 4425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_30470 4422 5588 gene locus_tag LOCUS_30480 4422 5588 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190793.1 protein_id gnl|my_center|LOCUS_30480 6805 5654 gene locus_tag LOCUS_30490 6805 5654 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222907.1 protein_id gnl|my_center|LOCUS_30490 7647 6823 gene locus_tag LOCUS_30500 7647 6823 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_30500 9092 7857 gene locus_tag LOCUS_30510 9092 7857 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229192.1 protein_id gnl|my_center|LOCUS_30510 9216 10181 gene locus_tag LOCUS_30520 9216 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_30520 10226 12568 gene locus_tag LOCUS_30530 10226 12568 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_30530 12782 13504 gene locus_tag LOCUS_30540 12782 13504 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284974.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence122 62 289 gene locus_tag LOCUS_30550 62 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 312 2099 gene locus_tag LOCUS_30560 gene ctaD 312 2099 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_30560 2096 3325 gene locus_tag LOCUS_30570 gene serB 2096 3325 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229475.1 protein_id gnl|my_center|LOCUS_30570 3322 4101 gene locus_tag LOCUS_30580 3322 4101 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_30580 4517 4182 gene locus_tag LOCUS_30590 4517 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229471.1 protein_id gnl|my_center|LOCUS_30590 6590 4572 gene locus_tag LOCUS_30600 6590 4572 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_30600 6840 7502 gene locus_tag LOCUS_30610 6840 7502 CDS product choice-of-anchor P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839866.1 protein_id gnl|my_center|LOCUS_30610 8088 7516 gene locus_tag LOCUS_30620 8088 7516 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229466.1 protein_id gnl|my_center|LOCUS_30620 9401 8109 gene locus_tag LOCUS_30630 9401 8109 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_30630 9502 9801 gene locus_tag LOCUS_30640 gene clpS 9502 9801 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_30640 11111 9816 gene locus_tag LOCUS_30650 11111 9816 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_30650 11198 11725 gene locus_tag LOCUS_30660 11198 11725 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_30660 11829 12875 gene locus_tag LOCUS_30670 11829 12875 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229462.1 protein_id gnl|my_center|LOCUS_30670 12898 13119 gene locus_tag LOCUS_30680 12898 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 13116 13628 gene locus_tag LOCUS_30690 13116 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 >Feature sequence123 1199 2368 gene locus_tag LOCUS_30700 1199 2368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114201.1 protein_id gnl|my_center|LOCUS_30700 2406 3695 gene locus_tag LOCUS_30710 2406 3695 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_30710 3724 4803 gene locus_tag LOCUS_30720 3724 4803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_30720 4824 5654 gene locus_tag LOCUS_30730 4824 5654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_30730 5651 6574 gene locus_tag LOCUS_30740 5651 6574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_30740 6571 7683 gene locus_tag LOCUS_30750 6571 7683 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_30750 7676 8140 gene locus_tag LOCUS_30760 7676 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8143 9150 gene locus_tag LOCUS_30770 8143 9150 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_30770 9201 10007 gene locus_tag LOCUS_30780 9201 10007 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_30780 10401 10045 gene locus_tag LOCUS_30790 10401 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 10617 11876 gene locus_tag LOCUS_30800 10617 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 11901 12272 gene locus_tag LOCUS_30810 11901 12272 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974491.1 protein_id gnl|my_center|LOCUS_30810 12895 12326 gene locus_tag LOCUS_30820 12895 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 12797 13321 gene locus_tag LOCUS_30830 12797 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 13350 13553 gene locus_tag LOCUS_30840 13350 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence124 238 1569 gene locus_tag LOCUS_30850 238 1569 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_30850 4373 1632 gene locus_tag LOCUS_30860 4373 1632 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_30860 5557 4376 gene locus_tag LOCUS_30870 5557 4376 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_30870 6440 5598 gene locus_tag LOCUS_30880 6440 5598 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_30880 6660 7355 gene locus_tag LOCUS_30890 6660 7355 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_30890 7383 8558 gene locus_tag LOCUS_30900 gene galK 7383 8558 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_30900 8576 9568 gene locus_tag LOCUS_30910 gene galE 8576 9568 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_30910 10792 9719 gene locus_tag LOCUS_30920 10792 9719 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224286.1 protein_id gnl|my_center|LOCUS_30920 11325 10897 gene locus_tag LOCUS_30930 11325 10897 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence125 792 604 gene locus_tag LOCUS_30940 792 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2022 808 gene locus_tag LOCUS_30950 gene fdhA 2022 808 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_30950 2813 2070 gene locus_tag LOCUS_30960 2813 2070 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064390.1 protein_id gnl|my_center|LOCUS_30960 2988 4394 gene locus_tag LOCUS_30970 2988 4394 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729292.1 protein_id gnl|my_center|LOCUS_30970 5134 4433 gene locus_tag LOCUS_30980 gene mnoR 5134 4433 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_30980 6510 5131 gene locus_tag LOCUS_30990 gene mnoS 6510 5131 CDS product two-component system sensor histidine kinase MnoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_30990 7819 6518 gene locus_tag LOCUS_31000 7819 6518 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_31000 7981 8337 gene locus_tag LOCUS_31010 7981 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 8342 8536 gene locus_tag LOCUS_31020 8342 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8966 8589 gene locus_tag LOCUS_31030 8966 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 9349 8969 gene locus_tag LOCUS_31040 9349 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 9451 9981 gene locus_tag LOCUS_31050 9451 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 10065 10352 gene locus_tag LOCUS_31060 10065 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 10349 10612 gene locus_tag LOCUS_31070 10349 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 10618 10794 gene locus_tag LOCUS_31080 10618 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 11293 10799 gene locus_tag LOCUS_31090 11293 10799 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_31090 11313 12524 gene locus_tag LOCUS_31100 11313 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 12515 13249 gene locus_tag LOCUS_31110 12515 13249 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence126 <1 1040 gene locus_tag LOCUS_31120 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222758.1:D-alanyl-D-alanine carboxypeptidase family protein 2322 1270 gene locus_tag LOCUS_31130 gene yhjD 2322 1270 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222755.1 protein_id gnl|my_center|LOCUS_31130 3365 2349 gene locus_tag LOCUS_31140 gene trpS 3365 2349 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_31140 4985 3447 gene locus_tag LOCUS_31150 4985 3447 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027604.1 protein_id gnl|my_center|LOCUS_31150 5532 4987 gene locus_tag LOCUS_31160 5532 4987 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_31160 6485 5529 gene locus_tag LOCUS_31170 6485 5529 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_31170 6691 8280 gene locus_tag LOCUS_31180 6691 8280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 protein_id gnl|my_center|LOCUS_31180 8277 8954 gene locus_tag LOCUS_31190 8277 8954 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_31190 11587 9044 gene locus_tag LOCUS_31200 11587 9044 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_31200 12067 11663 gene locus_tag LOCUS_31210 12067 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 12497 12751 gene locus_tag LOCUS_31220 12497 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence127 119 823 gene locus_tag LOCUS_31230 119 823 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_31230 1266 2729 gene locus_tag LOCUS_31240 1266 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2739 3512 gene locus_tag LOCUS_31250 gene fabI 2739 3512 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_31250 3534 4565 gene locus_tag LOCUS_31260 3534 4565 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_31260 5432 4635 gene locus_tag LOCUS_31270 5432 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226765.1 protein_id gnl|my_center|LOCUS_31270 5809 5588 gene locus_tag LOCUS_31280 5809 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 5709 6440 gene locus_tag LOCUS_31290 5709 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 6739 6500 gene locus_tag LOCUS_31300 6739 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 7955 6762 gene locus_tag LOCUS_31310 7955 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 9413 8079 gene locus_tag LOCUS_31320 9413 8079 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401650.1 protein_id gnl|my_center|LOCUS_31320 9500 10108 gene locus_tag LOCUS_31330 9500 10108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_31330 10291 11412 gene locus_tag LOCUS_31340 gene mshC 10291 11412 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_31340 12619 11759 gene locus_tag LOCUS_31350 12619 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 13205 12612 gene locus_tag LOCUS_31360 13205 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence128 1355 570 gene locus_tag LOCUS_31370 1355 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1434 2315 gene locus_tag LOCUS_31380 gene chbR 1434 2315 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983576.1 protein_id gnl|my_center|LOCUS_31380 2388 3836 gene locus_tag LOCUS_31390 2388 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3932 5236 gene locus_tag LOCUS_31400 3932 5236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_31400 5240 6283 gene locus_tag LOCUS_31410 5240 6283 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_31410 6402 7244 gene locus_tag LOCUS_31420 6402 7244 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_31420 7241 8029 gene locus_tag LOCUS_31430 7241 8029 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092205.1 protein_id gnl|my_center|LOCUS_31430 8016 9965 gene locus_tag LOCUS_31440 8016 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 9962 11248 gene locus_tag LOCUS_31450 9962 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 12005 11355 gene locus_tag LOCUS_31460 12005 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 12289 12020 gene locus_tag LOCUS_31470 12289 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 12180 12971 gene locus_tag LOCUS_31480 12180 12971 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence129 1049 171 gene locus_tag LOCUS_31490 1049 171 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_31490 1790 1086 gene locus_tag LOCUS_31500 1790 1086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_31500 2556 1795 gene locus_tag LOCUS_31510 2556 1795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_31510 2783 4042 gene locus_tag LOCUS_31520 2783 4042 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842507.1 protein_id gnl|my_center|LOCUS_31520 4125 5033 gene locus_tag LOCUS_31530 4125 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 5247 5855 gene locus_tag LOCUS_31540 5247 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 6767 5907 gene locus_tag LOCUS_31550 6767 5907 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226941.1 protein_id gnl|my_center|LOCUS_31550 6782 7075 gene locus_tag LOCUS_31560 6782 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 7038 7430 gene locus_tag LOCUS_31570 7038 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 7479 8366 gene locus_tag LOCUS_31580 7479 8366 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_31580 8651 8391 gene locus_tag LOCUS_31590 8651 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 8841 9107 gene locus_tag LOCUS_31600 8841 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 9211 9441 gene locus_tag LOCUS_31610 9211 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 9486 9656 gene locus_tag LOCUS_31620 9486 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 10516 9722 gene locus_tag LOCUS_31630 10516 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 11046 10621 gene locus_tag LOCUS_31640 11046 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31640 11261 11139 gene locus_tag LOCUS_31650 11261 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 12888 11314 gene locus_tag LOCUS_31660 12888 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence130 1694 570 gene locus_tag LOCUS_31670 1694 570 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_31670 2644 1691 gene locus_tag LOCUS_31680 gene tgmB 2644 1691 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_31680 2973 2647 gene locus_tag LOCUS_31690 2973 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3244 3059 gene locus_tag LOCUS_31700 3244 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3534 3241 gene locus_tag LOCUS_31710 3534 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3893 3531 gene locus_tag LOCUS_31720 3893 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3989 5317 gene locus_tag LOCUS_31730 3989 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5330 5878 gene locus_tag LOCUS_31740 5330 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 6250 6732 gene locus_tag LOCUS_31750 6250 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31750 6740 6922 gene locus_tag LOCUS_31760 6740 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 7039 7266 gene locus_tag LOCUS_31770 7039 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 7263 7685 gene locus_tag LOCUS_31780 7263 7685 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403386.1 protein_id gnl|my_center|LOCUS_31780 7862 8989 gene locus_tag LOCUS_31790 7862 8989 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315406.1 protein_id gnl|my_center|LOCUS_31790 9583 9993 gene locus_tag LOCUS_31800 9583 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 10261 9926 gene locus_tag LOCUS_31810 10261 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229823.1 protein_id gnl|my_center|LOCUS_31810 11169 10258 gene locus_tag LOCUS_31820 gene mca 11169 10258 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_31820 11269 11718 gene locus_tag LOCUS_31830 11269 11718 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229825.1 protein_id gnl|my_center|LOCUS_31830 11827 12396 gene locus_tag LOCUS_31840 gene greA 11827 12396 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_31840 12560 12384 gene locus_tag LOCUS_31850 12560 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 12622 13287 gene locus_tag LOCUS_31860 12622 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229827.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence131 253 65 gene locus_tag LOCUS_31870 253 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 484 1188 gene locus_tag LOCUS_31880 484 1188 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_31880 1345 1989 gene locus_tag LOCUS_31890 1345 1989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_31890 2167 2826 gene locus_tag LOCUS_31900 2167 2826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_31900 7346 2901 gene locus_tag LOCUS_31910 7346 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224660.1 protein_id gnl|my_center|LOCUS_31910 8146 7355 gene locus_tag LOCUS_31920 8146 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224659.1 protein_id gnl|my_center|LOCUS_31920 9609 8143 gene locus_tag LOCUS_31930 9609 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224658.1 protein_id gnl|my_center|LOCUS_31930 10751 9768 gene locus_tag LOCUS_31940 gene whiA 10751 9768 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_31940 11740 10742 gene locus_tag LOCUS_31950 gene yvcK 11740 10742 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_31950 12674 11763 gene locus_tag LOCUS_31960 gene rapZ 12674 11763 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_31960 <13179 12671 gene locus_tag LOCUS_31970 <13179 12671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071831611.1:excinuclease ABC subunit UvrC >Feature sequence132 275 772 gene locus_tag LOCUS_31980 275 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1866 1423 gene locus_tag LOCUS_31990 1866 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1990 2355 gene locus_tag LOCUS_32000 1990 2355 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_32000 2446 2931 gene locus_tag LOCUS_32010 2446 2931 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_32010 2928 4940 gene locus_tag LOCUS_32020 2928 4940 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_32020 4937 5884 gene locus_tag LOCUS_32030 4937 5884 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_32030 5929 6594 gene locus_tag LOCUS_32040 5929 6594 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_32040 6591 8078 gene locus_tag LOCUS_32050 6591 8078 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950336.1 protein_id gnl|my_center|LOCUS_32050 8075 9598 gene locus_tag LOCUS_32060 8075 9598 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_32060 9721 9924 gene locus_tag LOCUS_32070 9721 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 9966 11783 gene locus_tag LOCUS_32080 9966 11783 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_32080 11825 12508 gene locus_tag LOCUS_32090 11825 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32090 12760 12437 gene locus_tag LOCUS_32100 12760 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 12644 12937 gene locus_tag LOCUS_32110 12644 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32110 >Feature sequence133 2131 1106 gene locus_tag LOCUS_32120 2131 1106 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 protein_id gnl|my_center|LOCUS_32120 2844 2128 gene locus_tag LOCUS_32130 2844 2128 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_32130 3881 2841 gene locus_tag LOCUS_32140 3881 2841 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728055.1 protein_id gnl|my_center|LOCUS_32140 4266 3895 gene locus_tag LOCUS_32150 4266 3895 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226172.1 protein_id gnl|my_center|LOCUS_32150 5441 4263 gene locus_tag LOCUS_32160 5441 4263 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226171.1 protein_id gnl|my_center|LOCUS_32160 6510 5464 gene locus_tag LOCUS_32170 6510 5464 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_32170 8221 6566 gene locus_tag LOCUS_32180 8221 6566 CDS product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226169.1 protein_id gnl|my_center|LOCUS_32180 8590 8345 gene locus_tag LOCUS_32190 8590 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226168.1 protein_id gnl|my_center|LOCUS_32190 8725 9327 gene locus_tag LOCUS_32200 8725 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 9421 11214 gene locus_tag LOCUS_32210 9421 11214 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_32210 11319 11804 gene locus_tag LOCUS_32220 11319 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 12631 11846 gene locus_tag LOCUS_32230 12631 11846 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence134 157 1044 gene locus_tag LOCUS_32240 157 1044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229432.1 protein_id gnl|my_center|LOCUS_32240 2023 1088 gene locus_tag LOCUS_32250 2023 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32250 2100 2366 gene locus_tag LOCUS_32260 2100 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 2956 3201 gene locus_tag LOCUS_32270 2956 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 4259 3276 gene locus_tag LOCUS_32280 4259 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4494 4324 gene locus_tag LOCUS_32290 4494 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 4448 4927 gene locus_tag LOCUS_32300 4448 4927 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_32300 5036 5521 gene locus_tag LOCUS_32310 5036 5521 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_32310 5871 5566 gene locus_tag LOCUS_32320 5871 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 5998 6513 gene locus_tag LOCUS_32330 5998 6513 