>Feature sequence001 1136 765 gene locus_tag LOCUS_00010 1136 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2839 1271 gene locus_tag LOCUS_00020 2839 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3096 4934 gene locus_tag LOCUS_00030 3096 4934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_00030 4939 5520 gene locus_tag LOCUS_00040 4939 5520 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_00040 5614 6600 gene locus_tag LOCUS_00050 5614 6600 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_00050 6713 10021 gene locus_tag LOCUS_00060 6713 10021 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_00060 10034 11704 gene locus_tag LOCUS_00070 10034 11704 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_00070 11697 12908 gene locus_tag LOCUS_00080 11697 12908 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_00080 13723 14766 gene locus_tag LOCUS_00090 13723 14766 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764608.1 protein_id gnl|my_center|LOCUS_00090 14831 16318 gene locus_tag LOCUS_00100 14831 16318 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_00100 16436 17266 gene locus_tag LOCUS_00110 16436 17266 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_00110 17372 18190 gene locus_tag LOCUS_00120 17372 18190 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_00120 19192 18557 gene locus_tag LOCUS_00130 19192 18557 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_00130 19303 19905 gene locus_tag LOCUS_00140 19303 19905 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767596.1 protein_id gnl|my_center|LOCUS_00140 19968 20495 gene locus_tag LOCUS_00150 19968 20495 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_00150 20631 22523 gene locus_tag LOCUS_00160 gene speA 20631 22523 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_00160 22525 23295 gene locus_tag LOCUS_00170 gene argB 22525 23295 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_00170 23356 23865 gene locus_tag LOCUS_00180 23356 23865 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_00180 23855 24337 gene locus_tag LOCUS_00190 23855 24337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108812.1 protein_id gnl|my_center|LOCUS_00190 25520 24660 gene locus_tag LOCUS_00200 25520 24660 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_00200 25809 26519 gene locus_tag LOCUS_00210 25809 26519 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_00210 27124 26726 gene locus_tag LOCUS_00220 27124 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763662.1 protein_id gnl|my_center|LOCUS_00220 27263 28951 gene locus_tag LOCUS_00230 27263 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 33137 29091 gene locus_tag LOCUS_00240 33137 29091 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_00240 33218 33400 gene locus_tag LOCUS_00250 33218 33400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33445 36537 gene locus_tag LOCUS_00260 33445 36537 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_00260 36556 38217 gene locus_tag LOCUS_00270 36556 38217 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_00270 38268 39095 gene locus_tag LOCUS_00280 38268 39095 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_00280 43381 39299 gene locus_tag LOCUS_00290 43381 39299 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_00290 43676 45316 gene locus_tag LOCUS_00300 43676 45316 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_00300 45452 48487 gene locus_tag LOCUS_00310 45452 48487 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_00310 48500 50158 gene locus_tag LOCUS_00320 48500 50158 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_00320 50171 52537 gene locus_tag LOCUS_00330 50171 52537 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_00330 52678 53517 gene locus_tag LOCUS_00340 52678 53517 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_00340 53681 54889 gene locus_tag LOCUS_00350 53681 54889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 54979 56175 gene locus_tag LOCUS_00360 54979 56175 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_00360 56180 58507 gene locus_tag LOCUS_00370 56180 58507 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_00370 58743 61133 gene locus_tag LOCUS_00380 58743 61133 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_00380 61270 63126 gene locus_tag LOCUS_00390 61270 63126 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_00390 63216 63482 gene locus_tag LOCUS_00400 63216 63482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 63479 63745 gene locus_tag LOCUS_00410 63479 63745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 63891 64358 gene locus_tag LOCUS_00420 gene rimP 63891 64358 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_00420 64363 65628 gene locus_tag LOCUS_00430 gene nusA 64363 65628 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_00430 65752 68793 gene locus_tag LOCUS_00440 gene infB 65752 68793 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_00440 68915 69427 gene locus_tag LOCUS_00450 68915 69427 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_00450 69476 70930 gene locus_tag LOCUS_00460 gene sufB 