>Feature sequence001 <1 943 gene locus_tag LOCUS_00010 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487169.1:iron ABC transporter permease 945 1670 gene locus_tag LOCUS_00020 945 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1698 2123 gene locus_tag LOCUS_00030 1698 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2151 3950 gene locus_tag LOCUS_00040 2151 3950 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_00040 5421 3970 gene locus_tag LOCUS_00050 5421 3970 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 protein_id gnl|my_center|LOCUS_00050 5590 5676 gene locus_tag LOCUS_t00010 5590 5676 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5976 7211 gene locus_tag LOCUS_00060 5976 7211 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_00060 7347 8135 gene locus_tag LOCUS_00070 7347 8135 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_00070 9225 8197 gene locus_tag LOCUS_00080 9225 8197 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_00080 10334 9222 gene locus_tag LOCUS_00090 10334 9222 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900650.1 protein_id gnl|my_center|LOCUS_00090 11599 10331 gene locus_tag LOCUS_00100 11599 10331 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 protein_id gnl|my_center|LOCUS_00100 12044 11592 gene locus_tag LOCUS_00110 12044 11592 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_00110 12848 12069 gene locus_tag LOCUS_00120 12848 12069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_00120 13060 12845 gene locus_tag LOCUS_00130 13060 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14283 13057 gene locus_tag LOCUS_00140 14283 13057 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 protein_id gnl|my_center|LOCUS_00140 15515 14280 gene locus_tag LOCUS_00150 15515 14280 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_00150 17047 15563 gene locus_tag LOCUS_00160 17047 15563 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084280.1 protein_id gnl|my_center|LOCUS_00160 17483 17040 gene locus_tag LOCUS_00170 17483 17040 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_00170 18658 17480 gene locus_tag LOCUS_00180 18658 17480 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_00180 18824 19741 gene locus_tag LOCUS_00190 18824 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19750 20700 gene locus_tag LOCUS_00200 19750 20700 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_00200 21466 20690 gene locus_tag LOCUS_00210 21466 20690 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_00210 21573 23156 gene locus_tag LOCUS_00220 21573 23156 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_00220 24046 23177 gene locus_tag LOCUS_00230 24046 23177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25209 24043 gene locus_tag LOCUS_00240 25209 24043 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_00240 25272 26015 gene locus_tag LOCUS_00250 25272 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26053 27120 gene locus_tag LOCUS_00260 26053 27120 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039574.1 protein_id gnl|my_center|LOCUS_00260 28345 27140 gene locus_tag LOCUS_00270 28345 27140 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_00270 28344 29249 gene locus_tag LOCUS_00280 28344 29249 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 protein_id gnl|my_center|LOCUS_00280 29457 31073 gene locus_tag LOCUS_00290 29457 31073 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_00290 31093 32577 gene locus_tag LOCUS_00300 31093 32577 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730815.1 protein_id gnl|my_center|LOCUS_00300 32581 33390 gene locus_tag LOCUS_00310 32581 33390 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446672.1 protein_id gnl|my_center|LOCUS_00310 33403 34119 gene locus_tag LOCUS_00320 33403 34119 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_00320 34116 34994 gene locus_tag LOCUS_00330 34116 34994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_00330 35165 36730 gene locus_tag LOCUS_00340 35165 36730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_00340 36943 37998 gene locus_tag LOCUS_00350 36943 37998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_00350 37995 38930 gene locus_tag LOCUS_00360 37995 38930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_00360 38985 40067 gene locus_tag LOCUS_00370 38985 40067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_00370 40069 41064 gene locus_tag LOCUS_00380 40069 41064 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_00380 41136 42164 gene locus_tag LOCUS_00390 41136 42164 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_00390 42170 43312 gene locus_tag LOCUS_00400 42170 43312 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_00400 44286 43354 gene locus_tag LOCUS_00410 44286 43354 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_00410 44798 44283 gene locus_tag LOCUS_00420 44798 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45039 46988 gene locus_tag LOCUS_00430 45039 46988 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_00430 48907 47030 gene locus_tag LOCUS_00440 48907 47030 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_00440 49104 50027 gene locus_tag LOCUS_00450 49104 50027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51669 50038 gene locus_tag LOCUS_00460 51669 50038 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 protein_id gnl|my_center|LOCUS_00460 51773 53506 gene locus_tag LOCUS_00470 51773 53506 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_00470 53519 54322 gene locus_tag LOCUS_00480 53519 54322 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_00480 55049 54330 gene locus_tag LOCUS_00490 55049 54330 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084270.1 protein_id gnl|my_center|LOCUS_00490 55106 56089 gene locus_tag LOCUS_00500 55106 56089 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_00500 56099 56887 gene locus_tag LOCUS_00510 56099 56887 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_00510 57644 56844 gene locus_tag LOCUS_00520 57644 56844 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 protein_id gnl|my_center|LOCUS_00520 58673 57648 gene locus_tag LOCUS_00530 gene adhP 58673 57648 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649193.1 protein_id gnl|my_center|LOCUS_00530 58723 59484 gene locus_tag LOCUS_00540 58723 59484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60064 59498 gene locus_tag LOCUS_00550 60064 59498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60938 60069 gene locus_tag LOCUS_00560 60938 60069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61841 61002 gene locus_tag LOCUS_00570 gene tauD 61841 61002 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_00570 62711 61869 gene locus_tag LOCUS_00580 62711 61869 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 protein_id gnl|my_center|LOCUS_00580 63097 62708 gene locus_tag LOCUS_00590 63097 62708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 63270 63680 gene locus_tag LOCUS_00600 gene gloA 63270 63680 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 protein_id gnl|my_center|LOCUS_00600 63818 65107 gene locus_tag LOCUS_00610 63818 65107 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_00610 67132 65111 gene locus_tag LOCUS_00620 67132 65111 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_00620 67795 67178 gene locus_tag LOCUS_00630 67795 67178 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_00630 69483 67795 gene locus_tag LOCUS_00640 69483 67795 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence002 <1 709 gene locus_tag LOCUS_00650 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125527.1:TraR/DksA family transcriptional regulator 889 1323 gene locus_tag LOCUS_00660 889 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1325 2266 gene locus_tag LOCUS_00670 1325 2266 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_00670 2723 2238 gene locus_tag LOCUS_00680 2723 2238 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_00680 2801 3931 gene locus_tag LOCUS_00690 2801 3931 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_00690 3956 4459 gene locus_tag LOCUS_00700 3956 4459 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_00700 5052 4474 gene locus_tag LOCUS_00710 5052 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5234 8773 gene locus_tag LOCUS_00720 gene dnaE 5234 8773 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_00720 8855 9523 gene locus_tag LOCUS_00730 8855 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 9573 10139 gene locus_tag LOCUS_00740 9573 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12125 10140 gene locus_tag LOCUS_00750 12125 10140 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_00750 12166 12993 gene locus_tag LOCUS_00760 12166 12993 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_00760 13821 13003 gene locus_tag LOCUS_00770 13821 13003 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083337.1 protein_id gnl|my_center|LOCUS_00770 14862 13846 gene locus_tag LOCUS_00780 gene menE 14862 13846 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402892.1 protein_id gnl|my_center|LOCUS_00780 14767 14955 gene locus_tag LOCUS_00790 14767 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 15008 15898 gene locus_tag LOCUS_00800 15008 15898 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_00800 16717 15899 gene locus_tag LOCUS_00810 gene menH 16717 15899 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_00810 16716 18413 gene locus_tag LOCUS_00820 gene menD 16716 18413 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_00820 19689 18403 gene locus_tag LOCUS_00830 19689 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 20396 19686 gene locus_tag LOCUS_00840 gene ubiE 20396 19686 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_00840 22034 20439 gene locus_tag LOCUS_00850 22034 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_00850 23855 22215 gene locus_tag LOCUS_00860 23855 22215 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_00860 24227 23862 gene locus_tag LOCUS_00870 24227 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 24248 25096 gene locus_tag LOCUS_00880 24248 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26118 25021 gene locus_tag LOCUS_00890 gene rlmN 26118 25021 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_00890 26735 26115 gene locus_tag LOCUS_00900 26735 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 26779 27420 gene locus_tag LOCUS_00910 gene nth 26779 27420 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_00910 27736 27515 gene locus_tag LOCUS_00920 27736 27515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 27943 29247 gene locus_tag LOCUS_00930 gene hisD 27943 29247 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_00930 29244 30308 gene locus_tag LOCUS_00940 29244 30308 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_00940 30305 30919 gene locus_tag LOCUS_00950 gene hisB 30305 30919 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_00950 30916 31554 gene locus_tag LOCUS_00960 gene hisH 30916 31554 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_00960 31554 32285 gene locus_tag LOCUS_00970 gene hisA 31554 32285 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_00970 32320 32943 gene locus_tag LOCUS_00980 32320 32943 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839433.1 protein_id gnl|my_center|LOCUS_00980 32954 33727 gene locus_tag LOCUS_00990 gene hisF 32954 33727 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_00990 34389 33742 gene locus_tag LOCUS_01000 gene coxH3 34389 33742 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_01000 34414 34782 gene locus_tag LOCUS_01010 34414 34782 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_01010 34842 35204 gene locus_tag LOCUS_01020 34842 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 35207 36733 gene locus_tag LOCUS_01030 35207 36733 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_01030 36777 37709 gene locus_tag LOCUS_01040 36777 37709 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 protein_id gnl|my_center|LOCUS_01040 37719 38261 gene locus_tag LOCUS_01050 37719 38261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 38285 38599 gene locus_tag LOCUS_01060 38285 38599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 38686 39390 gene locus_tag LOCUS_01070 gene trpC 38686 39390 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_01070 39448 40080 gene locus_tag LOCUS_01080 39448 40080 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723935.1 protein_id gnl|my_center|LOCUS_01080 40148 41248 gene locus_tag LOCUS_01090 gene trpB 40148 41248 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_01090 41245 42075 gene locus_tag LOCUS_01100 gene trpA 41245 42075 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_01100 42072 42500 gene locus_tag LOCUS_01110 42072 42500 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878109.1 protein_id gnl|my_center|LOCUS_01110 42709 42993 gene locus_tag LOCUS_01120 42709 42993 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_01120 43107 43571 gene locus_tag LOCUS_01130 gene bcp 43107 43571 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_01130 43568 43993 gene locus_tag LOCUS_01140 gene fabZ 43568 43993 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_01140 43997 44464 gene locus_tag LOCUS_01150 43997 44464 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_01150 45652 44471 gene locus_tag LOCUS_01160 gene fabF 45652 44471 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_01160 45882 45649 gene locus_tag LOCUS_01170 gene acpP 45882 45649 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_01170 46662 45952 gene locus_tag LOCUS_01180 gene fabG 46662 45952 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_01180 47621 46659 gene locus_tag LOCUS_01190 gene fabH 47621 46659 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100539.1 protein_id gnl|my_center|LOCUS_01190 48876 47644 gene locus_tag LOCUS_01200 48876 47644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 49006 48922 gene locus_tag LOCUS_t00020 49006 48922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48985 49404 gene locus_tag LOCUS_01210 48985 49404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 49467 50051 gene locus_tag LOCUS_01220 49467 50051 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_01220 50048 52735 gene locus_tag LOCUS_01230 gene polA 50048 52735 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 protein_id gnl|my_center|LOCUS_01230 52737 53480 gene locus_tag LOCUS_01240 52737 53480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence003 <1 1461 gene locus_tag LOCUS_01250 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112031.1:acetyl-CoA acetyltransferase 1559 2770 gene locus_tag LOCUS_01260 1559 2770 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_01260 2777 3589 gene locus_tag LOCUS_01270 2777 3589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_01270 3652 4455 gene locus_tag LOCUS_01280 gene fabG 3652 4455 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_01280 4505 5515 gene locus_tag LOCUS_01290 4505 5515 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_01290 5580 7175 gene locus_tag LOCUS_01300 5580 7175 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_01300 7172 8197 gene locus_tag LOCUS_01310 7172 8197 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_01310 8199 9341 gene locus_tag LOCUS_01320 8199 9341 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_01320 9397 10683 gene locus_tag LOCUS_01330 9397 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10698 12008 gene locus_tag LOCUS_01340 10698 12008 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026178447.1 protein_id gnl|my_center|LOCUS_01340 12015 12668 gene locus_tag LOCUS_01350 12015 12668 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059796.1 protein_id gnl|my_center|LOCUS_01350 12709 13821 gene locus_tag LOCUS_01360 12709 13821 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_01360 14013 14384 gene locus_tag LOCUS_01370 14013 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 14433 16022 gene locus_tag LOCUS_01380 gene fadD8 14433 16022 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_01380 16220 18490 gene locus_tag LOCUS_01390 16220 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 18477 19217 gene locus_tag LOCUS_01400 18477 19217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_01400 19214 19954 gene locus_tag LOCUS_01410 19214 19954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_01410 19967 20335 gene locus_tag LOCUS_01420 19967 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 20335 21141 gene locus_tag LOCUS_01430 20335 21141 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_01430 21983 21192 gene locus_tag LOCUS_01440 21983 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01440 22910 21984 gene locus_tag LOCUS_01450 22910 21984 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_01450 23839 22913 gene locus_tag LOCUS_01460 23839 22913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_01460 24642 23839 gene locus_tag LOCUS_01470 24642 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 27276 24685 gene locus_tag LOCUS_01480 27276 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 28262 27351 gene locus_tag LOCUS_01490 28262 27351 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_01490 29054 28284 gene locus_tag LOCUS_01500 29054 28284 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_01500 29614 29045 gene locus_tag LOCUS_01510 29614 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 29720 30895 gene locus_tag LOCUS_01520 29720 30895 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_01520 30915 31970 gene locus_tag LOCUS_01530 30915 31970 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224294.1 protein_id gnl|my_center|LOCUS_01530 33040 32039 gene locus_tag LOCUS_01540 33040 32039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34872 33130 gene locus_tag LOCUS_01550 34872 33130 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01550 34976 36469 gene locus_tag LOCUS_01560 34976 36469 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_01560 36521 37627 gene locus_tag LOCUS_01570 36521 37627 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_01570 37715 38461 gene locus_tag LOCUS_01580 37715 38461 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_01580 38625 40004 gene locus_tag LOCUS_01590 38625 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 40086 42293 gene locus_tag LOCUS_01600 40086 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 42290 43033 gene locus_tag LOCUS_01610 42290 43033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_01610 43030 43737 gene locus_tag LOCUS_01620 43030 43737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_01620 43757 44116 gene locus_tag LOCUS_01630 43757 44116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 44268 45161 gene locus_tag LOCUS_01640 44268 45161 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_01640 45182 46366 gene locus_tag LOCUS_01650 45182 46366 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_01650 46363 47124 gene locus_tag LOCUS_01660 46363 47124 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_01660 48594 47125 gene locus_tag LOCUS_01670 48594 47125 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_01670 48750 49571 gene locus_tag LOCUS_01680 48750 49571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 49585 50784 gene locus_tag LOCUS_01690 49585 50784 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730165.1 protein_id gnl|my_center|LOCUS_01690 52149 50788 gene locus_tag LOCUS_01700 52149 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 52909 52154 gene locus_tag LOCUS_01710 52909 52154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence004 <1 656 gene locus_tag LOCUS_01720 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081124.1:thiolase family protein 666 1028 gene locus_tag LOCUS_01730 666 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1445 1122 gene locus_tag LOCUS_01740 1445 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1519 2100 gene locus_tag LOCUS_01750 1519 2100 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_01750 3856 2147 gene locus_tag LOCUS_01760 gene pknB 3856 2147 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_01760 5475 3994 gene locus_tag LOCUS_01770 5475 3994 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_01770 6776 5472 gene locus_tag LOCUS_01780 gene rodA 6776 5472 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_01780 8007 6781 gene locus_tag LOCUS_01790 8007 6781 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_01790 8480 8004 gene locus_tag LOCUS_01800 8480 8004 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_01800 9142 8483 gene locus_tag LOCUS_01810 9142 8483 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_01810 9270 9356 gene locus_tag LOCUS_t00030 9270 9356 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11042 9414 gene locus_tag LOCUS_01820 11042 9414 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_01820 12078 11128 gene locus_tag LOCUS_01830 12078 11128 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_01830 13246 12116 gene locus_tag LOCUS_01840 13246 12116 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_01840 13464 13988 gene locus_tag LOCUS_01850 13464 13988 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_01850 13985 14386 gene locus_tag LOCUS_01860 13985 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 16170 14383 gene locus_tag LOCUS_01870 16170 14383 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_01870 17150 16302 gene locus_tag LOCUS_01880 17150 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 17755 17147 gene locus_tag LOCUS_01890 17755 17147 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 protein_id gnl|my_center|LOCUS_01890 17813 18655 gene locus_tag LOCUS_01900 17813 18655 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 protein_id gnl|my_center|LOCUS_01900 18680 20662 gene locus_tag LOCUS_01910 18680 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 22173 20671 gene locus_tag LOCUS_01920 22173 20671 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_01920 22303 25332 gene locus_tag LOCUS_01930 22303 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 25842 25336 gene locus_tag LOCUS_01940 25842 25336 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064991.1 protein_id gnl|my_center|LOCUS_01940 27249 25930 gene locus_tag LOCUS_01950 27249 25930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_01950 27755 27246 gene locus_tag LOCUS_01960 27755 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 28014 27847 gene locus_tag LOCUS_01970 28014 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 27971 28630 gene locus_tag LOCUS_01980 gene modA 27971 28630 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_01980 28627 29466 gene locus_tag LOCUS_01990 28627 29466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_01990 29463 30527 gene locus_tag LOCUS_02000 29463 30527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_02000 30834 34061 gene locus_tag LOCUS_02010 30834 34061 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225383.1 protein_id gnl|my_center|LOCUS_02010 34058 34348 gene locus_tag LOCUS_02020 34058 34348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 34370 35809 gene locus_tag LOCUS_02030 34370 35809 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_02030 36752 36033 gene locus_tag LOCUS_02040 36752 36033 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228182.1 protein_id gnl|my_center|LOCUS_02040 37612 36791 gene locus_tag LOCUS_02050 37612 36791 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_02050 37708 38505 gene locus_tag LOCUS_02060 gene budA 37708 38505 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_02060 38940 38506 gene locus_tag LOCUS_02070 38940 38506 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967708.1 protein_id gnl|my_center|LOCUS_02070 40520 38958 gene locus_tag LOCUS_02080 40520 38958 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066904.1 protein_id gnl|my_center|LOCUS_02080 40523 41149 gene locus_tag LOCUS_02090 40523 41149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 41273 41476 gene locus_tag LOCUS_02100 41273 41476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 41473 41859 gene locus_tag LOCUS_02110 41473 41859 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_02110 41914 43185 gene locus_tag LOCUS_02120 41914 43185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 44962 43196 gene locus_tag LOCUS_02130 44962 43196 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_02130 45869 45195 gene locus_tag LOCUS_02140 45869 45195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_02140 47419 45869 gene locus_tag LOCUS_02150 47419 45869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_02150 47995 47555 gene locus_tag LOCUS_02160 47995 47555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 48031 48447 gene locus_tag LOCUS_02170 48031 48447 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728622.1 protein_id gnl|my_center|LOCUS_02170 48868 48674 gene locus_tag LOCUS_02180 48868 48674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 49160 49960 gene locus_tag LOCUS_02190 49160 49960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 49965 50585 gene locus_tag LOCUS_02200 49965 50585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 50614 50955 gene locus_tag LOCUS_02210 50614 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 51461 51015 gene locus_tag LOCUS_02220 51461 51015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence005 1439 279 gene locus_tag LOCUS_02230 1439 279 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_02230 1524 2306 gene locus_tag LOCUS_02240 1524 2306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_02240 2329 3852 gene locus_tag LOCUS_02250 2329 3852 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104262.1 protein_id gnl|my_center|LOCUS_02250 3979 4374 gene locus_tag LOCUS_02260 3979 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4485 6590 gene locus_tag LOCUS_02270 4485 6590 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_02270 7148 6666 gene locus_tag LOCUS_02280 7148 6666 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_02280 7725 7228 gene locus_tag LOCUS_02290 7725 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8528 7722 gene locus_tag LOCUS_02300 8528 7722 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_02300 9817 8525 gene locus_tag LOCUS_02310 9817 8525 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_02310 9984 10754 gene locus_tag LOCUS_02320 gene fabG 9984 10754 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_02320 11686 10769 gene locus_tag LOCUS_02330 11686 10769 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_02330 12145 12921 gene locus_tag LOCUS_02340 12145 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12918 14018 gene locus_tag LOCUS_02350 12918 14018 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_02350 14015 15649 gene locus_tag LOCUS_02360 14015 15649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_02360 15646 16485 gene locus_tag LOCUS_02370 15646 16485 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_02370 16508 17473 gene locus_tag LOCUS_02380 gene gyaR 16508 17473 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_02380 18341 17478 gene locus_tag LOCUS_02390 18341 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 19092 18430 gene locus_tag LOCUS_02400 gene bioD 19092 18430 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868999.1 protein_id gnl|my_center|LOCUS_02400 20246 19089 gene locus_tag LOCUS_02410 gene bioF 20246 19089 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_02410 21556 20234 gene locus_tag LOCUS_02420 gene bioA 21556 20234 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_02420 22944 21553 gene locus_tag LOCUS_02430 22944 21553 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056872.1 protein_id gnl|my_center|LOCUS_02430 23160 24668 gene locus_tag LOCUS_02440 23160 24668 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_02440 24665 25363 gene locus_tag LOCUS_02450 gene queC 24665 25363 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922142.1 protein_id gnl|my_center|LOCUS_02450 25866 25408 gene locus_tag LOCUS_02460 25866 25408 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_02460 25969 26820 gene locus_tag LOCUS_02470 25969 26820 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_02470 26807 27166 gene locus_tag LOCUS_02480 26807 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 27981 27175 gene locus_tag LOCUS_02490 27981 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 28901 28104 gene locus_tag LOCUS_02500 28901 28104 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_02500 30371 28989 gene locus_tag LOCUS_02510 30371 28989 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_02510 31063 30368 gene locus_tag LOCUS_02520 31063 30368 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_02520 31208 31747 gene locus_tag LOCUS_02530 31208 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 32269 31748 gene locus_tag LOCUS_02540 32269 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 32427 33266 gene locus_tag LOCUS_02550 32427 33266 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_02550 33285 33890 gene locus_tag LOCUS_02560 33285 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 34604 33891 gene locus_tag LOCUS_02570 34604 33891 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_02570 34649 35518 gene locus_tag LOCUS_02580 34649 35518 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418777.1 protein_id gnl|my_center|LOCUS_02580 36352 35519 gene locus_tag LOCUS_02590 36352 35519 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_02590 37102 36356 gene locus_tag LOCUS_02600 