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_32330 7694 6720 gene locus_tag LOCUS_32340 gene ligD 7694 6720 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_32340 7743 7925 gene locus_tag LOCUS_32350 7743 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 8024 8422 gene locus_tag LOCUS_32360 8024 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 9218 8508 gene locus_tag LOCUS_32370 9218 8508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_32370 9674 9841 gene locus_tag LOCUS_32380 9674 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 10569 9946 gene locus_tag LOCUS_32390 10569 9946 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224770.1 protein_id gnl|my_center|LOCUS_32390 10663 11808 gene locus_tag LOCUS_32400 10663 11808 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence135 895 656 gene locus_tag LOCUS_32410 895 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1263 1688 gene locus_tag LOCUS_32420 1263 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1762 2967 gene locus_tag LOCUS_32430 1762 2967 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785364.1 protein_id gnl|my_center|LOCUS_32430 3892 3002 gene locus_tag LOCUS_32440 gene panB 3892 3002 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_32440 4475 4287 gene locus_tag LOCUS_32450 4475 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 5303 4488 gene locus_tag LOCUS_32460 gene folP 5303 4488 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_32460 6217 5387 gene locus_tag LOCUS_32470 gene folD 6217 5387 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 protein_id gnl|my_center|LOCUS_32470 7113 6232 gene locus_tag LOCUS_32480 7113 6232 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_32480 8493 7159 gene locus_tag LOCUS_32490 8493 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 9030 8653 gene locus_tag LOCUS_32500 9030 8653 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120193016.1 protein_id gnl|my_center|LOCUS_32500 10174 9062 gene locus_tag LOCUS_32510 10174 9062 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_32510 11300 10371 gene locus_tag LOCUS_32520 11300 10371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877054.1 protein_id gnl|my_center|LOCUS_32520 11458 12414 gene locus_tag LOCUS_32530 11458 12414 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence136 <1 815 gene locus_tag LOCUS_32540 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227556.1:ArsB/NhaD family transporter 932 2182 gene locus_tag LOCUS_32550 gene nhaA 932 2182 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_32550 2349 2861 gene locus_tag LOCUS_32560 2349 2861 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230543.1 protein_id gnl|my_center|LOCUS_32560 2947 3801 gene locus_tag LOCUS_32570 2947 3801 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_32570 5004 3841 gene locus_tag LOCUS_32580 5004 3841 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_32580 5812 5111 gene locus_tag LOCUS_32590 5812 5111 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230548.1 protein_id gnl|my_center|LOCUS_32590 6432 5809 gene locus_tag LOCUS_32600 6432 5809 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230549.1 protein_id gnl|my_center|LOCUS_32600 7121 6429 gene locus_tag LOCUS_32610 gene nth 7121 6429 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_32610 7427 7681 gene locus_tag LOCUS_32620 7427 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230551.1 protein_id gnl|my_center|LOCUS_32620 8114 7884 gene locus_tag LOCUS_32630 8114 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 8010 8684 gene locus_tag LOCUS_32640 8010 8684 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_32640 9862 9542 gene locus_tag LOCUS_32650 9862 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 10159 9917 gene locus_tag LOCUS_32660 10159 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 11099 10311 gene locus_tag LOCUS_32670 11099 10311 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230559.1 protein_id gnl|my_center|LOCUS_32670 11944 11096 gene locus_tag LOCUS_32680 11944 11096 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_32680 12401 11946 gene locus_tag LOCUS_32690 12401 11946 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_32690 12572 12405 gene locus_tag LOCUS_32700 12572 12405 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003068074.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence137 1471 299 gene locus_tag LOCUS_32710 1471 299 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224305.1 protein_id gnl|my_center|LOCUS_32710 2667 1468 gene locus_tag LOCUS_32720 2667 1468 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224304.1 protein_id gnl|my_center|LOCUS_32720 3716 2667 gene locus_tag LOCUS_32730 3716 2667 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284352.1 protein_id gnl|my_center|LOCUS_32730 4741 3713 gene locus_tag LOCUS_32740 4741 3713 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224302.1 protein_id gnl|my_center|LOCUS_32740 6108 4720 gene locus_tag LOCUS_32750 6108 4720 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_32750 6962 6105 gene locus_tag LOCUS_32760 6962 6105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466821.1 protein_id gnl|my_center|LOCUS_32760 7759 6965 gene locus_tag LOCUS_32770 7759 6965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224299.1 protein_id gnl|my_center|LOCUS_32770 8546 7785 gene locus_tag LOCUS_32780 8546 7785 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_32780 9545 8613 gene locus_tag LOCUS_32790 9545 8613 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_32790 9632 10813 gene locus_tag LOCUS_32800 9632 10813 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_32800 10823 11914 gene locus_tag LOCUS_32810 10823 11914 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224294.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence138 1047 178 gene locus_tag LOCUS_32820 1047 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32820 1297 1485 gene locus_tag LOCUS_32830 1297 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 1642 3006 gene locus_tag LOCUS_32840 1642 3006 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_32840 4218 3094 gene locus_tag LOCUS_32850 4218 3094 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230094.1 protein_id gnl|my_center|LOCUS_32850 4616 4218 gene locus_tag LOCUS_32860 4616 4218 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230092.1 protein_id gnl|my_center|LOCUS_32860 5458 4631 gene locus_tag LOCUS_32870 5458 4631 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_32870 6144 5455 gene locus_tag LOCUS_32880 6144 5455 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228733.1 protein_id gnl|my_center|LOCUS_32880 7673 6141 gene locus_tag LOCUS_32890 7673 6141 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_32890 8440 7670 gene locus_tag LOCUS_32900 8440 7670 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_32900 8635 9462 gene locus_tag LOCUS_32910 8635 9462 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228730.1 protein_id gnl|my_center|LOCUS_32910 9455 10246 gene locus_tag LOCUS_32920 9455 10246 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_32920 10243 11433 gene locus_tag LOCUS_32930 10243 11433 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_32930 <12536 11541 gene locus_tag LOCUS_32940 <12536 11541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878348.1:acyl-CoA dehydrogenase family protein >Feature sequence139 920 135 gene locus_tag LOCUS_32950 gene trpA 920 135 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_32950 2337 1054 gene locus_tag LOCUS_32960 gene trpB 2337 1054 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_32960 3125 2316 gene locus_tag LOCUS_32970 gene trpC 3125 2316 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_32970 3862 3299 gene locus_tag LOCUS_32980 3862 3299 CDS product Trp biosynthesis-associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224166.1 protein_id gnl|my_center|LOCUS_32980 5432 3855 gene locus_tag LOCUS_32990 5432 3855 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_32990 5550 6179 gene locus_tag LOCUS_33000 5550 6179 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224164.1 protein_id gnl|my_center|LOCUS_33000 6281 6679 gene locus_tag LOCUS_33010 6281 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401352.1 protein_id gnl|my_center|LOCUS_33010 7023 6772 gene locus_tag LOCUS_33020 7023 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 7458 7024 gene locus_tag LOCUS_33030 7458 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 7874 7527 gene locus_tag LOCUS_33040 gene hisI 7874 7527 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224158.1 protein_id gnl|my_center|LOCUS_33040 8644 7871 gene locus_tag LOCUS_33050 gene hisF 8644 7871 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_33050 8697 9269 gene locus_tag LOCUS_33060 8697 9269 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_33060 9331 10041 gene locus_tag LOCUS_33070 9331 10041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_33070 10130 10885 gene locus_tag LOCUS_33080 10130 10885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229140.1 protein_id gnl|my_center|LOCUS_33080 10912 11298 gene locus_tag LOCUS_33090 10912 11298 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224150.1 protein_id gnl|my_center|LOCUS_33090 12129 11398 gene locus_tag LOCUS_33100 gene priA 12129 11398 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence140 1623 220 gene locus_tag LOCUS_33110 gene lpdA 1623 220 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_33110 2543 1704 gene locus_tag LOCUS_33120 gene folP 2543 1704 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228969.1 protein_id gnl|my_center|LOCUS_33120 2649 3287 gene locus_tag LOCUS_33130 2649 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3409 4857 gene locus_tag LOCUS_33140 3409 4857 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079346.1 protein_id gnl|my_center|LOCUS_33140 4967 7891 gene locus_tag LOCUS_33150 4967 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 9129 7888 gene locus_tag LOCUS_33160 9129 7888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_33160 9216 10325 gene locus_tag LOCUS_33170 9216 10325 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_33170 10340 11518 gene locus_tag LOCUS_33180 10340 11518 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_33180 12194 11523 gene locus_tag LOCUS_33190 gene canB 12194 11523 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence141 274 1224 gene locus_tag LOCUS_33200 274 1224 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223173.1 protein_id gnl|my_center|LOCUS_33200 1296 1544 gene locus_tag LOCUS_33210 1296 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230564.1 protein_id gnl|my_center|LOCUS_33210 1589 2614 gene locus_tag LOCUS_33220 1589 2614 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_33220 2616 3764 gene locus_tag LOCUS_33230 2616 3764 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_33230 4091 3804 gene locus_tag LOCUS_33240 4091 3804 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230567.1 protein_id gnl|my_center|LOCUS_33240 4266 6440 gene locus_tag LOCUS_33250 4266 6440 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_33250 6450 7421 gene locus_tag LOCUS_33260 6450 7421 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_33260 7453 7527 gene locus_tag LOCUS_t00290 7453 7527 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7638 9452 gene locus_tag LOCUS_33270 7638 9452 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230572.1 protein_id gnl|my_center|LOCUS_33270 10092 9499 gene locus_tag LOCUS_33280 10092 9499 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_33280 10201 11265 gene locus_tag LOCUS_33290 10201 11265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_33290 11602 11282 gene locus_tag LOCUS_33300 11602 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 12268 12029 gene locus_tag LOCUS_33310 12268 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence142 1140 34 gene locus_tag LOCUS_33320 1140 34 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_33320 2267 1137 gene locus_tag LOCUS_33330 2267 1137 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_33330 2812 2348 gene locus_tag LOCUS_33340 2812 2348 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222445.1 protein_id gnl|my_center|LOCUS_33340 4572 2905 gene locus_tag LOCUS_33350 gene menD 4572 2905 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_33350 4507 5550 gene locus_tag LOCUS_33360 4507 5550 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 protein_id gnl|my_center|LOCUS_33360 5747 7918 gene locus_tag LOCUS_33370 5747 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 8096 8806 gene locus_tag LOCUS_33380 8096 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9687 8827 gene locus_tag LOCUS_33390 9687 8827 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_33390 9797 10342 gene locus_tag LOCUS_33400 9797 10342 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814561.1 protein_id gnl|my_center|LOCUS_33400 11618 10386 gene locus_tag LOCUS_33410 11618 10386 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_33410 <12201 11663 gene locus_tag LOCUS_33420 <12201 11663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399256.1:glycosyltransferase >Feature sequence143 <1 679 gene locus_tag LOCUS_33430 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029852.1:LysR family transcriptional regulator 1619 699 gene locus_tag LOCUS_33440 1619 699 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_33440 1742 3166 gene locus_tag LOCUS_33450 1742 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3457 3236 gene locus_tag LOCUS_33460 3457 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4614 3658 gene locus_tag LOCUS_33470 4614 3658 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_33470 4757 5758 gene locus_tag LOCUS_33480 4757 5758 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_33480 6039 7328 gene locus_tag LOCUS_33490 gene egtB 6039 7328 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_33490 7325 8287 gene locus_tag LOCUS_33500 7325 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 8300 9232 gene locus_tag LOCUS_33510 8300 9232 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_33510 9232 10005 gene locus_tag LOCUS_33520 9232 10005 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_33520 10002 11690 gene locus_tag LOCUS_33530 10002 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence144 1780 464 gene locus_tag LOCUS_33540 1780 464 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_33540 2295 1777 gene locus_tag LOCUS_33550 2295 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3353 2295 gene locus_tag LOCUS_33560 3353 2295 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814124.1 protein_id gnl|my_center|LOCUS_33560 4414 3395 gene locus_tag LOCUS_33570 4414 3395 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212559.1 protein_id gnl|my_center|LOCUS_33570 5614 4454 gene locus_tag LOCUS_33580 5614 4454 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_33580 6125 5607 gene locus_tag LOCUS_33590 gene ripB 6125 5607 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_33590 7329 6145 gene locus_tag LOCUS_33600 7329 6145 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_33600 8750 7329 gene locus_tag LOCUS_33610 8750 7329 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_33610 9637 8747 gene locus_tag LOCUS_33620 9637 8747 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731186.1 protein_id gnl|my_center|LOCUS_33620 9761 10915 gene locus_tag LOCUS_33630 9761 10915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229001.1 protein_id gnl|my_center|LOCUS_33630 11562 10972 gene locus_tag LOCUS_33640 11562 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence145 <1 1080 gene locus_tag LOCUS_33650 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259630.1:response regulator 1077 2468 gene locus_tag LOCUS_33660 1077 2468 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_33660 2465 4126 gene locus_tag LOCUS_33670 2465 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4128 5039 gene locus_tag LOCUS_33680 4128 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 6096 5296 gene locus_tag LOCUS_33690 6096 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 6493 7497 gene locus_tag LOCUS_33700 gene gap 6493 7497 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_33700 7623 8828 gene locus_tag LOCUS_33710 7623 8828 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 protein_id gnl|my_center|LOCUS_33710 8872 9660 gene locus_tag LOCUS_33720 gene tpiA 8872 9660 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224668.1 protein_id gnl|my_center|LOCUS_33720 9773 10003 gene locus_tag LOCUS_33730 gene secG 9773 10003 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_33730 10069 10410 gene locus_tag LOCUS_33740 10069 10410 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_33740 11625 10438 gene locus_tag LOCUS_33750 11625 10438 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence146 507 334 gene locus_tag LOCUS_33760 507 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 696 2870 gene locus_tag LOCUS_33770 gene betT 696 2870 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 protein_id gnl|my_center|LOCUS_33770 3015 3209 gene locus_tag LOCUS_33780 3015 3209 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406063.1 protein_id gnl|my_center|LOCUS_33780 3900 3271 gene locus_tag LOCUS_33790 3900 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803693.1 protein_id gnl|my_center|LOCUS_33790 4105 4998 gene locus_tag LOCUS_33800 4105 4998 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_33800 6251 5007 gene locus_tag LOCUS_33810 6251 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 6730 6260 gene locus_tag LOCUS_33820 6730 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 7471 6764 gene locus_tag LOCUS_33830 7471 6764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064294.1 protein_id gnl|my_center|LOCUS_33830 8274 7471 gene locus_tag LOCUS_33840 8274 7471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_33840 9412 8261 gene locus_tag LOCUS_33850 9412 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 10299 9409 gene locus_tag LOCUS_33860 10299 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 11759 10299 gene locus_tag LOCUS_33870 11759 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence147 1111 599 gene locus_tag LOCUS_33880 gene purE 1111 599 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_33880 2313 1132 gene locus_tag LOCUS_33890 2313 1132 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_33890 3612 2359 gene locus_tag LOCUS_33900 3612 2359 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222900.1 protein_id gnl|my_center|LOCUS_33900 4607 3729 gene locus_tag LOCUS_33910 4607 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222899.1 protein_id gnl|my_center|LOCUS_33910 4954 7152 gene locus_tag LOCUS_33920 4954 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 7334 7837 gene locus_tag LOCUS_33930 7334 7837 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_33930 7918 8241 gene locus_tag LOCUS_33940 7918 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 8238 8645 gene locus_tag LOCUS_33950 8238 8645 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_33950 10026 8740 gene locus_tag LOCUS_33960 10026 8740 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_33960 10740 10030 gene locus_tag LOCUS_33970 10740 10030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_33970 10783 11592 gene locus_tag LOCUS_33980 gene hisN 10783 11592 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence148 235 990 gene locus_tag LOCUS_33990 235 990 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_33990 992 1774 gene locus_tag LOCUS_34000 992 1774 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_34000 1774 2757 gene locus_tag LOCUS_34010 1774 2757 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_34010 2781 3569 gene locus_tag LOCUS_34020 gene fabG 2781 3569 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_34020 3601 4053 gene locus_tag LOCUS_34030 3601 4053 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_34030 4056 5111 gene locus_tag LOCUS_34040 4056 5111 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_34040 5111 6334 gene locus_tag LOCUS_34050 5111 6334 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_34050 6331 7383 gene locus_tag LOCUS_34060 6331 7383 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_34060 7376 7855 gene locus_tag LOCUS_34070 7376 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 9122 7932 gene locus_tag LOCUS_34080 9122 7932 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_34080 10574 9231 gene locus_tag LOCUS_34090 10574 9231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_34090 <11689 10635 gene locus_tag LOCUS_34100 <11689 10635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223282.1:branched-chain amino acid ABC transporter permease >Feature sequence149 