>Feature sequence001 1763 1248 gene locus_tag LOCUS_0010 gene rpsI 1763 1248 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_0010 2250 1807 gene locus_tag LOCUS_0020 gene rplM 2250 1807 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_0020 3234 2359 gene locus_tag LOCUS_0030 gene truA 3234 2359 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_0030 3836 3231 gene locus_tag LOCUS_0040 3836 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 4941 3889 gene locus_tag LOCUS_0050 4941 3889 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_0050 5658 5032 gene locus_tag LOCUS_0060 gene rpsD 5658 5032 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_0060 6083 5679 gene locus_tag LOCUS_0070 gene rpsK 6083 5679 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_0070 6521 6144 gene locus_tag LOCUS_0080 gene rpsM 6521 6144 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_0080 7050 6829 gene locus_tag LOCUS_0090 gene infA 7050 6829 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_0090 8079 7309 gene locus_tag LOCUS_0100 gene map 8079 7309 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403728.1 protein_id gnl|my_center|LOCUS_0100 8651 8088 gene locus_tag LOCUS_0110 8651 8088 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_0110 9964 8651 gene locus_tag LOCUS_0120 gene secY 9964 8651 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_0120 10511 10071 gene locus_tag LOCUS_0130 gene rplO 10511 10071 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_0130 10695 10513 gene locus_tag LOCUS_0140 gene rpmD 10695 10513 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_0140 11283 10699 gene locus_tag LOCUS_0150 gene rpsE 11283 10699 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_0150 11710 11324 gene locus_tag LOCUS_0160 gene rplR 11710 11324 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_0160 12253 11714 gene locus_tag LOCUS_0170 gene rplF 12253 11714 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_0170 12673 12269 gene locus_tag LOCUS_0180 gene rpsH 12673 12269 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_0180 12922 12737 gene locus_tag LOCUS_0190 12922 12737 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_0190 13484 12924 gene locus_tag LOCUS_0200 gene rplE 13484 12924 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_0200 13825 13484 gene locus_tag LOCUS_0210 gene rplX 13825 13484 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_0210 14193 13825 gene locus_tag LOCUS_0220 gene rplN 14193 13825 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_0220 14524 14255 gene locus_tag LOCUS_0230 gene rpsQ 14524 14255 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_0230 14751 14521 gene locus_tag LOCUS_0240 gene rpmC 14751 14521 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_0240 15171 14752 gene locus_tag LOCUS_0250 gene rplP 15171 14752 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_0250 16006 15173 gene locus_tag LOCUS_0260 gene rpsC 16006 15173 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_0260 16362 16006 gene locus_tag LOCUS_0270 gene rplV 16362 16006 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_0270 16693 16412 gene locus_tag LOCUS_0280 gene rpsS 16693 16412 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_0280 17542 16706 gene locus_tag LOCUS_0290 gene rplB 17542 16706 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_0290 17876 17577 gene locus_tag LOCUS_0300 gene rplW 17876 17577 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055645.1 protein_id gnl|my_center|LOCUS_0300 18556 17873 gene locus_tag LOCUS_0310 gene rplD 18556 17873 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_0310 19203 18559 gene locus_tag LOCUS_0320 gene rplC 19203 18559 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_0320 19524 19216 gene locus_tag LOCUS_0330 gene rpsJ 19524 19216 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_0330 20803 19610 gene locus_tag LOCUS_0340 gene tuf 20803 19610 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_0340 21595 20903 gene locus_tag LOCUS_0350 21595 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 >Feature sequence002 3055 1421 gene locus_tag LOCUS_0360 3055 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 3443 3048 gene locus_tag LOCUS_0370 3443 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 7154 3462 gene locus_tag LOCUS_0380 7154 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 9217 7187 gene locus_tag LOCUS_0390 gene nrdJ 9217 7187 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_0390 9605 9384 gene locus_tag LOCUS_0400 9605 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 10846 9650 gene locus_tag LOCUS_0410 10846 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 10986 11558 gene locus_tag LOCUS_0420 10986 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 <12056 11555 gene locus_tag LOCUS_0430 <12056 11555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815500.1:carbamoyltransferase C-terminal domain-containing protein >Feature sequence003 120 2006 gene locus_tag LOCUS_0440 120 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_0440 2061 5933 gene locus_tag LOCUS_0450 2061 5933 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_0450 6593 5937 gene locus_tag LOCUS_0460 gene rpiA 6593 5937 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_0460 6679 7734 gene locus_tag LOCUS_0470 gene tal 6679 7734 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689551.1 protein_id gnl|my_center|LOCUS_0470 8076 8255 gene locus_tag LOCUS_0480 8076 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 8182 8556 gene locus_tag LOCUS_0490 gene rpsL 8182 8556 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_0490 8556 9026 gene locus_tag LOCUS_0500 gene rpsG 8556 9026 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_0500 >Feature sequence004 608 426 gene locus_tag LOCUS_0510 608 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 565 1344 gene locus_tag LOCUS_0520 565 1344 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_0520 1468 3081 gene locus_tag LOCUS_0530 1468 3081 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805024.1 protein_id gnl|my_center|LOCUS_0530 4092 3016 gene locus_tag LOCUS_0540 gene trpD 4092 3016 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_0540 4537 4103 gene locus_tag LOCUS_0550 4537 4103 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_0550 4807 5286 gene locus_tag LOCUS_0560 4807 5286 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_0560 5310 6137 gene locus_tag LOCUS_0570 5310 6137 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_0570 6134 7141 gene locus_tag LOCUS_0580 6134 7141 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_0580 7138 8784 gene locus_tag LOCUS_0590 7138 8784 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_0590 9568 8798 gene locus_tag LOCUS_0600 9568 8798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172560.1 protein_id gnl|my_center|LOCUS_0600 <10526 9565 gene locus_tag LOCUS_0610 <10526 9565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385042.1:rhodanese-like domain-containing protein >Feature sequence005 485 1753 gene locus_tag LOCUS_0620 485 1753 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_0620 1750 2814 gene locus_tag LOCUS_0630 1750 2814 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_0630 3125 3051 gene locus_tag LOCUS_t0010 3125 3051 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4079 3168 gene locus_tag LOCUS_0640 4079 3168 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_0640 4135 4629 gene locus_tag LOCUS_0650 4135 4629 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_0650 6906 4636 gene locus_tag LOCUS_0660 6906 4636 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_0660 7147 7479 gene locus_tag LOCUS_0670 gene wblA 7147 7479 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_0670 7572 7733 gene locus_tag LOCUS_0680 7572 7733 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003068074.1 protein_id gnl|my_center|LOCUS_0680 7737 8198 gene locus_tag LOCUS_0690 7737 8198 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_0690 8195 8884 gene locus_tag LOCUS_0700 8195 8884 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_0700 8881 9627 gene locus_tag LOCUS_0710 8881 9627 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419731.1 protein_id gnl|my_center|LOCUS_0710 >Feature sequence006 <1 712 gene locus_tag LOCUS_0720 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407642.1:GDP-L-fucose synthase 1686 709 gene locus_tag LOCUS_0730 1686 709 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_0730 2090 1674 gene locus_tag LOCUS_0740 2090 1674 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_0740 2635 2141 gene locus_tag LOCUS_0750 2635 2141 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_0750 2818 2675 gene locus_tag LOCUS_0760 2818 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 3172 2873 gene locus_tag LOCUS_0770 3172 2873 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_0770 4035 3172 gene locus_tag LOCUS_0780 4035 3172 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_0780 4550 4098 gene locus_tag LOCUS_0790 4550 4098 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_0790 5374 4874 gene locus_tag LOCUS_0800 5374 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 6137 5379 gene