37102 36356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904169.1 protein_id gnl|my_center|LOCUS_02600 38664 37099 gene locus_tag LOCUS_02610 38664 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 40514 38697 gene locus_tag LOCUS_02620 40514 38697 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_02620 40722 41879 gene locus_tag LOCUS_02630 40722 41879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 41995 42651 gene locus_tag LOCUS_02640 gene nfuA 41995 42651 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_02640 42829 43632 gene locus_tag LOCUS_02650 42829 43632 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_02650 43681 44703 gene locus_tag LOCUS_02660 43681 44703 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_02660 44703 45773 gene locus_tag LOCUS_02670 44703 45773 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_02670 45770 46927 gene locus_tag LOCUS_02680 45770 46927 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085868.1 protein_id gnl|my_center|LOCUS_02680 47007 47843 gene locus_tag LOCUS_02690 47007 47843 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_02690 47840 48334 gene locus_tag LOCUS_02700 47840 48334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence006 280 1845 gene locus_tag LOCUS_02710 gene purF 280 1845 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_02710 1838 2887 gene locus_tag LOCUS_02720 gene purM 1838 2887 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_02720 2933 3499 gene locus_tag LOCUS_02730 gene pyrE 2933 3499 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_02730 3590 4996 gene locus_tag LOCUS_02740 3590 4996 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 protein_id gnl|my_center|LOCUS_02740 5002 5727 gene locus_tag LOCUS_02750 5002 5727 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_02750 5811 6731 gene locus_tag LOCUS_02760 5811 6731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_02760 6869 7774 gene locus_tag LOCUS_02770 6869 7774 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_02770 7906 7833 gene locus_tag LOCUS_t00040 7906 7833 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8034 7957 gene locus_tag LOCUS_t00050 8034 7957 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8120 8047 gene locus_tag LOCUS_t00060 8120 8047 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8695 8207 gene locus_tag LOCUS_02780 8695 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9002 8697 gene locus_tag LOCUS_02790 gene clpS 9002 8697 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_02790 9913 8999 gene locus_tag LOCUS_02800 9913 8999 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_02800 10037 10933 gene locus_tag LOCUS_02810 10037 10933 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_02810 11114 12676 gene locus_tag LOCUS_02820 gene ctaD 11114 12676 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868161.1 protein_id gnl|my_center|LOCUS_02820 12679 13269 gene locus_tag LOCUS_02830 12679 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 13433 13254 gene locus_tag LOCUS_02840 13433 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 13387 14133 gene locus_tag LOCUS_02850 13387 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 14316 15536 gene locus_tag LOCUS_02860 gene coxB 14316 15536 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_02860 15579 17594 gene locus_tag LOCUS_02870 gene ctaD 15579 17594 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_02870 17587 18222 gene locus_tag LOCUS_02880 gene cyoC 17587 18222 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483335.1 protein_id gnl|my_center|LOCUS_02880 18237 18593 gene locus_tag LOCUS_02890 18237 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 18633 19535 gene locus_tag LOCUS_02900 gene ctaG 18633 19535 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_02900 20264 19536 gene locus_tag LOCUS_02910 20264 19536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_02910 21232 20261 gene locus_tag LOCUS_02920 21232 20261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_02920 21272 22564 gene locus_tag LOCUS_02930 gene serS 21272 22564 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485584.1 protein_id gnl|my_center|LOCUS_02930 22572 22973 gene locus_tag LOCUS_02940 gene crcB 22572 22973 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_02940 22970 23338 gene locus_tag LOCUS_02950 22970 23338 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886831.1 protein_id gnl|my_center|LOCUS_02950 23385 24038 gene locus_tag LOCUS_02960 gene pdxH 23385 24038 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_02960 24982 24050 gene locus_tag LOCUS_02970 24982 24050 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_02970 25852 24992 gene locus_tag LOCUS_02980 25852 24992 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_02980 26468 25854 gene locus_tag LOCUS_02990 26468 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 26978 26634 gene locus_tag LOCUS_03000 26978 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 27541 28266 gene locus_tag LOCUS_03010 27541 28266 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908915.1 protein_id gnl|my_center|LOCUS_03010 29454 28282 gene locus_tag LOCUS_03020 29454 28282 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_03020 29562 29882 gene locus_tag LOCUS_03030 gene erpA 29562 29882 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_03030 29974 31617 gene locus_tag LOCUS_03040 29974 31617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 31598 31978 gene locus_tag LOCUS_03050 31598 31978 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_03050 31989 32156 gene locus_tag LOCUS_03060 31989 32156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 32310 32510 gene locus_tag LOCUS_03070 32310 32510 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_03070 33277 32597 gene locus_tag LOCUS_03080 33277 32597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_03080 34617 33283 gene locus_tag LOCUS_03090 gene glnA 34617 33283 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112411.1 protein_id gnl|my_center|LOCUS_03090 34833 36257 gene locus_tag LOCUS_03100 gene glnA 34833 36257 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895686.1 protein_id gnl|my_center|LOCUS_03100 36468 37361 gene locus_tag LOCUS_03110 36468 37361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 37405 38049 gene locus_tag LOCUS_03120 37405 38049 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_03120 39474 38050 gene locus_tag LOCUS_03130 39474 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 41909 39522 gene locus_tag LOCUS_03140 41909 39522 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 41994 42236 gene locus_tag LOCUS_03150 41994 42236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 42303 44003 gene locus_tag LOCUS_03160 42303 44003 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_03160 44035 44583 gene locus_tag LOCUS_03170 44035 44583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 44703 45638 gene locus_tag LOCUS_03180 gene rpoD 44703 45638 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_03180 45664 46284 gene locus_tag LOCUS_03190 45664 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 47266 46358 gene locus_tag LOCUS_03200 47266 46358 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence007 215 670 gene locus_tag LOCUS_03210 215 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_03210 725 2449 gene locus_tag LOCUS_03220 725 2449 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_03220 3487 2534 gene locus_tag LOCUS_03230 3487 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4870 3497 gene locus_tag LOCUS_03240 4870 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5784 4867 gene locus_tag LOCUS_03250 5784 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6032 6457 gene locus_tag LOCUS_03260 6032 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6949 6491 gene locus_tag LOCUS_03270 6949 6491 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 protein_id gnl|my_center|LOCUS_03270 8406 6976 gene locus_tag LOCUS_03280 8406 6976 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 protein_id gnl|my_center|LOCUS_03280 8480 9550 gene locus_tag LOCUS_03290 8480 9550 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_03290 11079 9667 gene locus_tag LOCUS_03300 11079 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 11827 11321 gene locus_tag LOCUS_03310 11827 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13423 11861 gene locus_tag LOCUS_03320 13423 11861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_03320 13582 14154 gene locus_tag LOCUS_03330 13582 14154 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973632.1 protein_id gnl|my_center|LOCUS_03330 14506 14105 gene locus_tag LOCUS_03340 14506 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 15777 14488 gene locus_tag LOCUS_03350 15777 14488 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_03350 17123 15789 gene locus_tag LOCUS_03360 17123 15789 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_03360 17415 18242 gene locus_tag LOCUS_03370 gene yaaA 17415 18242 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_03370 18276 20564 gene locus_tag LOCUS_03380 18276 20564 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_03380 20561 20767 gene locus_tag LOCUS_03390 20561 20767 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720048.1 protein_id gnl|my_center|LOCUS_03390 22730 20772 gene locus_tag LOCUS_03400 22730 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 24235 22742 gene locus_tag LOCUS_03410 24235 22742 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974139.1 protein_id gnl|my_center|LOCUS_03410 24909 24253 gene locus_tag LOCUS_03420 24909 24253 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_03420 25853 24915 gene locus_tag LOCUS_03430 gene hemC 25853 24915 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350351.1 protein_id gnl|my_center|LOCUS_03430 27120 25861 gene locus_tag LOCUS_03440 gene hemA 27120 25861 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_03440 27737 27108 gene locus_tag LOCUS_03450 27737 27108 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_03450 28393 27734 gene locus_tag LOCUS_03460 28393 27734 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_03460 28524 29294 gene locus_tag LOCUS_03470 28524 29294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 30271 29411 gene locus_tag LOCUS_03480 30271 29411 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_03480 31095 30304 gene locus_tag LOCUS_03490 gene proC 31095 30304 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_03490 31763 31296 gene locus_tag LOCUS_03500 31763 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 32984 31767 gene locus_tag LOCUS_03510 gene mshA 32984 31767 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_03510 33861 33091 gene locus_tag LOCUS_03520 33861 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 34100 33858 gene locus_tag LOCUS_03530 34100 33858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 34161 34751 gene locus_tag LOCUS_03540 34161 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 34826 35410 gene locus_tag LOCUS_03550 34826 35410 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_03550 36097 35414 gene locus_tag LOCUS_03560 36097 35414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 36954 36094 gene locus_tag LOCUS_03570 gene hpnK 36954 36094 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192157.1 protein_id gnl|my_center|LOCUS_03570 37733 36951 gene locus_tag LOCUS_03580 37733 36951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 38964 37738 gene locus_tag LOCUS_03590 38964 37738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 39076 39152 gene locus_tag LOCUS_t00070 39076 39152 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39950 39219 gene locus_tag LOCUS_03600 39950 39219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 40525 39947 gene locus_tag LOCUS_03610 40525 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 40636 41103 gene locus_tag LOCUS_03620 40636 41103 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_03620 41124 41552 gene locus_tag LOCUS_03630 41124 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03630 41575 43938 gene locus_tag LOCUS_03640 41575 43938 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_03640 44489 44007 gene locus_tag LOCUS_03650 gene dut 44489 44007 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_03650 44488 45048 gene locus_tag LOCUS_03660 gene orn 44488 45048 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 protein_id gnl|my_center|LOCUS_03660 45110 46231 gene locus_tag LOCUS_03670 45110 46231 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_03670 46237 47625 gene locus_tag LOCUS_03680 46237 47625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890734.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence008 1368 469 gene locus_tag LOCUS_03690 gene truB 1368 469 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_03690 1757 1365 gene locus_tag LOCUS_03700 gene rbfA 1757 1365 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810550.1 protein_id gnl|my_center|LOCUS_03700 4702 1814 gene locus_tag LOCUS_03710 4702 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 6071 4833 gene locus_tag LOCUS_03720 6071 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6664 6068 gene locus_tag LOCUS_03730 6664 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8316 6904 gene locus_tag LOCUS_03740 gene proS 8316 6904 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_03740 9597 8368 gene locus_tag LOCUS_03750 gene ispG 9597 8368 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_03750 11137 9614 gene locus_tag LOCUS_03760 gene rip 11137 9614 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899518.1 protein_id gnl|my_center|LOCUS_03760 12333 11134 gene locus_tag LOCUS_03770 12333 11134 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_03770 13842 12376 gene locus_tag LOCUS_03780 13842 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 14411 13842 gene locus_tag LOCUS_03790 gene frr 14411 13842 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_03790 15195 14464 gene locus_tag LOCUS_03800 gene pyrH 15195 14464 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356761.1 protein_id gnl|my_center|LOCUS_03800 15989 15195 gene locus_tag LOCUS_03810 gene tsf 15989 15195 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_03810 16901 15996 gene locus_tag LOCUS_03820 16901 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 18588 17092 gene locus_tag LOCUS_03830 18588 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 19796 18831 gene locus_tag LOCUS_03840 gene xerC 19796 18831 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_03840 20941 19793 gene locus_tag LOCUS_03850 gene dprA 20941 19793 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_03850 22456 20942 gene locus_tag LOCUS_03860 22456 20942 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_03860 22712 23461 gene locus_tag LOCUS_03870 22712 23461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 23937 23530 gene locus_tag LOCUS_03880 23937 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 24070 24294 gene locus_tag LOCUS_03890 24070 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 24309 24986 gene locus_tag LOCUS_03900 24309 24986 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_03900 25779 24997 gene locus_tag LOCUS_03910 25779 24997 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_03910 27485 25845 gene locus_tag LOCUS_03920 gene pgi 27485 25845 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_03920 28441 27500 gene locus_tag LOCUS_03930 28441 27500 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_03930 29459 28431 gene locus_tag LOCUS_03940 gene gnd 29459 28431 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_03940 29602 31905 gene locus_tag LOCUS_03950 29602 31905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 32001 33461 gene locus_tag LOCUS_03960 32001 33461 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_03960 34838 33531 gene locus_tag LOCUS_03970 34838 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 35862 34843 gene locus_tag LOCUS_03980 35862 34843 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_03980 37047 35869 gene locus_tag LOCUS_03990 37047 35869 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_03990 37241 38485 gene locus_tag LOCUS_04000 37241 38485 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_04000 38533 39036 gene locus_tag LOCUS_04010 38533 39036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 39033 39860 gene locus_tag LOCUS_04020 39033 39860 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_04020 40517 39861 gene locus_tag LOCUS_04030 40517 39861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 <43858 40588 gene locus_tag LOCUS_04040 <43858 40588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836785.1:CshA/CshB family fibrillar adhesin-related protein >Feature sequence009 1488 364 gene locus_tag LOCUS_04050 gene prfB 1488 364 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748464.1 protein_id gnl|my_center|LOCUS_04050 4202 1485 gene locus_tag LOCUS_04060 gene secA 4202 1485 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_04060 4777 4289 gene locus_tag LOCUS_04070 4777 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5837 5022 gene locus_tag LOCUS_04080 5837 5022 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_04080 7378 5915 gene locus_tag LOCUS_04090 gene ahcY 7378 5915 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_04090 8581 7544 gene locus_tag LOCUS_04100 8581 7544 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_04100 8821 8585 gene locus_tag LOCUS_04110 8821 8585 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_04110 10240 8840 gene locus_tag LOCUS_04120 10240 8840 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_04120 11193 10252 gene locus_tag LOCUS_04130 11193 10252 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_04130 13742 11184 gene locus_tag LOCUS_04140 13742 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 14804 13791 gene locus_tag LOCUS_04150 14804 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 14867 15097 gene locus_tag LOCUS_04160 14867 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15155 17128 gene locus_tag LOCUS_04170 gene ftsH 15155 17128 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_04170 17585 17130 gene locus_tag LOCUS_04180 17585 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 19240 17588 gene locus_tag LOCUS_04190 19240 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22824 19237 gene locus_tag LOCUS_04200 22824 19237 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_04200 23112 24236 gene locus_tag LOCUS_04210 23112 24236 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_04210 24246 25151 gene locus_tag LOCUS_04220 24246 25151 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_04220 25245 26225 gene locus_tag LOCUS_04230 gene gmd 25245 26225 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_04230 26231 27199 gene locus_tag LOCUS_04240 gene cofD 26231 27199 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_04240 27196 27912 gene locus_tag LOCUS_04250 27196 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 27946 29052 gene locus_tag LOCUS_04260 27946 29052 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223312.1 protein_id gnl|my_center|LOCUS_04260 29999 29049 gene locus_tag LOCUS_04270 29999 29049 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_04270 31003 30002 gene locus_tag LOCUS_04280 31003 30002 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_04280 31290 31000 gene locus_tag LOCUS_04290 31290 31000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 32611 31340 gene locus_tag LOCUS_04300 32611 31340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_04300 33753 32608 gene locus_tag LOCUS_04310 33753 32608 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_04310 34838 33750 gene locus_tag LOCUS_04320 34838 33750 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_04320 34948 35925 gene locus_tag LOCUS_04330 34948 35925 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_04330 37189 35981 gene locus_tag LOCUS_04340 37189 35981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 37295 38275 gene locus_tag LOCUS_04350 37295 38275 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_04350 38272 39087 gene locus_tag LOCUS_04360 38272 39087 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_04360 39907 39095 gene locus_tag LOCUS_04370 39907 39095 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080805.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence010 5879 1317 gene locus_tag LOCUS_04380 gene gltB 5879 1317 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_04380 6081 7403 gene locus_tag LOCUS_04390 6081 7403 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_04390 7400 7990 gene locus_tag LOCUS_04400 7400 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8043 8642 gene locus_tag LOCUS_04410 8043 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9601 8684 gene locus_tag LOCUS_04420 9601 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9882 11186 gene locus_tag LOCUS_04430 9882 11186 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_04430 12362 11190 gene locus_tag LOCUS_04440 12362 11190 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_04440 12669 13163 gene locus_tag LOCUS_04450 12669 13163 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_04450 14133 13168 gene locus_tag LOCUS_04460 14133 13168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_04460 15257 14130 gene locus_tag LOCUS_04470 15257 14130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_04470 16816 15254 gene locus_tag LOCUS_04480 16816 15254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_04480 17999 16836 gene locus_tag LOCUS_04490 17999 16836 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_04490 18173 19438 gene locus_tag LOCUS_04500 18173 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 19806 19384 gene locus_tag LOCUS_04510 19806 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 19887 20675 gene locus_tag LOCUS_04520 19887 20675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 20705 22342 gene locus_tag LOCUS_04530 20705 22342 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_04530 23936 22368 gene locus_tag LOCUS_04540 23936 22368 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_04540 24334 24011 gene locus_tag LOCUS_04550 24334 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 24218 25081 gene locus_tag LOCUS_04560 24218 25081 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_04560 25594 25094 gene locus_tag LOCUS_04570 25594 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 26804 25608 gene locus_tag LOCUS_04580 26804 25608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 27365 26940 gene locus_tag LOCUS_04590 27365 26940 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 protein_id gnl|my_center|LOCUS_04590 28570 27362 gene locus_tag LOCUS_04600 28570 27362 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225718.1 protein_id gnl|my_center|LOCUS_04600 28603 29499 gene locus_tag LOCUS_04610 28603 29499 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_04610 29970 29509 gene locus_tag LOCUS_04620 29970 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 31676 30012 gene locus_tag LOCUS_04630 31676 30012 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_04630 32927 31716 gene locus_tag LOCUS_04640 32927 31716 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_04640 33019 33900 gene locus_tag LOCUS_04650 33019 33900 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081490.1 protein_id gnl|my_center|LOCUS_04650 33914 34855 gene locus_tag LOCUS_04660 33914 34855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_04660 35260 34859 gene locus_tag LOCUS_04670 35260 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence011 1 1134 gene locus_tag LOCUS_04680 1 1134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_04680 1224 2270 gene locus_tag LOCUS_04690 1224 2270 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_04690 2272 3108 gene locus_tag LOCUS_04700 2272 3108 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172927.1 protein_id gnl|my_center|LOCUS_04700 3105 4667 gene locus_tag LOCUS_04710 3105 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5641 4682 gene locus_tag LOCUS_04720 5641 4682 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_04720 5892 6725 gene locus_tag LOCUS_04730 5892 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6768 7973 gene locus_tag LOCUS_04740 6768 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9534 7981 gene locus_tag LOCUS_04750 9534 7981 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_04750 9710 10195 gene locus_tag LOCUS_04760 9710 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10347 10276 gene locus_tag LOCUS_t00080 10347 10276 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11667 10381 gene locus_tag LOCUS_04770 11667 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 11931 12932 gene locus_tag LOCUS_04780 11931 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13143 14096 gene locus_tag LOCUS_04790 13143 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 14234 14158 gene locus_tag LOCUS_t00090 14234 14158 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14343 15719 gene locus_tag LOCUS_04800 gene tig 14343 15719 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_04800 15716 16381 gene locus_tag LOCUS_04810 gene clpP 15716 16381 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_04810 16410 17681 gene locus_tag LOCUS_04820 gene clpX 16410 17681 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_04820 17714 19018 gene locus_tag LOCUS_04830 17714 19018 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_04830 19075 19482 gene locus_tag LOCUS_04840 gene ndk 19075 19482 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_04840 19666 20754 gene locus_tag LOCUS_04850 19666 20754 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_04850 20900 21598 gene locus_tag LOCUS_04860 20900 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 21602 22111 gene locus_tag LOCUS_04870 21602 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 22191 24146 gene locus_tag LOCUS_04880 gene mrdA 22191 24146 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_04880 24146 25291 gene locus_tag LOCUS_04890 gene rodA 24146 25291 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_04890 25323 27275 gene locus_tag LOCUS_04900 25323 27275 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_04900 27287 28006 gene locus_tag LOCUS_04910 27287 28006 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_04910 28022 30034 gene locus_tag LOCUS_04920 28022 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 30104 30409 gene locus_tag LOCUS_04930 gene rplU 30104 30409 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 protein_id gnl|my_center|LOCUS_04930 30413 30664 gene locus_tag LOCUS_04940 gene rpmA 30413 30664 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_04940 31205 30720 gene locus_tag LOCUS_04950 31205 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 31245 31448 gene locus_tag LOCUS_04960 31245 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 31482 31649 gene locus_tag LOCUS_04970 31482 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 31935 33227 gene locus_tag LOCUS_04980 gene obgE 31935 33227 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_04980 33227 34321 gene locus_tag LOCUS_04990 gene proB 33227 34321 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_04990 <35350 34318 gene locus_tag LOCUS_05000 <35350 34318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224759.1:murein biosynthesis integral membrane protein MurJ >Feature sequence012 434 3511 gene locus_tag LOCUS_05010 gene ileS 434 3511 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_05010 4541 3597 gene locus_tag LOCUS_05020 4541 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4815 4558 gene locus_tag LOCUS_05030 4815 4558 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229582.1 protein_id gnl|my_center|LOCUS_05030 5415 4825 gene locus_tag LOCUS_05040 5415 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6197 5520 gene locus_tag LOCUS_05050 6197 5520 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_05050 6727 6194 gene locus_tag LOCUS_05060 gene pgeF 6727 6194 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_05060 6617 6907 gene locus_tag LOCUS_05070 6617 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7968 6901 gene locus_tag LOCUS_05080 gene ftsZ 7968 6901 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_05080 8841 8050 gene locus_tag LOCUS_05090 8841 8050 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392366.1 protein_id gnl|my_center|LOCUS_05090 9797 8841 gene locus_tag LOCUS_05100 gene murB 9797 8841 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05100 11203 9794 gene locus_tag LOCUS_05110 gene murC 11203 9794 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_05110 12317 11187 gene locus_tag LOCUS_05120 gene murG 12317 11187 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_05120 13477 12317 gene locus_tag LOCUS_05130 gene ftsW 13477 12317 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_05130 14829 13474 gene locus_tag LOCUS_05140 gene murD 14829 13474 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_05140 15875 14841 gene locus_tag LOCUS_05150 gene mraY 15875 14841 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_05150 17305 15872 gene locus_tag LOCUS_05160 17305 15872 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_05160 19192 17309 gene locus_tag LOCUS_05170 19192 17309 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_05170 20130 19615 gene locus_tag LOCUS_05180 20130 