145 1809 gene locus_tag LOCUS_34110 gene thiC 145 1809 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_34110 1809 2630 gene locus_tag LOCUS_34120 gene thiD 1809 2630 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230296.1 protein_id gnl|my_center|LOCUS_34120 2729 3535 gene locus_tag LOCUS_34130 2729 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 4314 3541 gene locus_tag LOCUS_34140 4314 3541 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230300.1 protein_id gnl|my_center|LOCUS_34140 4520 4317 gene locus_tag LOCUS_34150 gene thiS 4520 4317 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230301.1 protein_id gnl|my_center|LOCUS_34150 5653 4529 gene locus_tag LOCUS_34160 gene thiO 5653 4529 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_34160 5830 6498 gene locus_tag LOCUS_34170 gene thiE 5830 6498 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230303.1 protein_id gnl|my_center|LOCUS_34170 6594 7583 gene locus_tag LOCUS_34180 6594 7583 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_34180 8226 7504 gene locus_tag LOCUS_34190 8226 7504 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_34190 8699 9529 gene locus_tag LOCUS_34200 8699 9529 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_34200 10870 9968 gene locus_tag LOCUS_34210 gene thpD 10870 9968 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 protein_id gnl|my_center|LOCUS_34210 11404 11009 gene locus_tag LOCUS_34220 11404 11009 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence150 101 1108 gene locus_tag LOCUS_34230 gene fgd 101 1108 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225239.1 protein_id gnl|my_center|LOCUS_34230 1649 1128 gene locus_tag LOCUS_34240 1649 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2320 2817 gene locus_tag LOCUS_34250 2320 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 3397 3690 gene locus_tag LOCUS_34260 3397 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229228.1 protein_id gnl|my_center|LOCUS_34260 5017 3716 gene locus_tag LOCUS_34270 5017 3716 CDS product 3-hydroxybenzoate 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015578.1 protein_id gnl|my_center|LOCUS_34270 5766 5050 gene locus_tag LOCUS_34280 gene nagL 5766 5050 CDS product mycothiol-dependent maleylpyruvate isomerase NagL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855155.1 protein_id gnl|my_center|LOCUS_34280 6605 5766 gene locus_tag LOCUS_34290 6605 5766 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 protein_id gnl|my_center|LOCUS_34290 7800 6649 gene locus_tag LOCUS_34300 7800 6649 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015576.1 protein_id gnl|my_center|LOCUS_34300 7874 8650 gene locus_tag LOCUS_34310 7874 8650 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_34310 9648 8893 gene locus_tag LOCUS_34320 9648 8893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_34320 9761 9591 gene locus_tag LOCUS_34330 9761 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 10029 10496 gene locus_tag LOCUS_34340 10029 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 10507 11268 gene locus_tag LOCUS_34350 10507 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence151 65 268 gene locus_tag LOCUS_34360 65 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3156 334 gene locus_tag LOCUS_34370 3156 334 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_34370 5014 3536 gene locus_tag LOCUS_34380 5014 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 5470 5036 gene locus_tag LOCUS_34390 5470 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 5865 7202 gene locus_tag LOCUS_34400 5865 7202 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226784.1 protein_id gnl|my_center|LOCUS_34400 7374 8438 gene locus_tag LOCUS_34410 7374 8438 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_34410 8445 9401 gene locus_tag LOCUS_34420 8445 9401 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_34420 9398 10381 gene locus_tag LOCUS_34430 9398 10381 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_34430 10384 10836 gene locus_tag LOCUS_34440 10384 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 11359 10895 gene locus_tag LOCUS_34450 11359 10895 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226777.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence152 530 1486 gene locus_tag LOCUS_34460 530 1486 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_34460 1483 2304 gene locus_tag LOCUS_34470 1483 2304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_34470 2301 3125 gene locus_tag LOCUS_34480 2301 3125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_34480 3140 4006 gene locus_tag LOCUS_34490 3140 4006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_34490 4077 5234 gene locus_tag LOCUS_34500 4077 5234 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_34500 7007 5244 gene locus_tag LOCUS_34510 7007 5244 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_34510 8207 7032 gene locus_tag LOCUS_34520 8207 7032 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441295.1 protein_id gnl|my_center|LOCUS_34520 8378 9280 gene locus_tag LOCUS_34530 8378 9280 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_34530 9543 10922 gene locus_tag LOCUS_34540 9543 10922 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_34540 11252 10974 gene locus_tag LOCUS_34550 11252 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 >Feature sequence153 241 1038 gene locus_tag LOCUS_34560 gene lipA 241 1038 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_34560 1496 1017 gene locus_tag LOCUS_34570 1496 1017 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_34570 3071 1692 gene locus_tag LOCUS_34580 3071 1692 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_34580 3229 4260 gene locus_tag LOCUS_34590 3229 4260 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973469.1 protein_id gnl|my_center|LOCUS_34590 4273 5226 gene locus_tag LOCUS_34600 4273 5226 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079494.1 protein_id gnl|my_center|LOCUS_34600 5261 5431 gene locus_tag LOCUS_34610 5261 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 5425 6906 gene locus_tag LOCUS_34620 5425 6906 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182573247.1 protein_id gnl|my_center|LOCUS_34620 7733 6840 gene locus_tag LOCUS_34630 7733 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 8383 8511 gene locus_tag LOCUS_34640 8383 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 8662 9306 gene locus_tag LOCUS_34650 8662 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34650 9888 9361 gene locus_tag LOCUS_34660 9888 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 10267 10581 gene locus_tag LOCUS_34670 10267 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 10631 10900 gene locus_tag LOCUS_34680 10631 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 10963 11229 gene locus_tag LOCUS_34690 10963 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence154 2484 1420 gene locus_tag LOCUS_34700 2484 1420 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397979.1 protein_id gnl|my_center|LOCUS_34700 3356 2481 gene locus_tag LOCUS_34710 3356 2481 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 protein_id gnl|my_center|LOCUS_34710 3622 3413 gene locus_tag LOCUS_34720 3622 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 4901 3642 gene locus_tag LOCUS_34730 4901 3642 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067077.1 protein_id gnl|my_center|LOCUS_34730 5619 4927 gene locus_tag LOCUS_34740 5619 4927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528528.1 protein_id gnl|my_center|LOCUS_34740 6427 5612 gene locus_tag LOCUS_34750 6427 5612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_34750 8394 6538 gene locus_tag LOCUS_34760 8394 6538 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_34760 9233 8481 gene locus_tag LOCUS_34770 9233 8481 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_34770 9528 11219 gene locus_tag LOCUS_34780 9528 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence155 422 553 gene locus_tag LOCUS_34790 422 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 898 662 gene locus_tag LOCUS_34800 898 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 872 1423 gene locus_tag LOCUS_34810 872 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 2516 2121 gene locus_tag LOCUS_34820 2516 2121 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400656.1 protein_id gnl|my_center|LOCUS_34820 2820 3110 gene locus_tag LOCUS_34830 2820 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3282 3686 gene locus_tag LOCUS_34840 3282 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3806 3979 gene locus_tag LOCUS_34850 3806 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 5458 6426 gene locus_tag LOCUS_34860 5458 6426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036010.1 protein_id gnl|my_center|LOCUS_34860 6461 7624 gene locus_tag LOCUS_34870 6461 7624 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878153.1 protein_id gnl|my_center|LOCUS_34870 7652 8044 gene locus_tag LOCUS_34880 7652 8044 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_34880 8049 9275 gene locus_tag LOCUS_34890 8049 9275 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_34890 9272 9478 gene locus_tag LOCUS_34900 9272 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 9514 10329 gene locus_tag LOCUS_34910 9514 10329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105360.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence156 555 226 gene locus_tag LOCUS_34920 gene mazF7 555 226 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410654.1 protein_id gnl|my_center|LOCUS_34920 814 578 gene locus_tag LOCUS_34930 814 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 2400 868 gene locus_tag LOCUS_34940 2400 868 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224181.1 protein_id gnl|my_center|LOCUS_34940 7118 2448 gene locus_tag LOCUS_34950 gene gltB 7118 2448 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224180.1 protein_id gnl|my_center|LOCUS_34950 7355 8152 gene locus_tag LOCUS_34960 7355 8152 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_34960 8152 9219 gene locus_tag LOCUS_34970 8152 9219 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 protein_id gnl|my_center|LOCUS_34970 10132 9194 gene locus_tag LOCUS_34980 10132 9194 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191091.1 protein_id gnl|my_center|LOCUS_34980 <11049 10281 gene locus_tag LOCUS_34990 <11049 10281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001310055.1:RNA-guided endonuclease TnpB family protein >Feature sequence157 144 413 gene locus_tag LOCUS_35000 144 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 628 443 gene locus_tag LOCUS_35010 628 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 690 1367 gene locus_tag LOCUS_35020 690 1367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_35020 1681 2046 gene locus_tag LOCUS_35030 1681 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 2916 2083 gene locus_tag LOCUS_35040 2916 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3494 2970 gene locus_tag LOCUS_35050 3494 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 6305 3525 gene locus_tag LOCUS_35060 6305 3525 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950528.1 protein_id gnl|my_center|LOCUS_35060 7134 6697 gene locus_tag LOCUS_35070 7134 6697 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_35070 7393 7145 gene locus_tag LOCUS_35080 7393 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8789 8352 gene locus_tag LOCUS_35090 8789 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 10469 8937 gene locus_tag LOCUS_35100 10469 8937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_35100 10795 10466 gene locus_tag LOCUS_35110 10795 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence158 658 335 gene locus_tag LOCUS_35120 658 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 2210 660 gene locus_tag LOCUS_35130 gene lnt 2210 660 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 protein_id gnl|my_center|LOCUS_35130 3987 2368 gene locus_tag LOCUS_35140 3987 2368 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226567.1 protein_id gnl|my_center|LOCUS_35140 4146 5537 gene locus_tag LOCUS_35150 4146 5537 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_35150 6925 5615 gene locus_tag LOCUS_35160 6925 5615 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_35160 7240 8304 gene locus_tag LOCUS_35170 7240 8304 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_35170 8833 8381 gene locus_tag LOCUS_35180 8833 8381 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_35180 9984 8833 gene locus_tag LOCUS_35190 9984 8833 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence159 382 1137 gene locus_tag LOCUS_35200 382 1137 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_35200 2123 1260 gene locus_tag LOCUS_35210 2123 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 2313 2651 gene locus_tag LOCUS_35220 2313 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4288 2687 gene locus_tag LOCUS_35230 4288 2687 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530057.1 protein_id gnl|my_center|LOCUS_35230 4774 4325 gene locus_tag LOCUS_35240 4774 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 6182 4767 gene locus_tag LOCUS_35250 6182 4767 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_35250 7041 6226 gene locus_tag LOCUS_35260 7041 6226 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_35260 7994 7029 gene locus_tag LOCUS_35270 7994 7029 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_35270 9535 8138 gene locus_tag LOCUS_35280 9535 8138 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_35280 9534 9785 gene locus_tag LOCUS_35290 9534 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 9933 10535 gene locus_tag LOCUS_35300 9933 10535 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence160 289 1101 gene locus_tag LOCUS_35310 289 1101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_35310 1115 1636 gene locus_tag LOCUS_35320 1115 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1895 2407 gene locus_tag LOCUS_35330 1895 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 2404 2643 gene locus_tag LOCUS_35340 2404 2643 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 protein_id gnl|my_center|LOCUS_35340 2644 3156 gene locus_tag LOCUS_35350 gene rimM 2644 3156 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_35350 3156 3917 gene locus_tag LOCUS_35360 gene trmD 3156 3917 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_35360 4062 4421 gene locus_tag LOCUS_35370 gene rplS 4062 4421 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_35370 4449 5264 gene locus_tag LOCUS_35380 gene lepB 4449 5264 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227333.1 protein_id gnl|my_center|LOCUS_35380 5348 6112 gene locus_tag LOCUS_35390 gene lepB 5348 6112 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227333.1 protein_id gnl|my_center|LOCUS_35390 6112 6933 gene locus_tag LOCUS_35400 6112 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 6930 7253 gene locus_tag LOCUS_35410 6930 7253 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_35410 7473 7832 gene locus_tag LOCUS_35420 7473 7832 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_35420 7832 9343 gene locus_tag LOCUS_35430 7832 9343 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223857.1 protein_id gnl|my_center|LOCUS_35430 9414 10568 gene locus_tag LOCUS_35440 gene dprA 9414 10568 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742183.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence161 940 146 gene locus_tag LOCUS_35450 940 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 2564 1200 gene locus_tag LOCUS_35460 2564 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081911195.1 protein_id gnl|my_center|LOCUS_35460 3178 2861 gene locus_tag LOCUS_35470 3178 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 5677 3260 gene locus_tag LOCUS_35480 gene pcrA 5677 3260 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 protein_id gnl|my_center|LOCUS_35480 5912 6199 gene locus_tag LOCUS_35490 5912 6199 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222709.1 protein_id gnl|my_center|LOCUS_35490 6419 6673 gene locus_tag LOCUS_35500 6419 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 7350 6670 gene locus_tag LOCUS_35510 7350 6670 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_35510 7922 9673 gene locus_tag LOCUS_35520 7922 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222713.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence162 192 1526 gene locus_tag LOCUS_35530 192 1526 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223144.1 protein_id gnl|my_center|LOCUS_35530 1678 2652 gene locus_tag LOCUS_35540 1678 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223143.1 protein_id gnl|my_center|LOCUS_35540 3041 2850 gene locus_tag LOCUS_35550 3041 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3394 3068 gene locus_tag LOCUS_35560 3394 3068 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098383.1 protein_id gnl|my_center|LOCUS_35560 3783 3544 gene locus_tag LOCUS_35570 3783 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 5987 3906 gene locus_tag LOCUS_35580 5987 3906 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_35580 6107 6823 gene locus_tag LOCUS_35590 6107 6823 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_35590 7401 6919 gene locus_tag LOCUS_35600 7401 6919 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223134.1 protein_id gnl|my_center|LOCUS_35600 7640 9064 gene locus_tag LOCUS_35610 gene glnA 7640 9064 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_35610 9188 9958 gene locus_tag LOCUS_35620 9188 9958 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064562.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence163 1590 136 gene locus_tag LOCUS_35630 gene argH 1590 136 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_35630 3020 1590 gene locus_tag LOCUS_35640 gene argG 3020 1590 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_35640 3547 3017 gene locus_tag LOCUS_35650 3547 3017 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_35650 4467 3544 gene locus_tag LOCUS_35660 gene argF 4467 3544 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227834.1 protein_id gnl|my_center|LOCUS_35660 5767 4469 gene locus_tag LOCUS_35670 5767 4469 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_35670 6680 5760 gene locus_tag LOCUS_35680 gene argB 6680 5760 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_35680 7948 6677 gene locus_tag LOCUS_35690 gene argJ 7948 6677 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_35690 8988 7945 gene locus_tag LOCUS_35700 gene argC 8988 7945 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_35700 9456 9064 gene locus_tag LOCUS_35710 9456 9064 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_35710 9707 9453 gene locus_tag LOCUS_35720 9707 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 10315 9785 gene locus_tag LOCUS_35730 10315 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227840.1 protein_id gnl|my_center|LOCUS_35730 10564 10385 gene locus_tag LOCUS_35740 10564 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence164 1826 372 gene locus_tag LOCUS_35750 1826 372 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_35750 2625 1939 gene locus_tag LOCUS_35760 gene mftE 2625 1939 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403497.1 protein_id gnl|my_center|LOCUS_35760 4025 2622 gene locus_tag LOCUS_35770 gene mftF 4025 2622 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_35770 4810 4022 gene locus_tag LOCUS_35780 4810 4022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_35780 5983 4811 gene locus_tag LOCUS_35790 gene mftD 5983 4811 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_35790 7185 6004 gene locus_tag LOCUS_35800 gene mftC 7185 6004 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_35800 7508 7182 gene locus_tag LOCUS_35810 gene mftB 7508 7182 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 protein_id gnl|my_center|LOCUS_35810 7674 8294 gene locus_tag LOCUS_35820 gene mftR 7674 8294 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 protein_id gnl|my_center|LOCUS_35820 8291 8524 gene locus_tag LOCUS_35830 8291 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 8711 8550 gene locus_tag LOCUS_35840 8711 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 8710 8946 gene locus_tag LOCUS_35850 8710 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 9390 9076 gene locus_tag LOCUS_35860 9390 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 9425 9700 gene locus_tag LOCUS_35870 9425 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 9942 10157 gene locus_tag LOCUS_35880 9942 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence165 365 1903 gene locus_tag LOCUS_35890 365 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 1970 2341 gene locus_tag LOCUS_tm00010 1970 2341 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2958 