locus_tag LOCUS_0810 6137 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 6235 6951 gene locus_tag LOCUS_0820 gene glnR 6235 6951 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_0820 6948 7937 gene locus_tag LOCUS_0830 gene mshD 6948 7937 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_0830 >Feature sequence007 <1 501 gene locus_tag LOCUS_0840 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284299.1:branched-chain amino acid aminotransferase 535 1314 gene locus_tag LOCUS_0850 535 1314 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_0850 1421 2842 gene locus_tag LOCUS_0860 gene gltX 1421 2842 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081448.1 protein_id gnl|my_center|LOCUS_0860 2839 3801 gene locus_tag LOCUS_0870 2839 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 3834 3906 gene locus_tag LOCUS_t0020 3834 3906 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3977 4052 gene locus_tag LOCUS_t0030 3977 4052 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4812 4093 gene locus_tag LOCUS_0880 gene ndgR 4812 4093 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_0880 4866 6272 gene locus_tag LOCUS_0890 gene leuC 4866 6272 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_0890 6284 6877 gene locus_tag LOCUS_0900 gene leuD 6284 6877 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775883.1 protein_id gnl|my_center|LOCUS_0900 7111 6944 gene locus_tag LOCUS_0910 7111 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 7058 7666 gene locus_tag LOCUS_0920 7058 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 7801 8193 gene locus_tag LOCUS_0930 7801 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 8855 8241 gene locus_tag LOCUS_0940 gene cofC 8855 8241 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_0940 >Feature sequence008 1321 800 gene locus_tag LOCUS_0950 gene ilvN 1321 800 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_0950 3065 1323 gene locus_tag LOCUS_0960 3065 1323 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_0960 4943 3261 gene locus_tag LOCUS_0970 gene ilvD 4943 3261 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_0970 5246 4953 gene locus_tag LOCUS_0980 5246 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 6126 5257 gene locus_tag LOCUS_0990 6126 5257 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_0990 6213 7163 gene locus_tag LOCUS_1000 6213 7163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 protein_id gnl|my_center|LOCUS_1000 8665 7157 gene locus_tag LOCUS_1010 gene gatB 8665 7157 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_1010 >Feature sequence009 543 373 gene locus_tag LOCUS_1020 543 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 1919 543 gene locus_tag LOCUS_1030 1919 543 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_1030 2318 1983 gene locus_tag LOCUS_1040 2318 1983 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_1040 3872 2418 gene locus_tag LOCUS_1050 3872 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 7147 3947 gene locus_tag LOCUS_1060 7147 3947 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_1060 7483 7223 gene locus_tag LOCUS_1070 7483 7223 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_1070 <8628 7865 gene locus_tag LOCUS_1080 <8628 7865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104130.1:bifunctional FO biosynthesis protein CofGH >Feature sequence010 1794 1030 gene locus_tag LOCUS_1090 gene sufC 1794 1030 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_1090 2167 1796 gene locus_tag LOCUS_1100 2167 1796 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_1100 3303 2164 gene locus_tag LOCUS_1110 gene sufD 3303 2164 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_1110 4712 3300 gene locus_tag LOCUS_1120 gene sufB 4712 3300 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_1120 5374 4709 gene locus_tag LOCUS_1130 5374 4709 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_1130 5489 6382 gene locus_tag LOCUS_1140 5489 6382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_1140 6379 7161 gene locus_tag LOCUS_1150 6379 7161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_1150 7213 8127 gene locus_tag LOCUS_1160 7213 8127 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_1160 >Feature sequence011 1116 289 gene locus_tag LOCUS_1170 1116 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 2359 1148 gene locus_tag LOCUS_1180 2359 1148 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_1180 2539 2375 gene locus_tag LOCUS_1190 2539 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 3866 2583 gene locus_tag LOCUS_1200 3866 2583 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902541.1 protein_id gnl|my_center|LOCUS_1200 4033 4482 gene locus_tag LOCUS_1210 4033 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 5209 4535 gene locus_tag LOCUS_1220 5209 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 6049 5237 gene locus_tag LOCUS_1230 6049 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 6286 7044 gene locus_tag LOCUS_1240 6286 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 >Feature sequence012 3393 1447 gene locus_tag LOCUS_1250 gene gyrB 3393 1447 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_1250 3371 3589 gene locus_tag LOCUS_1260 3371 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 4179 3676 gene locus_tag LOCUS_1270 4179 3676 CDS product DUF721 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087667.1 protein_id gnl|my_center|LOCUS_1270 5303 4176 gene locus_tag LOCUS_1280 gene recF 5303 4176 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_1280 6466 5333 gene locus_tag LOCUS_1290 gene dnaN 6466 5333 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_1290 <7705 6864 gene locus_tag LOCUS_1300 <7705 6864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013221955.1:chromosomal replication initiator protein DnaA >Feature sequence013 1191 451 gene locus_tag LOCUS_1310 1191 451 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_1310 2898 1204 gene locus_tag LOCUS_1320 gene argS 2898 1204 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_1320 2901 4085 gene locus_tag LOCUS_1330 2901 4085 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_1330 2955 3027 gene locus_tag LOCUS_t0040 2955 3027 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4286 4756 gene locus_tag LOCUS_1340 4286 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 4787 5326 gene locus_tag LOCUS_1350 4787 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256633.1 protein_id gnl|my_center|LOCUS_1350 5377 6216 gene locus_tag LOCUS_1360 5377 6216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903969.1 protein_id gnl|my_center|LOCUS_1360 6691 6464 gene locus_tag LOCUS_1370 6691 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 >Feature sequence014 <1 1349 gene locus_tag LOCUS_1380 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030103.1:ATP-dependent DNA helicase 1346 4540 gene locus_tag LOCUS_1390 gene adnB 1346 4540 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728029.1 protein_id gnl|my_center|LOCUS_1390 5409 4537 gene locus_tag LOCUS_1400 5409 4537 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_1400 5492 5734 gene locus_tag LOCUS_1410 5492 5734 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_1410 >Feature sequence015 985 686 gene locus_tag LOCUS_1420 gene nuoK 985 686 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_1420 1779 982 gene locus_tag LOCUS_1430 1779 982 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_1430 2357 1776 gene locus_tag LOCUS_1440 gene nuoI 2357 1776 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_1440 3627 2350 gene locus_tag LOCUS_1450 gene nuoH 3627 2350 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_1450 6038 3624 gene locus_tag LOCUS_1460 6038 3624 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_1460 <6821 6035 gene locus_tag LOCUS_1470 <6821 6035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893427.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence016 761 1603 gene locus_tag LOCUS_1480 gene rsmI 761 1603 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_1480 1778 3832 gene locus_tag LOCUS_1490 1778 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 3892 5508 gene locus_tag LOCUS_1500 gene metG 3892 5508 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_1500 5505 6392 gene locus_tag LOCUS_1510 5505 6392 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_1510 >Feature sequence017 590 321 gene locus_tag LOCUS_1520 590 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 1648 605 gene locus_tag LOCUS_1530 gene tsaD 1648 605 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_1530 2108 1641 gene locus_tag LOCUS_1540 gene rimI 2108 1641 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_1540 2746 2108 gene locus_tag LOCUS_1550 gene tsaB 2746 2108 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_1550 3205 2756 gene locus_tag LOCUS_1560 gene tsaE 3205 2756 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_1560 3795 3208 gene locus_tag LOCUS_1570 3795 3208 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_1570 4859 3795 gene locus_tag LOCUS_1580 4859 3795 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_1580 6010 4856 gene locus_tag LOCUS_1590 gene alr 6010 4856 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_1590 <6701 6023 gene locus_tag LOCUS_1600 <6701 6023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029833.