69476 70930 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_00460 70972 71727 gene locus_tag LOCUS_00470 gene sufC 70972 71727 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_00470 71745 73088 gene locus_tag LOCUS_00480 gene sufD 71745 73088 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_00480 73111 74373 gene locus_tag LOCUS_00490 73111 74373 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_00490 74443 74763 gene locus_tag LOCUS_00500 74443 74763 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_00500 75823 75377 gene locus_tag LOCUS_00510 75823 75377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00510 78165 76021 gene locus_tag LOCUS_00520 gene pnp 78165 76021 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_00520 78373 79524 gene locus_tag LOCUS_00530 78373 79524 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_00530 79715 80179 gene locus_tag LOCUS_00540 gene greA 79715 80179 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_00540 80229 80621 gene locus_tag LOCUS_00550 80229 80621 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_00550 81806 80721 gene locus_tag LOCUS_00560 81806 80721 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_00560 81964 82048 gene locus_tag LOCUS_t00010 81964 82048 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 149 439 gene locus_tag LOCUS_00570 gene cas2 149 439 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_00570 609 2283 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcacaccctacgtgggtgtgtggattgaaac 2895 3959 gene locus_tag LOCUS_00580 2895 3959 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_00580 4090 5193 gene locus_tag LOCUS_00590 gene meaB 4090 5193 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_00590 5219 5803 gene locus_tag LOCUS_00600 5219 5803 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_00600 6508 5975 gene locus_tag LOCUS_00610 6508 5975 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_00610 7215 6571 gene locus_tag LOCUS_00620 7215 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 7160 7375 gene locus_tag LOCUS_00630 7160 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7620 8450 gene locus_tag LOCUS_00640 7620 8450 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_00640 8469 9515 gene locus_tag LOCUS_00650 8469 9515 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_00650 9594 10856 gene locus_tag LOCUS_00660 9594 10856 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_00660 11510 11989 gene locus_tag LOCUS_00670 11510 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 13648 12209 gene locus_tag LOCUS_00680 13648 12209 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109089.1 protein_id gnl|my_center|LOCUS_00680 15166 13688 gene locus_tag LOCUS_00690 15166 13688 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_00690 17092 15218 gene locus_tag LOCUS_00700 gene nuoL 17092 15218 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_00700 17531 17223 gene locus_tag LOCUS_00710 gene nuoK 17531 17223 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007764713.1 protein_id gnl|my_center|LOCUS_00710 18049 17537 gene locus_tag LOCUS_00720 18049 17537 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_00720 18583 18080 gene locus_tag LOCUS_00730 18583 18080 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_00730 19717 18641 gene locus_tag LOCUS_00740 gene nuoH 19717 18641 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_00740 21308 19719 gene locus_tag LOCUS_00750 21308 19719 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785050.1 protein_id gnl|my_center|LOCUS_00750 21966 21367 gene locus_tag LOCUS_00760 21966 21367 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_00760 22307 21957 gene locus_tag LOCUS_00770 22307 21957 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_00770 22790 22419 gene locus_tag LOCUS_00780 22790 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760953.1 protein_id gnl|my_center|LOCUS_00780 24345 22894 gene locus_tag LOCUS_00790 24345 22894 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_00790 25707 24367 gene locus_tag LOCUS_00800 gene trkA 25707 24367 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_00800 27668 25788 gene locus_tag LOCUS_00810 gene dxs 27668 25788 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_00810 28344 29573 gene locus_tag LOCUS_00820 28344 29573 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200755826.1 protein_id gnl|my_center|LOCUS_00820 29570 29941 gene locus_tag LOCUS_00830 29570 29941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109069.1 protein_id gnl|my_center|LOCUS_00830 30237 30878 gene locus_tag LOCUS_00840 30237 30878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 31186 30971 gene locus_tag LOCUS_00850 31186 30971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 32208 33578 gene locus_tag LOCUS_00860 gene mobV 32208 33578 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_00860 35033 33666 gene locus_tag LOCUS_00870 35033 33666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 36215 35046 gene locus_tag LOCUS_00880 36215 35046 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764755.1 