2434 gene locus_tag LOCUS_35900 2958 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 3281 2940 gene locus_tag LOCUS_35910 3281 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3799 3197 gene locus_tag LOCUS_35920 3799 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 4001 4183 gene locus_tag LOCUS_35930 4001 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4826 4197 gene locus_tag LOCUS_35940 4826 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 6418 4823 gene locus_tag LOCUS_35950 6418 4823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_35950 6705 6418 gene locus_tag LOCUS_35960 6705 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 7014 6829 gene locus_tag LOCUS_35970 7014 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 7885 6971 gene locus_tag LOCUS_35980 7885 6971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_35980 8190 9122 gene locus_tag LOCUS_35990 8190 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 9158 9421 gene locus_tag LOCUS_36000 9158 9421 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 protein_id gnl|my_center|LOCUS_36000 9451 9783 gene locus_tag LOCUS_36010 9451 9783 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence166 <1 2392 gene locus_tag LOCUS_36020 <1 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230993.1:transglycosylase domain-containing protein 2440 4194 gene locus_tag LOCUS_36030 2440 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 5008 4220 gene locus_tag LOCUS_36040 5008 4220 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_36040 5411 5229 gene locus_tag LOCUS_36050 5411 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5374 6213 gene locus_tag LOCUS_36060 5374 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 6378 7223 gene locus_tag LOCUS_36070 6378 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231000.1 protein_id gnl|my_center|LOCUS_36070 7323 8240 gene locus_tag LOCUS_36080 7323 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231001.1 protein_id gnl|my_center|LOCUS_36080 8363 8680 gene locus_tag LOCUS_36090 gene rpsF 8363 8680 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742059.1 protein_id gnl|my_center|LOCUS_36090 8692 9189 gene locus_tag LOCUS_36100 8692 9189 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_36100 9244 9492 gene locus_tag LOCUS_36110 gene rpsR 9244 9492 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098744.1 protein_id gnl|my_center|LOCUS_36110 9521 9979 gene locus_tag LOCUS_36120 gene rplI 9521 9979 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231004.1 protein_id gnl|my_center|LOCUS_36120 10344 10114 gene locus_tag LOCUS_36130 10344 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 >Feature sequence167 69 278 gene locus_tag LOCUS_36140 69 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 414 929 gene locus_tag LOCUS_36150 414 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 1530 1087 gene locus_tag LOCUS_36160 1530 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 2245 1535 gene locus_tag LOCUS_36170 2245 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4073 2394 gene locus_tag LOCUS_36180 4073 2394 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_36180 6130 4070 gene locus_tag LOCUS_36190 6130 4070 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_36190 7677 6127 gene locus_tag LOCUS_36200 7677 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 9006 7744 gene locus_tag LOCUS_36210 9006 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 9466 10263 gene locus_tag LOCUS_36220 9466 10263 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence168 <1 1513 gene locus_tag LOCUS_36230 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230432.1:type IV secretory system conjugative DNA transfer family protein 1510 2109 gene locus_tag LOCUS_36240 1510 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 2106 2513 gene locus_tag LOCUS_36250 2106 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 2510 2938 gene locus_tag LOCUS_36260 2510 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2935 3594 gene locus_tag LOCUS_36270 2935 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 3591 4448 gene locus_tag LOCUS_36280 3591 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 4445 4681 gene locus_tag LOCUS_36290 4445 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 4681 9114 gene locus_tag LOCUS_36300 4681 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 9587 9129 gene locus_tag LOCUS_36310 9587 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence169 <1 615 gene locus_tag LOCUS_36320 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230053.1:DUF2064 domain-containing protein 1006 590 gene locus_tag LOCUS_36330 1006 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1467 955 gene locus_tag LOCUS_36340 1467 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2438 1611 gene locus_tag LOCUS_36350 2438 1611 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_36350 2989 2435 gene locus_tag LOCUS_36360 2989 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 3706 3134 gene locus_tag LOCUS_36370 3706 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 5274 3871 gene locus_tag LOCUS_36380 5274 3871 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230057.1 protein_id gnl|my_center|LOCUS_36380 6787 5411 gene locus_tag LOCUS_36390 6787 5411 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_36390 7483 6788 gene locus_tag LOCUS_36400 7483 6788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_36400 7622 9097 gene locus_tag LOCUS_36410 7622 9097 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_36410 9760 9149 gene locus_tag LOCUS_36420 9760 9149 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_36420 <10437 9798 gene locus_tag LOCUS_36430 <10437 9798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230063.1:response regulator transcription factor >Feature sequence170 466 164 gene locus_tag LOCUS_36440 466 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36440 933 1322 gene locus_tag LOCUS_36450 933 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1315 1806 gene locus_tag LOCUS_36460 1315 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2228 1944 gene locus_tag LOCUS_36470 2228 1944 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_36470 2524 2228 gene locus_tag LOCUS_36480 2524 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3562 3323 gene locus_tag LOCUS_36490 3562 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3789 4007 gene locus_tag LOCUS_36500 3789 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 5028 4063 gene locus_tag LOCUS_36510 5028 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 5073 5270 gene locus_tag LOCUS_36520 5073 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 5945 5514 gene locus_tag LOCUS_36530 5945 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 <10409 5945 gene locus_tag LOCUS_36540 <10409 5945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein >Feature sequence171 93 449 gene locus_tag LOCUS_36550 93 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 546 965 gene locus_tag LOCUS_36560 546 965 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098517.1 protein_id gnl|my_center|LOCUS_36560 1099 2460 gene locus_tag LOCUS_36570 1099 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3207 2521 gene locus_tag LOCUS_36580 3207 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 3335 3583 gene locus_tag LOCUS_36590 3335 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 3690 5384 gene locus_tag LOCUS_36600 3690 5384 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_36600 5835 5479 gene locus_tag LOCUS_36610 gene frdD 5835 5479 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_36610 6224 5832 gene locus_tag LOCUS_36620 6224 5832 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916859.1 protein_id gnl|my_center|LOCUS_36620 7009 6221 gene locus_tag LOCUS_36630 gene sdhB 7009 6221 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407767.1 protein_id gnl|my_center|LOCUS_36630 8769 7015 gene locus_tag LOCUS_36640 gene frdA 8769 7015 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_36640 9005 8772 gene locus_tag LOCUS_36650 9005 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 9149 9604 gene locus_tag LOCUS_36660 9149 9604 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803757.1 protein_id gnl|my_center|LOCUS_36660 9750 10034 gene locus_tag LOCUS_36670 9750 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 10099 10380 gene locus_tag LOCUS_36680 10099 10380 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence172 1931 1173 gene locus_tag LOCUS_36690 1931 1173 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_36690 1946 3391 gene locus_tag LOCUS_36700 1946 3391 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_36700 3388 3888 gene locus_tag LOCUS_36710 3388 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_36710 3990 5618 gene locus_tag LOCUS_36720 gene pruA 3990 5618 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_36720 6483 5713 gene locus_tag LOCUS_36730 6483 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229717.1 protein_id gnl|my_center|LOCUS_36730 7360 6689 gene locus_tag LOCUS_36740 7360 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229717.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36740 8719 7712 gene locus_tag LOCUS_36750 gene rsgA 8719 7712 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 protein_id gnl|my_center|LOCUS_36750 8808 9596 gene locus_tag LOCUS_36760 8808 9596 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_36760 9593 10204 gene locus_tag LOCUS_36770 9593 10204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence173 684 37 gene locus_tag LOCUS_36780 684 37 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_36780 914 2065 gene locus_tag LOCUS_36790 914 2065 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_36790 2097 3239 gene locus_tag LOCUS_36800 2097 3239 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_36800 3383 3550 gene locus_tag LOCUS_36810 3383 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3993 4481 gene locus_tag LOCUS_36820 3993 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224355.1 protein_id gnl|my_center|LOCUS_36820 4619 5500 gene locus_tag LOCUS_36830 4619 5500 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_36830 5579 6064 gene locus_tag LOCUS_36840 5579 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742169.1 protein_id gnl|my_center|LOCUS_36840 6102 6455 gene locus_tag LOCUS_36850 6102 6455 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_36850 >Feature sequence174 1406 2152 gene locus_tag LOCUS_36860 1406 2152 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_36860 2178 3527 gene locus_tag LOCUS_36870 2178 3527 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_36870 3605 3681 gene locus_tag LOCUS_t00300 3605 3681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3944 4441 gene locus_tag LOCUS_36880 3944 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 4743 4453 gene locus_tag LOCUS_36890 4743 4453 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_36890 5529 4762 gene locus_tag LOCUS_36900 5529 4762 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_36900 6510 5587 gene locus_tag LOCUS_36910 6510 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 6410 6775 gene locus_tag LOCUS_36920 6410 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 6787 7884 gene locus_tag LOCUS_36930 6787 7884 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_36930 8321 8001 gene locus_tag LOCUS_36940 8321 8001 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_36940 9304 8327 gene locus_tag LOCUS_36950 9304 8327 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_36950 <10220 9382 gene locus_tag LOCUS_36960 <10220 9382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968790.1:chromate transporter >Feature sequence175 186 413 gene locus_tag LOCUS_36970 186 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 410 952 gene locus_tag LOCUS_36980 410 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605869.1 protein_id gnl|my_center|LOCUS_36980 983 2332 gene locus_tag LOCUS_36990 983 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3296 2337 gene locus_tag LOCUS_37000 3296 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37000 5519 3486 gene locus_tag LOCUS_37010 5519 3486 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226130.1 protein_id gnl|my_center|LOCUS_37010 6822 5527 gene locus_tag LOCUS_37020 6822 5527 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 protein_id gnl|my_center|LOCUS_37020 7353 6970 gene locus_tag LOCUS_37030 7353 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 7452 8039 gene locus_tag LOCUS_37040 7452 8039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229903.1 protein_id gnl|my_center|LOCUS_37040 8143 9012 gene locus_tag LOCUS_37050 8143 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 9233 9607 gene locus_tag LOCUS_37060 9233 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37060 9553 9948 gene locus_tag LOCUS_37070 9553 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence176 1419 214 gene locus_tag LOCUS_37080 1419 214 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224451.1 protein_id gnl|my_center|LOCUS_37080 1649 3388 gene locus_tag LOCUS_37090 1649 3388 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 protein_id gnl|my_center|LOCUS_37090 3655 3476 gene locus_tag LOCUS_37100 3655 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224457.1 protein_id gnl|my_center|LOCUS_37100 3951 4769 gene locus_tag LOCUS_37110 3951 4769 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224458.1 protein_id gnl|my_center|LOCUS_37110 6950 4881 gene locus_tag LOCUS_37120 6950 4881 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094234.1 protein_id gnl|my_center|LOCUS_37120 7127 8497 gene locus_tag LOCUS_37130 7127 8497 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_37130 8502 9731 gene locus_tag LOCUS_37140 8502 9731 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence177 1008 118 gene locus_tag LOCUS_37150 1008 118 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_37150 1658 1005 gene locus_tag LOCUS_37160 1658 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 2540 1668 gene locus_tag LOCUS_37170 gene purU 2540 1668 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229305.1 protein_id gnl|my_center|LOCUS_37170 3907 2534 gene locus_tag LOCUS_37180 3907 2534 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_37180 4509 3904 gene locus_tag LOCUS_37190 4509 3904 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229306.1 protein_id gnl|my_center|LOCUS_37190 7366 4499 gene locus_tag LOCUS_37200 7366 4499 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_37200 6116 6025 gene locus_tag LOCUS_t00310 6116 6025 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7650 7363 gene locus_tag LOCUS_37210 7650 7363 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_37210 8890 7667 gene locus_tag LOCUS_37220 8890 7667 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_37220 8997 9671 gene locus_tag LOCUS_37230 8997 9671 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence178 8 271 gene locus_tag LOCUS_37240 8 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 228 575 gene locus_tag LOCUS_37250 228 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 572 1417 gene locus_tag LOCUS_37260 572 1417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_37260 2608 2141 gene locus_tag LOCUS_37270 2608 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37270 2845 2657 gene locus_tag LOCUS_37280 2845 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3873 2866 gene locus_tag LOCUS_37290 3873 2866 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_37290 5169 3925 gene locus_tag LOCUS_37300 5169 3925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 protein_id gnl|my_center|LOCUS_37300 6002 5166 gene locus_tag LOCUS_37310 6002 5166 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 protein_id gnl|my_center|LOCUS_37310 7197 6121 gene locus_tag LOCUS_37320 7197 6121 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530723.1 protein_id gnl|my_center|LOCUS_37320 7341 8384 gene locus_tag LOCUS_37330 7341 8384 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226377.1 protein_id gnl|my_center|LOCUS_37330 8381 9928 gene locus_tag LOCUS_37340 8381 9928 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence179 1095 433 gene locus_tag LOCUS_37350 1095 433 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095827.1 protein_id gnl|my_center|LOCUS_37350 1200 1649 gene locus_tag LOCUS_37360 1200 1649 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175557.1 protein_id gnl|my_center|LOCUS_37360 1784 2944 gene locus_tag LOCUS_37370 gene menE 1784 2944 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_37370 2992 3864 gene locus_tag LOCUS_37380 2992 3864 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_37380 5034 3949 gene locus_tag LOCUS_37390 5034 3949 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_37390 5327 5031 gene locus_tag LOCUS_37400 5327 5031 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222438.1 protein_id gnl|my_center|LOCUS_37400 5623 5838 gene locus_tag LOCUS_37410 5623 5838 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_37410 5943 6128 gene locus_tag LOCUS_37420 5943 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222436.1 protein_id gnl|my_center|LOCUS_37420 7424 6135 gene locus_tag LOCUS_37430 7424 6135 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222435.1 protein_id gnl|my_center|LOCUS_37430 8576 7605 gene locus_tag LOCUS_37440 gene ccsB 8576 7605 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_37440 <9986 8576 gene locus_tag LOCUS_37450 <9986 8576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222433.1:cytochrome c biogenesis protein ResB >Feature sequence180 237 1091 gene locus_tag LOCUS_37460 237 1091 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224747.1 protein_id gnl|my_center|LOCUS_37460 1108 1731 gene locus_tag LOCUS_37470 1108 1731 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228711.1 protein_id gnl|my_center|LOCUS_37470 2116 1790 gene locus_tag LOCUS_37480 2116 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2736 4583 gene locus_tag LOCUS_37490 2736 4583 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222257.1 protein_id gnl|my_center|LOCUS_37490 4783 5091 gene locus_tag LOCUS_37500 4783 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 5248 5475 gene locus_tag LOCUS_37510 5248 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 6501 5539 gene locus_tag LOCUS_37520 6501 5539 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 protein_id gnl|my_center|LOCUS_37520 6574 7056 gene locus_tag LOCUS_37530 6574 7056 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_37530 7061 7540 gene locus_tag LOCUS_37540 7061 7540 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420508.1 protein_id gnl|my_center|LOCUS_37540 7566 7829 gene locus_tag LOCUS_37550 7566 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 7884 7972 gene locus_tag LOCUS_t00320 7884 7972 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8738 8058 gene locus_tag LOCUS_37560 8738 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 9312 8944 gene locus_tag LOCUS_37570 9312 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence181 55 612 gene locus_tag LOCUS_37580 55 612 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_37580 609 1436 gene locus_tag LOCUS_37590 gene map 609 1436 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_37590 1631 2539 gene locus_tag LOCUS_37600 1631 2539 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_37600 2768 2989 gene locus_tag LOCUS_37610 gene infA 2768 2989 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_37610 3382 3756 gene locus_tag LOCUS_37620 gene rpsM 3382 3756 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285908.1 protein_id gnl|my_center|LOCUS_37620 3959 4360 gene locus_tag LOCUS_37630 gene rpsK 3959 4360 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_37630 4385 4990 gene locus_tag LOCUS_37640 gene rpsD 4385 4990 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_37640 5141 6214 gene locus_tag LOCUS_37650 5141 6214 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558887.1 protein_id gnl|my_center|LOCUS_37650 6214 6984 gene locus_tag LOCUS_37660 6214 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 7113 7877 gene locus_tag LOCUS_37670 gene truA 7113 7877 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086862314.1 protein_id gnl|my_center|LOCUS_37670 8306 7965 gene locus_tag LOCUS_37680 8306 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 8202 8990 gene locus_tag LOCUS_37690 8202 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228047.1 protein_id gnl|my_center|LOCUS_37690 9800 9078 gene locus_tag LOCUS_37700 9800 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222627.