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase >Feature sequence018 <1 1395 gene locus_tag LOCUS_1610 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893815.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase 1427 2452 gene locus_tag LOCUS_1620 gene speB 1427 2452 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_1620 4134 2488 gene locus_tag LOCUS_1630 4134 2488 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_1630 4269 5480 gene locus_tag LOCUS_1640 4269 5480 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_1640 <6691 5491 gene locus_tag LOCUS_1650 <6691 5491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892002.1:4-aminobutyrate--2-oxoglutarate transaminase >Feature sequence019 1124 1933 gene locus_tag LOCUS_1660 1124 1933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 protein_id gnl|my_center|LOCUS_1660 1963 3858 gene locus_tag LOCUS_1670 1963 3858 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_1670 3858 4628 gene locus_tag LOCUS_1680 3858 4628 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_1680 5094 4684 gene locus_tag LOCUS_1690 5094 4684 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_1690 5451 5230 gene locus_tag LOCUS_1700 5451 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 >Feature sequence020 <1 579 gene locus_tag LOCUS_1710 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907518.1:decaprenyl-phosphate phosphoribosyltransferase 1316 585 gene locus_tag LOCUS_1720 1316 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 2134 1334 gene locus_tag LOCUS_1730 2134 1334 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_1730 2248 3054 gene locus_tag LOCUS_1740 2248 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 4224 3058 gene locus_tag LOCUS_1750 4224 3058 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_1750 5003 4221 gene locus_tag LOCUS_1760 5003 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 >Feature sequence021 2327 1938 gene locus_tag LOCUS_1770 gene rplL 2327 1938 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_1770 3076 2381 gene locus_tag LOCUS_1780 3076 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 3380 3838 gene locus_tag LOCUS_1790 3380 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 4551 3835 gene locus_tag LOCUS_1800 gene rplA 4551 3835 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776393.1 protein_id gnl|my_center|LOCUS_1800 5057 4626 gene locus_tag LOCUS_1810 gene rplK 5057 4626 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_1810 6005 5091 gene locus_tag LOCUS_1820 6005 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 >Feature sequence022 2446 1535 gene locus_tag LOCUS_1830 gene thrB 2446 1535 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_1830 3539 2451 gene locus_tag LOCUS_1840 gene thrC 3539 2451 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_1840 4791 3550 gene locus_tag LOCUS_1850 4791 3550 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_1850 <6036 4875 gene locus_tag LOCUS_1860 <6036 4875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030202.1:diaminopimelate decarboxylase >Feature sequence023 <1 1984 gene locus_tag LOCUS_1870 <1 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028446.1:Rne/Rng family ribonuclease 2106 2417 gene locus_tag LOCUS_1880 gene rplU 2106 2417 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_1880 2426 2680 gene locus_tag LOCUS_1890 gene rpmA 2426 2680 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_1890 2798 4156 gene locus_tag LOCUS_1900 gene obgE 2798 4156 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_1900 4153 5277 gene locus_tag LOCUS_1910 gene proB 4153 5277 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_1910 >Feature sequence024 981 805 gene locus_tag LOCUS_1920 981 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 1578 1024 gene locus_tag LOCUS_1930 1578 1024 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_1930 2151 1633 gene locus_tag LOCUS_1940 2151 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 2688 2215 gene locus_tag LOCUS_1950 gene coaD 2688 2215 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_1950 3269 2712 gene locus_tag LOCUS_1960 gene rsmD 3269 2712 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_1960 5604 3307 gene locus_tag LOCUS_1970 gene recG 5604 3307 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_1970 >Feature sequence025 <1 603 gene locus_tag LOCUS_1980 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229528.1:F0F1 ATP synthase subunit A 639 845 gene locus_tag LOCUS_1990 639 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 867 1430 gene locus_tag LOCUS_2000 867 1430 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_2000 1430 2239 gene locus_tag LOCUS_2010 1430 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2010 2297 3925 gene locus_tag LOCUS_2020 gene atpA 2297 3925 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_2020 3938 4855 gene locus_tag LOCUS_2030 3938 4855 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_2030 >Feature sequence026 355 1224 gene locus_tag LOCUS_2040 355 1224 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211260731.1 protein_id gnl|my_center|LOCUS_2040 2005 1229 gene locus_tag LOCUS_2050 2005 1229 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908592.1 protein_id gnl|my_center|LOCUS_2050 2318 2028 gene locus_tag LOCUS_2060 2318 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 2475 2765 gene locus_tag LOCUS_2070 gene rpsF 2475 2765 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_2070 2774 3271 gene locus_tag LOCUS_2080 2774 3271 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064618.1 protein_id gnl|my_center|LOCUS_2080 3296 3541 gene locus_tag LOCUS_2090 gene rpsR 3296 3541 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_2090 3556 4002 gene locus_tag LOCUS_2100 gene rplI 3556 4002 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_2100 >Feature sequence027 845 1099 gene locus_tag LOCUS_2110 845 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 1379 1867 gene locus_tag LOCUS_2120 gene nrdR 1379 1867 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_2120 1894 4752 gene locus_tag LOCUS_2130 1894 4752 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_2130 4840 5403 gene locus_tag LOCUS_2140 4840 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 >Feature sequence028 500 429 gene locus_tag LOCUS_t0050 500 429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 557 632 gene locus_tag LOCUS_t0060 557 632 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 662 1972 gene locus_tag LOCUS_2150 gene tig 662 1972 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_2150 2070 2720 gene locus_tag LOCUS_2160 2070 2720 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_2160 2717 3325 gene locus_tag LOCUS_2170 2717 3325 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_2170 3451 4740 gene locus_tag LOCUS_2180 gene clpX 3451 4740 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_2180 <5483 4737 gene locus_tag LOCUS_2190 <5483 4737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224259.1:valine--tRNA ligase >Feature sequence029 982 203 gene locus_tag LOCUS_2200 982 203 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_2200 1905 979 gene locus_tag LOCUS_2210 1905 979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993809.1 protein_id gnl|my_center|LOCUS_2210 2174 3229 gene locus_tag LOCUS_2220 2174 3229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 protein_id gnl|my_center|LOCUS_2220 3229 3780 gene locus_tag LOCUS_2230 3229 3780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_2230 5032 3800 gene locus_tag LOCUS_2240 5032 3800 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156694785.1 protein_id gnl|my_center|LOCUS_2240 >Feature sequence030 4590 964 gene locus_tag LOCUS_2250 gene smc 4590 964 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_2250 <5376 4773 gene locus_tag LOCUS_2260 <5376 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223692.