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 21068 20127 gene locus_tag LOCUS_05190 gene rsmH 21068 20127 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_05190 21781 21302 gene locus_tag LOCUS_05200 gene mraZ 21781 21302 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_05200 22649 21987 gene locus_tag LOCUS_05210 22649 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22686 23534 gene locus_tag LOCUS_05220 22686 23534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_05220 23817 23539 gene locus_tag LOCUS_05230 23817 23539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24567 23827 gene locus_tag LOCUS_05240 24567 23827 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 25085 24699 gene locus_tag LOCUS_05250 25085 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 26442 25177 gene locus_tag LOCUS_05260 gene dinB 26442 25177 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_05260 26924 26439 gene locus_tag LOCUS_05270 26924 26439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 27751 26927 gene locus_tag LOCUS_05280 27751 26927 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_05280 27801 28073 gene locus_tag LOCUS_05290 27801 28073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 28070 28870 gene locus_tag LOCUS_05300 28070 28870 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_05300 28938 29618 gene locus_tag LOCUS_05310 28938 29618 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_05310 29675 31093 gene locus_tag LOCUS_05320 29675 31093 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_05320 32488 31253 gene locus_tag LOCUS_05330 32488 31253 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_05330 32519 34024 gene locus_tag LOCUS_05340 gene glpK 32519 34024 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence013 1172 2353 gene locus_tag LOCUS_05350 1172 2353 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_05350 2957 2355 gene locus_tag LOCUS_05360 gene recR 2957 2355 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_05360 3367 2954 gene locus_tag LOCUS_05370 3367 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5349 3400 gene locus_tag LOCUS_05380 5349 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 5233 5463 gene locus_tag LOCUS_05390 5233 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5610 5697 gene locus_tag LOCUS_t00100 5610 5697 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5734 6222 gene locus_tag LOCUS_05400 gene tadA 5734 6222 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_05400 6285 6374 gene locus_tag LOCUS_t00110 6285 6374 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6478 8337 gene locus_tag LOCUS_05410 6478 8337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_05410 9283 8342 gene locus_tag LOCUS_05420 9283 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9373 9900 gene locus_tag LOCUS_05430 9373 9900 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467027.1 protein_id gnl|my_center|LOCUS_05430 10180 10007 gene locus_tag LOCUS_05440 10180 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10165 10701 gene locus_tag LOCUS_05450 10165 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 10785 11690 gene locus_tag LOCUS_05460 10785 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 protein_id gnl|my_center|LOCUS_05460 12498 11692 gene locus_tag LOCUS_05470 gene heR 12498 11692 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_05470 12559 13467 gene locus_tag LOCUS_05480 12559 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 13731 13525 gene locus_tag LOCUS_05490 13731 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 13869 15425 gene locus_tag LOCUS_05500 13869 15425 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_05500 15422 15625 gene locus_tag LOCUS_05510 15422 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 16608 15622 gene locus_tag LOCUS_05520 16608 15622 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_05520 16698 17816 gene locus_tag LOCUS_05530 16698 17816 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_05530 19748 17826 gene locus_tag LOCUS_05540 19748 17826 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_05540 20515 19835 gene locus_tag LOCUS_05550 gene aat 20515 19835 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_05550 21409 20549 gene locus_tag LOCUS_05560 21409 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 21519 22052 gene locus_tag LOCUS_05570 21519 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 22049 22726 gene locus_tag LOCUS_05580 22049 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 23417 22737 gene locus_tag LOCUS_05590 23417 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 24372 23470 gene locus_tag LOCUS_05600 24372 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 24367 25608 gene locus_tag LOCUS_05610 24367 25608 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419828.1 protein_id gnl|my_center|LOCUS_05610 25695 26735 gene locus_tag LOCUS_05620 25695 26735 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_05620 26882 26806 gene locus_tag LOCUS_t00120 26882 26806 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27389 26934 gene locus_tag LOCUS_05630 27389 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 28500 27433 gene locus_tag LOCUS_05640 28500 27433 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_05640 29468 28497 gene locus_tag LOCUS_05650 29468 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 29489 30832 gene locus_tag LOCUS_05660 29489 30832 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_05660 30978 31241 gene locus_tag LOCUS_05670 30978 31241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 31391 31870 gene locus_tag LOCUS_05680 31391 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 31962 32711 gene locus_tag LOCUS_05690 31962 32711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence014 2202 2053 gene locus_tag LOCUS_05700 2202 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2149 3558 gene locus_tag LOCUS_05710 2149 3558 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_05710 3561 4580 gene locus_tag LOCUS_05720 gene cydB 3561 4580 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_05720 4616 6265 gene locus_tag LOCUS_05730 4616 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6262 7938 gene locus_tag LOCUS_05740 gene cydC 6262 7938 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933482.1 protein_id gnl|my_center|LOCUS_05740 8747 7929 gene locus_tag LOCUS_05750 8747 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9974 9099 gene locus_tag LOCUS_05760 9974 9099 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 protein_id gnl|my_center|LOCUS_05760 10191 11822 gene locus_tag LOCUS_05770 10191 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12008 12988 gene locus_tag LOCUS_05780 12008 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14490 13000 gene locus_tag LOCUS_05790 14490 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 14859 15137 gene locus_tag LOCUS_05800 14859 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 16112 15516 gene locus_tag LOCUS_05810 16112 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 17505 16222 gene locus_tag LOCUS_05820 17505 16222 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_05820 18173 17619 gene locus_tag LOCUS_05830 18173 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 20034 18478 gene locus_tag LOCUS_05840 20034 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 22134 20188 gene locus_tag LOCUS_05850 22134 20188 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_05850 22489 23286 gene locus_tag LOCUS_05860 22489 23286 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_05860 24033 23308 gene locus_tag LOCUS_05870 24033 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 25004 24264 gene locus_tag LOCUS_05880 25004 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 protein_id gnl|my_center|LOCUS_05880 27265 25064 gene locus_tag LOCUS_05890 27265 25064 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_05890 28039 27359 gene locus_tag LOCUS_05900 28039 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 30468 28264 gene locus_tag LOCUS_05910 30468 28264 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_05910 32258 30594 gene locus_tag LOCUS_05920 32258 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence015 432 88 gene locus_tag LOCUS_05930 432 88 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_05930 748 446 gene locus_tag LOCUS_05940 748 446 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804628.1 protein_id gnl|my_center|LOCUS_05940 1166 822 gene locus_tag LOCUS_05950 gene rplS 1166 822 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_05950 2025 1300 gene locus_tag LOCUS_05960 gene trmD 2025 1300 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_05960 2514 2032 gene locus_tag LOCUS_05970 gene rimM 2514 2032 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_05970 2806 2519 gene locus_tag LOCUS_05980 2806 2519 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_05980 3066 2803 gene locus_tag LOCUS_05990 gene rpsP 3066 2803 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_05990 4692 3190 gene locus_tag LOCUS_06000 gene ffh 4692 3190 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_06000 5000 4692 gene locus_tag LOCUS_06010 5000 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6142 4997 gene locus_tag LOCUS_06020 gene ftsY 6142 4997 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_06020 7441 6287 gene locus_tag LOCUS_06030 7441 6287 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073821.1 protein_id gnl|my_center|LOCUS_06030 8831 7677 gene locus_tag LOCUS_06040 8831 7677 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_06040 9673 8963 gene locus_tag LOCUS_06050 9673 8963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_06050 9824 10867 gene locus_tag LOCUS_06060 9824 10867 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_06060 10864 11865 gene locus_tag LOCUS_06070 10864 11865 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_06070 11862 12821 gene locus_tag LOCUS_06080 11862 12821 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_06080 16292 12831 gene locus_tag LOCUS_06090 gene smc 16292 12831 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_06090 17128 16292 gene locus_tag LOCUS_06100 gene mutM 17128 16292 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_06100 17681 17121 gene locus_tag LOCUS_06110 17681 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 18141 17851 gene locus_tag LOCUS_06120 18141 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 19245 18250 gene locus_tag LOCUS_06130 gene plsX 19245 18250 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_06130 19440 19261 gene locus_tag LOCUS_06140 19440 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 20058 19516 gene locus_tag LOCUS_06150 20058 19516 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056944.1 protein_id gnl|my_center|LOCUS_06150 20952 20062 gene locus_tag LOCUS_06160 20952 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21428 20949 gene locus_tag LOCUS_06170 gene coaD 21428 20949 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_06170 21991 21425 gene locus_tag LOCUS_06180 gene rsmD 21991 21425 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_06180 22018 22200 gene locus_tag LOCUS_06190 22018 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 22215 22649 gene locus_tag LOCUS_06200 22215 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 23333 22668 gene locus_tag LOCUS_06210 23333 22668 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228255.1 protein_id gnl|my_center|LOCUS_06210 25513 23357 gene locus_tag LOCUS_06220 gene recG 25513 23357 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_06220 27174 25510 gene locus_tag LOCUS_06230 27174 25510 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_06230 27323 27517 gene locus_tag LOCUS_06240 gene rpmB 27323 27517 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_06240 27520 27807 gene locus_tag LOCUS_06250 27520 27807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 27925 29751 gene locus_tag LOCUS_06260 27925 29751 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_06260 29880 30407 gene locus_tag LOCUS_06270 29880 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 30776 30411 gene locus_tag LOCUS_06280 30776 30411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence016 382 306 gene locus_tag LOCUS_t00130 382 306 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 491 418 gene locus_tag LOCUS_t00140 491 418 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 525 1070 gene locus_tag LOCUS_06290 525 1070 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_06290 1151 1235 gene locus_tag LOCUS_t00150 1151 1235 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1321 1809 gene locus_tag LOCUS_06300 1321 1809 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_06300 2303 1821 gene locus_tag LOCUS_06310 2303 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4258 2300 gene locus_tag LOCUS_06320 gene acs 4258 2300 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_06320 5409 4309 gene locus_tag LOCUS_06330 5409 4309 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_06330 6994 5483 gene locus_tag LOCUS_06340 6994 5483 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_06340 8558 6999 gene locus_tag LOCUS_06350 8558 6999 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_06350 10804 8576 gene locus_tag LOCUS_06360 gene nuoL 10804 8576 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_06360 11124 10810 gene locus_tag LOCUS_06370 gene nuoK 11124 10810 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_06370 11633 11124 gene locus_tag LOCUS_06380 11633 11124 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_06380 12142 11633 gene locus_tag LOCUS_06390 12142 11633 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_06390 13179 12142 gene locus_tag LOCUS_06400 13179 12142 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_06400 14351 13176 gene locus_tag LOCUS_06410 14351 13176 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_06410 15031 14348 gene locus_tag LOCUS_06420 15031 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 15509 15009 gene locus_tag LOCUS_06430 15509 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15874 15500 gene locus_tag LOCUS_06440 15874 15500 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_06440 17587 15953 gene locus_tag LOCUS_06450 17587 15953 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_06450 19236 17584 gene locus_tag LOCUS_06460 19236 17584 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06460 21224 19236 gene locus_tag LOCUS_06470 gene nuoL 21224 19236 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_06470 21538 21230 gene locus_tag LOCUS_06480 gene nuoK 21538 21230 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_06480 22140 21538 gene locus_tag LOCUS_06490 22140 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 22868 22143 gene locus_tag LOCUS_06500 22868 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 24076 22868 gene locus_tag LOCUS_06510 24076 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 26767 24122 gene locus_tag LOCUS_06520 26767 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 28103 26760 gene locus_tag LOCUS_06530 gene nuoF 28103 26760 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_06530 28714 28100 gene locus_tag LOCUS_06540 28714 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 30048 28714 gene locus_tag LOCUS_06550 30048 28714 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_06550 <30605 30053 gene locus_tag LOCUS_06560 <30605 30053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174270.1:NADH-quinone oxidoreductase subunit C >Feature sequence017 <1 938 gene locus_tag LOCUS_06570 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256872.1:MoxR family ATPase 948 2102 gene locus_tag LOCUS_06580 948 2102 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_06580 2102 2416 gene locus_tag LOCUS_06590 2102 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06590 2422 3210 gene locus_tag LOCUS_06600 2422 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06600 4067 3240 gene locus_tag LOCUS_06610 4067 3240 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_06610 4537 4064 gene locus_tag LOCUS_06620 4537 4064 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_06620 4649 5230 gene locus_tag LOCUS_06630 4649 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5221 5907 gene locus_tag LOCUS_06640 5221 5907 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141279381.1 protein_id gnl|my_center|LOCUS_06640 5904 6392 gene locus_tag LOCUS_06650 5904 6392 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 protein_id gnl|my_center|LOCUS_06650 6389 7306 gene locus_tag LOCUS_06660 6389 7306 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_06660 7375 7965 gene locus_tag LOCUS_06670 7375 7965 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_06670 8088 9293 gene locus_tag LOCUS_06680 8088 9293 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_06680 10277 9312 gene locus_tag LOCUS_06690 10277 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10346 10777 gene locus_tag LOCUS_06700 10346 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 10829 10913 gene locus_tag LOCUS_t00160 10829 10913 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13164 11008 gene locus_tag LOCUS_06710 13164 11008 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_06710 13256 14230 gene locus_tag LOCUS_06720 13256 14230 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_06720 14296 15414 gene locus_tag LOCUS_06730 14296 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16327 15422 gene locus_tag LOCUS_06740 16327 15422 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_06740 16559 18067 gene locus_tag LOCUS_06750 16559 18067 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021270.1 protein_id gnl|my_center|LOCUS_06750 18610 18086 gene locus_tag LOCUS_06760 18610 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 18645 19124 gene locus_tag LOCUS_06770 18645 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 19158 19958 gene locus_tag LOCUS_06780 19158 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 19980 21185 gene locus_tag LOCUS_06790 19980 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_06790 21182 22582 gene locus_tag LOCUS_06800 21182 22582 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_06800 22579 23367 gene locus_tag LOCUS_06810 gene eutC 22579 23367 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966004.1 protein_id gnl|my_center|LOCUS_06810 23377 24426 gene locus_tag LOCUS_06820 23377 24426 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_06820 24438 25310 gene locus_tag LOCUS_06830 24438 25310 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_06830 26932 25328 gene locus_tag LOCUS_06840 26932 25328 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_06840 27437 26976 gene locus_tag LOCUS_06850 27437 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 29238 27418 gene locus_tag LOCUS_06860 29238 27418 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence018 960 2918 gene locus_tag LOCUS_06870 gene tkt 960 2918 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_06870 2933 4024 gene locus_tag LOCUS_06880 2933 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4021 4707 gene locus_tag LOCUS_06890 gene pgl 4021 4707 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838435.1 protein_id gnl|my_center|LOCUS_06890 4718 7057 gene locus_tag LOCUS_06900 4718 7057 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_06900 7262 7059 gene locus_tag LOCUS_06910 7262 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7349 8104 gene locus_tag LOCUS_06920 7349 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_06920 9953 8121 gene locus_tag LOCUS_06930 gene typA 9953 8121 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_06930 10058 10225 gene locus_tag LOCUS_06940 10058 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11441 10275 gene locus_tag LOCUS_06950 gene rnd 11441 10275 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_06950 11777 11451 gene locus_tag LOCUS_06960 11777 11451 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084133.1 protein_id gnl|my_center|LOCUS_06960 12397 11774 gene locus_tag LOCUS_06970 12397 11774 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887290.1 protein_id gnl|my_center|LOCUS_06970 12847 12401 gene locus_tag LOCUS_06980 12847 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 14367 12928 gene locus_tag LOCUS_06990 gene pyk 14367 12928 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_06990 15197 14418 gene locus_tag LOCUS_07000 15197 14418 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_07000 15346 16014 gene locus_tag LOCUS_07010 15346 16014 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_07010 16219 17172 gene locus_tag LOCUS_07020 16219 17172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_07020 17153 18133 gene locus_tag LOCUS_07030 17153 18133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_07030 18136 19224 gene locus_tag LOCUS_07040 18136 19224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_07040 19224 20237 gene locus_tag LOCUS_07050 19224 20237 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243637.1 protein_id gnl|my_center|LOCUS_07050 20867 20244 gene locus_tag LOCUS_07060 20867 20244 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_07060 20857 21387 gene locus_tag LOCUS_07070 20857 21387 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_07070 21611 21405 gene locus_tag LOCUS_07080 21611 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 22696 21653 gene locus_tag LOCUS_07090 22696 21653 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_07090 24336 22774 gene locus_tag LOCUS_07100 24336 22774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 24445 26031 gene locus_tag LOCUS_07110 24445 26031 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_07110 26116 26796 gene locus_tag LOCUS_07120 26116 26796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_07120 26968 27681 gene locus_tag LOCUS_07130 26968 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence019 1366 551 gene locus_tag LOCUS_07140 gene fdhD 1366 551 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_07140 3056 1440 gene locus_tag LOCUS_07150 gene groL 3056 1440 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804390.1 protein_id gnl|my_center|LOCUS_07150 3524 3246 gene locus_tag LOCUS_07160 3524 3246 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_07160 3849 3610 gene locus_tag LOCUS_07170 3849 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3766 4560 gene locus_tag LOCUS_07180 3766 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4603 5454 gene locus_tag LOCUS_07190 4603 5454 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_07190 6458 5466 gene locus_tag LOCUS_07200 6458 5466 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_07200 6583 6807 gene locus_tag LOCUS_07210 6583 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6818 7522 gene locus_tag LOCUS_07220 6818 7522 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_07220 8047 7547 gene locus_tag LOCUS_07230 8047 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8316 8050 gene locus_tag LOCUS_07240 8316 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8454 9602 gene locus_tag LOCUS_07250 8454 9602 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225686.1 protein_id gnl|my_center|LOCUS_07250 9676 9603 gene locus_tag LOCUS_t00170 9676 9603 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11478 9790 gene locus_tag LOCUS_07260 11478 9790 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_07260 11587 13842 gene locus_tag LOCUS_07270 11587 13842 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_07270 13844 14836 gene locus_tag LOCUS_07280 13844 14836 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_07280 15984 14833 gene locus_tag LOCUS_07290 15984 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 16454 15981 gene locus_tag LOCUS_07300 gene ispF 16454 15981 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_07300 17165 16464 gene locus_tag LOCUS_07310 gene ispD 17165 16464 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_07310 17278 17937 gene locus_tag LOCUS_07320 17278 17937 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727023.1 protein_id gnl|my_center|LOCUS_07320 18866 17940 gene locus_tag LOCUS_07330 18866 17940 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618895.1 protein_id gnl|my_center|LOCUS_07330 19711 18863 gene locus_tag LOCUS_07340 19711 18863 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112858.1 protein_id gnl|my_center|LOCUS_07340 20736 19711 gene locus_tag LOCUS_07350 20736 19711 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_07350 20910 22178 gene locus_tag LOCUS_07360 20910 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 22843 22184 gene locus_tag LOCUS_07370 22843 22184 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_07370 24229 22853 gene locus_tag LOCUS_07380 gene radA 24229 22853 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_07380 24873 24328 gene locus_tag LOCUS_07390 24873 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 25024 25617 gene locus_tag LOCUS_07400 25024 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 26229 25717 gene locus_tag LOCUS_07410 26229 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 26379 26972 gene locus_tag LOCUS_07420 26379 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence020 1192 197 gene locus_tag LOCUS_07430 1192 197 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_07430 1412 1194 gene locus_tag LOCUS_07440 1412 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1891 1409 gene locus_tag LOCUS_07450 1891 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2041 3129 gene locus_tag LOCUS_07460 2041 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4183 3113 gene locus_tag LOCUS_07470 4183 3113 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_07470 4267 5496 gene locus_tag LOCUS_07480 4267 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7098 5509 gene locus_tag LOCUS_07490 7098 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7993 7277 gene locus_tag LOCUS_07500 7993 7277 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062021.1 protein_id gnl|my_center|LOCUS_07500 9269 7998 gene locus_tag LOCUS_07510 9269 7998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_07510 10012 9269 gene locus_tag LOCUS_07520 gene phoU 10012 9269 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_07520 10702 10046 gene locus_tag LOCUS_07530 gene phoU 10702 10046 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_07530 11561 10713 gene locus_tag LOCUS_07540 gene pstB 11561 10713 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_07540 12518 11619 gene locus_tag LOCUS_07550 gene pstA 12518 11619 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112722.1 protein_id gnl|my_center|LOCUS_07550 13512 12520 gene locus_tag LOCUS_07560 gene pstC 13512 12520 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036711.1 protein_id gnl|my_center|LOCUS_07560 14601 13522 gene locus_tag LOCUS_07570 gene pstS 14601 13522 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_07570 15083 14739 gene locus_tag LOCUS_07580 15083 14739 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031215.1 protein_id gnl|my_center|LOCUS_07580 15178 15657 gene locus_tag LOCUS_07590 15178 15657 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_07590 15657 16358 gene locus_tag LOCUS_07600 15657 16358 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_07600 16358 16768 gene locus_tag LOCUS_07610 16358 16768 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_07610 17260 16802 gene locus_tag LOCUS_07620 17260 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 19378 17264 gene locus_tag LOCUS_07630 19378 17264 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_07630 19641 19375 gene locus_tag LOCUS_07640 19641 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19818 20069 gene locus_tag LOCUS_07650 19818 20069 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094330.1 protein_id gnl|my_center|LOCUS_07650 20164 20943 gene locus_tag LOCUS_07660 gene ftcD 20164 20943 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_07660 21312 20986 gene locus_tag LOCUS_07670 21312 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 23587 21572 gene locus_tag LOCUS_07680 23587 21572 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_07680 23617 24825 gene locus_tag LOCUS_07690 23617 24825 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_07690 24843 25538 gene locus_tag LOCUS_07700 gene rpiA 24843 25538 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 protein_id gnl|my_center|LOCUS_07700 26374 25553 gene locus_tag LOCUS_07710 26374 25553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence021 1898 1095 gene locus_tag LOCUS_07720 1898 1095 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_07720 1986 2600 gene locus_tag LOCUS_07730 1986 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2708 2920 gene locus_tag LOCUS_07740 2708 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4080 3085 gene locus_tag LOCUS_07750 4080 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6095 4212 gene locus_tag LOCUS_07760 6095 4212 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_07760 7063 6140 gene locus_tag LOCUS_07770 7063 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7716 7081 gene locus_tag LOCUS_07780 7716 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_07780 8670 7756 gene locus_tag LOCUS_07790 8670 7756 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_07790 9378 8686 gene locus_tag LOCUS_07800 9378 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 10054 9428 gene locus_tag LOCUS_07810 10054 