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence182 1215 19 gene locus_tag LOCUS_37710 gene fahA 1215 19 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113316.1 protein_id gnl|my_center|LOCUS_37710 2108 1212 gene locus_tag LOCUS_37720 2108 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_37720 3751 2105 gene locus_tag LOCUS_37730 3751 2105 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_37730 4744 3782 gene locus_tag LOCUS_37740 4744 3782 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_37740 4875 5414 gene locus_tag LOCUS_37750 4875 5414 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227078.1 protein_id gnl|my_center|LOCUS_37750 5620 5411 gene locus_tag LOCUS_37760 5620 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 5796 6485 gene locus_tag LOCUS_37770 5796 6485 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_37770 6760 7491 gene locus_tag LOCUS_37780 6760 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37780 7561 7983 gene locus_tag LOCUS_37790 7561 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37790 8934 8155 gene locus_tag LOCUS_37800 8934 8155 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_37800 9317 8934 gene locus_tag LOCUS_37810 9317 8934 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_37810 9491 9715 gene locus_tag LOCUS_37820 9491 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence183 862 239 gene locus_tag LOCUS_37830 862 239 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 protein_id gnl|my_center|LOCUS_37830 904 2628 gene locus_tag LOCUS_37840 904 2628 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081996.1 protein_id gnl|my_center|LOCUS_37840 2887 4131 gene locus_tag LOCUS_37850 2887 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4471 4205 gene locus_tag LOCUS_37860 4471 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 5287 7539 gene locus_tag LOCUS_37870 5287 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 8373 8558 gene locus_tag LOCUS_37880 8373 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 8524 8841 gene locus_tag LOCUS_37890 8524 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 8880 9509 gene locus_tag LOCUS_37900 8880 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 >Feature sequence184 <1 795 gene locus_tag LOCUS_37910 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391918.1:IclR family transcriptional regulator 2187 817 gene locus_tag LOCUS_37920 2187 817 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_37920 3072 2230 gene locus_tag LOCUS_37930 3072 2230 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_37930 4454 3069 gene locus_tag LOCUS_37940 gene accC 4454 3069 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_37940 5925 4456 gene locus_tag LOCUS_37950 5925 4456 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_37950 6452 5925 gene locus_tag LOCUS_37960 gene accB 6452 5925 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259570.1 protein_id gnl|my_center|LOCUS_37960 7330 6602 gene locus_tag LOCUS_37970 7330 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 7923 7747 gene locus_tag LOCUS_37980 7923 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 7978 8475 gene locus_tag LOCUS_37990 7978 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 9273 8479 gene locus_tag LOCUS_38000 9273 8479 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence185 262 1428 gene locus_tag LOCUS_38010 262 1428 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_38010 1468 2613 gene locus_tag LOCUS_38020 1468 2613 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_38020 2693 2950 gene locus_tag LOCUS_38030 2693 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4569 3196 gene locus_tag LOCUS_38040 4569 3196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 protein_id gnl|my_center|LOCUS_38040 5860 4589 gene locus_tag LOCUS_38050 5860 4589 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_38050 5904 8858 gene locus_tag LOCUS_38060 5904 8858 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_38060 8862 9653 gene locus_tag LOCUS_38070 8862 9653 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_38070 >Feature sequence186 <1 1396 gene locus_tag LOCUS_38080 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114561.1:acyl-CoA dehydrogenase 2408 1473 gene locus_tag LOCUS_38090 2408 1473 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_38090 2508 2693 gene locus_tag LOCUS_38100 2508 2693 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_38100 3401 2775 gene locus_tag LOCUS_38110 3401 2775 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_38110 3543 4610 gene locus_tag LOCUS_38120 3543 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4782 4576 gene locus_tag LOCUS_38130 4782 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 5119 8082 gene locus_tag LOCUS_38140 5119 8082 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence187 622 155 gene locus_tag LOCUS_38150 622 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2338 665 gene locus_tag LOCUS_38160 2338 665 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084295.1 protein_id gnl|my_center|LOCUS_38160 2516 3541 gene locus_tag LOCUS_38170 2516 3541 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 protein_id gnl|my_center|LOCUS_38170 3543 4382 gene locus_tag LOCUS_38180 3543 4382 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_38180 4431 5096 gene locus_tag LOCUS_38190 4431 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 5779 5060 gene locus_tag LOCUS_38200 5779 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 5871 6737 gene locus_tag LOCUS_38210 5871 6737 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_38210 6943 6632 gene locus_tag LOCUS_38220 6943 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 7270 7007 gene locus_tag LOCUS_38230 7270 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 7280 9316 gene locus_tag LOCUS_38240 7280 9316 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113050.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence188 886 170 gene locus_tag LOCUS_38250 886 170 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_38250 1661 897 gene locus_tag LOCUS_38260 1661 897 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_38260 3025 1661 gene locus_tag LOCUS_38270 3025 1661 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_38270 3759 3022 gene locus_tag LOCUS_38280 3759 3022 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_38280 5203 3830 gene locus_tag LOCUS_38290 5203 3830 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_38290 5423 6871 gene locus_tag LOCUS_38300 gene eat 5423 6871 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_38300 7843 6941 gene locus_tag LOCUS_38310 gene rfbD 7843 6941 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_38310 8838 7840 gene locus_tag LOCUS_38320 gene rfbB 8838 7840 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence189 151 564 gene locus_tag LOCUS_38330 151 564 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223132.1 protein_id gnl|my_center|LOCUS_38330 1801 542 gene locus_tag LOCUS_38340 1801 542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_38340 2086 1841 gene locus_tag LOCUS_38350 2086 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2429 3148 gene locus_tag LOCUS_38360 2429 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3224 4297 gene locus_tag LOCUS_38370 3224 4297 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224380.1 protein_id gnl|my_center|LOCUS_38370 4303 5457 gene locus_tag LOCUS_38380 4303 5457 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466834.1 protein_id gnl|my_center|LOCUS_38380 5454 6413 gene locus_tag LOCUS_38390 5454 6413 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_38390 6410 6838 gene locus_tag LOCUS_38400 6410 6838 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_38400 6835 8013 gene locus_tag LOCUS_38410 6835 8013 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence190 618 785 gene locus_tag LOCUS_38420 618 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 805 1221 gene locus_tag LOCUS_38430 805 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 1758 1414 gene locus_tag LOCUS_38440 gene pemK 1758 1414 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416110.1 protein_id gnl|my_center|LOCUS_38440 1981 1748 gene locus_tag LOCUS_38450 1981 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 2534 2079 gene locus_tag LOCUS_38460 2534 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 3457 2531 gene locus_tag LOCUS_38470 3457 2531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_38470 4296 3460 gene locus_tag LOCUS_38480 4296 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 4826 4524 gene locus_tag LOCUS_38490 4826 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 4922 5170 gene locus_tag LOCUS_38500 4922 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 5130 5318 gene locus_tag LOCUS_38510 5130 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 5384 5809 gene locus_tag LOCUS_38520 5384 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5828 6367 gene locus_tag LOCUS_38530 5828 6367 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_38530 6473 7585 gene locus_tag LOCUS_38540 gene prfB 6473 7585 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748464.1 protein_id gnl|my_center|LOCUS_38540 7638 8327 gene locus_tag LOCUS_38550 gene ftsE 7638 8327 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence191 1741 557 gene locus_tag LOCUS_38560 1741 557 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_38560 1886 2497 gene locus_tag LOCUS_38570 1886 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 3276 2521 gene locus_tag LOCUS_38580 3276 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3686 4570 gene locus_tag LOCUS_38590 3686 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 5021 4644 gene locus_tag LOCUS_38600 5021 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 5867 5190 gene locus_tag LOCUS_38610 5867 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 5787 6176 gene locus_tag LOCUS_38620 5787 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 6341 6964 gene locus_tag LOCUS_38630 6341 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38630 7203 7397 gene locus_tag LOCUS_38640 7203 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38640 7394 8395 gene locus_tag LOCUS_38650 gene ligD 7394 8395 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225998.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence192 608 1402 gene locus_tag LOCUS_38660 608 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 1377 1844 gene locus_tag LOCUS_38670 1377 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2857 1922 gene locus_tag LOCUS_38680 2857 1922 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222345.1 protein_id gnl|my_center|LOCUS_38680 3014 3589 gene locus_tag LOCUS_38690 3014 3589 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_38690 3759 5819 gene locus_tag LOCUS_38700 3759 5819 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_38700 6992 5901 gene locus_tag LOCUS_38710 6992 5901 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_38710 7640 7050 gene locus_tag LOCUS_38720 7640 7050 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230991.1 protein_id gnl|my_center|LOCUS_38720 7825 8244 gene locus_tag LOCUS_38730 7825 8244 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_38730 >Feature sequence193 1065 2114 gene locus_tag LOCUS_38740 1065 2114 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_38740 2334 3491 gene locus_tag LOCUS_38750 2334 3491 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_38750 3539 4819 gene locus_tag LOCUS_38760 3539 4819 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_38760 4869 5591 gene locus_tag LOCUS_38770 gene bioD 4869 5591 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_38770 5676 6713 gene locus_tag LOCUS_38780 gene bioB 5676 6713 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307266.1 protein_id gnl|my_center|LOCUS_38780 6983 7519 gene locus_tag LOCUS_38790 6983 7519 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224098.1 protein_id gnl|my_center|LOCUS_38790 7595 8656 gene locus_tag LOCUS_38800 7595 8656 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224099.1 protein_id gnl|my_center|LOCUS_38800 >Feature sequence194 396 1544 gene locus_tag LOCUS_38810 396 1544 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_38810 1633 4602 gene locus_tag LOCUS_38820 1633 4602 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_38820 5280 4681 gene locus_tag LOCUS_38830 5280 4681 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226962.1 protein_id gnl|my_center|LOCUS_38830 6127 5261 gene locus_tag LOCUS_38840 6127 5261 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226961.1 protein_id gnl|my_center|LOCUS_38840 6717 6199 gene locus_tag LOCUS_38850 6717 6199 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_38850 8270 6714 gene locus_tag LOCUS_38860 8270 6714 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229782.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence195 300 2534 gene locus_tag LOCUS_38870 300 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 2679 3194 gene locus_tag LOCUS_38880 2679 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 3657 3439 gene locus_tag LOCUS_38890 3657 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3672 3914 gene locus_tag LOCUS_38900 3672 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 4146 3877 gene locus_tag LOCUS_38910 4146 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 4841 4918 gene locus_tag LOCUS_t00330 4841 4918 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5183 5581 gene locus_tag LOCUS_38920 5183 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 6509 5793 gene locus_tag LOCUS_38930 6509 5793 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_38930 7009 6797 gene locus_tag LOCUS_38940 7009 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 7337 7792 gene locus_tag LOCUS_38950 7337 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 7835 8545 gene locus_tag LOCUS_38960 7835 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence196 60 1430 gene locus_tag LOCUS_38970 60 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 1447 2193 gene locus_tag LOCUS_38980 1447 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 2520 2257 gene locus_tag LOCUS_38990 2520 2257 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228157.1 protein_id gnl|my_center|LOCUS_38990 3146 2670 gene locus_tag LOCUS_39000 3146 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3319 3098 gene locus_tag LOCUS_39010 3319 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3635 3333 gene locus_tag LOCUS_39020 3635 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 4939 3914 gene locus_tag LOCUS_39030 4939 3914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_39030 5535 4945 gene locus_tag LOCUS_39040 5535 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940553.1 protein_id gnl|my_center|LOCUS_39040 6228 5686 gene locus_tag LOCUS_39050 6228 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230400.1 protein_id gnl|my_center|LOCUS_39050 6670 7233 gene locus_tag LOCUS_39060 6670 7233 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_39060 7240 7956 gene locus_tag LOCUS_39070 gene ispD 7240 7956 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_39070 7953 8435 gene locus_tag LOCUS_39080 gene ispF 7953 8435 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230402.1 protein_id gnl|my_center|LOCUS_39080 >Feature sequence197 1680 799 gene locus_tag LOCUS_39090 1680 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 protein_id gnl|my_center|LOCUS_39090 2137 1691 gene locus_tag LOCUS_39100 2137 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_39100 2442 2218 gene locus_tag LOCUS_39110 2442 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 2733 3764 gene locus_tag LOCUS_39120 2733 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4639 3761 gene locus_tag LOCUS_39130 4639 3761 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_39130 5310 4810 gene locus_tag LOCUS_39140 5310 4810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_39140 6295 5324 gene locus_tag LOCUS_39150 6295 5324 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_39150 7805 6309 gene locus_tag LOCUS_39160 7805 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 8186 8530 gene locus_tag LOCUS_39170 8186 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence198 399 623 gene locus_tag LOCUS_39180 399 623 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_39180 647 2953 gene locus_tag LOCUS_39190 647 2953 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_39190 3324 4418 gene locus_tag LOCUS_39200 gene gcvT 3324 4418 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_39200 4437 4811 gene locus_tag LOCUS_39210 gene gcvH 4437 4811 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_39210 4811 6073 gene locus_tag LOCUS_39220 4811 6073 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223710.1 protein_id gnl|my_center|LOCUS_39220 6220 6981 gene locus_tag LOCUS_39230 6220 6981 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence199 275 1357 gene locus_tag LOCUS_39240 275 1357 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_39240 1612 2808 gene locus_tag LOCUS_39250 1612 2808 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39250 2819 3007 gene locus_tag LOCUS_39260 2819 3007 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417045.1 protein_id gnl|my_center|LOCUS_39260 3004 3186 gene locus_tag LOCUS_39270 gene rubB 3004 3186 CDS product rubredoxin RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417044.1 protein_id gnl|my_center|LOCUS_39270 3207 4430 gene locus_tag LOCUS_39280 3207 4430 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195442.1 protein_id gnl|my_center|LOCUS_39280 4427 5128 gene locus_tag LOCUS_39290 4427 5128 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296677.1 protein_id gnl|my_center|LOCUS_39290 <8476 5273 gene locus_tag LOCUS_39300 <8476 5273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228832.1:cobaltochelatase subunit CobN >Feature sequence200 1149 85 gene locus_tag LOCUS_39310 1149 85 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_39310 1931 1209 gene locus_tag LOCUS_39320 1931 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_39320 2199 3125 gene locus_tag LOCUS_39330 2199 3125 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390494.1 protein_id gnl|my_center|LOCUS_39330 3203 3673 gene locus_tag LOCUS_39340 3203 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 3973 4389 gene locus_tag LOCUS_39350 gene tsaA 3973 4389 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229491.1 protein_id gnl|my_center|LOCUS_39350 5052 4411 gene locus_tag LOCUS_39360 5052 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 5466 5146 gene locus_tag LOCUS_39370 5466 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 5863 5573 gene locus_tag LOCUS_39380 5863 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 5952 6731 gene locus_tag LOCUS_39390 5952 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 6976 6632 gene locus_tag LOCUS_39400 6976 6632 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_39400 7148 8155 gene locus_tag LOCUS_39410 7148 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544197.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence201 3135 2290 gene locus_tag LOCUS_39420 3135 2290 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223187.1 protein_id gnl|my_center|LOCUS_39420 3192 3722 gene locus_tag LOCUS_39430 3192 3722 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_39430 3730 4548 gene locus_tag LOCUS_39440 3730 4548 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_39440 4622 4960 gene locus_tag LOCUS_39450 4622 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223190.1 protein_id gnl|my_center|LOCUS_39450 4981 6063 gene locus_tag LOCUS_39460 4981 6063 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223191.1 protein_id gnl|my_center|LOCUS_39460 6074 6472 gene locus_tag LOCUS_39470 6074 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223192.1 protein_id gnl|my_center|LOCUS_39470 6483 6995 gene locus_tag LOCUS_39480 6483 6995 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223193.1 protein_id gnl|my_center|LOCUS_39480 7576 7007 gene locus_tag LOCUS_39490 7576 7007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877376.1 protein_id gnl|my_center|LOCUS_39490 7545 8267 gene locus_tag LOCUS_39500 7545 8267 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728323.