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase >Feature sequence031 1001 1894 gene locus_tag LOCUS_2270 gene dapD 1001 1894 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084448.1 protein_id gnl|my_center|LOCUS_2270 1898 2626 gene locus_tag LOCUS_2280 1898 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 3184 2630 gene locus_tag LOCUS_2290 3184 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 4495 3212 gene locus_tag LOCUS_2300 4495 3212 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_2300 <5182 4624 gene locus_tag LOCUS_2310 <5182 4624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003903345.1:succinyldiaminopimelate transaminase >Feature sequence032 <1 820 gene locus_tag LOCUS_2320 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411159.1:UDP-N-acetylmuramate--L-alanine ligase 817 1491 gene locus_tag LOCUS_2330 817 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 1497 2285 gene locus_tag LOCUS_2340 1497 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 2435 3577 gene locus_tag LOCUS_2350 gene ftsZ 2435 3577 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_2350 3586 4278 gene locus_tag LOCUS_2360 gene pgeF 3586 4278 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_2360 4259 4951 gene locus_tag LOCUS_2370 4259 4951 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_2370 >Feature sequence033 <1 930 gene locus_tag LOCUS_2380 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030570.1:chloride channel protein 988 1665 gene locus_tag LOCUS_2390 gene mtrA 988 1665 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_2390 1767 3278 gene locus_tag LOCUS_2400 1767 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 3275 4966 gene locus_tag LOCUS_2410 3275 4966 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_2410 >Feature sequence034 482 48 gene locus_tag LOCUS_2420 482 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 475 1227 gene locus_tag LOCUS_2430 475 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 1395 2468 gene locus_tag LOCUS_2440 1395 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 2468 3262 gene locus_tag LOCUS_2450 2468 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227467.1 protein_id gnl|my_center|LOCUS_2450 3310 4329 gene locus_tag LOCUS_2460 3310 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 >Feature sequence035 653 1336 gene locus_tag LOCUS_2470 653 1336 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913210.1 protein_id gnl|my_center|LOCUS_2470 1751 2329 gene locus_tag LOCUS_2480 gene infC 1751 2329 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_2480 2307 2501 gene locus_tag LOCUS_2490 gene rpmI 2307 2501 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_2490 2564 2941 gene locus_tag LOCUS_2500 gene rplT 2564 2941 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_2500 3035 3751 gene locus_tag LOCUS_2510 3035 3751 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_2510 3808 4875 gene locus_tag LOCUS_2520 gene pheS 3808 4875 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_2520 >Feature sequence036 989 12 gene locus_tag LOCUS_2530 gene whiA 989 12 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_2530 1957 980 gene locus_tag LOCUS_2540 gene yvcK 1957 980 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_2540 2826 1954 gene locus_tag LOCUS_2550 gene rapZ 2826 1954 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_2550 4736 2823 gene locus_tag LOCUS_2560 gene uvrC 4736 2823 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_2560 >Feature sequence037 102 2309 gene locus_tag LOCUS_2570 gene scpA 102 2309 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_2570 2306 3298 gene locus_tag LOCUS_2580 gene meaB 2306 3298 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_2580 3728 3330 gene locus_tag LOCUS_2590 3728 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 4140 3778 gene locus_tag LOCUS_2600 4140 3778 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_2600 >Feature sequence038 731 12 gene locus_tag LOCUS_2610 731 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 1471 926 gene locus_tag LOCUS_2620 gene hpt 1471 926 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_2620 2487 1510 gene locus_tag LOCUS_2630 gene tilS 2487 1510 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_2630 3572 2487 gene locus_tag LOCUS_2640 3572 2487 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_2640 4982 3582 gene locus_tag LOCUS_2650 gene dacB 4982 3582 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907601.1 protein_id gnl|my_center|LOCUS_2650 >Feature sequence039 99 299 gene locus_tag LOCUS_2660 99 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 640 864 gene locus_tag LOCUS_2670 640 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 907 1260 gene locus_tag LOCUS_2680 907 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 3982 1325 gene locus_tag LOCUS_2690 3982 1325 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_2690 4812 3985 gene locus_tag LOCUS_2700 4812 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 >Feature sequence040 1850 1161 gene locus_tag LOCUS_2710 1850 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 3504 1987 gene locus_tag LOCUS_2720 3504 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 4211 3501 gene locus_tag LOCUS_2730 4211 3501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115766.1 protein_id gnl|my_center|LOCUS_2730 <4888 4211 gene locus_tag LOCUS_2740 <4888 4211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028538.1:AMP-dependent synthetase/ligase >Feature sequence041 176 505 gene locus_tag LOCUS_2750 176 505 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_2750 535 1821 gene locus_tag LOCUS_2760 gene mshA 535 1821 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_2760 1932 2411 gene locus_tag LOCUS_2770 1932 2411 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_2770 2453 3217 gene locus_tag LOCUS_2780 2453 3217 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_2780 3847 3221 gene locus_tag LOCUS_2790 gene phoU 3847 3221 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_2790 >Feature sequence042 <1 557 gene locus_tag LOCUS_2800 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027828.1:glycosyltransferase family 4 protein 554 1081 gene locus_tag LOCUS_2810 554 1081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_2810 1168 2070 gene locus_tag LOCUS_2820 gene pdxS 1168 2070 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_2820 2067 2669 gene locus_tag LOCUS_2830 gene pdxT 2067 2669 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_2830 2666 3418 gene locus_tag LOCUS_2840 2666 3418 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_2840 3456 3977 gene locus_tag LOCUS_2850 gene ruvC 3456 3977 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_2850 3974 4561 gene locus_tag LOCUS_2860 gene ruvA 3974 4561 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_2860 >Feature sequence043 <1 1324 gene locus_tag LOCUS_2870 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994664.1:amidohydrolase family protein 1321 2025 gene locus_tag LOCUS_2880 1321 2025 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_2880 2136 3419 gene locus_tag LOCUS_2890 2136 3419 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_2890 3535 3891 gene locus_tag LOCUS_2900 3535 3891 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_2900 3895 4449 gene locus_tag LOCUS_2910 3895 4449 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_2910 >Feature sequence044 198 2495 gene locus_tag LOCUS_2920 198 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 2557 3987 gene locus_tag LOCUS_2930 2557 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 <4777 4027 gene locus_tag LOCUS_2940 <4777 4027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920789.1:MinD/ParA family protein >Feature sequence045 442 98 gene locus_tag LOCUS_2950 442 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 protein_id gnl|my_center|LOCUS_2950 579 1955 gene locus_tag LOCUS_2960 gene lpdA 579 1955 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_2960 2019 3803 gene locus_tag LOCUS_2970 gene sucB 2019 3803 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_2970 3852 4748 gene locus_tag LOCUS_2980 3852 4748 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_2980 >Feature sequence046 2060 4519 gene locus_tag LOCUS_2990 2060 4519 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_2990 >Feature sequence047 351 956 gene locus_tag LOCUS_3000 gene rdgB 351 956 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_3000 1046 961 gene locus_tag LOCUS_t0070 1046 961 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1979 1080 gene locus_tag LOCUS_3010 1979 1080 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_3010 2761 1979 gene locus_tag LOCUS_3020 2761 1979 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888912.1 protein_id gnl|my_center|LOCUS_3020 3762 2758 gene locus_tag LOCUS_3030 3762 2758 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_3030 3843 4127 gene locus_tag LOCUS_3040 3843 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 >Feature sequence048 1287 277 gene locus_tag LOCUS_3050 1287 277 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_3050 1536 2810 gene locus_tag LOCUS_3060 gene thrC 1536 2810 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_3060 2807 3091 gene locus_tag LOCUS_3070 2807 3091 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_3070 >Feature sequence049 <1 2271 gene locus_tag LOCUS_3080 <1 2271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027754.1:aminomethyl-transferring glycine dehydrogenase 3107 2349 gene locus_tag LOCUS_3090 3107 2349 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_3090 4429 3104 gene locus_tag LOCUS_3100 gene lnt 4429 3104 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_3100 >Feature sequence050 694 428 gene locus_tag LOCUS_3110 694 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 1743 691 gene locus_tag LOCUS_3120 1743 691 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_3120 2700 1747 gene locus_tag LOCUS_3130 2700 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 3110 2682 gene locus_tag LOCUS_3140 3110 2682 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_3140 3562 3107 gene locus_tag LOCUS_3150 3562 3107 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_3150 3747 3583 gene locus_tag LOCUS_3160 gene rpmG 3747 3583 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_3160 3919 3843 gene locus_tag LOCUS_t0080 3919 3843 