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 11148 10051 gene locus_tag LOCUS_07820 11148 10051 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_07820 11236 11916 gene locus_tag LOCUS_07830 11236 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11942 13315 gene locus_tag LOCUS_07840 11942 13315 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_07840 13374 14234 gene locus_tag LOCUS_07850 13374 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_07850 14360 14896 gene locus_tag LOCUS_07860 14360 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14893 15879 gene locus_tag LOCUS_07870 14893 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_07870 16167 15895 gene locus_tag LOCUS_07880 16167 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17656 16184 gene locus_tag LOCUS_07890 17656 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17953 19536 gene locus_tag LOCUS_07900 17953 19536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_07900 19593 19889 gene locus_tag LOCUS_07910 19593 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 20332 19910 gene locus_tag LOCUS_07920 20332 19910 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_07920 20991 20329 gene locus_tag LOCUS_07930 20991 20329 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728638.1 protein_id gnl|my_center|LOCUS_07930 21788 20988 gene locus_tag LOCUS_07940 21788 20988 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_07940 21942 22502 gene locus_tag LOCUS_07950 21942 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 23305 22523 gene locus_tag LOCUS_07960 23305 22523 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_07960 23381 24187 gene locus_tag LOCUS_07970 23381 24187 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086691.1 protein_id gnl|my_center|LOCUS_07970 24189 24983 gene locus_tag LOCUS_07980 24189 24983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 protein_id gnl|my_center|LOCUS_07980 25374 24994 gene locus_tag LOCUS_07990 25374 24994 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence022 1522 1112 gene locus_tag LOCUS_08000 1522 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1672 4518 gene locus_tag LOCUS_08010 gene topA 1672 4518 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_08010 4572 6218 gene locus_tag LOCUS_08020 4572 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 6215 6826 gene locus_tag LOCUS_08030 6215 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6823 7914 gene locus_tag LOCUS_08040 6823 7914 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_08040 7970 8043 gene locus_tag LOCUS_t00180 7970 8043 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8046 8636 gene locus_tag LOCUS_08050 gene sigR 8046 8636 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_08050 8633 8965 gene locus_tag LOCUS_08060 8633 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8937 9110 gene locus_tag LOCUS_08070 8937 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 9115 10188 gene locus_tag LOCUS_08080 9115 10188 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_08080 10306 11097 gene locus_tag LOCUS_08090 gene tilS 10306 11097 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092153.1 protein_id gnl|my_center|LOCUS_08090 11119 11700 gene locus_tag LOCUS_08100 gene hpt 11119 11700 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_08100 11782 12354 gene locus_tag LOCUS_08110 gene folE 11782 12354 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_08110 12357 13178 gene locus_tag LOCUS_08120 gene folP 12357 13178 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_08120 13175 13693 gene locus_tag LOCUS_08130 13175 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 13710 14075 gene locus_tag LOCUS_08140 13710 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08140 14076 14540 gene locus_tag LOCUS_08150 gene folK 14076 14540 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_08150 14537 15322 gene locus_tag LOCUS_08160 14537 15322 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113142.1 protein_id gnl|my_center|LOCUS_08160 15322 16176 gene locus_tag LOCUS_08170 gene panC 15322 16176 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976190.1 protein_id gnl|my_center|LOCUS_08170 16230 16628 gene locus_tag LOCUS_08180 16230 16628 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226860.1 protein_id gnl|my_center|LOCUS_08180 16657 18219 gene locus_tag LOCUS_08190 16657 18219 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_08190 18261 19121 gene locus_tag LOCUS_08200 gene nadC 18261 19121 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_08200 19136 19930 gene locus_tag LOCUS_08210 19136 19930 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_08210 20971 19946 gene locus_tag LOCUS_08220 gene grcC 20971 19946 CDS product polyprenyl-diphosphate synthase GrcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402957.1 protein_id gnl|my_center|LOCUS_08220 21083 23653 gene locus_tag LOCUS_08230 21083 23653 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_08230 23786 24526 gene locus_tag LOCUS_08240 23786 24526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 24655 25143 gene locus_tag LOCUS_08250 24655 25143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence023 2184 3476 gene locus_tag LOCUS_08260 2184 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6155 3492 gene locus_tag LOCUS_08270 6155 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7853 6273 gene locus_tag LOCUS_08280 7853 6273 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_08280 8588 7866 gene locus_tag LOCUS_08290 8588 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8945 8628 gene locus_tag LOCUS_08300 8945 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9399 8965 gene locus_tag LOCUS_08310 9399 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 10142 9435 gene locus_tag LOCUS_08320 10142 9435 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_08320 11831 10182 gene locus_tag LOCUS_08330 11831 10182 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_08330 13625 11967 gene locus_tag LOCUS_08340 13625 11967 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030775978.1 protein_id gnl|my_center|LOCUS_08340 15619 13796 gene locus_tag LOCUS_08350 15619 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15699 16325 gene locus_tag LOCUS_08360 15699 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16322 17101 gene locus_tag LOCUS_08370 16322 17101 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_08370 17336 18640 gene locus_tag LOCUS_08380 17336 18640 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 protein_id gnl|my_center|LOCUS_08380 18726 19289 gene locus_tag LOCUS_08390 18726 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19399 20202 gene locus_tag LOCUS_08400 19399 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 20253 20999 gene locus_tag LOCUS_08410 20253 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 21187 22614 gene locus_tag LOCUS_08420 21187 22614 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence024 962 423 gene locus_tag LOCUS_08430 962 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1071 1847 gene locus_tag LOCUS_08440 1071 1847 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_08440 2333 1866 gene locus_tag LOCUS_08450 2333 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2826 2335 gene locus_tag LOCUS_08460 2826 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3472 2828 gene locus_tag LOCUS_08470 3472 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5210 3603 gene locus_tag LOCUS_08480 5210 3603 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_08480 6447 5257 gene locus_tag LOCUS_08490 6447 5257 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_08490 6639 6866 gene locus_tag LOCUS_08500 6639 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 9685 7091 gene locus_tag LOCUS_08510 9685 7091 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_08510 10439 9687 gene locus_tag LOCUS_08520 gene tatC 10439 9687 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080091.1 protein_id gnl|my_center|LOCUS_08520 10828 10484 gene locus_tag LOCUS_08530 10828 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 10984 11628 gene locus_tag LOCUS_08540 10984 11628 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763000.1 protein_id gnl|my_center|LOCUS_08540 12216 11659 gene locus_tag LOCUS_08550 gene lepB 12216 11659 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_08550 13293 12343 gene locus_tag LOCUS_08560 13293 12343 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 protein_id gnl|my_center|LOCUS_08560 14263 13286 gene locus_tag LOCUS_08570 14263 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15654 14296 gene locus_tag LOCUS_08580 gene pafA 15654 14296 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_08580 16386 15703 gene locus_tag LOCUS_08590 gene prcA 16386 15703 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_08590 17225 16383 gene locus_tag LOCUS_08600 gene prcB 17225 16383 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_08600 17462 17268 gene locus_tag LOCUS_08610 17462 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18806 17517 gene locus_tag LOCUS_08620 gene dop 18806 17517 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080108.1 protein_id gnl|my_center|LOCUS_08620 18729 18941 gene locus_tag LOCUS_08630 18729 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 20824 19067 gene locus_tag LOCUS_08640 gene arc 20824 19067 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_08640 21031 21267 gene locus_tag LOCUS_08650 21031 21267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 <22410 21370 gene locus_tag LOCUS_08660 <22410 21370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731101.1:acid resistance serine protease MarP >Feature sequence025 386 1144 gene locus_tag LOCUS_08670 386 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1742 1473 gene locus_tag LOCUS_08680 1742 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1741 1980 gene locus_tag LOCUS_08690 1741 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2011 2832 gene locus_tag LOCUS_08700 gene rsmA 2011 2832 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_08700 2837 3571 gene locus_tag LOCUS_08710 2837 3571 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_08710 3979 3907 gene locus_tag LOCUS_t00190 3979 3907 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4129 5124 gene locus_tag LOCUS_08720 4129 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5154 6134 gene locus_tag LOCUS_08730 5154 6134 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_08730 6394 7041 gene locus_tag LOCUS_08740 6394 7041 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_08740 7042 7665 gene locus_tag LOCUS_08750 gene pth 7042 7665 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059133.1 protein_id gnl|my_center|LOCUS_08750 8097 7711 gene locus_tag LOCUS_08760 8097 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10006 8099 gene locus_tag LOCUS_08770 10006 8099 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_08770 10296 13733 gene locus_tag LOCUS_08780 gene mfd 10296 13733 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_08780 13730 14842 gene locus_tag LOCUS_08790 13730 14842 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_08790 14856 16220 gene locus_tag LOCUS_08800 gene mazG 14856 16220 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_08800 16293 17576 gene locus_tag LOCUS_08810 gene eno 16293 17576 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_08810 17579 18028 gene locus_tag LOCUS_08820 17579 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 18098 20407 gene locus_tag LOCUS_08830 18098 20407 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_08830 20578 21282 gene locus_tag LOCUS_08840 20578 21282 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891556.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence026 <1 609 gene locus_tag LOCUS_08850 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731379.1:acyl-CoA dehydrogenase family protein 606 1397 gene locus_tag LOCUS_08860 606 1397 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727864.1 protein_id gnl|my_center|LOCUS_08860 2039 1419 gene locus_tag LOCUS_08870 2039 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2170 3102 gene locus_tag LOCUS_08880 2170 3102 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031608.1 protein_id gnl|my_center|LOCUS_08880 3774 3115 gene locus_tag LOCUS_08890 3774 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4987 3785 gene locus_tag LOCUS_08900 4987 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5103 5816 gene locus_tag LOCUS_08910 gene frnE 5103 5816 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_08910 6333 5851 gene locus_tag LOCUS_08920 6333 5851 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_08920 7180 6398 gene locus_tag LOCUS_08930 7180 6398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083761.1 protein_id gnl|my_center|LOCUS_08930 7328 8434 gene locus_tag LOCUS_08940 7328 8434 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_08940 8482 9558 gene locus_tag LOCUS_08950 8482 9558 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_08950 10110 9562 gene locus_tag LOCUS_08960 10110 9562 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_08960 10877 10110 gene locus_tag LOCUS_08970 10877 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 10865 12331 gene locus_tag LOCUS_08980 10865 12331 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_08980 12359 12820 gene locus_tag LOCUS_08990 12359 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13731 12829 gene locus_tag LOCUS_09000 13731 12829 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_09000 14673 13771 gene locus_tag LOCUS_09010 14673 13771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_09010 15715 14684 gene locus_tag LOCUS_09020 15715 14684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_09020 17237 15756 gene locus_tag LOCUS_09030 gene pnbA 17237 15756 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_09030 17304 18125 gene locus_tag LOCUS_09040 17304 18125 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_09040 18129 19394 gene locus_tag LOCUS_09050 18129 19394 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_09050 19437 20351 gene locus_tag LOCUS_09060 19437 20351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence027 363 602 gene locus_tag LOCUS_09070 363 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 607 1512 gene locus_tag LOCUS_09080 607 1512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_09080 1509 2318 gene locus_tag LOCUS_09090 1509 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2746 2330 gene locus_tag LOCUS_09100 2746 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3197 3877 gene locus_tag LOCUS_09110 3197 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3917 4111 gene locus_tag LOCUS_09120 gene rpmI 3917 4111 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_09120 4163 4525 gene locus_tag LOCUS_09130 gene rplT 4163 4525 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_09130 4541 5368 gene locus_tag LOCUS_09140 4541 5368 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_09140 5421 6458 gene locus_tag LOCUS_09150 gene pheS 5421 6458 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_09150 6455 8821 gene locus_tag LOCUS_09160 gene pheT 6455 8821 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_09160 8885 9934 gene locus_tag LOCUS_09170 gene argC 8885 9934 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_09170 9931 11094 gene locus_tag LOCUS_09180 gene argJ 9931 11094 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908321.1 protein_id gnl|my_center|LOCUS_09180 11091 12005 gene locus_tag LOCUS_09190 gene argB 11091 12005 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_09190 12002 13210 gene locus_tag LOCUS_09200 12002 13210 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_09200 13207 14106 gene locus_tag LOCUS_09210 gene argF 13207 14106 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_09210 14103 14591 gene locus_tag LOCUS_09220 14103 14591 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_09220 14633 15832 gene locus_tag LOCUS_09230 14633 15832 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_09230 15839 17215 gene locus_tag LOCUS_09240 gene argH 15839 17215 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_09240 17216 17860 gene locus_tag LOCUS_09250 17216 17860 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_09250 18502 17873 gene locus_tag LOCUS_09260 18502 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 18558 19838 gene locus_tag LOCUS_09270 gene tyrS 18558 19838 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence028 <1 1347 gene locus_tag LOCUS_09280 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907970.1:lipoyl synthase 1445 3574 gene locus_tag LOCUS_09290 1445 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3571 4584 gene locus_tag LOCUS_09300 3571 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4581 5546 gene locus_tag LOCUS_09310 4581 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5543 6715 gene locus_tag LOCUS_09320 5543 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6748 7854 gene locus_tag LOCUS_09330 6748 7854 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_09330 7870 8733 gene locus_tag LOCUS_09340 7870 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 12222 8737 gene locus_tag LOCUS_09350 gene metH 12222 8737 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_09350 12401 12937 gene locus_tag LOCUS_09360 12401 12937 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_09360 12977 14449 gene locus_tag LOCUS_09370 12977 14449 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_09370 15086 14430 gene locus_tag LOCUS_09380 15086 14430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 15241 16023 gene locus_tag LOCUS_09390 15241 16023 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_09390 16112 17287 gene locus_tag LOCUS_09400 gene moeB 16112 17287 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_09400 17344 18720 gene locus_tag LOCUS_09410 17344 18720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 18720 19316 gene locus_tag LOCUS_09420 18720 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence029 147 437 gene locus_tag LOCUS_09430 147 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 444 1280 gene locus_tag LOCUS_09440 gene rplB 444 1280 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_09440 1292 1570 gene locus_tag LOCUS_09450 gene rpsS 1292 1570 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_09450 1570 2208 gene locus_tag LOCUS_09460 1570 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2208 3110 gene locus_tag LOCUS_09470 gene rpsC 2208 3110 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_09470 3113 3529 gene locus_tag LOCUS_09480 gene rplP 3113 3529 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892830.1 protein_id gnl|my_center|LOCUS_09480 3529 3762 gene locus_tag LOCUS_09490 gene rpmC 3529 3762 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892831.1 protein_id gnl|my_center|LOCUS_09490 3762 4040 gene locus_tag LOCUS_09500 gene rpsQ 3762 4040 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_09500 4037 4405 gene locus_tag LOCUS_09510 gene rplN 4037 4405 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_09510 4402 4716 gene locus_tag LOCUS_09520 gene rplX 4402 4716 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_09520 4713 5285 gene locus_tag LOCUS_09530 gene rplE 4713 5285 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_09530 5285 5470 gene locus_tag LOCUS_09540 5285 5470 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908573.1 protein_id gnl|my_center|LOCUS_09540 5484 5888 gene locus_tag LOCUS_09550 gene rpsH 5484 5888 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403669.1 protein_id gnl|my_center|LOCUS_09550 5898 6437 gene locus_tag LOCUS_09560 gene rplF 5898 6437 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055712.1 protein_id gnl|my_center|LOCUS_09560 6440 6805 gene locus_tag LOCUS_09570 gene rplR 6440 6805 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_09570 6805 7368 gene locus_tag LOCUS_09580 gene rpsE 6805 7368 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_09580 7368 7568 gene locus_tag LOCUS_09590 gene rpmD 7368 7568 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_09590 7576 8064 gene locus_tag LOCUS_09600 gene rplO 7576 8064 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_09600 8115 9428 gene locus_tag LOCUS_09610 gene secY 8115 9428 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_09610 9428 10075 gene locus_tag LOCUS_09620 9428 10075 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_09620 10083 10826 gene locus_tag LOCUS_09630 gene map 10083 10826 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_09630 11101 10886 gene locus_tag LOCUS_09640 11101 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11033 11191 gene locus_tag LOCUS_09650 11033 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 11433 11810 gene locus_tag LOCUS_09660 gene rpsM 11433 11810 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_09660 11810 12208 gene locus_tag LOCUS_09670 gene rpsK 11810 12208 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_09670 12211 12828 gene locus_tag LOCUS_09680 gene rpsD 12211 12828 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_09680 12903 13841 gene locus_tag LOCUS_09690 12903 13841 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_09690 13848 14201 gene locus_tag LOCUS_09700 13848 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 14228 15142 gene locus_tag LOCUS_09710 gene truA 14228 15142 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_09710 15276 15722 gene locus_tag LOCUS_09720 gene rplM 15276 15722 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_09720 15740 16132 gene locus_tag LOCUS_09730 gene rpsI 15740 16132 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09730 16179 17504 gene locus_tag LOCUS_09740 gene glmM 16179 17504 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence030 2122 368 gene locus_tag LOCUS_09750 gene aspS 2122 368 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_09750 3428 2139 gene locus_tag LOCUS_09760 gene hisS 3428 2139 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_09760 5773 3515 gene locus_tag LOCUS_09770 gene relA 5773 3515 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_09770 7007 5886 gene locus_tag LOCUS_09780 gene secF 7007 5886 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_09780 8542 7004 gene locus_tag LOCUS_09790 8542 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8844 8539 gene locus_tag LOCUS_09800 8844 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10072 8942 gene locus_tag LOCUS_09810 gene tgt 10072 8942 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_09810 10153 10461 gene locus_tag LOCUS_09820 10153 10461 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633884.1 protein_id gnl|my_center|LOCUS_09820 11520 10480 gene locus_tag LOCUS_09830 gene queA 11520 10480 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_09830 12221 11550 gene locus_tag LOCUS_09840 12221 11550 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284214.1 protein_id gnl|my_center|LOCUS_09840 13357 12272 gene locus_tag LOCUS_09850 gene ruvB 13357 12272 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_09850 13959 13357 gene locus_tag LOCUS_09860 gene ruvA 13959 13357 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418603.1 protein_id gnl|my_center|LOCUS_09860 14474 13959 gene locus_tag LOCUS_09870 gene ruvC 14474 13959 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_09870 15335 14556 gene locus_tag LOCUS_09880 15335 14556 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_09880 15943 15395 gene locus_tag LOCUS_09890 15943 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence031 402 1469 gene locus_tag LOCUS_09900 gene mnmA 402 1469 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_09900 2394 1456 gene locus_tag LOCUS_09910 2394 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2502 3521 gene locus_tag LOCUS_09920 2502 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_09920 3561 5612 gene locus_tag LOCUS_09930 gene ligA 3561 5612 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_09930 5633 6268 gene locus_tag LOCUS_09940 5633 6268 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_09940 6777 6298 gene locus_tag LOCUS_09950 6777 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6891 8858 gene locus_tag LOCUS_09960 gene pknB 6891 8858 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_09960 8898 10463 gene locus_tag LOCUS_09970 8898 10463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_09970 10907 10491 gene locus_tag LOCUS_09980 10907 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11003 11305 gene locus_tag LOCUS_09990 gene gatC 11003 11305 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_09990 11307 12761 gene locus_tag LOCUS_10000 gene gatA 11307 12761 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993697.1 protein_id gnl|my_center|LOCUS_10000 12758 14251 gene locus_tag LOCUS_10010 gene gatB 12758 14251 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_10010 14317 14814 gene locus_tag LOCUS_10020 14317 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 15088 16818 gene locus_tag LOCUS_10030 15088 16818 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728299.1 protein_id gnl|my_center|LOCUS_10030 16815 17306 gene locus_tag LOCUS_10040 gene ilvN 16815 17306 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence032 484 242 gene locus_tag LOCUS_10050 484 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1823 645 gene locus_tag LOCUS_10060 1823 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2162 2968 gene locus_tag LOCUS_10070 2162 2968 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_10070 3283 6180 gene locus_tag LOCUS_10080 gene gcvP 3283 6180 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_10080 7263 6181 gene locus_tag LOCUS_10090 gene gcvT 7263 6181 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_10090 7791 7294 gene locus_tag LOCUS_10100 7791 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8438 7944 gene locus_tag LOCUS_10110 8438 7944 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_10110 9455 8481 gene locus_tag LOCUS_10120 9455 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9949 9452 gene locus_tag LOCUS_10130 9949 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 10329 9946 gene locus_tag LOCUS_10140 gene gcvH 10329 9946 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_10140 10992 10393 gene locus_tag LOCUS_10150 10992 10393 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_10150 11025 11435 gene locus_tag LOCUS_10160 11025 11435 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 protein_id gnl|my_center|LOCUS_10160 11671 11453 gene locus_tag LOCUS_10170 11671 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11724 11993 gene locus_tag LOCUS_10180 11724 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13926 12187 gene locus_tag LOCUS_10190 13926 12187 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_10190 15543 13960 gene locus_tag LOCUS_10200 gene lysS 15543 13960 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_10200 15684 15607 gene locus_tag LOCUS_t00200 15684 15607 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17206 15698 gene locus_tag LOCUS_10210 17206 15698 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence033 126 917 gene locus_tag LOCUS_10220 126 917 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_10220 918 1775 gene locus_tag LOCUS_10230 918 1775 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_10230 1772 2530 gene locus_tag LOCUS_10240 1772 2530 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_10240 2530 3606 gene locus_tag LOCUS_10250 2530 3606 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_10250 3628 4083 gene locus_tag LOCUS_10260 3628 4083 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_10260 4131 5288 gene locus_tag LOCUS_10270 4131 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_10270 5296 7587 gene locus_tag LOCUS_10280 5296 7587 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_10280 7598 8896 gene locus_tag LOCUS_10290 7598 8896 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_10290 11734 8924 gene locus_tag LOCUS_10300 11734 8924 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_10300 13953 11737 gene locus_tag LOCUS_10310 13953 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 14136 15551 gene locus_tag LOCUS_10320 14136 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 15650 16417 gene locus_tag LOCUS_10330 15650 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 16462 17304 gene locus_tag LOCUS_10340 gene tauD 16462 17304 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095796.