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence202 1735 419 gene locus_tag LOCUS_39510 1735 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 3570 1978 gene locus_tag LOCUS_39520 3570 1978 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_39520 3703 5226 gene locus_tag LOCUS_39530 3703 5226 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_39530 5340 6347 gene locus_tag LOCUS_39540 5340 6347 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_39540 6553 6966 gene locus_tag LOCUS_39550 6553 6966 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227043.1 protein_id gnl|my_center|LOCUS_39550 6963 7382 gene locus_tag LOCUS_39560 6963 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 7394 7657 gene locus_tag LOCUS_39570 7394 7657 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227045.1 protein_id gnl|my_center|LOCUS_39570 7818 8315 gene locus_tag LOCUS_39580 7818 8315 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence203 1686 1108 gene locus_tag LOCUS_39590 1686 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 2790 1747 gene locus_tag LOCUS_39600 2790 1747 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089174.1 protein_id gnl|my_center|LOCUS_39600 3601 2846 gene locus_tag LOCUS_39610 3601 2846 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404007.1 protein_id gnl|my_center|LOCUS_39610 4654 3680 gene locus_tag LOCUS_39620 4654 3680 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_39620 4843 6000 gene locus_tag LOCUS_39630 4843 6000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087812.1 protein_id gnl|my_center|LOCUS_39630 6064 6525 gene locus_tag LOCUS_39640 6064 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39640 6534 8327 gene locus_tag LOCUS_39650 6534 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39650 >Feature sequence204 996 499 gene locus_tag LOCUS_39660 996 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227143.1 protein_id gnl|my_center|LOCUS_39660 2153 993 gene locus_tag LOCUS_39670 2153 993 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_39670 3079 2150 gene locus_tag LOCUS_39680 3079 2150 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_39680 3687 3076 gene locus_tag LOCUS_39690 3687 3076 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_39690 4494 3943 gene locus_tag LOCUS_39700 4494 3943 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_39700 6560 4491 gene locus_tag LOCUS_39710 gene thrS 6560 4491 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 protein_id gnl|my_center|LOCUS_39710 6457 6756 gene locus_tag LOCUS_39720 6457 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 6777 7745 gene locus_tag LOCUS_39730 6777 7745 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_39730 7972 7715 gene locus_tag LOCUS_39740 7972 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence205 20 121 gene locus_tag LOCUS_r00010 20 121 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 623 252 gene locus_tag LOCUS_39750 623 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 528 1175 gene locus_tag LOCUS_39760 528 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227825.1 protein_id gnl|my_center|LOCUS_39760 1172 2164 gene locus_tag LOCUS_39770 1172 2164 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_39770 2199 2384 gene locus_tag LOCUS_39780 2199 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227823.1 protein_id gnl|my_center|LOCUS_39780 2390 3250 gene locus_tag LOCUS_39790 2390 3250 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_39790 3247 4170 gene locus_tag LOCUS_39800 3247 4170 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_39800 4284 6035 gene locus_tag LOCUS_39810 gene recN 4284 6035 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_39810 6182 7309 gene locus_tag LOCUS_39820 gene steA 6182 7309 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286379.1 protein_id gnl|my_center|LOCUS_39820 7306 8253 gene locus_tag LOCUS_39830 7306 8253 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence206 388 1395 gene locus_tag LOCUS_39840 388 1395 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_39840 2702 1407 gene locus_tag LOCUS_39850 2702 1407 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_39850 3660 2713 gene locus_tag LOCUS_39860 3660 2713 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223047.1 protein_id gnl|my_center|LOCUS_39860 4838 3684 gene locus_tag LOCUS_39870 4838 3684 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223046.1 protein_id gnl|my_center|LOCUS_39870 5479 4835 gene locus_tag LOCUS_39880 5479 4835 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223045.1 protein_id gnl|my_center|LOCUS_39880 6498 5476 gene locus_tag LOCUS_39890 6498 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 7414 6557 gene locus_tag LOCUS_39900 7414 6557 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223050.1 protein_id gnl|my_center|LOCUS_39900 7554 8186 gene locus_tag LOCUS_39910 7554 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence207 272 114 gene locus_tag LOCUS_39920 272 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 872 465 gene locus_tag LOCUS_39930 872 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 2631 883 gene locus_tag LOCUS_39940 2631 883 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_39940 2841 3563 gene locus_tag LOCUS_39950 2841 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 3626 3781 gene locus_tag LOCUS_39960 3626 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 3815 4042 gene locus_tag LOCUS_39970 3815 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4071 4886 gene locus_tag LOCUS_39980 4071 4886 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_39980 7139 4905 gene locus_tag LOCUS_39990 7139 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 7334 8215 gene locus_tag LOCUS_40000 7334 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230389.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence208 309 1202 gene locus_tag LOCUS_40010 309 1202 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_40010 1199 2101 gene locus_tag LOCUS_40020 gene panC 1199 2101 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 protein_id gnl|my_center|LOCUS_40020 2113 2625 gene locus_tag LOCUS_40030 2113 2625 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_40030 2728 3537 gene locus_tag LOCUS_40040 2728 3537 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_40040 3616 5118 gene locus_tag LOCUS_40050 gene lysS 3616 5118 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_40050 5247 5585 gene locus_tag LOCUS_40060 5247 5585 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_40060 6721 5849 gene locus_tag LOCUS_40070 6721 5849 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230450.1 protein_id gnl|my_center|LOCUS_40070 >Feature sequence209 837 2612 gene locus_tag LOCUS_40080 837 2612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_40080 3289 2705 gene locus_tag LOCUS_40090 3289 2705 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222191.1 protein_id gnl|my_center|LOCUS_40090 3434 4633 gene locus_tag LOCUS_40100 3434 4633 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222192.1 protein_id gnl|my_center|LOCUS_40100 5626 4649 gene locus_tag LOCUS_40110 5626 4649 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_40110 5962 5792 gene locus_tag LOCUS_40120 5962 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 5892 7361 gene locus_tag LOCUS_40130 5892 7361 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_40130 7596 7844 gene locus_tag LOCUS_40140 7596 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 8018 8103 gene locus_tag LOCUS_t00340 8018 8103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence210 1170 772 gene locus_tag LOCUS_40150 1170 772 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_40150 1087 2049 gene locus_tag LOCUS_40160 1087 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 2557 1982 gene locus_tag LOCUS_40170 2557 1982 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225287.1 protein_id gnl|my_center|LOCUS_40170 3330 2683 gene locus_tag LOCUS_40180 3330 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 3864 3496 gene locus_tag LOCUS_40190 3864 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 5071 3989 gene locus_tag LOCUS_40200 gene galT 5071 3989 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_40200 5953 5171 gene locus_tag LOCUS_40210 5953 5171 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_40210 6621 6046 gene locus_tag LOCUS_40220 6621 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 6749 7258 gene locus_tag LOCUS_40230 6749 7258 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_40230 7255 7902 gene locus_tag LOCUS_40240 7255 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence211 4058 3183 gene locus_tag LOCUS_40250 4058 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4541 5761 gene locus_tag LOCUS_40260 4541 5761 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_40260 5956 7083 gene locus_tag LOCUS_40270 5956 7083 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231016.1 protein_id gnl|my_center|LOCUS_40270 7080 7739 gene locus_tag LOCUS_40280 7080 7739 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence212 1367 210 gene locus_tag LOCUS_40290 1367 210 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230788.1 protein_id gnl|my_center|LOCUS_40290 1713 1402 gene locus_tag LOCUS_40300 1713 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 2602 1835 gene locus_tag LOCUS_40310 2602 1835 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_40310 4296 2599 gene locus_tag LOCUS_40320 4296 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4858 4430 gene locus_tag LOCUS_40330 4858 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 6455 5187 gene locus_tag LOCUS_40340 gene purD 6455 5187 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230794.1 protein_id gnl|my_center|LOCUS_40340 6690 7475 gene locus_tag LOCUS_40350 6690 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 >Feature sequence213 3575 78 gene locus_tag LOCUS_40360 3575 78 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223655.1 protein_id gnl|my_center|LOCUS_40360 5858 3648 gene locus_tag LOCUS_40370 gene recG 5858 3648 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_40370 7496 5865 gene locus_tag LOCUS_40380 7496 5865 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223646.1 protein_id gnl|my_center|LOCUS_40380 7662 7853 gene locus_tag LOCUS_40390 gene rpmB 7662 7853 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence214 587 372 gene locus_tag LOCUS_40400 587 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 804 1265 gene locus_tag LOCUS_40410 804 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227041.1 protein_id gnl|my_center|LOCUS_40410 1355 1627 gene locus_tag LOCUS_40420 1355 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 1746 1976 gene locus_tag LOCUS_40430 1746 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_40430 2477 2094 gene locus_tag LOCUS_40440 2477 2094 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229180.1 protein_id gnl|my_center|LOCUS_40440 2715 3449 gene locus_tag LOCUS_40450 2715 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 4443 3454 gene locus_tag LOCUS_40460 gene ligD 4443 3454 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467071.1 protein_id gnl|my_center|LOCUS_40460 4571 4732 gene locus_tag LOCUS_40470 4571 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4811 5170 gene locus_tag LOCUS_40480 4811 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40480 5167 6564 gene locus_tag LOCUS_40490 5167 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 6588 6791 gene locus_tag LOCUS_40500 6588 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227087.1 protein_id gnl|my_center|LOCUS_40500 7447 6803 gene locus_tag LOCUS_40510 7447 6803 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_40510 >Feature sequence215 751 2127 gene locus_tag LOCUS_40520 751 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2153 4582 gene locus_tag LOCUS_40530 2153 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 4579 5991 gene locus_tag LOCUS_40540 4579 5991 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_40540 6008 6223 gene locus_tag LOCUS_40550 6008 6223 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_40550 7729 6233 gene locus_tag LOCUS_40560 7729 6233 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082592.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence216 1841 639 gene locus_tag LOCUS_40570 gene hutI 1841 639 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_40570 3181 1838 gene locus_tag LOCUS_40580 3181 1838 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223170.1 protein_id gnl|my_center|LOCUS_40580 4892 3228 gene locus_tag LOCUS_40590 gene hutU 4892 3228 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_40590 6484 4892 gene locus_tag LOCUS_40600 gene hutH 6484 4892 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223167.1 protein_id gnl|my_center|LOCUS_40600 6611 7393 gene locus_tag LOCUS_40610 6611 7393 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence217 365 1381 gene locus_tag LOCUS_40620 365 1381 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_40620 1551 2909 gene locus_tag LOCUS_40630 1551 2909 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229985.1 protein_id gnl|my_center|LOCUS_40630 3448 2846 gene locus_tag LOCUS_40640 3448 2846 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_40640 3856 5076 gene locus_tag LOCUS_40650 3856 5076 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529882.1 protein_id gnl|my_center|LOCUS_40650 5138 6097 gene locus_tag LOCUS_40660 5138 6097 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_40660 6105 7295 gene locus_tag LOCUS_40670 6105 7295 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence218 314 766 gene locus_tag LOCUS_40680 314 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 827 1648 gene locus_tag LOCUS_40690 827 1648 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_40690 2666 1719 gene locus_tag LOCUS_40700 2666 1719 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_40700 3794 2685 gene locus_tag LOCUS_40710 3794 2685 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 protein_id gnl|my_center|LOCUS_40710 3757 3939 gene locus_tag LOCUS_40720 3757 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4307 4990 gene locus_tag LOCUS_40730 4307 4990 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_40730 5831 4968 gene locus_tag LOCUS_40740 5831 4968 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852947.1 protein_id gnl|my_center|LOCUS_40740 7179 5818 gene locus_tag LOCUS_40750 7179 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40750 >Feature sequence219 <1 775 gene locus_tag LOCUS_40760 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227000.1:methionine synthase 813 1718 gene locus_tag LOCUS_40770 813 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224792.1 protein_id gnl|my_center|LOCUS_40770 2768 1725 gene locus_tag LOCUS_40780 2768 1725 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_40780 2939 3844 gene locus_tag LOCUS_40790 2939 3844 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_40790 4692 3871 gene locus_tag LOCUS_40800 4692 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 5675 5202 gene locus_tag LOCUS_40810 5675 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224436.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence220 3310 1490 gene locus_tag LOCUS_40820 3310 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 4854 3307 gene locus_tag LOCUS_40830 4854 3307 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731434.1 protein_id gnl|my_center|LOCUS_40830 5043 5486 gene locus_tag LOCUS_40840 5043 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 5811 6179 gene locus_tag LOCUS_40850 5811 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40850 7169 6180 gene locus_tag LOCUS_40860 7169 6180 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence221 447 1 gene locus_tag LOCUS_40870 gene ybaK 447 1 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_40870 674 1288 gene locus_tag LOCUS_40880 674 1288 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_40880 1285 1602 gene locus_tag LOCUS_40890 gene rsrA 1285 1602 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229711.1 protein_id gnl|my_center|LOCUS_40890 2099 1890 gene locus_tag LOCUS_40900 2099 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40900 2393 2232 gene locus_tag LOCUS_40910 2393 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2616 2380 gene locus_tag LOCUS_40920 2616 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 2858 4387 gene locus_tag LOCUS_40930 2858 4387 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_40930 4721 4470 gene locus_tag LOCUS_40940 4721 4470 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003059797.1 protein_id gnl|my_center|LOCUS_40940 5870 5010 gene locus_tag LOCUS_40950 5870 5010 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_40950 6188 6610 gene locus_tag LOCUS_40960 6188 6610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229708.1 protein_id gnl|my_center|LOCUS_40960 7205 6690 gene locus_tag LOCUS_40970 7205 6690 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_40970 >Feature sequence222 2309 2142 gene locus_tag LOCUS_40980 2309 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 2963 2616 gene locus_tag LOCUS_40990 2963 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 3056 3874 gene locus_tag LOCUS_41000 3056 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4267 3938 gene locus_tag LOCUS_41010 4267 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 5016 4372 gene locus_tag LOCUS_41020 5016 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4952 5554 gene locus_tag LOCUS_41030 4952 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 5655 6359 gene locus_tag LOCUS_41040 5655 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 6356 7057 gene locus_tag LOCUS_41050 6356 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 >Feature sequence223 349 789 gene locus_tag LOCUS_41060 349 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 926 1225 gene locus_tag LOCUS_41070 926 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41070 1237 2418 gene locus_tag LOCUS_41080 1237 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_41080 2442 4856 gene locus_tag LOCUS_41090 2442 4856 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_41090 5127 5672 gene locus_tag LOCUS_41100 5127 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 5788 6384 gene locus_tag LOCUS_41110 5788 6384 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_41110 6381 7238 gene locus_tag LOCUS_41120 6381 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 >Feature sequence224 741 58 gene locus_tag LOCUS_41130 gene pdxH 741 58 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_41130 1117 2250 gene locus_tag LOCUS_41140 1117 2250 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230178.1 protein_id gnl|my_center|LOCUS_41140 2390 3739 gene locus_tag LOCUS_41150 2390 3739 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_41150 3752 4879 gene locus_tag LOCUS_41160 gene serC 3752 4879 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_41160 4931 5161 gene locus_tag LOCUS_41170 4931 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 5158 5631 gene locus_tag LOCUS_41180 gene vapC26 5158 5631 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_41180 5735 6634 gene locus_tag LOCUS_41190 gene sepH 5735 6634 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230196.1 protein_id gnl|my_center|LOCUS_41190 6738 7127 gene locus_tag LOCUS_41200 6738 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 >Feature sequence225 132 797 gene locus_tag LOCUS_41210 132 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227104.1 protein_id gnl|my_center|LOCUS_41210 1202 810 gene locus_tag LOCUS_41220 1202 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2494 1340 gene locus_tag LOCUS_41230 2494 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41230 3164 2745 gene locus_tag LOCUS_41240 3164 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41240 3213 3515 gene locus_tag LOCUS_41250 3213 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4117 3566 gene locus_tag LOCUS_41260 4117 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 4581 4165 gene locus_tag LOCUS_41270 4581 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41270 4678 5334 gene locus_tag LOCUS_41280 4678 5334 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229182.1 protein_id gnl|my_center|LOCUS_41280 6990 5437 gene locus_tag LOCUS_41290 6990 5437 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728060.