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4030 3957 gene locus_tag LOCUS_t0090 4030 3957 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 1284 1970 gene locus_tag LOCUS_3170 1284 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 1970 2437 gene locus_tag LOCUS_3180 1970 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 3855 2434 gene locus_tag LOCUS_3190 3855 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 >Feature sequence052 12 87 gene locus_tag LOCUS_t0100 12 87 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 1657 2310 gene locus_tag LOCUS_3200 1657 2310 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688528.1 protein_id gnl|my_center|LOCUS_3200 2364 3977 gene locus_tag LOCUS_3210 2364 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 >Feature sequence054 1711 1211 gene locus_tag LOCUS_3220 1711 1211 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_3220 3222 1708 gene locus_tag LOCUS_3230 3222 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 4007 3246 gene locus_tag LOCUS_3240 4007 3246 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_3240 <4516 4009 gene locus_tag LOCUS_3250 <4516 4009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975452.1:carboxylating nicotinate-nucleotide diphosphorylase >Feature sequence055 1645 155 gene locus_tag LOCUS_3260 gene gatA 1645 155 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_3260 1944 1648 gene locus_tag LOCUS_3270 gene gatC 1944 1648 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_3270 3164 1995 gene locus_tag LOCUS_3280 3164 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 4486 3293 gene locus_tag LOCUS_3290 4486 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 >Feature sequence056 1469 321 gene locus_tag LOCUS_3300 1469 321 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_3300 2200 1469 gene locus_tag LOCUS_3310 2200 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 2354 3211 gene locus_tag LOCUS_3320 2354 3211 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_3320 4030 3218 gene locus_tag LOCUS_3330 4030 3218 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_3330 >Feature sequence057 <1 1809 gene locus_tag LOCUS_3340 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028453.1:penicillin-binding protein 2 1806 2987 gene locus_tag LOCUS_3350 gene rodA 1806 2987 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_3350 >Feature sequence058 <1 1141 gene locus_tag LOCUS_3360 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013231061.1:PLP-dependent aminotransferase family protein 1141 2109 gene locus_tag LOCUS_3370 1141 2109 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_3370 3123 2122 gene locus_tag LOCUS_3380 3123 2122 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_3380 4087 3140 gene locus_tag LOCUS_3390 4087 3140 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_3390 >Feature sequence059 636 52 gene locus_tag LOCUS_3400 gene purN 636 52 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907570.1 protein_id gnl|my_center|LOCUS_3400 1841 675 gene locus_tag LOCUS_3410 1841 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 2775 1891 gene locus_tag LOCUS_3420 gene sucD 2775 1891 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_3420 3920 2787 gene locus_tag LOCUS_3430 gene sucC 3920 2787 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_3430 >Feature sequence060 177 587 gene locus_tag LOCUS_3440 177 587 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_3440 1360 584 gene locus_tag LOCUS_3450 1360 584 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_3450 2106 1357 gene locus_tag LOCUS_3460 gene recO 2106 1357 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_3460 3873 2146 gene locus_tag LOCUS_3470 gene leuA 3873 2146 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_3470 >Feature sequence061 1468 359 gene locus_tag LOCUS_3480 gene rlmN 1468 359 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_3480 2301 1465 gene locus_tag LOCUS_3490 2301 1465 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804638.1 protein_id gnl|my_center|LOCUS_3490 2883 2326 gene locus_tag LOCUS_3500 gene frr 2883 2326 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_3500 3668 2883 gene locus_tag LOCUS_3510 gene pyrH 3668 2883 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_3510 <4399 3674 gene locus_tag LOCUS_3520 <4399 3674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899527.1:translation elongation factor Ts >Feature sequence062 632 1336 gene locus_tag LOCUS_3530 632 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 2421 1342 gene locus_tag LOCUS_3540 gene disA 2421 1342 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_3540 2521 3021 gene locus_tag LOCUS_3550 2521 3021 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_3550 <4384 3018 gene locus_tag LOCUS_3560 <4384 3018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028928.1:DNA repair protein RadA >Feature sequence063 1055 1900 gene locus_tag LOCUS_3570 1055 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 3597 1849 gene locus_tag LOCUS_3580 gene aspS 3597 1849 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_3580 <4338 3594 gene locus_tag LOCUS_3590 <4338 3594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016325801.1:histidine--tRNA ligase >Feature sequence064 918 112 gene locus_tag LOCUS_3600 918 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 2010 1486 gene locus_tag LOCUS_3610 2010 1486 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263795.1 protein_id gnl|my_center|LOCUS_3610 2250 2089 gene locus_tag LOCUS_3620 2250 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 2948 2238 gene locus_tag LOCUS_3630 2948 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 >Feature sequence065 343 1731 gene locus_tag LOCUS_3640 343 1731 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_3640 1810 3702 gene locus_tag LOCUS_3650 1810 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 >Feature sequence066 968 198 gene locus_tag LOCUS_3660 968 198 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_3660 1100 1816 gene locus_tag LOCUS_3670 1100 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 1813 2622 gene locus_tag LOCUS_3680 1813 2622 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_3680 2999 2619 gene locus_tag LOCUS_3690 2999 2619 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_3690 >Feature sequence067 1243 833 gene locus_tag LOCUS_3700 gene ndk 1243 833 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_3700 1615 1292 gene locus_tag LOCUS_3710 1615 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 2997 1612 gene locus_tag LOCUS_3720 2997 1612 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110172.1 protein_id gnl|my_center|LOCUS_3720 >Feature sequence068 2681 1761 gene locus_tag LOCUS_3730 2681 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 3136 3324 gene locus_tag LOCUS_3740 3136 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 3342 4169 gene locus_tag LOCUS_3750 3342 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 >Feature sequence069 <1 829 gene locus_tag LOCUS_3760 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029417.1:phosphoribosylamine--glycine ligase 826 1554 gene locus_tag LOCUS_3770 826 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 1551 2975 gene locus_tag LOCUS_3780 gene purB 1551 2975 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_3780 2972 3874 gene locus_tag LOCUS_3790 2972 3874 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_3790 >Feature sequence070 1041 46 gene locus_tag LOCUS_3800 1041 46 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_3800 1110 2015 gene locus_tag LOCUS_3810 1110 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 2074 2874 gene locus_tag LOCUS_3820 gene panC 2074 2874 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_3820 >Feature sequence071 965 60 gene locus_tag LOCUS_3830 965 60 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_3830 2533 977 gene locus_tag LOCUS_3840 2533 977 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_3840 2465 2764 gene locus_tag LOCUS_3850 2465 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 3743 2775 gene locus_tag LOCUS_3860 gene ccsB 3743 2775 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_3860 >Feature sequence072 478 717 gene locus_tag LOCUS_3870 478 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 1400 735 gene locus_tag LOCUS_3880 1400 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 3873 3721 gene locus_tag LOCUS_3890 3873 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 >Feature sequence073 1643 150 gene locus_tag LOCUS_3900 gene mptB 1643 150 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877585.1 protein_id gnl|my_center|LOCUS_3900 3295 1796 gene locus_tag LOCUS_3910 gene crtI 3295 1796 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_3910 <4115 3353 gene locus_tag LOCUS_3920 <4115 3353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224198.1:polyprenyl synthetase family protein >Feature sequence074 1144 1836 gene locus_tag LOCUS_3930 1144 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 1833 3533 gene locus_tag LOCUS_3940 1833 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 >Feature sequence075 153 1487 gene locus_tag LOCUS_3950 153 1487 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_3950 2390 1494 gene locus_tag LOCUS_3960 2390 1494 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_3960 <4091 2394 gene locus_tag LOCUS_3970 <4091 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029269.