protein_id gnl|my_center|LOCUS_00880 38636 36228 gene locus_tag LOCUS_00890 38636 36228 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764754.1 protein_id gnl|my_center|LOCUS_00890 38850 38653 gene locus_tag LOCUS_00900 38850 38653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022251786.1 protein_id gnl|my_center|LOCUS_00900 39565 40554 gene locus_tag LOCUS_00910 39565 40554 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_00910 40530 43055 gene locus_tag LOCUS_00920 40530 43055 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_00920 43180 43395 gene locus_tag LOCUS_00930 gene tatA 43180 43395 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_00930 43527 44345 gene locus_tag LOCUS_00940 gene tatC 43527 44345 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_00940 44342 47773 gene locus_tag LOCUS_00950 44342 47773 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_00950 49687 48098 gene locus_tag LOCUS_00960 49687 48098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_00960 50681 49725 gene locus_tag LOCUS_00970 gene kduI 50681 49725 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_00970 52101 50710 gene locus_tag LOCUS_00980 52101 50710 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_00980 52705 53277 gene locus_tag LOCUS_00990 52705 53277 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786040.1 protein_id gnl|my_center|LOCUS_00990 53382 53753 gene locus_tag LOCUS_01000 53382 53753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 53831 54865 gene locus_tag LOCUS_01010 53831 54865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 55747 55019 gene locus_tag LOCUS_01020 55747 55019 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_01020 56045 56902 gene locus_tag LOCUS_01030 56045 56902 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_01030 56902 57606 gene locus_tag LOCUS_01040 56902 57606 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_01040 58429 57572 gene locus_tag LOCUS_01050 58429 57572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785267.1 protein_id gnl|my_center|LOCUS_01050 59614 58748 gene locus_tag LOCUS_01060 gene lipA 59614 58748 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_01060 61901 59688 gene locus_tag LOCUS_01070 61901 59688 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence003 325 1155 gene locus_tag LOCUS_01080 gene lepB 325 1155 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783767.1 protein_id gnl|my_center|LOCUS_01080 1243 1881 gene locus_tag LOCUS_01090 1243 1881 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_01090 3952 1871 gene locus_tag LOCUS_01100 3952 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 5090 8263 gene locus_tag LOCUS_01110 5090 8263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761957.1 protein_id gnl|my_center|LOCUS_01110 8279 10270 gene locus_tag LOCUS_01120 8279 10270 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761956.1 protein_id gnl|my_center|LOCUS_01120 10401 13061 gene locus_tag LOCUS_01130 10401 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 13119 15485 gene locus_tag LOCUS_01140 13119 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 15627 18074 gene locus_tag LOCUS_01150 15627 18074 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767256.1 protein_id gnl|my_center|LOCUS_01150 18151 18963 gene locus_tag LOCUS_01160 18151 18963 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_01160 19101 20273 gene locus_tag LOCUS_01170 gene uxuA 19101 20273 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_01170 22341 20623 gene locus_tag LOCUS_01180 22341 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 23774 22344 gene locus_tag LOCUS_01190 23774 22344 CDS product MutH/Sau3AI family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183204.1 protein_id gnl|my_center|LOCUS_01190 26283 24034 gene locus_tag LOCUS_01200 26283 24034 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_01200 27869 26619 gene locus_tag LOCUS_01210 27869 26619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 29617 28079 gene locus_tag LOCUS_01220 29617 28079 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_01220 29839 30966 gene locus_tag LOCUS_01230 29839 30966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 30966 31547 gene locus_tag LOCUS_01240 30966 31547 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_01240 31735 31971 gene locus_tag LOCUS_01250 31735 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01250 31990 32334 gene locus_tag LOCUS_01260 31990 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01260 33592 32345 gene locus_tag LOCUS_01270 33592 32345 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_01270 33720 34325 gene locus_tag LOCUS_01280 33720 34325 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_01280 34313 35242 gene locus_tag LOCUS_01290 34313 35242 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_01290 35408 35800 gene locus_tag LOCUS_01300 35408 35800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35797 36414 gene locus_tag LOCUS_01310 35797 36414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 36451 37065 gene locus_tag LOCUS_01320 