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence226 390 172 gene locus_tag LOCUS_41300 390 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 967 542 gene locus_tag LOCUS_41310 967 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 1229 1750 gene locus_tag LOCUS_41320 1229 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 3375 1837 gene locus_tag LOCUS_41330 3375 1837 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726984.1 protein_id gnl|my_center|LOCUS_41330 4095 3583 gene locus_tag LOCUS_41340 4095 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 4276 5283 gene locus_tag LOCUS_41350 4276 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5276 5698 gene locus_tag LOCUS_41360 5276 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence227 211 14 gene locus_tag LOCUS_41370 211 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 467 180 gene locus_tag LOCUS_41380 467 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 1804 590 gene locus_tag LOCUS_41390 1804 590 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226706.1 protein_id gnl|my_center|LOCUS_41390 2577 1855 gene locus_tag LOCUS_41400 2577 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 5426 2670 gene locus_tag LOCUS_41410 5426 2670 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_41410 6462 5485 gene locus_tag LOCUS_41420 gene tatC 6462 5485 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_41420 6803 6483 gene locus_tag LOCUS_41430 gene tatA 6803 6483 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226712.1 protein_id gnl|my_center|LOCUS_41430 7029 6880 gene locus_tag LOCUS_41440 7029 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 >Feature sequence228 1161 373 gene locus_tag LOCUS_41450 1161 373 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_41450 1257 2000 gene locus_tag LOCUS_41460 1257 2000 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224480.1 protein_id gnl|my_center|LOCUS_41460 2717 2055 gene locus_tag LOCUS_41470 2717 2055 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224479.1 protein_id gnl|my_center|LOCUS_41470 3222 2734 gene locus_tag LOCUS_41480 gene dut 3222 2734 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_41480 3350 3754 gene locus_tag LOCUS_41490 3350 3754 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_41490 4129 3821 gene locus_tag LOCUS_41500 4129 3821 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224476.1 protein_id gnl|my_center|LOCUS_41500 4647 5330 gene locus_tag LOCUS_41510 gene cei 4647 5330 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224475.1 protein_id gnl|my_center|LOCUS_41510 6411 5584 gene locus_tag LOCUS_41520 6411 5584 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_41520 >Feature sequence229 614 351 gene locus_tag LOCUS_41530 614 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 1180 611 gene locus_tag LOCUS_41540 1180 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 1600 1262 gene locus_tag LOCUS_41550 1600 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 1869 1597 gene locus_tag LOCUS_41560 1869 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742211.1 protein_id gnl|my_center|LOCUS_41560 2819 1908 gene locus_tag LOCUS_41570 2819 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 5074 2819 gene locus_tag LOCUS_41580 5074 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 6189 5116 gene locus_tag LOCUS_41590 6189 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 6539 6189 gene locus_tag LOCUS_41600 6539 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 6803 6648 gene locus_tag LOCUS_41610 6803 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 >Feature sequence230 2258 1416 gene locus_tag LOCUS_41620 2258 1416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_41620 3109 2255 gene locus_tag LOCUS_41630 3109 2255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_41630 4348 3116 gene locus_tag LOCUS_41640 4348 3116 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_41640 5537 4341 gene locus_tag LOCUS_41650 5537 4341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_41650 <6934 5549 gene locus_tag LOCUS_41660 <6934 5549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030368.1:gamma-aminobutyraldehyde dehydrogenase >Feature sequence231 2314 377 gene locus_tag LOCUS_41670 2314 377 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_41670 3743 2469 gene locus_tag LOCUS_41680 gene tyrS 3743 2469 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227826.1 protein_id gnl|my_center|LOCUS_41680 4870 3848 gene locus_tag LOCUS_41690 4870 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5610 5011 gene locus_tag LOCUS_41700 5610 5011 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_41700 5825 6253 gene locus_tag LOCUS_41710 5825 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41710 >Feature sequence232 1617 190 gene locus_tag LOCUS_41720 1617 190 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223535.1 protein_id gnl|my_center|LOCUS_41720 1813 3171 gene locus_tag LOCUS_41730 gene aceA 1813 3171 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_41730 3494 5104 gene locus_tag LOCUS_41740 gene aceB 3494 5104 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223537.1 protein_id gnl|my_center|LOCUS_41740 <6808 5381 gene locus_tag LOCUS_41750 <6808 5381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_117302210.1:M14 family zinc carboxypeptidase >Feature sequence233 407 1486 gene locus_tag LOCUS_41760 407 1486 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223488.1 protein_id gnl|my_center|LOCUS_41760 1483 2259 gene locus_tag LOCUS_41770 1483 2259 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 protein_id gnl|my_center|LOCUS_41770 2259 2606 gene locus_tag LOCUS_41780 2259 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223486.1 protein_id gnl|my_center|LOCUS_41780 2610 4382 gene locus_tag LOCUS_41790 2610 4382 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223485.1 protein_id gnl|my_center|LOCUS_41790 4445 4798 gene locus_tag LOCUS_41800 4445 4798 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 protein_id gnl|my_center|LOCUS_41800 4795 6405 gene locus_tag LOCUS_41810 4795 6405 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_41810 >Feature sequence234 <1 843 gene locus_tag LOCUS_41820 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222260.1:NADPH-dependent 2,4-dienoyl-CoA reductase 869 1294 gene locus_tag LOCUS_41830 869 1294 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_41830 1440 2429 gene locus_tag LOCUS_41840 1440 2429 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_41840 5370 2563 gene locus_tag LOCUS_41850 5370 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 6703 5378 gene locus_tag LOCUS_41860 6703 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence235 4019 1659 gene locus_tag LOCUS_41870 4019 1659 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_41870 5115 4072 gene locus_tag LOCUS_41880 5115 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 5245 6105 gene locus_tag LOCUS_41890 5245 6105 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_41890 6370 6636 gene locus_tag LOCUS_41900 6370 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence236 574 227 gene locus_tag LOCUS_41910 574 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 679 1257 gene locus_tag LOCUS_41920 679 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41920 1154 1996 gene locus_tag LOCUS_41930 1154 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2764 2102 gene locus_tag LOCUS_41940 2764 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 3480 2767 gene locus_tag LOCUS_41950 3480 2767 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_41950 3513 5132 gene locus_tag LOCUS_41960 3513 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_41960 5611 5192 gene locus_tag LOCUS_41970 5611 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence237 1982 534 gene locus_tag LOCUS_41980 1982 534 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 protein_id gnl|my_center|LOCUS_41980 2208 3845 gene locus_tag LOCUS_41990 2208 3845 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_41990 3891 4727 gene locus_tag LOCUS_42000 3891 4727 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730686.1 protein_id gnl|my_center|LOCUS_42000 6421 4832 gene locus_tag LOCUS_42010 6421 4832 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_42010 >Feature sequence238 200 1420 gene locus_tag LOCUS_42020 200 1420 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_42020 1522 3324 gene locus_tag LOCUS_42030 1522 3324 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118146.1 protein_id gnl|my_center|LOCUS_42030 3870 3490 gene locus_tag LOCUS_42040 3870 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 4117 3887 gene locus_tag LOCUS_42050 4117 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 4552 4815 gene locus_tag LOCUS_42060 4552 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 5800 4877 gene locus_tag LOCUS_42070 gene folD 5800 4877 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_42070 6425 5793 gene locus_tag LOCUS_42080 6425 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 >Feature sequence239 279 1364 gene locus_tag LOCUS_42090 279 1364 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_42090 1361 2389 gene locus_tag LOCUS_42100 1361 2389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_42100 2386 3258 gene locus_tag LOCUS_42110 2386 3258 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229773.1 protein_id gnl|my_center|LOCUS_42110 3697 3398 gene locus_tag LOCUS_42120 3697 3398 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_42120 3848 4912 gene locus_tag LOCUS_42130 3848 4912 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_42130 5783 5076 gene locus_tag LOCUS_42140 5783 5076 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 protein_id gnl|my_center|LOCUS_42140 >Feature sequence240 680 2221 gene locus_tag LOCUS_42150 680 2221 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_42150 3732 2230 gene locus_tag LOCUS_42160 3732 2230 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_42160 3924 5351 gene locus_tag LOCUS_42170 3924 5351 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223099.1 protein_id gnl|my_center|LOCUS_42170 6471 5311 gene locus_tag LOCUS_42180 6471 5311 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_42180 >Feature sequence241 29 706 gene locus_tag LOCUS_42190 29 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 1111 2640 gene locus_tag LOCUS_42200 1111 2640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_42200 2729 3562 gene locus_tag LOCUS_42210 2729 3562 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729481.1 protein_id gnl|my_center|LOCUS_42210 3608 3895 gene locus_tag LOCUS_42220 3608 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 5373 3988 gene locus_tag LOCUS_42230 5373 3988 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727516.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence242 428 2371 gene locus_tag LOCUS_42240 428 2371 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224215.1 protein_id gnl|my_center|LOCUS_42240 2645 2388 gene locus_tag LOCUS_42250 2645 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 2568 2762 gene locus_tag LOCUS_42260 2568 2762 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_42260 3019 2834 gene locus_tag LOCUS_42270 3019 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 3018 5147 gene locus_tag LOCUS_42280 gene recA 3018 5147 CDS product intein-containing recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908056.1 protein_id gnl|my_center|LOCUS_42280 5157 5732 gene locus_tag LOCUS_42290 5157 5732 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224218.1 protein_id gnl|my_center|LOCUS_42290 6007 6300 gene locus_tag LOCUS_42300 6007 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003054488.1 protein_id gnl|my_center|LOCUS_42300 >Feature sequence243 118 483 gene locus_tag LOCUS_42310 118 483 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223497.1 protein_id gnl|my_center|LOCUS_42310 968 480 gene locus_tag LOCUS_42320 968 480 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_42320 1149 2072 gene locus_tag LOCUS_42330 1149 2072 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_42330 3543 2098 gene locus_tag LOCUS_42340 3543 2098 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_42340 3729 6281 gene locus_tag LOCUS_42350 gene glgP 3729 6281 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223503.1 protein_id gnl|my_center|LOCUS_42350 >Feature sequence244 1734 205 gene locus_tag LOCUS_42360 1734 205 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_42360 2366 1731 gene locus_tag LOCUS_42370 2366 1731 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228825.1 protein_id gnl|my_center|LOCUS_42370 3532 2363 gene locus_tag LOCUS_42380 3532 2363 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228826.1 protein_id gnl|my_center|LOCUS_42380 3708 4670 gene locus_tag LOCUS_42390 3708 4670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_42390 4667 5515 gene locus_tag LOCUS_42400 4667 5515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_42400 5544 5792 gene locus_tag LOCUS_42410 5544 5792 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_42410 >Feature sequence245 <1 1012 gene locus_tag LOCUS_42420 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931574.1:diaminopimelate decarboxylase 999 2702 gene locus_tag LOCUS_42430 999 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 5858 2712 gene locus_tag LOCUS_42440 gene ileS 5858 2712 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_42440 >Feature sequence246 734 973 gene locus_tag LOCUS_42450 734 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 1076 1597 gene locus_tag LOCUS_42460 1076 1597 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994099.1 protein_id gnl|my_center|LOCUS_42460 1658 2038 gene locus_tag LOCUS_42470 1658 2038 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_42470 2158 3078 gene locus_tag LOCUS_42480 2158 3078 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_42480 4130 3570 gene locus_tag LOCUS_42490 4130 3570 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112936.1 protein_id gnl|my_center|LOCUS_42490 4352 4534 gene locus_tag LOCUS_42500 4352 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 4537 5409 gene locus_tag LOCUS_42510 4537 5409 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777001.1 protein_id gnl|my_center|LOCUS_42510 5434 6240 gene locus_tag LOCUS_42520 5434 6240 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_42520 >Feature sequence247 1108 278 gene locus_tag LOCUS_42530 1108 278 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_42530 2128 1217 gene locus_tag LOCUS_42540 2128 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 protein_id gnl|my_center|LOCUS_42540 2593 2138 gene locus_tag LOCUS_42550 2593 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_42550 2934 2695 gene locus_tag LOCUS_42560 2934 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 3169 2993 gene locus_tag LOCUS_42570 3169 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4007 4936 gene locus_tag LOCUS_42580 4007 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 5500 4940 gene locus_tag LOCUS_42590 5500 4940 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_42590 5938 5759 gene locus_tag LOCUS_42600 5938 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence248 1390 77 gene locus_tag LOCUS_42610 1390 77 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532523.1 protein_id gnl|my_center|LOCUS_42610 1578 1387 gene locus_tag LOCUS_42620 1578 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 2015 1575 gene locus_tag LOCUS_42630 2015 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 2311 2009 gene locus_tag LOCUS_42640 2311 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 3337 2576 gene locus_tag LOCUS_42650 3337 2576 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895268.1 protein_id gnl|my_center|LOCUS_42650 3862 3380 gene locus_tag LOCUS_42660 3862 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 4182 3955 gene locus_tag LOCUS_42670 4182 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 5439 4333 gene locus_tag LOCUS_42680 5439 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 5741 5436 gene locus_tag LOCUS_42690 5741 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence249 1118 573 gene locus_tag LOCUS_42700 1118 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 1603 2040 gene locus_tag LOCUS_42710 1603 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42710 2475 2068 gene locus_tag LOCUS_42720 2475 2068 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_42720 3319 2759 gene locus_tag LOCUS_42730 3319 2759 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415983.1 protein_id gnl|my_center|LOCUS_42730 3549 3319 gene locus_tag LOCUS_42740 3549 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 4889 3762 gene locus_tag LOCUS_42750 4889 3762 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974908.1 protein_id gnl|my_center|LOCUS_42750 5693 5019 gene locus_tag LOCUS_42760 5693 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence250 803 168 gene locus_tag LOCUS_42770 803 168 CDS product QsdR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229987.1 protein_id gnl|my_center|LOCUS_42770 2965 926 gene locus_tag LOCUS_42780 2965 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 4244 3003 gene locus_tag LOCUS_42790 4244 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 5998 4346 gene locus_tag LOCUS_42800 5998 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 >Feature sequence251 991 515 gene locus_tag LOCUS_42810 991 515 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224643.1 protein_id gnl|my_center|LOCUS_42810 1499 999 gene locus_tag LOCUS_42820 gene ribH 1499 999 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_42820 2829 1531 gene locus_tag LOCUS_42830 2829 1531 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_42830 3470 2832 gene locus_tag LOCUS_42840 3470 2832 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224640.1 protein_id gnl|my_center|LOCUS_42840 4540 3494 gene locus_tag LOCUS_42850 gene ribD 4540 3494 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_42850 5223 4537 gene locus_tag LOCUS_42860 gene rpe 5223 4537 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224639.1 protein_id gnl|my_center|LOCUS_42860 <5954 5322 gene locus_tag LOCUS_42870 <5954 5322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224633.1:transcription antitermination factor NusB >Feature sequence252 893 162 gene locus_tag LOCUS_42880 893 162 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_42880 975 1928 gene locus_tag LOCUS_42890 975 1928 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223529.1 protein_id gnl|my_center|LOCUS_42890 2059 2544 gene locus_tag LOCUS_42900 2059 2544 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_42900 3543 2551 gene locus_tag LOCUS_42910 3543 2551 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_42910 4330 3551 gene locus_tag LOCUS_42920 4330 3551 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_42920 5407 4466 gene locus_tag LOCUS_42930 5407 4466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_42930 5427 5795 gene locus_tag LOCUS_42940 5427 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence253 355 888 gene locus_tag LOCUS_42950 355 888 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 protein_id gnl|my_center|LOCUS_42950 885 1832 gene locus_tag LOCUS_42960 885 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 1941 2324 gene locus_tag LOCUS_42970 1941 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 2542 4164 gene locus_tag LOCUS_42980 2542 4164 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465068.1 protein_id gnl|my_center|LOCUS_42980 4358 5086 gene locus_tag LOCUS_42990 4358 5086 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42990 >Feature sequence254 1608 10 gene locus_tag LOCUS_43000 1608 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 3545 1635 gene locus_tag LOCUS_43010 3545 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 4269 3718 gene locus_tag LOCUS_43020 4269 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 5148 4651 gene locus_tag LOCUS_43030 5148 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 <5750 5148 gene locus_tag LOCUS_43040 <5750 5148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704606.1:sugar diacid recognition domain-containing protein >Feature sequence255 1378 131 gene locus_tag LOCUS_43050 1378 131 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_43050 1761 1381 gene locus_tag LOCUS_43060 1761 1381 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_43060 2201 1842 gene locus_tag LOCUS_43070 2201 1842 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_43070 2357 2500 gene locus_tag LOCUS_43080 2357 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 3787 2519 gene locus_tag LOCUS_43090 3787 2519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_43090 3993 4322 gene locus_tag LOCUS_43100 3993 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4279 4653 gene locus_tag LOCUS_43110 4279 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 4798 4992 gene locus_tag LOCUS_43120 4798 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 4974 5438 gene locus_tag LOCUS_43130 4974 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence256 271 954 gene locus_tag LOCUS_43140 271 954 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226559.1 protein_id gnl|my_center|LOCUS_43140 1751 969 gene locus_tag LOCUS_43150 1751 969 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_43150 2000 2203 gene locus_tag LOCUS_43160 2000 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 2626 2829 gene locus_tag LOCUS_43170 2626 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 2963 5350 gene locus_tag LOCUS_43180 2963 5350 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_43180 5495 5313 gene locus_tag LOCUS_43190 5495 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 >Feature sequence257 173 