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence034 506 432 gene locus_tag LOCUS_t00210 506 432 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 609 686 gene locus_tag LOCUS_t00220 609 686 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 827 902 gene locus_tag LOCUS_t00230 827 902 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1468 1010 gene locus_tag LOCUS_10350 1468 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2637 1669 gene locus_tag LOCUS_10360 2637 1669 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_10360 3432 2638 gene locus_tag LOCUS_10370 3432 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4683 3484 gene locus_tag LOCUS_10380 4683 3484 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_10380 4794 5486 gene locus_tag LOCUS_10390 gene rpe 4794 5486 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088426.1 protein_id gnl|my_center|LOCUS_10390 5491 5949 gene locus_tag LOCUS_10400 5491 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6567 5965 gene locus_tag LOCUS_10410 gene clpP 6567 5965 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694635.1 protein_id gnl|my_center|LOCUS_10410 7510 6701 gene locus_tag LOCUS_10420 7510 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 8103 7507 gene locus_tag LOCUS_10430 8103 7507 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_10430 8843 8109 gene locus_tag LOCUS_10440 gene rph 8843 8109 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_10440 8968 9432 gene locus_tag LOCUS_10450 8968 9432 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_10450 11358 9454 gene locus_tag LOCUS_10460 gene cysN 11358 9454 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_10460 12260 11358 gene locus_tag LOCUS_10470 gene cysD 12260 11358 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 protein_id gnl|my_center|LOCUS_10470 13160 12375 gene locus_tag LOCUS_10480 gene racE 13160 12375 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_10480 14173 13223 gene locus_tag LOCUS_10490 14173 13223 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_10490 14688 14269 gene locus_tag LOCUS_10500 14688 14269 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_10500 14754 15275 gene locus_tag LOCUS_10510 14754 15275 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229261.1 protein_id gnl|my_center|LOCUS_10510 15313 15804 gene locus_tag LOCUS_10520 gene smpB 15313 15804 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 protein_id gnl|my_center|LOCUS_10520 15932 16495 gene locus_tag LOCUS_10530 15932 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 16941 16492 gene locus_tag LOCUS_10540 16941 16492 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225420.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence035 1720 845 gene locus_tag LOCUS_10550 1720 845 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075293048.1 protein_id gnl|my_center|LOCUS_10550 1913 2863 gene locus_tag LOCUS_10560 1913 2863 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_10560 2863 4284 gene locus_tag LOCUS_10570 2863 4284 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_10570 4428 5696 gene locus_tag LOCUS_10580 4428 5696 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_10580 6702 5710 gene locus_tag LOCUS_10590 6702 5710 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112900.1 protein_id gnl|my_center|LOCUS_10590 6725 8977 gene locus_tag LOCUS_10600 6725 8977 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_10600 10272 9010 gene locus_tag LOCUS_10610 10272 9010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_10610 11406 10279 gene locus_tag LOCUS_10620 11406 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_10620 11562 11488 gene locus_tag LOCUS_t00240 11562 11488 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11638 12489 gene locus_tag LOCUS_10630 11638 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 12504 12578 gene locus_tag LOCUS_t00250 12504 12578 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13272 12670 gene locus_tag LOCUS_10640 13272 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13163 13384 gene locus_tag LOCUS_10650 13163 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14219 13425 gene locus_tag LOCUS_10660 14219 13425 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726860.1 protein_id gnl|my_center|LOCUS_10660 15779 14301 gene locus_tag LOCUS_10670 15779 14301 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_10670 16928 15822 gene locus_tag LOCUS_10680 16928 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence036 295 438 gene locus_tag LOCUS_10690 295 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 654 1844 gene locus_tag LOCUS_10700 654 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1841 2959 gene locus_tag LOCUS_10710 1841 2959 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_10710 2964 3752 gene locus_tag LOCUS_10720 2964 3752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_10720 3762 5243 gene locus_tag LOCUS_10730 3762 5243 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_10730 5318 6409 gene locus_tag LOCUS_10740 5318 6409 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_10740 6556 6834 gene locus_tag LOCUS_10750 6556 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6827 8209 gene locus_tag LOCUS_10760 6827 8209 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_10760 8222 8782 gene locus_tag LOCUS_10770 8222 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8779 9426 gene locus_tag LOCUS_10780 8779 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9423 10280 gene locus_tag LOCUS_10790 9423 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 10340 12469 gene locus_tag LOCUS_10800 10340 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 12497 13777 gene locus_tag LOCUS_10810 12497 13777 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_10810 13821 14846 gene locus_tag LOCUS_10820 13821 14846 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_10820 14858 15688 gene locus_tag LOCUS_10830 14858 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 17022 15742 gene locus_tag LOCUS_10840 17022 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence037 3983 414 gene locus_tag LOCUS_10850 3983 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4785 4009 gene locus_tag LOCUS_10860 gene tauD 4785 4009 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_10860 5977 4826 gene locus_tag LOCUS_10870 5977 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6063 6431 gene locus_tag LOCUS_10880 6063 6431 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966633.1 protein_id gnl|my_center|LOCUS_10880 9149 6489 gene locus_tag LOCUS_10890 9149 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9948 9337 gene locus_tag LOCUS_10900 9948 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 10023 10952 gene locus_tag LOCUS_10910 10023 10952 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_10910 11816 10962 gene locus_tag LOCUS_10920 11816 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11872 12939 gene locus_tag LOCUS_10930 11872 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_10930 12942 13493 gene locus_tag LOCUS_10940 12942 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 13490 14299 gene locus_tag LOCUS_10950 13490 14299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_10950 15408 14320 gene locus_tag LOCUS_10960 15408 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16118 15405 gene locus_tag LOCUS_10970 16118 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence038 1566 1294 gene locus_tag LOCUS_10980 1566 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1685 2515 gene locus_tag LOCUS_10990 gene folP 1685 2515 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223256.1 protein_id gnl|my_center|LOCUS_10990 2512 3570 gene locus_tag LOCUS_11000 gene holA 2512 3570 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_11000 3910 3647 gene locus_tag LOCUS_11010 gene rpsT 3910 3647 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_11010 4091 5875 gene locus_tag LOCUS_11020 gene lepA 4091 5875 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228456.1 protein_id gnl|my_center|LOCUS_11020 5943 6995 gene locus_tag LOCUS_11030 gene hrcA 5943 6995 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_11030 7000 8103 gene locus_tag LOCUS_11040 gene dnaJ 7000 8103 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_11040 8108 8812 gene locus_tag LOCUS_11050 8108 8812 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546112.1 protein_id gnl|my_center|LOCUS_11050 8809 9882 gene locus_tag LOCUS_11060 gene hemW 8809 9882 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_11060 9886 10530 gene locus_tag LOCUS_11070 9886 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10637 11473 gene locus_tag LOCUS_11080 10637 11473 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172927.1 protein_id gnl|my_center|LOCUS_11080 12367 11549 gene locus_tag LOCUS_11090 12367 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 13924 12863 gene locus_tag LOCUS_11100 13924 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 15329 13989 gene locus_tag LOCUS_11110 15329 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15517 15442 gene locus_tag LOCUS_t00260 15517 15442 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 <1 1038 gene locus_tag LOCUS_11120 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071831611.1:excinuclease ABC subunit UvrC 1051 1791 gene locus_tag LOCUS_11130 1051 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2379 1810 gene locus_tag LOCUS_11140 2379 1810 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_11140 2418 3272 gene locus_tag LOCUS_11150 gene rapZ 2418 3272 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_11150 3412 4422 gene locus_tag LOCUS_11160 gene gap 3412 4422 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_11160 4432 5556 gene locus_tag LOCUS_11170 4432 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 5549 6325 gene locus_tag LOCUS_11180 gene tpiA 5549 6325 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_11180 6340 6570 gene locus_tag LOCUS_11190 gene secG 6340 6570 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076011.1 protein_id gnl|my_center|LOCUS_11190 6577 7377 gene locus_tag LOCUS_11200 6577 7377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_11200 7350 8723 gene locus_tag LOCUS_11210 7350 8723 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_11210 8725 9783 gene locus_tag LOCUS_11220 8725 9783 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_11220 10554 9787 gene locus_tag LOCUS_11230 gene fabI 10554 9787 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_11230 10656 11324 gene locus_tag LOCUS_11240 gene npdG 10656 11324 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_11240 11348 12496 gene locus_tag LOCUS_11250 gene mshC 11348 12496 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 protein_id gnl|my_center|LOCUS_11250 12547 14496 gene locus_tag LOCUS_11260 gene thrS 12547 14496 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115326.1 protein_id gnl|my_center|LOCUS_11260 14500 15024 gene locus_tag LOCUS_11270 14500 15024 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 protein_id gnl|my_center|LOCUS_11270 15188 15682 gene locus_tag LOCUS_11280 15188 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence040 <1 867 gene locus_tag LOCUS_11290 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223583.1:ketol-acid reductoisomerase 1408 1016 gene locus_tag LOCUS_11300 1408 1016 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_11300 1691 1410 gene locus_tag LOCUS_11310 1691 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1842 3152 gene locus_tag LOCUS_11320 1842 3152 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_11320 3250 4020 gene locus_tag LOCUS_11330 3250 4020 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_11330 4013 4969 gene locus_tag LOCUS_11340 4013 4969 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266773.1 protein_id gnl|my_center|LOCUS_11340 6106 4982 gene locus_tag LOCUS_11350 gene serC 6106 4982 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_11350 6235 7440 gene locus_tag LOCUS_11360 6235 7440 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_11360 7448 9475 gene locus_tag LOCUS_11370 7448 9475 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_11370 9531 11087 gene locus_tag LOCUS_11380 gene serA 9531 11087 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_11380 11320 12900 gene locus_tag LOCUS_11390 11320 12900 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_11390 13498 12902 gene locus_tag LOCUS_11400 gene leuD 13498 12902 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_11400 14918 13515 gene locus_tag LOCUS_11410 gene leuC 14918 13515 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence041 223 1224 gene locus_tag LOCUS_11420 223 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1340 2305 gene locus_tag LOCUS_11430 1340 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2608 2384 gene locus_tag LOCUS_11440 2608 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2708 3472 gene locus_tag LOCUS_11450 2708 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4536 3496 gene locus_tag LOCUS_11460 4536 3496 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_11460 4684 6417 gene locus_tag LOCUS_11470 4684 6417 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_11470 7553 6714 gene locus_tag LOCUS_11480 7553 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8576 7959 gene locus_tag LOCUS_11490 8576 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 8663 9877 gene locus_tag LOCUS_11500 8663 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10061 9906 gene locus_tag LOCUS_11510 10061 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 10087 10845 gene locus_tag LOCUS_11520 10087 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 11507 11118 gene locus_tag LOCUS_11530 11507 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 12657 11623 gene locus_tag LOCUS_11540 12657 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 12778 13101 gene locus_tag LOCUS_11550 12778 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13173 14159 gene locus_tag LOCUS_11560 13173 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 14195 14548 gene locus_tag LOCUS_11570 14195 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence042 2167 740 gene locus_tag LOCUS_11580 2167 740 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177563.1 protein_id gnl|my_center|LOCUS_11580 2265 5747 gene locus_tag LOCUS_11590 gene recC 2265 5747 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113008.1 protein_id gnl|my_center|LOCUS_11590 5744 9247 gene locus_tag LOCUS_11600 gene recB 5744 9247 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905355.1 protein_id gnl|my_center|LOCUS_11600 9244 11151 gene locus_tag LOCUS_11610 gene recD 9244 11151 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_11610 12682 11159 gene locus_tag LOCUS_11620 12682 11159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_11620 14619 12751 gene locus_tag LOCUS_11630 14619 12751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014011.1 protein_id gnl|my_center|LOCUS_11630 <15157 14616 gene locus_tag LOCUS_11640 <15157 14616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227095.1:ABC transporter ATP-binding protein >Feature sequence043 197 865 gene locus_tag LOCUS_11650 197 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 889 1575 gene locus_tag LOCUS_11660 889 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2571 1579 gene locus_tag LOCUS_11670 2571 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2717 3994 gene locus_tag LOCUS_11680 2717 3994 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_11680 5226 4009 gene locus_tag LOCUS_11690 5226 4009 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_11690 6601 5285 gene locus_tag LOCUS_11700 6601 5285 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_11700 7965 6601 gene locus_tag LOCUS_11710 gene cysS 7965 6601 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_11710 8043 10676 gene locus_tag LOCUS_11720 gene valS 8043 10676 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_11720 11747 10605 gene locus_tag LOCUS_11730 11747 10605 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_11730 12398 11817 gene locus_tag LOCUS_11740 gene sodB 12398 11817 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 protein_id gnl|my_center|LOCUS_11740 13034 12492 gene locus_tag LOCUS_11750 13034 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13955 13305 gene locus_tag LOCUS_11760 gene msrA 13955 13305 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence044 1027 515 gene locus_tag LOCUS_11770 1027 515 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_11770 1671 1024 gene locus_tag LOCUS_11780 1671 1024 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_11780 1829 2287 gene locus_tag LOCUS_11790 1829 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3472 2300 gene locus_tag LOCUS_11800 3472 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3562 4803 gene locus_tag LOCUS_11810 3562 4803 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_11810 5058 6491 gene locus_tag LOCUS_11820 5058 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6488 8029 gene locus_tag LOCUS_11830 6488 8029 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_11830 8096 8797 gene locus_tag LOCUS_11840 8096 8797 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_11840 8871 8799 gene locus_tag LOCUS_t00270 8871 8799 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9572 8919 gene locus_tag LOCUS_11850 9572 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225444.1 protein_id gnl|my_center|LOCUS_11850 10950 9619 gene locus_tag LOCUS_11860 gene murA 10950 9619 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_11860 10982 12727 gene locus_tag LOCUS_11870 gene argS 10982 12727 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_11870 12735 14006 gene locus_tag LOCUS_11880 gene lysA 12735 14006 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_11880 14014 14745 gene locus_tag LOCUS_11890 14014 14745 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence045 1208 330 gene locus_tag LOCUS_11900 gene galU 1208 330 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_11900 1784 1554 gene locus_tag LOCUS_11910 1784 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1822 2466 gene locus_tag LOCUS_11920 1822 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2509 3522 gene locus_tag LOCUS_11930 2509 3522 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_11930 4899 3532 gene locus_tag LOCUS_11940 4899 3532 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881223.1 protein_id gnl|my_center|LOCUS_11940 6239 4896 gene locus_tag LOCUS_11950 6239 4896 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_11950 7633 6236 gene locus_tag LOCUS_11960 7633 6236 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_11960 7759 8853 gene locus_tag LOCUS_11970 7759 8853 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_11970 9005 10870 gene locus_tag LOCUS_11980 gene dxs 9005 10870 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_11980 11874 10882 gene locus_tag LOCUS_11990 11874 10882 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_11990 12116 11841 gene locus_tag LOCUS_12000 12116 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12106 12882 gene locus_tag LOCUS_12010 12106 12882 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_12010 12879 13781 gene locus_tag LOCUS_12020 gene dapA 12879 13781 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908381.1 protein_id gnl|my_center|LOCUS_12020 15107 13833 gene locus_tag LOCUS_12030 15107 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence046 404 1183 gene locus_tag LOCUS_12040 404 1183 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228956.1 protein_id gnl|my_center|LOCUS_12040 2175 1201 gene locus_tag LOCUS_12050 2175 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3076 2177 gene locus_tag LOCUS_12060 3076 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3339 3139 gene locus_tag LOCUS_12070 3339 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4139 3399 gene locus_tag LOCUS_12080 4139 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4265 5077 gene locus_tag LOCUS_12090 4265 5077 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 protein_id gnl|my_center|LOCUS_12090 5079 6407 gene locus_tag LOCUS_12100 5079 6407 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_12100 6412 7209 gene locus_tag LOCUS_12110 6412 7209 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_12110 7247 8602 gene locus_tag LOCUS_12120 7247 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9871 8615 gene locus_tag LOCUS_12130 9871 8615 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_12130 9976 11592 gene locus_tag LOCUS_12140 9976 11592 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_12140 11621 12415 gene locus_tag LOCUS_12150 11621 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence047 197 397 gene locus_tag LOCUS_12160 gene cspB 197 397 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_12160 1123 560 gene locus_tag LOCUS_12170 1123 560 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730621.1 protein_id gnl|my_center|LOCUS_12170 2516 1212 gene locus_tag LOCUS_12180 2516 1212 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_12180 2588 3469 gene locus_tag LOCUS_12190 2588 3469 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_12190 3552 3755 gene locus_tag LOCUS_12200 3552 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3767 4624 gene locus_tag LOCUS_12210 gene purU 3767 4624 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_12210 6685 4628 gene locus_tag LOCUS_12220 6685 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8095 6707 gene locus_tag LOCUS_12230 8095 6707 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_12230 9430 8189 gene locus_tag LOCUS_12240 9430 8189 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_12240 9585 10565 gene locus_tag LOCUS_12250 9585 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11155 10583 gene locus_tag LOCUS_12260 11155 10583 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_12260 11507 11223 gene locus_tag LOCUS_12270 11507 11223 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405748.1 protein_id gnl|my_center|LOCUS_12270 12096 11623 gene locus_tag LOCUS_12280 12096 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 12252 12734 gene locus_tag LOCUS_12290 12252 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 12818 12747 gene locus_tag LOCUS_t00280 12818 12747 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12961 13776 gene locus_tag LOCUS_12300 12961 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence048 677 81 gene locus_tag LOCUS_12310 677 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1599 655 gene locus_tag LOCUS_12320 gene xerD 1599 655 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_12320 2140 1592 gene locus_tag LOCUS_12330 2140 1592 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_12330 3789 2137 gene locus_tag LOCUS_12340 gene pyrG 3789 2137 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_12340 5473 3899 gene locus_tag LOCUS_12350 gene recN 5473 3899 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_12350 6348 5488 gene locus_tag LOCUS_12360 gene nadK 6348 5488 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455932.1 protein_id gnl|my_center|LOCUS_12360 7211 6351 gene locus_tag LOCUS_12370 7211 6351 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_12370 8004 7222 gene locus_tag LOCUS_12380 8004 7222 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_12380 8096 9280 gene locus_tag LOCUS_12390 8096 9280 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12390 10431 9376 gene locus_tag LOCUS_12400 10431 9376 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_12400 10963 10547 gene locus_tag LOCUS_12410 10963 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 11880 11047 gene locus_tag LOCUS_12420 11880 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 12569 12460 gene locus_tag LOCUS_r00010 12569 12460 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence049 <1 795 gene locus_tag LOCUS_12430 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085689.1:cytochrome P450 862 1545 gene locus_tag LOCUS_12440 862 1545 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854958.1 protein_id gnl|my_center|LOCUS_12440 1666 3246 gene locus_tag LOCUS_12450 1666 3246 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974530.1 protein_id gnl|my_center|LOCUS_12450 3665 3258 gene locus_tag LOCUS_12460 3665 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4879 3662 gene locus_tag LOCUS_12470 4879 3662 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_12470 5596 4889 gene locus_tag LOCUS_12480 5596 4889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_12480 6792 5626 gene locus_tag LOCUS_12490 6792 5626 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110014.1 protein_id gnl|my_center|LOCUS_12490 6913 7353 gene locus_tag LOCUS_12500 6913 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 7447 7806 gene locus_tag LOCUS_12510 7447 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8878 8336 gene locus_tag LOCUS_12520 8878 8336 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_12520 8892 9197 gene locus_tag LOCUS_12530 8892 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 9226 9729 gene locus_tag LOCUS_12540 9226 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 11067 9838 gene locus_tag LOCUS_12550 11067 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 12055 11198 gene locus_tag LOCUS_12560 gene fabG 12055 11198 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence050 253 38 gene locus_tag LOCUS_12570 253 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1481 405 gene locus_tag LOCUS_12580 gene ychF 1481 405 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722138.1 protein_id gnl|my_center|LOCUS_12580 1698 2048 gene locus_tag LOCUS_12590 gene queF 1698 2048 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_12590 3104 2061 gene locus_tag LOCUS_12600 3104 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4671 3235 gene locus_tag LOCUS_12610 4671 3235 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_12610 4849 5451 gene locus_tag LOCUS_12620 4849 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6309 5464 gene locus_tag LOCUS_12630 6309 5464 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_12630 7322 6306 gene locus_tag LOCUS_12640 7322 6306 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_12640 7347 9986 gene locus_tag LOCUS_12650 7347 9986 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149096.1 protein_id gnl|my_center|LOCUS_12650 11657 10038 gene locus_tag LOCUS_12660 11657 10038 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729668.1 protein_id gnl|my_center|LOCUS_12660 <12769 11746 gene locus_tag LOCUS_12670 <12769 11746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001181592.1:FMN-binding glutamate synthase family protein >Feature sequence051 <1 747 gene locus_tag LOCUS_12680 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003219244.1:sporulation initiation inhibitor protein Soj 722 1621 gene locus_tag LOCUS_12690 722 1621 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_12690 2125 1799 gene locus_tag LOCUS_12700 gene trxA 2125 1799 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_12700 2405 4471 gene locus_tag LOCUS_12710 2405 4471 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727566.1 protein_id gnl|my_center|LOCUS_12710 5432 4473 gene locus_tag LOCUS_12720 gene trxB 5432 4473 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_12720 5917 5504 gene locus_tag LOCUS_12730 5917 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7339 5948 gene locus_tag LOCUS_12740 7339 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7232 7429 gene locus_tag LOCUS_12750 7232 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8312 7473 gene locus_tag LOCUS_12760 8312 7473 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169470.1 protein_id gnl|my_center|LOCUS_12760 10343 8349 gene locus_tag LOCUS_12770 10343 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 11062 10340 gene locus_tag LOCUS_12780 11062 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence052 2407 1295 gene locus_tag LOCUS_12790 gene carA 2407 1295 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_12790 3774 2404 gene locus_tag LOCUS_12800 3774 2404 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_12800 4747 3767 gene locus_tag LOCUS_12810 4747 3767 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_12810 5310 4744 gene locus_tag LOCUS_12820 gene pyrR 5310 4744 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_12820 5790 5383 gene locus_tag LOCUS_12830 gene nusB 5790 5383 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412985.1 protein_id gnl|my_center|LOCUS_12830 6350 5787 gene locus_tag LOCUS_12840 gene efp 6350 5787 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_12840 7520 6384 gene locus_tag LOCUS_12850 7520 6384 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 protein_id gnl|my_center|LOCUS_12850 7969 7526 gene locus_tag LOCUS_12860 gene aroQ 7969 7526 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_12860 8985 7969 gene locus_tag LOCUS_12870 8985 7969 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_12870 9518 8982 gene locus_tag LOCUS_12880 9518 8982 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_12880 10780 9515 gene locus_tag LOCUS_12890 gene aroC 10780 9515 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_12890 11526 10840 gene locus_tag LOCUS_12900 11526 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12378 11536 gene locus_tag LOCUS_12910 12378 11536 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence053 947 2206 gene locus_tag LOCUS_12920 947 2206 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_12920 2255 3157 gene locus_tag LOCUS_12930 2255 3157 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084944.1 protein_id gnl|my_center|LOCUS_12930 3177 4643 gene locus_tag LOCUS_12940 3177 4643 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_12940 5526 4843 gene locus_tag LOCUS_12950 5526 4843 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_12950 7292 5523 gene locus_tag LOCUS_12960 7292 5523 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_12960 8748 7396 gene locus_tag LOCUS_12970 8748 7396 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_12970 9633 8803 gene locus_tag LOCUS_12980 9633 8803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257903.1 protein_id gnl|my_center|LOCUS_12980 9754 10443 gene locus_tag LOCUS_12990 gene nadD 9754 10443 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_12990 10440 11879 gene locus_tag LOCUS_13000 