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence076 607 1902 gene locus_tag LOCUS_3980 607 1902 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_3980 1892 2416 gene locus_tag LOCUS_3990 1892 2416 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3990 2441 3574 gene locus_tag LOCUS_4000 2441 3574 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_4000 3889 3578 gene locus_tag LOCUS_4010 3889 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 >Feature sequence077 <1 1329 gene locus_tag LOCUS_4020 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit 1351 1530 gene locus_tag LOCUS_4030 1351 1530 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_4030 1590 2558 gene locus_tag LOCUS_4040 1590 2558 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112329.1 protein_id gnl|my_center|LOCUS_4040 2881 2555 gene locus_tag LOCUS_4050 2881 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 2970 3365 gene locus_tag LOCUS_4060 gene sodN 2970 3365 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_4060 3482 3922 gene locus_tag LOCUS_4070 3482 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 >Feature sequence078 3060 2080 gene locus_tag LOCUS_4080 3060 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 3569 3087 gene locus_tag LOCUS_4090 3569 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 >Feature sequence079 225 1343 gene locus_tag LOCUS_4100 gene ald 225 1343 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_4100 1360 2304 gene locus_tag LOCUS_4110 gene xerD 1360 2304 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_4110 2396 3241 gene locus_tag LOCUS_4120 2396 3241 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_4120 >Feature sequence080 2 1189 gene locus_tag LOCUS_4130 2 1189 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_4130 1214 2170 gene locus_tag LOCUS_4140 1214 2170 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_4140 2442 3233 gene locus_tag LOCUS_4150 2442 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 >Feature sequence081 <1 2141 gene locus_tag LOCUS_4160 <1 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977325.1:alanine--tRNA ligase 2150 2584 gene locus_tag LOCUS_4170 gene ruvX 2150 2584 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_4170 2581 3603 gene locus_tag LOCUS_4180 2581 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 >Feature sequence082 591 1373 gene locus_tag LOCUS_4190 591 1373 CDS product igiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895987.1 protein_id gnl|my_center|LOCUS_4190 1484 1957 gene locus_tag LOCUS_4200 1484 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 1972 2430 gene locus_tag LOCUS_4210 gene tadA 1972 2430 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_4210 2558 2647 gene locus_tag LOCUS_t0110 2558 2647 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2921 2833 gene locus_tag LOCUS_t0120 2921 2833 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence083 479 1132 gene locus_tag LOCUS_4220 479 1132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406678.1 protein_id gnl|my_center|LOCUS_4220 1224 2498 gene locus_tag LOCUS_4230 1224 2498 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_4230 2574 3845 gene locus_tag LOCUS_4240 2574 3845 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228089.1 protein_id gnl|my_center|LOCUS_4240 >Feature sequence084 1034 546 gene locus_tag LOCUS_4250 1034 546 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_4250 1242 2672 gene locus_tag LOCUS_4260 1242 2672 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence085 2705 1779 gene locus_tag LOCUS_4270 2705 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 <3897 2739 gene locus_tag LOCUS_4280 <3897 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878169.1:bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase >Feature sequence086 1176 205 gene locus_tag LOCUS_4290 1176 205 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 protein_id gnl|my_center|LOCUS_4290 2759 1197 gene locus_tag LOCUS_4300 gene purH 2759 1197 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_4300 3373 2756 gene locus_tag LOCUS_4310 gene purN 3373 2756 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222719.1 protein_id gnl|my_center|LOCUS_4310 >Feature sequence087 756 1046 gene locus_tag LOCUS_4320 gene clpS 756 1046 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_4320 1046 1606 gene locus_tag LOCUS_4330 1046 1606 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_4330 1616 2035 gene locus_tag LOCUS_4340 1616 2035 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_4340 2092 2367 gene locus_tag LOCUS_4350 2092 2367 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059911.1 protein_id gnl|my_center|LOCUS_4350 2367 3314 gene locus_tag LOCUS_4360 2367 3314 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084687.1 protein_id gnl|my_center|LOCUS_4360 >Feature sequence088 1415 324 gene locus_tag LOCUS_4370 1415 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 1532 2362 gene locus_tag LOCUS_4380 1532 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 3738 2359 gene locus_tag LOCUS_4390 3738 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 >Feature sequence089 1060 71 gene locus_tag LOCUS_4400 1060 71 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_4400 1623 1057 gene locus_tag LOCUS_4410 gene pyrR 1623 1057 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_4410 3193 1751 gene locus_tag LOCUS_4420 gene pyk 3193 1751 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_4420 <3814 3275 gene locus_tag LOCUS_4430 <3814 3275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228800.1:glutamate synthase subunit beta >Feature sequence090 >Feature sequence091 297 1442 gene locus_tag LOCUS_4440 gene ddlA 297 1442 CDS product D-alanine--D-alanine ligase DdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950808.1 protein_id gnl|my_center|LOCUS_4440 1894 1439 gene locus_tag LOCUS_4450 1894 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 2106 1873 gene locus_tag LOCUS_4460 2106 1873 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_4460 2218 3180 gene locus_tag LOCUS_4470 2218 3180 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_4470 3378 3193 gene locus_tag LOCUS_4480 gene rpmB 3378 3193 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_4480 >Feature sequence092 487 2079 gene locus_tag LOCUS_4490 gene serA 487 2079 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_4490 2104 3159 gene locus_tag LOCUS_4500 2104 3159 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111728.1 protein_id gnl|my_center|LOCUS_4500 >Feature sequence093 302 1531 gene locus_tag LOCUS_4510 gene mshC 302 1531 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_4510 2377 1535 gene locus_tag LOCUS_4520 gene parJ 2377 1535 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_4520 >Feature sequence094 189 677 gene locus_tag LOCUS_4530 189 677 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_4530 1378 674 gene locus_tag LOCUS_4540 1378 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 2473 1628 gene locus_tag LOCUS_4550 gene htpX 2473 1628 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_4550 2847 2509 gene locus_tag LOCUS_4560 2847 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 3278 2847 gene locus_tag LOCUS_4570 3278 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 3712 3275 gene locus_tag LOCUS_4580 3712 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 >Feature sequence095 125 285 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acaatctcgactggttcaac 1397 1927 gene locus_tag LOCUS_4590 1397 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_4590 1942 2646 gene locus_tag LOCUS_4600 1942 2646 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_4600 2639 3064 gene locus_tag LOCUS_4610 2639 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 3099 3428 gene locus_tag LOCUS_4620 3099 3428 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_4620 >Feature sequence096 28 876 gene locus_tag LOCUS_4630 28 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 1073 873 gene locus_tag LOCUS_4640 1073 873 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_4640 1984 1070 gene locus_tag LOCUS_4650 1984 1070 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_4650 2141 2980 gene locus_tag LOCUS_4660 2141 2980 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_4660 2990 3679 gene locus_tag LOCUS_4670 2990 3679 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_4670 >Feature sequence097 920 594 gene locus_tag LOCUS_4680 920 594 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_4680 1011 1322 gene locus_tag LOCUS_4690 1011 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 1372 2790 gene locus_tag LOCUS_4700 gene cysS 1372 2790 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_4700 <3705 2811 gene locus_tag LOCUS_4710 <3705 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228760.1:VanW family protein >Feature sequence098 <1 912 gene locus_tag LOCUS_4720 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029749.1:EamA family transporter RarD 1919 909 gene locus_tag LOCUS_4730 1919 909 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_4730 3489 1930 gene locus_tag LOCUS_4740 gene nuoN 3489 1930 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_4740 >Feature sequence099 <1 540 gene locus_tag LOCUS_4750 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976252.1:16S rRNA (uracil(1498)-N(3))-methyltransferase 549 941 gene locus_tag LOCUS_4760 549 941 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_4760 1038 2036 gene locus_tag LOCUS_4770 1038 2036 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_4770 2040 2501 gene locus_tag LOCUS_4780 gene ybeY 2040 2501 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_4780 >Feature sequence100 <1 2052 gene locus_tag LOCUS_4790 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 2186 2473 gene locus_tag LOCUS_4800 2186 2473 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_4800 2738 2517 gene locus_tag LOCUS_4810 gene bldC 2738 2517 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_4810 2943 3131 gene locus_tag LOCUS_4820 2943 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 <3654 3133 gene locus_tag LOCUS_4830 <3654 3133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974885.