616 gene locus_tag LOCUS_43200 173 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 863 558 gene locus_tag LOCUS_43210 863 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 1167 949 gene locus_tag LOCUS_43220 1167 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 1562 1188 gene locus_tag LOCUS_43230 1562 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 1476 2009 gene locus_tag LOCUS_43240 1476 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 2300 3397 gene locus_tag LOCUS_43250 2300 3397 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900742.1 protein_id gnl|my_center|LOCUS_43250 3458 4441 gene locus_tag LOCUS_43260 3458 4441 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891674.1 protein_id gnl|my_center|LOCUS_43260 >Feature sequence258 834 2804 gene locus_tag LOCUS_43270 834 2804 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_43270 2907 3494 gene locus_tag LOCUS_43280 2907 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_43280 3694 3491 gene locus_tag LOCUS_43290 3694 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 4398 3829 gene locus_tag LOCUS_43300 4398 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 5561 5028 gene locus_tag LOCUS_43310 5561 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence259 2594 780 gene locus_tag LOCUS_43320 2594 780 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226995.1 protein_id gnl|my_center|LOCUS_43320 3943 2714 gene locus_tag LOCUS_43330 3943 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 5463 4132 gene locus_tag LOCUS_43340 5463 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence260 20 121 gene locus_tag LOCUS_r00020 20 121 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 330 1100 gene locus_tag LOCUS_43350 330 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 1045 1269 gene locus_tag LOCUS_43360 1045 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 1398 1667 gene locus_tag LOCUS_43370 1398 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 1809 4703 gene locus_tag LOCUS_43380 1809 4703 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466641.1 protein_id gnl|my_center|LOCUS_43380 5249 4809 gene locus_tag LOCUS_43390 5249 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 >Feature sequence261 254 967 gene locus_tag LOCUS_43400 254 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 1001 1330 gene locus_tag LOCUS_43410 1001 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 1327 2067 gene locus_tag LOCUS_43420 1327 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 2067 2600 gene locus_tag LOCUS_43430 2067 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 2835 2668 gene locus_tag LOCUS_43440 2835 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 3667 3278 gene locus_tag LOCUS_43450 3667 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 3951 3673 gene locus_tag LOCUS_43460 3951 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 4875 4063 gene locus_tag LOCUS_43470 4875 4063 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_43470 5075 4875 gene locus_tag LOCUS_43480 5075 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 >Feature sequence262 153 419 gene locus_tag LOCUS_43490 153 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 416 772 gene locus_tag LOCUS_43500 416 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 921 1565 gene locus_tag LOCUS_43510 921 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 1565 2002 gene locus_tag LOCUS_43520 1565 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 3193 2258 gene locus_tag LOCUS_43530 3193 2258 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227634.1 protein_id gnl|my_center|LOCUS_43530 3326 3685 gene locus_tag LOCUS_43540 3326 3685 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_43540 4120 3689 gene locus_tag LOCUS_43550 4120 3689 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973660.1 protein_id gnl|my_center|LOCUS_43550 5229 4231 gene locus_tag LOCUS_43560 5229 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 5486 5226 gene locus_tag LOCUS_43570 5486 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence263 33 467 gene locus_tag LOCUS_43580 33 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1818 376 gene locus_tag LOCUS_43590 1818 376 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_43590 2003 2767 gene locus_tag LOCUS_43600 gene phnF 2003 2767 CDS product GntR family transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104245.1 protein_id gnl|my_center|LOCUS_43600 2787 2996 gene locus_tag LOCUS_43610 2787 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 3660 3103 gene locus_tag LOCUS_43620 3660 3103 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_43620 4672 4283 gene locus_tag LOCUS_43630 4672 4283 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_43630 4869 4669 gene locus_tag LOCUS_43640 4869 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 >Feature sequence264 920 342 gene locus_tag LOCUS_43650 920 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 1027 1824 gene locus_tag LOCUS_43660 1027 1824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223552.1 protein_id gnl|my_center|LOCUS_43660 1821 2759 gene locus_tag LOCUS_43670 1821 2759 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223553.1 protein_id gnl|my_center|LOCUS_43670 3076 4305 gene locus_tag LOCUS_43680 3076 4305 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence265 1867 869 gene locus_tag LOCUS_43690 1867 869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_43690 2948 2016 gene locus_tag LOCUS_43700 2948 2016 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_43700 3955 2954 gene locus_tag LOCUS_43710 3955 2954 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_43710 <5313 4198 gene locus_tag LOCUS_43720 <5313 4198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230617.1:ABC transporter substrate-binding protein >Feature sequence266 330 3269 gene locus_tag LOCUS_43730 gene leuS 330 3269 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_43730 4073 3291 gene locus_tag LOCUS_43740 4073 3291 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_43740 4379 5284 gene locus_tag LOCUS_43750 4379 5284 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_43750 >Feature sequence267 3091 8 gene locus_tag LOCUS_43760 3091 8 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_43760 3352 4083 gene locus_tag LOCUS_43770 3352 4083 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_43770 4257 5135 gene locus_tag LOCUS_43780 4257 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 >Feature sequence268 584 9 gene locus_tag LOCUS_43790 584 9 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_43790 2982 1984 gene locus_tag LOCUS_43800 2982 1984 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_43800 3222 4274 gene locus_tag LOCUS_43810 3222 4274 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742064.1 protein_id gnl|my_center|LOCUS_43810 4890 4441 gene locus_tag LOCUS_43820 gene rbfA 4890 4441 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_43820 5214 4918 gene locus_tag LOCUS_43830 5214 4918 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_43830 >Feature sequence269 165 629 gene locus_tag LOCUS_43840 165 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 2747 1230 gene locus_tag LOCUS_43850 2747 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 3297 2995 gene locus_tag LOCUS_43860 3297 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4126 4623 gene locus_tag LOCUS_43870 4126 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence270 1681 458 gene locus_tag LOCUS_43880 1681 458 CDS product thioester domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316091.1 protein_id gnl|my_center|LOCUS_43880 2093 1914 gene locus_tag LOCUS_43890 2093 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 2052 2270 gene locus_tag LOCUS_43900 2052 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 2889 3185 gene locus_tag LOCUS_43910 2889 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 3426 3983 gene locus_tag LOCUS_43920 3426 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5005 4130 gene locus_tag LOCUS_43930 5005 4130 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031008.1 protein_id gnl|my_center|LOCUS_43930 >Feature sequence271 205 417 gene locus_tag LOCUS_43940 205 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 548 1033 gene locus_tag LOCUS_43950 gene bfr 548 1033 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895015.1 protein_id gnl|my_center|LOCUS_43950 1223 2503 gene locus_tag LOCUS_43960 1223 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4337 2586 gene locus_tag LOCUS_43970 4337 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43970 4693 5046 gene locus_tag LOCUS_43980 4693 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence272 878 240 gene locus_tag LOCUS_43990 878 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 1111 2160 gene locus_tag LOCUS_44000 gene pta 1111 2160 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 protein_id gnl|my_center|LOCUS_44000 2202 2957 gene locus_tag LOCUS_44010 2202 2957 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_44010 3962 2961 gene locus_tag LOCUS_44020 3962 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44020 4627 3929 gene locus_tag LOCUS_44030 4627 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44030 >Feature sequence273 763 518 gene locus_tag LOCUS_44040 763 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 877 2106 gene locus_tag LOCUS_44050 877 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 2372 2563 gene locus_tag LOCUS_44060 2372 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 3025 2663 gene locus_tag LOCUS_44070 3025 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 3203 3547 gene locus_tag LOCUS_44080 3203 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3541 3936 gene locus_tag LOCUS_44090 3541 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 3938 4219 gene locus_tag LOCUS_44100 3938 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4216 4917 gene locus_tag LOCUS_44110 4216 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence274 1792 2538 gene locus_tag LOCUS_44120 1792 2538 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_44120 2701 3507 gene locus_tag LOCUS_44130 2701 3507 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_44130 4106 3588 gene locus_tag LOCUS_44140 4106 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence275 855 1052 gene locus_tag LOCUS_44150 855 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 1298 1795 gene locus_tag LOCUS_44160 1298 1795 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226547.1 protein_id gnl|my_center|LOCUS_44160 1985 2401 gene locus_tag LOCUS_44170 1985 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 3511 3161 gene locus_tag LOCUS_44180 3511 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 3629 4126 gene locus_tag LOCUS_44190 3629 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 >Feature sequence276 116 1516 gene locus_tag LOCUS_44200 116 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 1438 1668 gene locus_tag LOCUS_44210 1438 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 1811 2476 gene locus_tag LOCUS_44220 1811 2476 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_44220 2473 3129 gene locus_tag LOCUS_44230 2473 3129 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 protein_id gnl|my_center|LOCUS_44230 3217 3981 gene locus_tag LOCUS_44240 3217 3981 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_44240 4072 4791 gene locus_tag LOCUS_44250 4072 4791 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence277 52 1209 gene locus_tag LOCUS_44260 52 1209 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_44260 1592 1218 gene locus_tag LOCUS_44270 1592 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1591 2796 gene locus_tag LOCUS_44280 gene ilvA 1591 2796 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_44280 4094 2895 gene locus_tag LOCUS_44290 gene hppD 4094 2895 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_44290 4235 4726 gene locus_tag LOCUS_44300 4235 4726 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence278 <1 852 gene locus_tag LOCUS_44310 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228464.1:ComEC/Rec2 family competence protein 2249 975 gene locus_tag LOCUS_44320 gene thrC 2249 975 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_44320 2724 3704 gene locus_tag LOCUS_44330 gene holA 2724 3704 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_44330 4228 3968 gene locus_tag LOCUS_44340 gene rpsT 4228 3968 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_44340 4385 4759 gene locus_tag LOCUS_44350 4385 4759 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228458.1 protein_id gnl|my_center|LOCUS_44350 >Feature sequence279 196 5 gene locus_tag LOCUS_44360 196 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 504 283 gene locus_tag LOCUS_44370 504 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 1000 773 gene locus_tag LOCUS_44380 1000 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 1752 1132 gene locus_tag LOCUS_44390 1752 1132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_44390 2161 1865 gene locus_tag LOCUS_44400 2161 1865 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_44400 3273 2158 gene locus_tag LOCUS_44410 3273 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_44410 3585 3863 gene locus_tag LOCUS_44420 3585 3863 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894403.1 protein_id gnl|my_center|LOCUS_44420 4200 4607 gene locus_tag LOCUS_44430 4200 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence280 253 1620 gene locus_tag LOCUS_44440 253 1620 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_44440 >Feature sequence281 927 67 gene locus_tag LOCUS_44450 927 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230036.1 protein_id gnl|my_center|LOCUS_44450 1798 1121 gene locus_tag LOCUS_44460 1798 1121 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 protein_id gnl|my_center|LOCUS_44460 3131 1809 gene locus_tag LOCUS_44470 3131 1809 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230038.1 protein_id gnl|my_center|LOCUS_44470 4036 3128 gene locus_tag LOCUS_44480 4036 3128 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230039.1 protein_id gnl|my_center|LOCUS_44480 >Feature sequence282 918 694 gene locus_tag LOCUS_44490 918 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2360 915 gene locus_tag LOCUS_44500 2360 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 2705 2409 gene locus_tag LOCUS_44510 2705 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 3172 4158 gene locus_tag LOCUS_44520 3172 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44520 4538 4257 gene locus_tag LOCUS_44530 4538 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence283 783 274 gene locus_tag LOCUS_44540 783 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_44540 984 784 gene locus_tag LOCUS_44550 984 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 2242 1271 gene locus_tag LOCUS_44560 2242 1271 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_44560 2331 2510 gene locus_tag LOCUS_44570 2331 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 3711 2566 gene locus_tag LOCUS_44580 3711 2566 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_44580 3817 4182 gene locus_tag LOCUS_44590 3817 4182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence284 68 310 gene locus_tag LOCUS_44600 68 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 461 385 gene locus_tag LOCUS_t00350 461 385 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3442 617 gene locus_tag LOCUS_44610 3442 617 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_44610 3730 4305 gene locus_tag LOCUS_44620 3730 4305 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_44620 >Feature sequence285 1708 890 gene locus_tag LOCUS_44630 1708 890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222189.1 protein_id gnl|my_center|LOCUS_44630 2757 1777 gene locus_tag LOCUS_44640 2757 1777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_44640 3601 2795 gene locus_tag LOCUS_44650 3601 2795 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 protein_id gnl|my_center|LOCUS_44650 >Feature sequence286 149 1558 gene locus_tag LOCUS_44660 149 1558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226560.1 protein_id gnl|my_center|LOCUS_44660 1883 2227 gene locus_tag LOCUS_44670 1883 2227 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_44670 3100 2300 gene locus_tag LOCUS_44680 3100 2300 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_44680 <4268 3111 gene locus_tag LOCUS_44690 <4268 3111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003415037.1:IS607 family element RNA-guided endonuclease TnpB >Feature sequence287 451 152 gene locus_tag LOCUS_44700 451 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 798 457 gene locus_tag LOCUS_44710 798 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44710 1320 1760 gene locus_tag LOCUS_44720 1320 1760 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229740.1 protein_id gnl|my_center|LOCUS_44720 2351 1788 gene locus_tag LOCUS_44730 gene msrA 2351 1788 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_44730 2555 3721 gene locus_tag LOCUS_44740 2555 3721 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_44740 >Feature sequence288 125 829 gene locus_tag LOCUS_44750 125 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 826 2940 gene locus_tag LOCUS_44760 826 2940 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_44760 2937 3977 gene locus_tag LOCUS_44770 2937 3977 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence289 408 1106 gene locus_tag LOCUS_44780 408 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_44780 1121 2260 gene locus_tag LOCUS_44790 1121 2260 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_44790 3288 2293 gene locus_tag LOCUS_44800 3288 2293 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_44800 >Feature sequence290 1031 162 gene locus_tag LOCUS_44810 1031 162 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_44810 1326 1165 gene locus_tag LOCUS_44820 1326 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1351 1662 gene locus_tag LOCUS_44830 1351 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 1740 1994 gene locus_tag LOCUS_44840 1740 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 1991 2383 gene locus_tag LOCUS_44850 1991 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2874 2380 gene locus_tag LOCUS_44860 2874 2380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_44860 >Feature sequence291 271 708 gene locus_tag LOCUS_44870 271 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 889 713 gene locus_tag LOCUS_44880 889 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 954 3119 gene locus_tag LOCUS_44890 954 3119 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_44890 >Feature sequence292 1393 341 gene locus_tag LOCUS_44900 1393 341 CDS product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229848.1 protein_id gnl|my_center|LOCUS_44900 3638 1644 gene locus_tag LOCUS_44910 3638 1644 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_44910 >Feature sequence293 <1 1174 gene locus_tag LOCUS_44920 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816379.1:M81 family metallopeptidase 1171 2037 gene locus_tag LOCUS_44930 1171 2037 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027038.1 protein_id gnl|my_center|LOCUS_44930 2137 3522 gene locus_tag LOCUS_44940 2137 3522 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_44940 >Feature sequence294 793 2367 gene locus_tag LOCUS_44950 793 2367 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_44950 3615 2422 gene locus_tag LOCUS_44960 3615 2422 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence295 282 797 gene locus_tag LOCUS_44970 282 797 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44970 995 1615 gene locus_tag LOCUS_44980 995 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 2776 1619 gene locus_tag LOCUS_44990 2776 1619 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_44990 <3825 2816 gene locus_tag LOCUS_45000 <3825 2816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097826.1:NADP-dependent oxidoreductase >Feature sequence296 322 53 gene locus_tag LOCUS_45010 322 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 1430 2068 gene locus_tag LOCUS_45020 1430 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 2072 2791 gene locus_tag LOCUS_45030 2072 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 3062 3304 gene locus_tag LOCUS_45040 3062 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 3305 3559 gene locus_tag LOCUS_45050 3305 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence297 584 1375 gene locus_tag LOCUS_45060 584 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 1513 2472 gene locus_tag LOCUS_45070 gene pip 1513 2472 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_45070 2970 2704 gene locus_tag LOCUS_45080 2970 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45080