10440 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 11876 12229 gene locus_tag LOCUS_13010 gene rsfS 11876 12229 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_13010 12293 12220 gene locus_tag LOCUS_t00290 12293 12220 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 423 869 gene locus_tag LOCUS_13020 423 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_13020 2037 913 gene locus_tag LOCUS_13030 2037 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_13030 3683 2091 gene locus_tag LOCUS_13040 3683 2091 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_13040 3979 3812 gene locus_tag LOCUS_13050 3979 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3978 4370 gene locus_tag LOCUS_13060 3978 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4383 4634 gene locus_tag LOCUS_13070 4383 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4755 6311 gene locus_tag LOCUS_13080 4755 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6951 6319 gene locus_tag LOCUS_13090 6951 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7092 8384 gene locus_tag LOCUS_13100 7092 8384 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_13100 8400 9605 gene locus_tag LOCUS_13110 8400 9605 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_13110 9633 11942 gene locus_tag LOCUS_13120 9633 11942 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence055 63 806 gene locus_tag LOCUS_13130 63 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 816 2810 gene locus_tag LOCUS_13140 816 2810 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_13140 2857 3396 gene locus_tag LOCUS_13150 2857 3396 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080798.1 protein_id gnl|my_center|LOCUS_13150 3403 4005 gene locus_tag LOCUS_13160 3403 4005 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_13160 4440 4009 gene locus_tag LOCUS_13170 4440 4009 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060706.1 protein_id gnl|my_center|LOCUS_13170 5650 4457 gene locus_tag LOCUS_13180 gene cyp142 5650 4457 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_13180 6746 5727 gene locus_tag LOCUS_13190 6746 5727 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224149877.1 protein_id gnl|my_center|LOCUS_13190 8510 6780 gene locus_tag LOCUS_13200 8510 6780 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_13200 8659 9084 gene locus_tag LOCUS_13210 8659 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 9133 10074 gene locus_tag LOCUS_13220 9133 10074 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 protein_id gnl|my_center|LOCUS_13220 10354 10076 gene locus_tag LOCUS_13230 10354 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 10597 11400 gene locus_tag LOCUS_13240 10597 11400 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057847.1 protein_id gnl|my_center|LOCUS_13240 11748 11404 gene locus_tag LOCUS_13250 11748 11404 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence056 1980 1768 gene locus_tag LOCUS_13260 1980 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1882 2445 gene locus_tag LOCUS_13270 1882 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3505 2450 gene locus_tag LOCUS_13280 3505 2450 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_13280 3563 4879 gene locus_tag LOCUS_13290 3563 4879 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_13290 6205 4880 gene locus_tag LOCUS_13300 6205 4880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_13300 6728 6258 gene locus_tag LOCUS_13310 6728 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7180 6722 gene locus_tag LOCUS_13320 7180 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 7431 7177 gene locus_tag LOCUS_13330 7431 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7823 7599 gene locus_tag LOCUS_13340 7823 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 8774 7875 gene locus_tag LOCUS_13350 8774 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 9655 8771 gene locus_tag LOCUS_13360 9655 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 10920 9652 gene locus_tag LOCUS_13370 10920 9652 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence057 381 1238 gene locus_tag LOCUS_13380 381 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1316 3019 gene locus_tag LOCUS_13390 1316 3019 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_13390 4318 3128 gene locus_tag LOCUS_13400 4318 3128 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_13400 5176 4328 gene locus_tag LOCUS_13410 gene paaX 5176 4328 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_13410 6528 5176 gene locus_tag LOCUS_13420 6528 5176 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_13420 7204 6602 gene locus_tag LOCUS_13430 7204 6602 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856229.1 protein_id gnl|my_center|LOCUS_13430 8304 7201 gene locus_tag LOCUS_13440 8304 7201 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026402003.1 protein_id gnl|my_center|LOCUS_13440 9656 8274 gene locus_tag LOCUS_13450 9656 8274 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_13450 10726 9656 gene locus_tag LOCUS_13460 10726 9656 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901847.1 protein_id gnl|my_center|LOCUS_13460 <11504 10730 gene locus_tag LOCUS_13470 <11504 10730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222473.1:enoyl-CoA hydratase >Feature sequence058 1123 1713 gene locus_tag LOCUS_13480 1123 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2611 1739 gene locus_tag LOCUS_13490 2611 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3427 2696 gene locus_tag LOCUS_13500 3427 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3489 3656 gene locus_tag LOCUS_13510 3489 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4855 3863 gene locus_tag LOCUS_13520 4855 3863 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_13520 4926 5858 gene locus_tag LOCUS_13530 4926 5858 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_13530 5909 6745 gene locus_tag LOCUS_13540 5909 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7623 6748 gene locus_tag LOCUS_13550 7623 6748 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_13550 8586 7666 gene locus_tag LOCUS_13560 8586 7666 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872677.1 protein_id gnl|my_center|LOCUS_13560 8889 8623 gene locus_tag LOCUS_13570 8889 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 9704 8886 gene locus_tag LOCUS_13580 9704 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10921 9767 gene locus_tag LOCUS_13590 10921 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence059 1283 2557 gene locus_tag LOCUS_13600 1283 2557 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_13600 2554 3345 gene locus_tag LOCUS_13610 2554 3345 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_13610 5053 3347 gene locus_tag LOCUS_13620 5053 3347 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_13620 5120 6727 gene locus_tag LOCUS_13630 gene fadD3 5120 6727 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_13630 7914 6724 gene locus_tag LOCUS_13640 7914 6724 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_13640 8004 9062 gene locus_tag LOCUS_13650 8004 9062 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_13650 9751 9281 gene locus_tag LOCUS_13660 9751 9281 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_13660 9858 11099 gene locus_tag LOCUS_13670 9858 11099 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence060 115 852 gene locus_tag LOCUS_13680 gene recO 115 852 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_13680 916 2280 gene locus_tag LOCUS_13690 916 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2294 4756 gene locus_tag LOCUS_13700 2294 4756 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_13700 4768 6099 gene locus_tag LOCUS_13710 4768 6099 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_13710 6136 8013 gene locus_tag LOCUS_13720 gene dnaG 6136 8013 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_13720 8006 9322 gene locus_tag LOCUS_13730 8006 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9322 9504 gene locus_tag LOCUS_13740 9322 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9554 9627 gene locus_tag LOCUS_t00300 9554 9627 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9641 9716 gene locus_tag LOCUS_t00310 9641 9716 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9755 10189 gene locus_tag LOCUS_13750 9755 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence061 <1 573 gene locus_tag LOCUS_13760 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027325.1:SDR family oxidoreductase 633 2372 gene locus_tag LOCUS_13770 633 2372 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_13770 2369 3592 gene locus_tag LOCUS_13780 2369 3592 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_13780 4519 3641 gene locus_tag LOCUS_13790 4519 3641 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_13790 4760 5950 gene locus_tag LOCUS_13800 4760 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 7601 5985 gene locus_tag LOCUS_13810 7601 5985 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_13810 7765 8970 gene locus_tag LOCUS_13820 gene cyp142 7765 8970 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_13820 9154 8957 gene locus_tag LOCUS_13830 9154 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9177 10439 gene locus_tag LOCUS_13840 9177 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence062 582 1397 gene locus_tag LOCUS_13850 582 1397 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_13850 1424 2617 gene locus_tag LOCUS_13860 1424 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_13860 4066 2651 gene locus_tag LOCUS_13870 4066 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5178 4102 gene locus_tag LOCUS_13880 5178 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6272 5175 gene locus_tag LOCUS_13890 6272 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6434 7327 gene locus_tag LOCUS_13900 6434 7327 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_13900 8132 7362 gene locus_tag LOCUS_13910 8132 7362 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228961.1 protein_id gnl|my_center|LOCUS_13910 8590 8132 gene locus_tag LOCUS_13920 8590 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence063 3340 1469 gene locus_tag LOCUS_13930 3340 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4734 3337 gene locus_tag LOCUS_13940 4734 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4857 6068 gene locus_tag LOCUS_13950 4857 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7391 6243 gene locus_tag LOCUS_13960 7391 6243 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_13960 7546 8319 gene locus_tag LOCUS_13970 7546 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 8316 9443 gene locus_tag LOCUS_13980 8316 9443 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence064 25 1203 gene locus_tag LOCUS_13990 25 1203 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_13990 1471 1986 gene locus_tag LOCUS_14000 1471 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2013 2855 gene locus_tag LOCUS_14010 2013 2855 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_14010 3726 2863 gene locus_tag LOCUS_14020 3726 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4655 3723 gene locus_tag LOCUS_14030 4655 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5658 4807 gene locus_tag LOCUS_14040 gene mca 5658 4807 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_14040 6035 5847 gene locus_tag LOCUS_14050 6035 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6061 6390 gene locus_tag LOCUS_14060 6061 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7206 6394 gene locus_tag LOCUS_14070 7206 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7297 8340 gene locus_tag LOCUS_14080 7297 8340 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_14080 8974 8429 gene locus_tag LOCUS_14090 8974 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 <10463 9084 gene locus_tag LOCUS_14100 <10463 9084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284781.1:error-prone DNA polymerase >Feature sequence065 1858 947 gene locus_tag LOCUS_14110 gene hemH 1858 947 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_14110 2922 1855 gene locus_tag LOCUS_14120 gene hemE 2922 1855 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_14120 3098 5221 gene locus_tag LOCUS_14130 3098 5221 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_14130 5900 5229 gene locus_tag LOCUS_14140 5900 5229 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_14140 6348 5953 gene locus_tag LOCUS_14150 6348 5953 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_14150 8906 6348 gene locus_tag LOCUS_14160 8906 6348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_14160 9660 8908 gene locus_tag LOCUS_14170 9660 8908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_14170 10381 9746 gene locus_tag LOCUS_14180 10381 9746 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence066 287 1963 gene locus_tag LOCUS_14190 gene ettA 287 1963 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_14190 1966 2337 gene locus_tag LOCUS_14200 1966 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2382 3137 gene locus_tag LOCUS_14210 2382 3137 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_14210 3184 4824 gene locus_tag LOCUS_14220 3184 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4851 5510 gene locus_tag LOCUS_14230 gene nucS 4851 5510 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_14230 6370 5522 gene locus_tag LOCUS_14240 gene htdY 6370 5522 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950882.1 protein_id gnl|my_center|LOCUS_14240 7281 6379 gene locus_tag LOCUS_14250 7281 6379 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_14250 7445 8644 gene locus_tag LOCUS_14260 7445 8644 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_14260 8683 9825 gene locus_tag LOCUS_14270 8683 9825 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence067 27 246 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacgcttcttggccggagccttctt 718 2073 gene locus_tag LOCUS_14280 718 2073 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_14280 5409 2098 gene locus_tag LOCUS_14290 5409 2098 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_14290 5793 6566 gene locus_tag LOCUS_14300 5793 6566 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_14300 6566 7285 gene locus_tag LOCUS_14310 6566 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 9441 7297 gene locus_tag LOCUS_14320 9441 7297 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence068 970 2 gene locus_tag LOCUS_14330 970 2 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_14330 1765 983 gene locus_tag LOCUS_14340 1765 983 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_14340 1876 2805 gene locus_tag LOCUS_14350 1876 2805 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_14350 3472 2792 gene locus_tag LOCUS_14360 3472 2792 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_14360 3779 4075 gene locus_tag LOCUS_14370 3779 4075 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 protein_id gnl|my_center|LOCUS_14370 5629 4157 gene locus_tag LOCUS_14380 5629 4157 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_14380 5884 5648 gene locus_tag LOCUS_14390 5884 5648 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_14390 7096 5951 gene locus_tag LOCUS_14400 7096 5951 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 protein_id gnl|my_center|LOCUS_14400 7156 7875 gene locus_tag LOCUS_14410 7156 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7881 9047 gene locus_tag LOCUS_14420 gene nifS 7881 9047 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_14420 9089 9571 gene locus_tag LOCUS_14430 9089 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence069 1 438 gene locus_tag LOCUS_14440 1 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1214 531 gene locus_tag LOCUS_14450 1214 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2223 1282 gene locus_tag LOCUS_14460 2223 1282 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267509.1 protein_id gnl|my_center|LOCUS_14460 2338 2709 gene locus_tag LOCUS_14470 2338 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3756 2770 gene locus_tag LOCUS_14480 3756 2770 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_14480 4683 3877 gene locus_tag LOCUS_14490 gene fabG 4683 3877 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_14490 5551 4724 gene locus_tag LOCUS_14500 5551 4724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_14500 5705 6598 gene locus_tag LOCUS_14510 5705 6598 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094214.1 protein_id gnl|my_center|LOCUS_14510 6654 6935 gene locus_tag LOCUS_14520 6654 6935 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_14520 6947 7243 gene locus_tag LOCUS_14530 6947 7243 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_14530 8133 7264 gene locus_tag LOCUS_14540 8133 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 <9843 8210 gene locus_tag LOCUS_14550 <9843 8210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776699.1:ABC transporter ATP-binding protein >Feature sequence070 3809 216 gene locus_tag LOCUS_14560 gene rpoB 3809 216 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_14560 4591 4214 gene locus_tag LOCUS_14570 gene rplL 4591 4214 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_14570 5322 4594 gene locus_tag LOCUS_14580 5322 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 6393 5686 gene locus_tag LOCUS_14590 gene rplA 6393 5686 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_14590 6923 6498 gene locus_tag LOCUS_14600 gene rplK 6923 6498 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141598.1 protein_id gnl|my_center|LOCUS_14600 7784 7032 gene locus_tag LOCUS_14610 7784 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8077 7784 gene locus_tag LOCUS_14620 8077 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8200 8127 gene locus_tag LOCUS_t00320 8200 8127 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8692 8330 gene locus_tag LOCUS_14630 8692 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9320 8664 gene locus_tag LOCUS_14640 9320 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9610 9446 gene locus_tag LOCUS_14650 gene rpmG 9610 9446 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence071 256 456 gene locus_tag LOCUS_14660 256 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 629 1903 gene locus_tag LOCUS_14670 629 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1973 2203 gene locus_tag LOCUS_14680 1973 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2289 3827 gene locus_tag LOCUS_14690 2289 3827 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_14690 3881 4588 gene locus_tag LOCUS_14700 3881 4588 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078328667.1 protein_id gnl|my_center|LOCUS_14700 4585 5421 gene locus_tag LOCUS_14710 4585 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5441 5815 gene locus_tag LOCUS_14720 5441 5815 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_14720 7279 5828 gene locus_tag LOCUS_14730 gene mftF 7279 5828 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_14730 7968 7276 gene locus_tag LOCUS_14740 gene mftE 7968 7276 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877069.1 protein_id gnl|my_center|LOCUS_14740 8919 7999 gene locus_tag LOCUS_14750 8919 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 <9560 8982 gene locus_tag LOCUS_14760 <9560 8982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051313.1:MoxR family ATPase >Feature sequence072 <1 635 gene locus_tag LOCUS_14770 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229548.1:cation diffusion facilitator family transporter 2194 653 gene locus_tag LOCUS_14780 2194 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3820 2234 gene locus_tag LOCUS_14790 3820 2234 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_14790 4293 3838 gene locus_tag LOCUS_14800 gene perR 4293 3838 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_14800 4359 5285 gene locus_tag LOCUS_14810 4359 5285 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_14810 5282 5932 gene locus_tag LOCUS_14820 5282 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7012 5945 gene locus_tag LOCUS_14830 7012 5945 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_14830 7248 7009 gene locus_tag LOCUS_14840 7248 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8495 7257 gene locus_tag LOCUS_14850 gene xseA 8495 7257 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_14850 9031 8552 gene locus_tag LOCUS_14860 gene mce 9031 8552 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence073 <1 948 gene locus_tag LOCUS_14870 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392846.1:prephenate dehydrogenase 948 2243 gene locus_tag LOCUS_14880 gene aroA 948 2243 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_14880 2240 2887 gene locus_tag LOCUS_14890 gene cmk 2240 2887 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_14890 2884 3597 gene locus_tag LOCUS_14900 2884 3597 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_14900 4183 3629 gene locus_tag LOCUS_14910 4183 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4652 4239 gene locus_tag LOCUS_14920 4652 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5739 4666 gene locus_tag LOCUS_14930 gene ispH 5739 4666 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_14930 5775 7133 gene locus_tag LOCUS_14940 5775 7133 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_14940 7130 8449 gene locus_tag LOCUS_14950 gene der 7130 8449 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_14950 8455 9390 gene locus_tag LOCUS_14960 8455 9390 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence074 1268 168 gene locus_tag LOCUS_14970 1268 168 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_14970 2783 1302 gene locus_tag LOCUS_14980 2783 1302 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_14980 3104 2799 gene locus_tag LOCUS_14990 3104 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228958.1 protein_id gnl|my_center|LOCUS_14990 3256 4023 gene locus_tag LOCUS_15000 3256 4023 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_15000 4635 4033 gene locus_tag LOCUS_15010 4635 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6311 4632 gene locus_tag LOCUS_15020 6311 4632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_15020 6509 6721 gene locus_tag LOCUS_15030 6509 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 6746 7318 gene locus_tag LOCUS_15040 6746 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7340 8527 gene locus_tag LOCUS_15050 gene cyp142 7340 8527 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_15050 8524 9057 gene locus_tag LOCUS_15060 8524 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence075 <1 607 gene locus_tag LOCUS_15070 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356893.1:dTDP-4-dehydrorhamnose 3,5-epimerase 618 1574 gene locus_tag LOCUS_15080 gene rfbB 618 1574 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_15080 1576 2430 gene locus_tag LOCUS_15090 gene rfbD 1576 2430 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_15090 3047 2451 gene locus_tag LOCUS_15100 3047 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3580 5451 gene locus_tag LOCUS_15110 3580 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5496 6857 gene locus_tag LOCUS_15120 5496 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7202 8977 gene locus_tag LOCUS_15130 7202 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence076 599 1381 gene locus_tag LOCUS_15140 599 1381 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_15140 2566 1385 gene locus_tag LOCUS_15150 2566 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3353 2580 gene locus_tag LOCUS_15160 3353 2580 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337180.1 protein_id gnl|my_center|LOCUS_15160 3418 5112 gene locus_tag LOCUS_15170 3418 5112 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_15170 6021 5116 gene locus_tag LOCUS_15180 6021 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 6134 8563 gene locus_tag LOCUS_15190 6134 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8560 8967 gene locus_tag LOCUS_15200 8560 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence077 1164 1679 gene locus_tag LOCUS_15210 1164 1679 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_15210 1683 2567 gene locus_tag LOCUS_15220 1683 2567 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_15220 3440 2568 gene locus_tag LOCUS_15230 3440 2568 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_15230 3553 4386 gene locus_tag LOCUS_15240 3553 4386 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_15240 4399 4896 gene locus_tag LOCUS_15250 4399 4896 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_15250 4900 5421 gene locus_tag LOCUS_15260 4900 5421 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_15260 5910 5437 gene locus_tag LOCUS_15270 5910 5437 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_15270 5969 6850 gene locus_tag LOCUS_15280 5969 6850 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_15280 6924 7904 gene locus_tag LOCUS_15290 6924 7904 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence078 365 1477 gene locus_tag LOCUS_15300 365 1477 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_15300 3948 1546 gene locus_tag LOCUS_15310 3948 1546 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_15310 3966 4196 gene locus_tag LOCUS_15320 3966 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4769 4134 gene locus_tag LOCUS_15330 4769 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5038 4962 gene locus_tag LOCUS_t00330 5038 4962 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6081 5119 gene locus_tag LOCUS_15340 6081 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7244 6087 gene locus_tag LOCUS_15350 7244 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7379 8308 gene locus_tag LOCUS_15360 7379 8308 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_15360 <9247 8319 gene locus_tag LOCUS_15370 <9247 8319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068443.1:FKBP-type peptidyl-prolyl cis-trans isomerase >Feature sequence079 218 1540 gene locus_tag LOCUS_15380 218 1540 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 protein_id gnl|my_center|LOCUS_15380 1540 2949 gene locus_tag LOCUS_15390 gene thrC 1540 2949 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_15390 2995 4140 gene locus_tag LOCUS_15400 2995 4140 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_15400 4334 5920 gene locus_tag LOCUS_15410 4334 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6013 6219 gene locus_tag LOCUS_15420 gene rpmE 6013 6219 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896340.1 protein_id gnl|my_center|LOCUS_15420 6257 7273 gene locus_tag LOCUS_15430 6257 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 7270 8343 gene locus_tag LOCUS_15440 gene prfA 7270 8343 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_15440 8340 9221 gene locus_tag LOCUS_15450 gene prmC 8340 9221 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence080 1240 572 gene locus_tag LOCUS_15460 1240 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1315 2547 gene locus_tag LOCUS_15470 1315 2547 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_15470 3407 2544 gene locus_tag LOCUS_15480 3407 2544 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_15480 3679 3482 gene locus_tag LOCUS_15490 3679 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4883 3804 gene locus_tag LOCUS_15500 4883 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6172 4922 gene locus_tag LOCUS_15510 6172 4922 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_15510 6277 6471 gene locus_tag LOCUS_15520 6277 6471 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_15520 6518 7750 gene locus_tag LOCUS_15530 6518 7750 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_15530 7750 8256 gene locus_tag LOCUS_15540 7750 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8264 8896 gene locus_tag LOCUS_15550 8264 8896 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence081 288 115 gene locus_tag LOCUS_15560 288 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2058 415 gene locus_tag LOCUS_15570 gene groL 2058 415 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_15570 2363 2073 gene locus_tag LOCUS_15580 gene groES 2363 2073 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_15580 3528 2488 gene locus_tag LOCUS_15590 gene tsaD 3528 2488 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_15590 4142 3525 gene locus_tag LOCUS_15600 4142 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4837 4139 gene locus_tag LOCUS_15610 gene tsaB 4837 4139 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_15610 5364 4837 gene locus_tag LOCUS_15620 gene tsaE 5364 4837 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_15620 6482 5364 gene locus_tag LOCUS_15630 gene alr 6482 5364 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_15630 7005 6487 gene locus_tag LOCUS_15640 7005 6487 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_15640 8864 7053 gene locus_tag LOCUS_15650 8864 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence082 <1 830 gene locus_tag LOCUS_15660 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257609.1:ABC transporter permease 835 2034 gene locus_tag LOCUS_15670 835 2034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_15670 2042 2917 gene locus_tag LOCUS_15680 2042 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2908 4110 gene locus_tag LOCUS_15690 2908 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5555 4107 gene locus_tag LOCUS_15700 5555 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5878 5564 gene locus_tag LOCUS_15710 5878 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 