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence101 1673 414 gene locus_tag LOCUS_4840 1673 414 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_4840 2908 1853 gene locus_tag LOCUS_4850 2908 1853 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_4850 3490 2933 gene locus_tag LOCUS_4860 3490 2933 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_4860 >Feature sequence102 1810 1016 gene locus_tag LOCUS_4870 1810 1016 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_4870 2031 1807 gene locus_tag LOCUS_4880 2031 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 2134 3255 gene locus_tag LOCUS_4890 2134 3255 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_4890 >Feature sequence103 <1 533 gene locus_tag LOCUS_4900 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013296133.1:heliorhodopsin HeR 698 3205 gene locus_tag LOCUS_4910 698 3205 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_4910 >Feature sequence104 <1 1466 gene locus_tag LOCUS_4920 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976982.1:ABC-F family ATP-binding cassette domain-containing protein 1494 2102 gene locus_tag LOCUS_4930 1494 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 >Feature sequence105 <1 2111 gene locus_tag LOCUS_4940 <1 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972923.1:aconitate hydratase AcnA >Feature sequence106 <1 2076 gene locus_tag LOCUS_4950 <1 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 2144 2977 gene locus_tag LOCUS_4960 2144 2977 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_4960 3202 3032 gene locus_tag LOCUS_4970 3202 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 >Feature sequence107 1582 497 gene locus_tag LOCUS_4980 1582 497 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_4980 2330 1593 gene locus_tag LOCUS_4990 2330 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 3040 2330 gene locus_tag LOCUS_5000 3040 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 3358 3068 gene locus_tag LOCUS_5010 3358 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 >Feature sequence108 <1 552 gene locus_tag LOCUS_5020 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837313.1:ABC transporter substrate-binding protein 711 638 gene locus_tag LOCUS_t0130 711 638 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1508 726 gene locus_tag LOCUS_5030 1508 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 2121 1633 gene locus_tag LOCUS_5040 2121 1633 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 protein_id gnl|my_center|LOCUS_5040 3288 2374 gene locus_tag LOCUS_5050 3288 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 >Feature sequence109 218 847 gene locus_tag LOCUS_5060 218 847 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_5060 958 2718 gene locus_tag LOCUS_5070 958 2718 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_5070 >Feature sequence110 <1 1261 gene locus_tag LOCUS_5080 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028744.1:two-component system sensor histidine kinase DraK 1656 1174 gene locus_tag LOCUS_5090 1656 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 1729 2850 gene locus_tag LOCUS_5100 1729 2850 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_5100 2855 3352 gene locus_tag LOCUS_5110 gene purE 2855 3352 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_5110 >Feature sequence111 1208 462 gene locus_tag LOCUS_5120 1208 462 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_5120 2204 1224 gene locus_tag LOCUS_5130 2204 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 2339 3067 gene locus_tag LOCUS_5140 2339 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 >Feature sequence112 1417 728 gene locus_tag LOCUS_5150 gene ftsE 1417 728 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_5150 2453 1506 gene locus_tag LOCUS_5160 2453 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 3301 2453 gene locus_tag LOCUS_5170 3301 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 >Feature sequence113 359 1099 gene locus_tag LOCUS_5180 359 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 1435 1172 gene locus_tag LOCUS_5190 gene crgA 1435 1172 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_5190 1478 2254 gene locus_tag LOCUS_5200 1478 2254 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 protein_id gnl|my_center|LOCUS_5200 2251 3027 gene locus_tag LOCUS_5210 2251 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 3065 3367 gene locus_tag LOCUS_5220 3065 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 >Feature sequence114 1244 213 gene locus_tag LOCUS_5230 1244 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 1496 3361 gene locus_tag LOCUS_5240 1496 3361 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_5240 >Feature sequence115 1249 278 gene locus_tag LOCUS_5250 1249 278 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_5250 <3440 1249 gene locus_tag LOCUS_5260 <3440 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977343.1:carbamoyl-phosphate synthase large subunit >Feature sequence116 496 1173 gene locus_tag LOCUS_5270 496 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 <3435 1295 gene locus_tag LOCUS_5280 <3435 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962626.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence117 1443 235 gene locus_tag LOCUS_5290 1443 235 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_5290 2838 1453 gene locus_tag LOCUS_5300 2838 1453 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_5300 <3433 2845 gene locus_tag LOCUS_5310 <3433 2845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004201153.1:pyridoxamine 5'-phosphate oxidase family protein >Feature sequence118 >Feature sequence119 <3391 2224 gene locus_tag LOCUS_5320 <3391 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966736.1:pentapeptide repeat-containing protein >Feature sequence120 1056 364 gene locus_tag LOCUS_5330 1056 364 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_5330 1745 3055 gene locus_tag LOCUS_5340 gene aroA 1745 3055 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_5340 >Feature sequence121 1240 1968 gene locus_tag LOCUS_5350 1240 1968 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_5350 1965 2606 gene locus_tag LOCUS_5360 1965 2606 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_5360 <3375 2603 gene locus_tag LOCUS_5370 <3375 2603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029333.1:GAF domain-containing protein >Feature sequence122 941 1786 gene locus_tag LOCUS_5380 941 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 1801 2643 gene locus_tag LOCUS_5390 1801 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 >Feature sequence123 <1 2052 gene locus_tag LOCUS_5400 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729733.