6058 6624 gene locus_tag LOCUS_15720 6058 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7636 6638 gene locus_tag LOCUS_15730 gene meaB 7636 6638 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_15730 <8945 7633 gene locus_tag LOCUS_15740 <8945 7633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337301.1:methylmalonyl-CoA mutase >Feature sequence083 1813 185 gene locus_tag LOCUS_15750 1813 185 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_15750 1887 2618 gene locus_tag LOCUS_15760 1887 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3293 2631 gene locus_tag LOCUS_15770 gene dapB 3293 2631 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_15770 3195 3527 gene locus_tag LOCUS_15780 3195 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4769 3429 gene locus_tag LOCUS_15790 4769 3429 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997834.1 protein_id gnl|my_center|LOCUS_15790 7128 4717 gene locus_tag LOCUS_15800 7128 4717 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414124.1 protein_id gnl|my_center|LOCUS_15800 7604 7320 gene locus_tag LOCUS_15810 gene rpsO 7604 7320 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence084 <1 822 gene locus_tag LOCUS_15820 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970482.1:acyl-CoA thioesterase II 902 1555 gene locus_tag LOCUS_15830 902 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1676 1751 gene locus_tag LOCUS_t00340 1676 1751 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1923 3176 gene locus_tag LOCUS_15840 1923 3176 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_15840 4841 3279 gene locus_tag LOCUS_15850 4841 3279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_15850 4929 5423 gene locus_tag LOCUS_15860 4929 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 5420 6652 gene locus_tag LOCUS_15870 gene rfbH 5420 6652 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261040.1 protein_id gnl|my_center|LOCUS_15870 6652 7473 gene locus_tag LOCUS_15880 6652 7473 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence085 <1 843 gene locus_tag LOCUS_15890 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005094688.1:sulfotransferase 843 1646 gene locus_tag LOCUS_15900 843 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1703 1779 gene locus_tag LOCUS_t00350 1703 1779 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2063 3199 gene locus_tag LOCUS_15910 2063 3199 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731407.1 protein_id gnl|my_center|LOCUS_15910 7839 3526 gene locus_tag LOCUS_15920 7839 3526 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726878.1 protein_id gnl|my_center|LOCUS_15920 <8878 7836 gene locus_tag LOCUS_15930 <8878 7836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763226.1:glycosyltransferase family 4 protein >Feature sequence086 1218 190 gene locus_tag LOCUS_15940 gene galK 1218 190 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_15940 2105 1215 gene locus_tag LOCUS_15950 gene galT 2105 1215 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_15950 2166 3041 gene locus_tag LOCUS_15960 2166 3041 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_15960 3073 4221 gene locus_tag LOCUS_15970 3073 4221 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_15970 4221 5054 gene locus_tag LOCUS_15980 4221 5054 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_15980 5903 5067 gene locus_tag LOCUS_15990 5903 5067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227235.1 protein_id gnl|my_center|LOCUS_15990 6865 5900 gene locus_tag LOCUS_16000 6865 5900 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 protein_id gnl|my_center|LOCUS_16000 7173 6862 gene locus_tag LOCUS_16010 7173 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 8095 7175 gene locus_tag LOCUS_16020 gene map 8095 7175 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908411.1 protein_id gnl|my_center|LOCUS_16020 8159 8536 gene locus_tag LOCUS_16030 8159 8536 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence087 <1 582 gene locus_tag LOCUS_16040 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225004.1:phosphotransferase family protein 1044 592 gene locus_tag LOCUS_16050 1044 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1898 1041 gene locus_tag LOCUS_16060 1898 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3180 1939 gene locus_tag LOCUS_16070 3180 1939 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_16070 3813 3223 gene locus_tag LOCUS_16080 3813 3223 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_16080 3953 3881 gene locus_tag LOCUS_t00360 3953 3881 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4623 4021 gene locus_tag LOCUS_16090 4623 4021 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_16090 6040 4625 gene locus_tag LOCUS_16100 gene gltX 6040 4625 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_16100 6154 7062 gene locus_tag LOCUS_16110 6154 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7676 7116 gene locus_tag LOCUS_16120 7676 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <8707 7688 gene locus_tag LOCUS_16130 <8707 7688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583555.1:citramalate synthase >Feature sequence088 773 48 gene locus_tag LOCUS_16140 773 48 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_16140 825 2729 gene locus_tag LOCUS_16150 825 2729 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_16150 3577 2738 gene locus_tag LOCUS_16160 gene era 3577 2738 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_16160 4860 3574 gene locus_tag LOCUS_16170 4860 3574 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_16170 5426 4851 gene locus_tag LOCUS_16180 gene ybeY 5426 4851 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_16180 6370 5423 gene locus_tag LOCUS_16190 6370 5423 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_16190 6439 6990 gene locus_tag LOCUS_16200 6439 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 7375 8022 gene locus_tag LOCUS_16210 7375 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence089 <1 700 gene locus_tag LOCUS_16220 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225726.1:acyl-CoA dehydrogenase family protein 739 1953 gene locus_tag LOCUS_16230 739 1953 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_16230 1983 3278 gene locus_tag LOCUS_16240 1983 3278 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_16240 3316 4107 gene locus_tag LOCUS_16250 3316 4107 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_16250 4182 5729 gene locus_tag LOCUS_16260 4182 5729 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_16260 5726 6472 gene locus_tag LOCUS_16270 5726 6472 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_16270 6493 7431 gene locus_tag LOCUS_16280 gene gluQRS 6493 7431 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897726.1 protein_id gnl|my_center|LOCUS_16280 7428 7709 gene locus_tag LOCUS_16290 7428 7709 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_16290 7719 8075 gene locus_tag LOCUS_16300 gene arsC 7719 8075 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_16300 8294 8082 gene locus_tag LOCUS_16310 8294 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence090 335 946 gene locus_tag LOCUS_16320 335 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 943 1605 gene locus_tag LOCUS_16330 943 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1602 3086 gene locus_tag LOCUS_16340 1602 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3086 4489 gene locus_tag LOCUS_16350 gene dacB 3086 4489 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113125.1 protein_id gnl|my_center|LOCUS_16350 4725 4438 gene locus_tag LOCUS_16360 4725 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4606 5145 gene locus_tag LOCUS_16370 4606 5145 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_16370 5267 5614 gene locus_tag LOCUS_16380 5267 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 5611 5820 gene locus_tag LOCUS_16390 5611 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5817 6098 gene locus_tag LOCUS_16400 5817 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6099 6332 gene locus_tag LOCUS_16410 6099 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 6329 7303 gene locus_tag LOCUS_16420 6329 7303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_16420 7300 8073 gene locus_tag LOCUS_16430 7300 8073 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence091 1116 1040 gene locus_tag LOCUS_t00370 1116 1040 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3584 1356 gene locus_tag LOCUS_16440 3584 1356 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_16440 3703 4002 gene locus_tag LOCUS_16450 3703 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4011 4388 gene locus_tag LOCUS_16460 gene vapC1 4011 4388 CDS product type II toxin-antitoxin system ribonuclease VapC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400580.1 protein_id gnl|my_center|LOCUS_16460 4544 4455 gene locus_tag LOCUS_t00380 4544 4455 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4677 4590 gene locus_tag LOCUS_t00390 4677 4590 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5703 4732 gene locus_tag LOCUS_16470 gene pheA 5703 4732 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_16470 5705 6520 gene locus_tag LOCUS_16480 gene larB 5705 6520 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_16480 6513 7841 gene locus_tag LOCUS_16490 gene larC 6513 7841 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence092 319 1455 gene locus_tag LOCUS_16500 gene dnaJ 319 1455 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_16500 1458 1874 gene locus_tag LOCUS_16510 1458 1874 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_16510 1885 3855 gene locus_tag LOCUS_16520 1885 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4824 3856 gene locus_tag LOCUS_16530 4824 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4955 6235 gene locus_tag LOCUS_16540 4955 6235 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_16540 6235 7476 gene locus_tag LOCUS_16550 gene purD 6235 7476 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_16550 7473 7922 gene locus_tag LOCUS_16560 gene purE 7473 7922 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence093 171 713 gene locus_tag LOCUS_16570 171 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1246 746 gene locus_tag LOCUS_16580 1246 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1406 2098 gene locus_tag LOCUS_16590 gene pgsA 1406 2098 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979475.1 protein_id gnl|my_center|LOCUS_16590 2105 3061 gene locus_tag LOCUS_16600 2105 3061 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_16600 3063 4139 gene locus_tag LOCUS_16610 3063 4139 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907730.1 protein_id gnl|my_center|LOCUS_16610 4176 4943 gene locus_tag LOCUS_16620 4176 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4940 6142 gene locus_tag LOCUS_16630 4940 6142 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_16630 6191 7096 gene locus_tag LOCUS_16640 gene pdxS 6191 7096 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_16640 7150 7737 gene locus_tag LOCUS_16650 gene pdxT 7150 7737 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence094 509 249 gene locus_tag LOCUS_16660 509 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 592 1194 gene locus_tag LOCUS_16670 gene coaE 592 1194 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_16670 2595 1201 gene locus_tag LOCUS_16680 2595 1201 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_16680 3484 2585 gene locus_tag LOCUS_16690 3484 2585 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 protein_id gnl|my_center|LOCUS_16690 4247 3486 gene locus_tag LOCUS_16700 4247 3486 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_16700 4351 6366 gene locus_tag LOCUS_16710 gene uvrB 4351 6366 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence095 28 2823 gene locus_tag LOCUS_16720 28 2823 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_16720 4208 2889 gene locus_tag LOCUS_16730 4208 2889 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_16730 5914 4211 gene locus_tag LOCUS_16740 5914 4211 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_16740 6617 6000 gene locus_tag LOCUS_16750 6617 6000 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615057.1 protein_id gnl|my_center|LOCUS_16750 6689 7651 gene locus_tag LOCUS_16760 6689 7651 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163264318.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence096 112 1260 gene locus_tag LOCUS_16770 112 1260 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085465.1 protein_id gnl|my_center|LOCUS_16770 2287 1331 gene locus_tag LOCUS_16780 2287 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2425 3045 gene locus_tag LOCUS_16790 2425 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4271 3072 gene locus_tag LOCUS_16800 4271 3072 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_16800 5532 4264 gene locus_tag LOCUS_16810 5532 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5767 6804 gene locus_tag LOCUS_16820 5767 6804 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence097 1905 4952 gene locus_tag LOCUS_16830 1905 4952 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_16830 5543 4953 gene locus_tag LOCUS_16840 5543 4953 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_16840 6646 5540 gene locus_tag LOCUS_16850 6646 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7797 6661 gene locus_tag LOCUS_16860 7797 6661 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence098 863 189 gene locus_tag LOCUS_16870 863 189 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_16870 1915 860 gene locus_tag LOCUS_16880 1915 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3970 1988 gene locus_tag LOCUS_16890 3970 1988 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_16890 4136 4996 gene locus_tag LOCUS_16900 4136 4996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_16900 4998 5753 gene locus_tag LOCUS_16910 4998 5753 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_16910 5750 6733 gene locus_tag LOCUS_16920 5750 6733 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence099 1590 691 gene locus_tag LOCUS_16930 1590 691 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_16930 2650 1667 gene locus_tag LOCUS_16940 2650 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3207 2731 gene locus_tag LOCUS_16950 3207 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4831 3224 gene locus_tag LOCUS_16960 4831 3224 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_16960 5037 5405 gene locus_tag LOCUS_16970 5037 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 <7821 5407 gene locus_tag LOCUS_16980 <7821 5407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411486.1:carboxylesterase CaeA >Feature sequence100 95 1252 gene locus_tag LOCUS_16990 95 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1249 2010 gene locus_tag LOCUS_17000 1249 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2007 2546 gene locus_tag LOCUS_17010 2007 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2598 2777 gene locus_tag LOCUS_17020 2598 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2774 3178 gene locus_tag LOCUS_17030 2774 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5437 3152 gene locus_tag LOCUS_17040 5437 3152 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_17040 5575 5925 gene locus_tag LOCUS_17050 gene bldG 5575 5925 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_17050 5996 7438 gene locus_tag LOCUS_17060 gene nhaA 5996 7438 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence101 <1 943 gene locus_tag LOCUS_17070 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230171.1:lipase family protein 1119 940 gene locus_tag LOCUS_17080 1119 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2189 1122 gene locus_tag LOCUS_17090 gene bioB 2189 1122 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_17090 3981 2233 gene locus_tag LOCUS_17100 3981 2233 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_17100 4859 3978 gene locus_tag LOCUS_17110 gene dapA 4859 3978 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_17110 6044 4926 gene locus_tag LOCUS_17120 6044 4926 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_17120 6690 6058 gene locus_tag LOCUS_17130 6690 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 <7593 6741 gene locus_tag LOCUS_17140 <7593 6741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030872966.1:SURF1 family protein >Feature sequence102 885 1649 gene locus_tag LOCUS_17150 885 1649 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_17150 2436 1639 gene locus_tag LOCUS_17160 2436 1639 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_17160 3013 2453 gene locus_tag LOCUS_17170 3013 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2995 4302 gene locus_tag LOCUS_17180 2995 4302 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_17180 5742 4348 gene locus_tag LOCUS_17190 5742 4348 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893069.1 protein_id gnl|my_center|LOCUS_17190 6694 5849 gene locus_tag LOCUS_17200 6694 5849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_17200 <7564 6691 gene locus_tag LOCUS_17210 <7564 6691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030376.1:ABC transporter permease subunit >Feature sequence103 1926 112 gene locus_tag LOCUS_17220 gene ilvD 1926 112 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087307.1 protein_id gnl|my_center|LOCUS_17220 2142 2067 gene locus_tag LOCUS_t00400 2142 2067 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2742 2203 gene locus_tag LOCUS_17230 2742 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3496 2942 gene locus_tag LOCUS_17240 gene moaC 3496 2942 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_17240 3552 4520 gene locus_tag LOCUS_17250 3552 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_17250 5144 4566 gene locus_tag LOCUS_17260 5144 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6311 5316 gene locus_tag LOCUS_17270 gene moaA 6311 5316 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_17270 7274 6321 gene locus_tag LOCUS_17280 7274 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence104 457 1476 gene locus_tag LOCUS_17290 457 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1571 2302 gene locus_tag LOCUS_17300 gene ygiD 1571 2302 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_17300 4198 2324 gene locus_tag LOCUS_17310 4198 2324 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_17310 5634 4270 gene locus_tag LOCUS_17320 gene phoR 5634 4270 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_17320 6317 5634 gene locus_tag LOCUS_17330 gene phoP 6317 5634 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_17330 6502 6975 gene locus_tag LOCUS_17340 6502 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence105 1142 66 gene locus_tag LOCUS_17350 gene dapE 1142 66 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_17350 1969 1145 gene locus_tag LOCUS_17360 1969 1145 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_17360 3182 2070 gene locus_tag LOCUS_17370 3182 2070 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_17370 4531 3179 gene locus_tag LOCUS_17380 gene hflX 4531 3179 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 protein_id gnl|my_center|LOCUS_17380 5321 4524 gene locus_tag LOCUS_17390 gene dapF 5321 4524 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_17390 6303 5368 gene locus_tag LOCUS_17400 gene miaA 6303 5368 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390091.1 protein_id gnl|my_center|LOCUS_17400 <7193 6300 gene locus_tag LOCUS_17410 <7193 6300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392626.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence106 2115 1588 gene locus_tag LOCUS_17420 2115 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2600 2112 gene locus_tag LOCUS_17430 2600 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3628 2648 gene locus_tag LOCUS_17440 3628 2648 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776686.1 protein_id gnl|my_center|LOCUS_17440 5232 3637 gene locus_tag LOCUS_17450 5232 3637 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_17450 6442 5225 gene locus_tag LOCUS_17460 6442 5225 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_17460 <7167 6439 gene locus_tag LOCUS_17470 <7167 6439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776688.1:HAD-IB family hydrolase >Feature sequence107 <1 1319 gene locus_tag LOCUS_17480 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618874.1:amidase 1368 1964 gene locus_tag LOCUS_17490 1368 1964 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087452.1 protein_id gnl|my_center|LOCUS_17490 1987 2739 gene locus_tag LOCUS_17500 gene fabG 1987 2739 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_17500 4295 2751 gene locus_tag LOCUS_17510 4295 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4392 4937 gene locus_tag LOCUS_17520 4392 4937 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_17520 4980 5915 gene locus_tag LOCUS_17530 4980 5915 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_17530 6182 5931 gene locus_tag LOCUS_17540 6182 5931 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 protein_id gnl|my_center|LOCUS_17540 6867 6190 gene locus_tag LOCUS_17550 6867 6190 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence108 1594 1256 gene locus_tag LOCUS_17560 1594 1256 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 protein_id gnl|my_center|LOCUS_17560 2932 1673 gene locus_tag LOCUS_17570 2932 1673 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_17570 3560 3060 gene locus_tag LOCUS_17580 3560 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4381 3557 gene locus_tag LOCUS_17590 gene larE 4381 3557 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_17590 5072 4389 gene locus_tag LOCUS_17600 5072 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 <6944 5115 gene locus_tag LOCUS_17610 <6944 5115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256094.1:FdhF/YdeP family oxidoreductase >Feature sequence109 <1 863 gene locus_tag LOCUS_17620 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900075.1:SDR family oxidoreductase 871 1836 gene locus_tag LOCUS_17630 871 1836 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_17630 2685 1852 gene locus_tag LOCUS_17640 gene fabG 2685 1852 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_17640 3629 2682 gene locus_tag LOCUS_17650 3629 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4438 3635 gene locus_tag LOCUS_17660 4438 3635 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_17660 4527 5345 gene locus_tag LOCUS_17670 gene tauD 4527 5345 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_17670 5428 6252 gene locus_tag LOCUS_17680 5428 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence110 208 540 gene locus_tag LOCUS_17690 208 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 614 1408 gene locus_tag LOCUS_17700 614 1408 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260655.1 protein_id gnl|my_center|LOCUS_17700 1786 2607 gene locus_tag LOCUS_17710 1786 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3809 2667 gene locus_tag LOCUS_17720 3809 2667 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_17720 4164 3916 gene locus_tag LOCUS_17730 4164 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4075 5115 gene locus_tag LOCUS_17740 4075 5115 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 protein_id gnl|my_center|LOCUS_17740 5190 6425 gene locus_tag LOCUS_17750 5190 6425 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence111 412 1713 gene locus_tag LOCUS_17760 412 1713 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_17760 1761 2621 gene locus_tag LOCUS_17770 1761 2621 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266338.1 protein_id gnl|my_center|LOCUS_17770 3271 2618 gene locus_tag LOCUS_17780 3271 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4350 3295 gene locus_tag LOCUS_17790 4350 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728645.1 protein_id gnl|my_center|LOCUS_17790 4517 4972 gene locus_tag LOCUS_17800 4517 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 4975 5748 gene locus_tag LOCUS_17810 4975 5748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727863.1 protein_id gnl|my_center|LOCUS_17810 5917 6645 gene locus_tag LOCUS_17820 5917 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence112 781 374 gene locus_tag LOCUS_17830 781 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 836 1543 gene locus_tag LOCUS_17840 836 1543 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_17840 2414 1545 gene locus_tag LOCUS_17850 2414 1545 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_17850 2972 2436 gene locus_tag LOCUS_17860 2972 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3657 3049 gene locus_tag LOCUS_17870 3657 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5051 3660 gene locus_tag LOCUS_17880 5051 3660 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_17880 5183 5869 gene locus_tag LOCUS_17890 5183 5869 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106691.1 protein_id gnl|my_center|LOCUS_17890 5866 6642 gene locus_tag LOCUS_17900 5866 6642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence113 552 22 gene locus_tag LOCUS_17910 552 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1196 549 gene locus_tag LOCUS_17920 1196 549 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_17920 1219 1761 gene locus_tag LOCUS_17930 gene def 1219 1761 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_17930 1769 2665 gene locus_tag LOCUS_17940 gene fmt 1769 2665 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224762.1 protein_id gnl|my_center|LOCUS_17940 2662 3867 gene locus_tag LOCUS_17950 2662 3867 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_17950 3864 4355 gene locus_tag LOCUS_17960 3864 4355 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_17960 4470 5453 gene locus_tag LOCUS_17970 gene ribD 4470 5453 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530135.1 protein_id gnl|my_center|LOCUS_17970 5456 6055 gene locus_tag LOCUS_17980 5456 6055 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence114 355 1101 gene locus_tag LOCUS_17990 355 1101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_17990 1098 2186 gene locus_tag LOCUS_18000 1098 2186 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_18000 2194 3150 gene locus_tag LOCUS_18010 2194 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3756 3136 gene locus_tag LOCUS_18020 3756 3136 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_18020 4264 3761 gene locus_tag LOCUS_18030 4264 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5529 4345 gene locus_tag LOCUS_18040 5529 4345 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_18040 5592 6461 gene locus_tag LOCUS_18050 5592 6461 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence115 1768 1019 gene locus_tag LOCUS_18060 gene sufC 1768 1019 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_18060 2446 1841 gene locus_tag LOCUS_18070 2446 1841 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_18070 2679 3794 gene locus_tag LOCUS_18080 2679 3794 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_18080 3822 4274 gene locus_tag LOCUS_18090 3822 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4324 4545 gene locus_tag LOCUS_18100 4324 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4558 5331 gene locus_tag LOCUS_18110 4558 5331 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_18110 <6537 5335 gene locus_tag LOCUS_18120 <6537 5335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114556.