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type 2805 2059 gene locus_tag LOCUS_5410 2805 2059 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 protein_id gnl|my_center|LOCUS_5410 >Feature sequence124 659 297 gene locus_tag LOCUS_5420 659 297 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_5420 1779 718 gene locus_tag LOCUS_5430 1779 718 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_5430 1815 2297 gene locus_tag LOCUS_5440 1815 2297 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_5440 >Feature sequence125 <1 2457 gene locus_tag LOCUS_5450 <1 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027870.1:phenylalanine--tRNA ligase subunit beta >Feature sequence126 1352 696 gene locus_tag LOCUS_5460 1352 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 2695 1352 gene locus_tag LOCUS_5470 gene nuoD 2695 1352 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080148.1 protein_id gnl|my_center|LOCUS_5470 3300 2692 gene locus_tag LOCUS_5480 3300 2692 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080149.1 protein_id gnl|my_center|LOCUS_5480 >Feature sequence127 <1 855 gene locus_tag LOCUS_5490 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975028.1:alanine racemase 979 1860 gene locus_tag LOCUS_5500 979 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 3130 1925 gene locus_tag LOCUS_5510 3130 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 >Feature sequence128 1432 443 gene locus_tag LOCUS_5520 1432 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 1985 1602 gene locus_tag LOCUS_5530 gene mscL 1985 1602 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815058.1 protein_id gnl|my_center|LOCUS_5530 2691 2038 gene locus_tag LOCUS_5540 2691 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 >Feature sequence129 620 387 gene locus_tag LOCUS_5550 620 387 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_5550 1193 624 gene locus_tag LOCUS_5560 1193 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 2849 1326 gene locus_tag LOCUS_5570 gene ffh 2849 1326 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_5570 >Feature sequence130 <1 611 gene locus_tag LOCUS_5580 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729853.1:TldD/PmbA family protein 608 2005 gene locus_tag LOCUS_5590 608 2005 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_5590 2225 2013 gene locus_tag LOCUS_5600 2225 2013 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898900.1 protein_id gnl|my_center|LOCUS_5600 2331 2660 gene locus_tag LOCUS_5610 2331 2660 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_5610 >Feature sequence131 2852 2091 gene locus_tag LOCUS_5620 2852 2091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_5620 >Feature sequence132 1209 2108 gene locus_tag LOCUS_5630 1209 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 2749 2105 gene locus_tag LOCUS_5640 2749 2105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 protein_id gnl|my_center|LOCUS_5640 >Feature sequence133 596 2428 gene locus_tag LOCUS_5650 gene dnaK 596 2428 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_5650 2425 2955 gene locus_tag LOCUS_5660 2425 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 >Feature sequence134 <1 571 gene locus_tag LOCUS_5670 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039137.1:fumarylacetoacetate hydrolase family protein 612 1595 gene locus_tag LOCUS_5680 612 1595 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_5680 1616 2767 gene locus_tag LOCUS_5690 1616 2767 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533146.1 protein_id gnl|my_center|LOCUS_5690 3236 2745 gene locus_tag LOCUS_5700 3236 2745 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_5700 >Feature sequence135 450 1649 gene locus_tag LOCUS_5710 gene xseA 450 1649 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 protein_id gnl|my_center|LOCUS_5710 1646 1870 gene locus_tag LOCUS_5720 1646 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 2434 1862 gene locus_tag LOCUS_5730 2434 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 >Feature sequence136 34 1134 gene locus_tag LOCUS_5740 34 1134 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_5740 1575 1138 gene locus_tag LOCUS_5750 1575 1138 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_5750 1997 1584 gene locus_tag LOCUS_5760 1997 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 2079 2942 gene locus_tag LOCUS_5770 gene folP 2079 2942 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_5770 >Feature sequence137 189 665 gene locus_tag LOCUS_5780 189 665 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_5780 1601 726 gene locus_tag LOCUS_5790 1601 726 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_5790 <3173 1842 gene locus_tag LOCUS_5800 <3173 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399863.1:UbiD family decarboxylase >Feature sequence138 1829 957 gene locus_tag LOCUS_5810 gene sucD 1829 957 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_5810 3016 1844 gene locus_tag LOCUS_5820 gene sucC 3016 1844 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_5820 >Feature sequence139 <1 1809 gene locus_tag LOCUS_5830 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973199.1:DNA topoisomerase IV subunit B 2330 1806 gene locus_tag LOCUS_5840 2330 1806 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262519.1 protein_id gnl|my_center|LOCUS_5840 <3136 2354 gene locus_tag LOCUS_5850 <3136 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030485.1:sucrase ferredoxin >Feature sequence140 696 1025 gene locus_tag LOCUS_5860 696 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 1022 1402 gene locus_tag LOCUS_5870 1022 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 2313 1399 gene locus_tag LOCUS_5880 2313 1399 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_5880 <3131 2300 gene locus_tag LOCUS_5890 <3131 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911542.1:polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB >Feature sequence141 441 1232 gene locus_tag LOCUS_5900 441 1232 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_5900 1252 2208 gene locus_tag LOCUS_5910 1252 2208 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_5910 >Feature sequence142 1826 1035 gene locus_tag LOCUS_5920 1826 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 2952 2227 gene locus_tag LOCUS_5930 2952 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 >Feature sequence143 1376 174 gene locus_tag LOCUS_5940 gene coaBC 1376 174 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_5940 1770 1396 gene locus_tag LOCUS_5950 1770 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 2376 1822 gene locus_tag LOCUS_5960 gene gmk 2376 1822 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_5960 <3071 2379 gene locus_tag LOCUS_5970 <3071 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156274057.1:orotidine-5'-phosphate decarboxylase >Feature sequence144 1076 72 gene locus_tag LOCUS_5980 1076 72 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_5980 2041 1073 gene locus_tag LOCUS_5990 2041 1073 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_5990 2422 2060 gene locus_tag LOCUS_6000 2422 2060 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 protein_id gnl|my_center|LOCUS_6000 2997 2464 gene locus_tag LOCUS_6010 2997 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 >Feature sequence145 1330 2187 gene locus_tag LOCUS_6020 1330 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 2180 2959 gene locus_tag LOCUS_6030 2180 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 >Feature sequence146 1545 67 gene locus_tag LOCUS_6040 1545 67 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_6040 <3061 1589 gene locus_tag LOCUS_6050 <3061 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976122.1:energy-dependent translational throttle protein EttA >Feature sequence147 <1 542 gene locus_tag LOCUS_6060 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085977020.1:IS5-like element ISRhru6 family transposase 2457 2969 gene locus_tag LOCUS_6070 2457 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 >Feature sequence148 206 1033 gene locus_tag LOCUS_6080 206 1033 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_6080 2130 1030 gene locus_tag LOCUS_6090 gene gcvT 2130 1030 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_6090 >Feature sequence149 <3053 1998 gene locus_tag LOCUS_6100 <3053 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003821323.1:ABC transporter ATP-binding protein >Feature sequence150 900 661 gene locus_tag LOCUS_6110 gene acpP 900 661 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 protein_id gnl|my_center|LOCUS_6110 1828 1055 gene locus_tag LOCUS_6120 gene fabG 1828 1055 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813819.1 protein_id gnl|my_center|LOCUS_6120 2763 1825 gene locus_tag LOCUS_6130 gene fabD 2763 1825 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_6130 >Feature sequence151 238 1155 gene locus_tag LOCUS_6140 238 1155 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_6140 1700 1152 gene locus_tag LOCUS_6150 1700 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2329 1817 gene locus_tag LOCUS_6160 2329 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 <3043 2332 gene locus_tag LOCUS_6170 <3043 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064180.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence152 1479 157 gene locus_tag LOCUS_6180 1479 157 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_6180 2648 1479 gene locus_tag LOCUS_6190 gene dxr 2648 1479 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_6190 >Feature sequence153 2 907 gene locus_tag LOCUS_6200 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 950 1591 gene locus_tag LOCUS_6210 950 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 1588 2775 gene locus_tag LOCUS_6220 1588 2775 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_6220 >Feature sequence154 801 4 gene locus_tag LOCUS_6230 801 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 2398 917 gene locus_tag LOCUS_6240 2398 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 2632 2429 gene locus_tag LOCUS_6250 2632 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 >Feature sequence155 >Feature sequence156 418 2373 gene locus_tag LOCUS_6260 418 2373 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence157 <1 1815 gene locus_tag LOCUS_6270 <1 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224556.1:prolyl oligopeptidase family serine peptidase <3001 1819 gene locus_tag LOCUS_6280 <3001 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973866.1:translational GTPase TypA