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type >Feature sequence116 89 457 gene locus_tag LOCUS_18130 89 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 476 1714 gene locus_tag LOCUS_18140 476 1714 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_18140 1719 2921 gene locus_tag LOCUS_18150 1719 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2953 3990 gene locus_tag LOCUS_18160 2953 3990 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_18160 5169 4006 gene locus_tag LOCUS_18170 5169 4006 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_18170 6173 5166 gene locus_tag LOCUS_18180 6173 5166 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence117 932 144 gene locus_tag LOCUS_18190 932 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1759 1049 gene locus_tag LOCUS_18200 1759 1049 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_18200 1844 2896 gene locus_tag LOCUS_18210 1844 2896 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_18210 2889 3743 gene locus_tag LOCUS_18220 gene parJ 2889 3743 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_18220 6230 3759 gene locus_tag LOCUS_18230 gene leuS 6230 3759 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_18230 6366 6439 gene locus_tag LOCUS_t00410 6366 6439 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 <1 795 gene locus_tag LOCUS_18240 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742217.1:class II fructose-bisphosphatase 1025 2113 gene locus_tag LOCUS_18250 1025 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3049 2123 gene locus_tag LOCUS_18260 3049 2123 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853543.1 protein_id gnl|my_center|LOCUS_18260 4051 3128 gene locus_tag LOCUS_18270 4051 3128 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_18270 4947 4306 gene locus_tag LOCUS_18280 4947 4306 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_18280 5593 4973 gene locus_tag LOCUS_18290 5593 4973 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence119 615 1868 gene locus_tag LOCUS_18300 615 1868 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_18300 1868 2332 gene locus_tag LOCUS_18310 1868 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2464 3384 gene locus_tag LOCUS_18320 2464 3384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_18320 3545 4171 gene locus_tag LOCUS_18330 3545 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5257 4184 gene locus_tag LOCUS_18340 5257 4184 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence120 458 1699 gene locus_tag LOCUS_18350 458 1699 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_18350 1720 2979 gene locus_tag LOCUS_18360 1720 2979 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_18360 3107 3397 gene locus_tag LOCUS_18370 3107 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3385 3846 gene locus_tag LOCUS_18380 3385 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3843 4610 gene locus_tag LOCUS_18390 gene atpB 3843 4610 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 protein_id gnl|my_center|LOCUS_18390 4705 4977 gene locus_tag LOCUS_18400 4705 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5079 5645 gene locus_tag LOCUS_18410 5079 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5660 6199 gene locus_tag LOCUS_18420 gene atpF 5660 6199 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence121 411 1079 gene locus_tag LOCUS_18430 411 1079 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_18430 1331 4114 gene locus_tag LOCUS_18440 1331 4114 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022472.1 protein_id gnl|my_center|LOCUS_18440 4111 4506 gene locus_tag LOCUS_18450 4111 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5253 4525 gene locus_tag LOCUS_18460 5253 4525 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence122 192 710 gene locus_tag LOCUS_18470 192 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 808 1386 gene locus_tag LOCUS_18480 808 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1619 2026 gene locus_tag LOCUS_18490 1619 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2607 2419 gene locus_tag LOCUS_18500 2607 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2972 3418 gene locus_tag LOCUS_18510 2972 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4769 4131 gene locus_tag LOCUS_18520 4769 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 5873 4779 gene locus_tag LOCUS_18530 5873 4779 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence123 <1 1682 gene locus_tag LOCUS_18540 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein 1733 2551 gene locus_tag LOCUS_18550 1733 2551 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_18550 3742 2567 gene locus_tag LOCUS_18560 3742 2567 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_18560 3772 4596 gene locus_tag LOCUS_18570 gene fabG 3772 4596 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_18570 5010 4615 gene locus_tag LOCUS_18580 5010 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6092 5007 gene locus_tag LOCUS_18590 6092 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence124 904 8 gene locus_tag LOCUS_18600 904 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1425 901 gene locus_tag LOCUS_18610 1425 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2009 1422 gene locus_tag LOCUS_18620 2009 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3979 2006 gene locus_tag LOCUS_18630 3979 2006 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_18630 4503 3976 gene locus_tag LOCUS_18640 4503 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4655 4494 gene locus_tag LOCUS_18650 4655 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5413 4652 gene locus_tag LOCUS_18660 gene ccsA 5413 4652 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_18660 <6063 5410 gene locus_tag LOCUS_18670 <6063 5410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256830.1:heme exporter protein CcmB >Feature sequence125 618 484 gene locus_tag LOCUS_18680 618 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 950 2362 gene locus_tag LOCUS_18690 950 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2682 3782 gene locus_tag LOCUS_18700 gene dnaN 2682 3782 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568447.1 protein_id gnl|my_center|LOCUS_18700 3784 4863 gene locus_tag LOCUS_18710 gene recF 3784 4863 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_18710 4910 5245 gene locus_tag LOCUS_18720 4910 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence126 <1 2319 gene locus_tag LOCUS_18730 <1 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141767.1:carbamoyl-phosphate synthase large subunit 2319 3263 gene locus_tag LOCUS_18740 2319 3263 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18740 3253 3978 gene locus_tag LOCUS_18750 gene pyrF 3253 3978 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_18750 4035 4352 gene locus_tag LOCUS_18760 gene mihF 4035 4352 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_18760 4363 4899 gene locus_tag LOCUS_18770 gene gmk 4363 4899 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354915.1 protein_id gnl|my_center|LOCUS_18770 5052 5390 gene locus_tag LOCUS_18780 5052 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence127 1210 158 gene locus_tag LOCUS_18790 1210 158 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_18790 1793 1275 gene locus_tag LOCUS_18800 1793 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3138 1780 gene locus_tag LOCUS_18810 3138 1780 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_18810 4006 3224 gene locus_tag LOCUS_18820 gene fetB 4006 3224 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_18820 4725 4003 gene locus_tag LOCUS_18830 4725 4003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792861.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence128 1318 131 gene locus_tag LOCUS_18840 1318 131 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174520.1 protein_id gnl|my_center|LOCUS_18840 2158 1340 gene locus_tag LOCUS_18850 2158 1340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_18850 3111 2155 gene locus_tag LOCUS_18860 3111 2155 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_18860 3602 3177 gene locus_tag LOCUS_18870 3602 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3694 4689 gene locus_tag LOCUS_18880 3694 4689 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence129 318 773 gene locus_tag LOCUS_18890 318 773 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080606.1 protein_id gnl|my_center|LOCUS_18890 785 1546 gene locus_tag LOCUS_18900 785 1546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_18900 1823 1569 gene locus_tag LOCUS_18910 1823 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1822 2715 gene locus_tag LOCUS_18920 1822 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2715 3467 gene locus_tag LOCUS_18930 2715 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069846.1 protein_id gnl|my_center|LOCUS_18930 4517 3729 gene locus_tag LOCUS_18940 4517 3729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092652.1 protein_id gnl|my_center|LOCUS_18940 4575 5432 gene locus_tag LOCUS_18950 gene paaG 4575 5432 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_18950 5861 5436 gene locus_tag LOCUS_18960 5861 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence130 <1 1137 gene locus_tag LOCUS_18970 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775775.1:alpha/beta fold hydrolase 1134 2126 gene locus_tag LOCUS_18980 1134 2126 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_18980 2195 3598 gene locus_tag LOCUS_18990 gene sufB 2195 3598 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_18990 3694 4554 gene locus_tag LOCUS_19000 3694 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 4578 4922 gene locus_tag LOCUS_19010 4578 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence131 2516 1074 gene locus_tag LOCUS_19020 2516 1074 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076164631.1 protein_id gnl|my_center|LOCUS_19020 3472 2582 gene locus_tag LOCUS_19030 3472 2582 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229121.1 protein_id gnl|my_center|LOCUS_19030 4671 3469 gene locus_tag LOCUS_19040 gene pstA 4671 3469 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229120.1 protein_id gnl|my_center|LOCUS_19040 5699 4668 gene locus_tag LOCUS_19050 gene pstC 5699 4668 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229119.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence132 272 1714 gene locus_tag LOCUS_19060 272 1714 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_19060 1711 2592 gene locus_tag LOCUS_19070 1711 2592 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_19070 3751 2603 gene locus_tag LOCUS_19080 3751 2603 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_19080 3823 4656 gene locus_tag LOCUS_19090 3823 4656 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence133 213 776 gene locus_tag LOCUS_19100 213 776 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095041.1 protein_id gnl|my_center|LOCUS_19100 2315 777 gene locus_tag LOCUS_19110 2315 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2935 2312 gene locus_tag LOCUS_19120 2935 2312 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_19120 3120 2932 gene locus_tag LOCUS_19130 3120 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3198 3464 gene locus_tag LOCUS_19140 3198 3464 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_19140 3539 4486 gene locus_tag LOCUS_19150 gene meaB 3539 4486 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_19150 4586 5446 gene locus_tag LOCUS_19160 4586 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence134 873 175 gene locus_tag LOCUS_19170 873 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1176 979 gene locus_tag LOCUS_19180 1176 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1514 1332 gene locus_tag LOCUS_19190 1514 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1537 3576 gene locus_tag LOCUS_19200 1537 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3667 4530 gene locus_tag LOCUS_19210 gene panB 3667 4530 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080134253.1 protein_id gnl|my_center|LOCUS_19210 4534 5073 gene locus_tag LOCUS_19220 4534 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5206 5547 gene locus_tag LOCUS_19230 gene rpsF 5206 5547 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence135 448 633 gene locus_tag LOCUS_19240 448 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1809 634 gene locus_tag LOCUS_19250 gene mftD 1809 634 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_19250 2845 1877 gene locus_tag LOCUS_19260 2845 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2944 4056 gene locus_tag LOCUS_19270 2944 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4379 4149 gene locus_tag LOCUS_19280 4379 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4278 4634 gene locus_tag LOCUS_19290 4278 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5474 4650 gene locus_tag LOCUS_19300 5474 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5636 5478 gene locus_tag LOCUS_19310 5636 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence136 1305 121 gene locus_tag LOCUS_19320 1305 121 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_19320 2510 1302 gene locus_tag LOCUS_19330 2510 1302 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_19330 4192 2696 gene locus_tag LOCUS_19340 4192 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 5364 4195 gene locus_tag LOCUS_19350 5364 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence137 713 321 gene locus_tag LOCUS_19360 713 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2542 902 gene locus_tag LOCUS_19370 2542 902 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_19370 2880 2539 gene locus_tag LOCUS_19380 2880 2539 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_19380 4474 3107 gene locus_tag LOCUS_19390 4474 3107 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_19390 5157 4471 gene locus_tag LOCUS_19400 5157 4471 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence138 886 431 gene locus_tag LOCUS_19410 886 431 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_19410 1810 899 gene locus_tag LOCUS_19420 1810 899 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_19420 2105 3508 gene locus_tag LOCUS_19430 gene lpdA 2105 3508 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_19430 3524 4888 gene locus_tag LOCUS_19440 3524 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence139 2116 851 gene locus_tag LOCUS_19450 gene hemL 2116 851 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_19450 3104 2121 gene locus_tag LOCUS_19460 gene hemB 3104 2121 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_19460 4651 3116 gene locus_tag LOCUS_19470 gene cobA 4651 3116 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_19470 4838 5140 gene locus_tag LOCUS_19480 4838 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence140 <1 884 gene locus_tag LOCUS_19490 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582488.1:competence/damage-inducible protein A 1332 919 gene locus_tag LOCUS_19500 gene msrB 1332 919 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 protein_id gnl|my_center|LOCUS_19500 1660 2754 gene locus_tag LOCUS_19510 gene recA 1660 2754 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_19510 4437 2899 gene locus_tag LOCUS_19520 4437 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence141 148 327 gene locus_tag LOCUS_19530 148 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 370 1194 gene locus_tag LOCUS_19540 370 1194 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312799.1 protein_id gnl|my_center|LOCUS_19540 1301 1822 gene locus_tag LOCUS_19550 1301 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1819 2253 gene locus_tag LOCUS_19560 1819 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2276 2722 gene locus_tag LOCUS_19570 2276 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2796 3833 gene locus_tag LOCUS_19580 2796 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3921 4736 gene locus_tag LOCUS_19590 3921 4736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079722.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence142 501 1457 gene locus_tag LOCUS_19600 gene aztC 501 1457 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027145.1 protein_id gnl|my_center|LOCUS_19600 1501 2346 gene locus_tag LOCUS_19610 gene aztB 1501 2346 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_19610 2351 3877 gene locus_tag LOCUS_19620 gene lnt 2351 3877 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence143 87 1895 gene locus_tag LOCUS_19630 87 1895 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_19630 1972 2775 gene locus_tag LOCUS_19640 1972 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2772 3242 gene locus_tag LOCUS_19650 2772 3242 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_19650 3251 4366 gene locus_tag LOCUS_19660 3251 4366 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence144 785 150 gene locus_tag LOCUS_19670 785 150 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_19670 1855 893 gene locus_tag LOCUS_19680 1855 893 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_19680 2370 1879 gene locus_tag LOCUS_19690 2370 1879 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_19690 2443 3336 gene locus_tag LOCUS_19700 2443 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3342 4736 gene locus_tag LOCUS_19710 3342 4736 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence145 2526 25 gene locus_tag LOCUS_19720 gene gyrA 2526 25 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891334.1 protein_id gnl|my_center|LOCUS_19720 4499 2562 gene locus_tag LOCUS_19730 gene gyrB 4499 2562 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence146 <1 1447 gene locus_tag LOCUS_19740 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086677.1:arylsulfatase 1444 2718 gene locus_tag LOCUS_19750 1444 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3181 2708 gene locus_tag LOCUS_19760 3181 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 <4494 3192 gene locus_tag LOCUS_19770 <4494 3192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467867.1:molybdopterin-dependent oxidoreductase >Feature sequence147 <1 1594 gene locus_tag LOCUS_19780 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113701643.1:DNA translocase FtsK 1611 2879 gene locus_tag LOCUS_19790 gene rimO 1611 2879 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_19790 2876 3460 gene locus_tag LOCUS_19800 gene pgsA 2876 3460 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence148 1019 162 gene locus_tag LOCUS_19810 1019 162 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_19810 1895 1065 gene locus_tag LOCUS_19820 1895 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1925 2413 gene locus_tag LOCUS_19830 1925 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3320 2418 gene locus_tag LOCUS_19840 3320 2418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_19840 3478 3810 gene locus_tag LOCUS_19850 3478 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence149 224 1474 gene locus_tag LOCUS_19860 224 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1742 1491 gene locus_tag LOCUS_19870 1742 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1718 2533 gene locus_tag LOCUS_19880 1718 2533 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_19880 2533 3504 gene locus_tag LOCUS_19890 2533 3504 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_19890 3844 3530 gene locus_tag LOCUS_19900 3844 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence150 672 304 gene locus_tag LOCUS_19910 gene aroH 672 304 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_19910 1445 696 gene locus_tag LOCUS_19920 1445 696 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_19920 2104 1442 gene locus_tag LOCUS_19930 gene scpB 2104 1442 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_19930 2894 2115 gene locus_tag LOCUS_19940 2894 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2977 3960 gene locus_tag LOCUS_19950 gene trpS 2977 3960 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence151 1462 296 gene locus_tag LOCUS_19960 1462 296 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894684.1 protein_id gnl|my_center|LOCUS_19960 2644 1490 gene locus_tag LOCUS_19970 2644 1490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence152 <1 854 gene locus_tag LOCUS_19980 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037226281.1:glycosyltransferase family 4 protein 851 1123 gene locus_tag LOCUS_19990 851 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1725 1132 gene locus_tag LOCUS_20000 1725 1132 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_20000 2960 1749 gene locus_tag LOCUS_20010 2960 1749 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_20010 3364 2972 gene locus_tag LOCUS_20020 3364 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3482 3787 gene locus_tag LOCUS_20030 3482 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence153 1 375 gene locus_tag LOCUS_20040 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1917 385 gene locus_tag LOCUS_20050 1917 385 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_20050 2105 3076 gene locus_tag LOCUS_20060 2105 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 <4141 3147 gene locus_tag LOCUS_20070 <4141 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005066508.1:acetyl-CoA C-acetyltransferase >Feature sequence154 <1 519 gene locus_tag LOCUS_20080 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337836.1:peptide chain release factor N(5)-glutamine methyltransferase 522 1355 gene locus_tag LOCUS_20090 522 1355 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_20090 2269 1367 gene locus_tag LOCUS_20100 2269 1367 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_20100 2352 2783 gene locus_tag LOCUS_20110 2352 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 <4098 2797 gene locus_tag LOCUS_20120 <4098 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112031.1:acetyl-CoA acetyltransferase >Feature sequence155 <1 1181 gene locus_tag LOCUS_20130 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189027735.1:CoA transferase 1178 1975 gene locus_tag LOCUS_20140 1178 1975 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_20140 2009 2467 gene locus_tag LOCUS_20150 2009 2467 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence156 <1 932 gene locus_tag LOCUS_20160 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400106.1:methionine gamma-lyase 938 1723 gene locus_tag LOCUS_20170 938 1723 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_20170 2222 2004 gene locus_tag LOCUS_20180 2222 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2209 2397 gene locus_tag LOCUS_20190 2209 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2412 2633 gene locus_tag LOCUS_20200 2412 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2653 3300 gene locus_tag LOCUS_20210 2653 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3352 3427 gene locus_tag LOCUS_t00420 3352 3427 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence157 2074 647 gene locus_tag LOCUS_20220 2074 647 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_20220 3646 2201 gene locus_tag LOCUS_20230 3646 2201 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence158 <1 2370 gene locus_tag LOCUS_20240 <1 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029870.1:DNA helicase PcrA 2464 3336 gene locus_tag LOCUS_20250 2464 3336 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence159 <1 1061 gene locus_tag LOCUS_20260 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772424.1:sugar porter family MFS transporter 1106 2296 gene locus_tag LOCUS_20270 1106 2296 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_20270 2306 2668 gene locus_tag LOCUS_20280 2306 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3081 2758 gene locus_tag LOCUS_20290 3081 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3154 3735 gene locus_tag LOCUS_20300 3154 3735 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence160 116 1279 gene locus_tag LOCUS_20310 116 1279 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_20310 1279 2061 gene locus_tag LOCUS_20320 1279 2061 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence161 2 967 gene locus_tag LOCUS_20330 2 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 972 1184 gene locus_tag LOCUS_20340 972 1184 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_20340 2312 1194 gene locus_tag LOCUS_20350 2312 1194 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_20350 2426 3259 gene locus_tag LOCUS_20360 2426 3259 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110110.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence162 <1 1386 gene locus_tag LOCUS_20370 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028066.1:excinuclease ABC subunit UvrA 2509 1388 gene locus_tag LOCUS_20380 gene nadA 2509 1388 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence163 1642 1277 gene locus_tag LOCUS_20390 1642 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2200 1682 gene locus_tag LOCUS_20400 2200 1682 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_20400 3314 2193 gene locus_tag LOCUS_20410 3314 2193 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence164 <1 758 gene locus_tag LOCUS_20420 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390644.1:manganese/iron ABC transporter ATP-binding protein 1551 769 gene locus_tag LOCUS_20430 gene hisN 1551 769 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_20430 2229 1594 gene locus_tag LOCUS_20440 2229 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2824 2231 gene locus_tag LOCUS_20450 2824 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3359 2835 gene locus_tag LOCUS_20460 3359 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence165 1372 473 gene locus_tag LOCUS_20470 1372 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 1371 1796 gene locus_tag LOCUS_20480 1371 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2316 1816 gene locus_tag LOCUS_20490 2316 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence166 1499 375 gene locus_tag LOCUS_20500 1499 375 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907855.1 protein_id gnl|my_center|LOCUS_20500 1615 1797 gene locus_tag LOCUS_20510 1615 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1799 2434 gene locus_tag LOCUS_20520 1799 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3419 2424 gene locus_tag LOCUS_20530 3419 2424 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence167 210 1448 gene locus_tag LOCUS_20540 210 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1488 2939 gene locus_tag LOCUS_20550 1488 2939 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence168 2223 34 gene locus_tag LOCUS_20560 2223 34 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_20560 2705 2298 gene locus_tag LOCUS_20570 2705 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2880 3320 gene locus_tag LOCUS_20580 2880 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence169 <1 747 gene locus_tag LOCUS_20590 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092984.1:succinyl-diaminopimelate desuccinylase 1437 805 gene locus_tag LOCUS_20600 gene lexA 1437 805 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076527.1 protein_id gnl|my_center|LOCUS_20600 1706 2266 gene locus_tag LOCUS_20610 1706 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2507 2842 gene locus_tag LOCUS_20620 2507 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 <3409 2824 gene locus_tag LOCUS_20630 <3409 2824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224546.1:pyrimidine reductase family protein >Feature sequence170 1550 183 gene locus_tag LOCUS_20640 gene dnaB 1550 183 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_20640 2298 1852 gene locus_tag LOCUS_20650 gene rplI 2298 1852 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_20650 2759 2295 gene locus_tag LOCUS_20660 2759 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3241 2759 gene locus_tag LOCUS_20670 3241 2759 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence171 >Feature sequence172 <1 744 gene locus_tag LOCUS_20680 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879859.1:bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase 754 1284 gene locus_tag LOCUS_20690 754 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1308 1383 gene locus_tag LOCUS_t00430 1308 1383 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1491 3317 gene locus_tag LOCUS_20700 1491 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence173 2379 1498 gene locus_tag LOCUS_20710 gene metF 2379 1498 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_20710 3245 2382 gene locus_tag LOCUS_20720 3245 2382 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence174 119 1255 gene locus_tag LOCUS_20730 gene dusB 119 1255 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_20730 1266 1853 gene locus_tag LOCUS_20740 1266 1853 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_20740 2221 1850 gene locus_tag LOCUS_20750 2221 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence175 815 1351 gene locus_tag LOCUS_20760 815 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1468 1956 gene locus_tag LOCUS_20770 1468 1956 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 protein_id gnl|my_center|LOCUS_20770 1956 3158 gene locus_tag LOCUS_20780 1956 3158 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057979.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence176 1336 206 gene locus_tag LOCUS_20790 1336 206 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_20790 2376 1333 gene locus_tag LOCUS_20800 2376 1333 CDS product DUF1730 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392044.1 protein_id gnl|my_center|LOCUS_20800 2665 2426 gene locus_tag LOCUS_20810 2665 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence177 <1 717 gene locus_tag LOCUS_20820 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392412.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 770 1963 gene locus_tag LOCUS_20830 gene metK 770 1963 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence178 298 1011 gene locus_tag LOCUS_20840 298 1011 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 protein_id gnl|my_center|LOCUS_20840 1008 1508 gene locus_tag LOCUS_20850 1008 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1517 2110 gene locus_tag LOCUS_20860 1517 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2147 2455 gene locus_tag LOCUS_20870 2147 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2459 3022 gene locus_tag LOCUS_20880 2459 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence179 2042 381 gene locus_tag LOCUS_20890 gene glpD 2042 381 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_20890 2202 2438 gene locus_tag LOCUS_20900 2202 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence180 1 459 gene locus_tag LOCUS_20910 1 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 523 1275 gene locus_tag LOCUS_20920 523 1275 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_20920 1354 2571 gene locus_tag LOCUS_20930 1354 2571 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence181 2189 2656 gene locus_tag LOCUS_20940 2189 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence182 327 1898 gene locus_tag LOCUS_20950 327 1898 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_20950 2841 1948 gene locus_tag LOCUS_20960 2841 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence183 1574 456 gene locus_tag LOCUS_20970 1574 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1853 1635 gene locus_tag LOCUS_20980 1853 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2330 1866 gene locus_tag LOCUS_20990 2330 1866 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_20990 2896 2351 gene locus_tag LOCUS_21000 2896 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000