36451 37065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 37178 39055 gene locus_tag LOCUS_01330 37178 39055 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_01330 39716 39222 gene locus_tag LOCUS_01340 39716 39222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 40088 41590 gene locus_tag LOCUS_01350 40088 41590 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_01350 42491 41862 gene locus_tag LOCUS_01360 42491 41862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 43705 43920 gene locus_tag LOCUS_01370 43705 43920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 43959 44228 gene locus_tag LOCUS_01380 43959 44228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 46323 44263 gene locus_tag LOCUS_01390 46323 44263 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_01390 47797 46436 gene locus_tag LOCUS_01400 47797 46436 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_01400 49302 47830 gene locus_tag LOCUS_01410 49302 47830 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_01410 50427 49390 gene locus_tag LOCUS_01420 gene ruvB 50427 49390 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_01420 50707 51141 gene locus_tag LOCUS_01430 50707 51141 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_01430 51553 53769 gene locus_tag LOCUS_01440 51553 53769 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203553.1 protein_id gnl|my_center|LOCUS_01440 53839 54843 gene locus_tag LOCUS_01450 53839 54843 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_01450 54928 56160 gene locus_tag LOCUS_01460 54928 56160 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_01460 56221 56634 gene locus_tag LOCUS_01470 gene ybeY 56221 56634 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_01470 57242 56706 gene locus_tag LOCUS_01480 57242 56706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 58622 57249 gene locus_tag LOCUS_01490 58622 57249 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence004 63 575 gene locus_tag LOCUS_01500 63 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 1922 594 gene locus_tag LOCUS_01510 1922 594 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_01510 2225 2662 gene locus_tag LOCUS_01520 gene dut 2225 2662 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_01520 2805 4655 gene locus_tag LOCUS_01530 2805 4655 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_01530 4630 5223 gene locus_tag LOCUS_01540 4630 5223 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784040.1 protein_id gnl|my_center|LOCUS_01540 5299 6567 gene locus_tag LOCUS_01550 5299 6567 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_01550 7747 6677 gene locus_tag LOCUS_01560 7747 6677 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_01560 7890 9695 gene locus_tag LOCUS_01570 7890 9695 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_01570 10033 10530 gene locus_tag LOCUS_01580 10033 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10744 11859 gene locus_tag LOCUS_01590 gene prfB 10744 11859 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_01590 12874 13008 gene locus_tag LOCUS_01600 12874 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 13028 13495 gene locus_tag LOCUS_01610 13028 13495 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_01610 13530 14825 gene locus_tag LOCUS_01620 13530 14825 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_01620 14975 17488 gene locus_tag LOCUS_01630 14975 17488 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_01630 18199 18117 gene locus_tag LOCUS_t00020 18199 18117 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19310 18276 gene locus_tag LOCUS_01640 19310 18276 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_01640 20183 19329 gene locus_tag LOCUS_01650 20183 19329 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_01650 22878 20197 gene locus_tag LOCUS_01660 22878 20197 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_01660 23237 23022 gene locus_tag LOCUS_01670 23237 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 23834 25375 gene locus_tag LOCUS_01680 23834 25375 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_01680 25443 26075 gene locus_tag LOCUS_01690 25443 26075 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796621.1 protein_id gnl|my_center|LOCUS_01690 27914 26148 gene locus_tag LOCUS_01700 27914 26148 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201989.1 protein_id gnl|my_center|LOCUS_01700 28936 28100 gene locus_tag LOCUS_01710 gene murQ 28936 28100 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_01710 29821 28982 gene locus_tag LOCUS_01720 29821 28982 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_01720 31072 29888 gene locus_tag LOCUS_01730 31072 29888 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_01730 34081 31106 gene locus_tag LOCUS_01740 34081 31106 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_01740 35448 34258 gene locus_tag LOCUS_01750 35448 34258 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_01750 36849 35527 gene locus_tag LOCUS_01760 36849 35527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_01760 38196 36877 gene locus_tag LOCUS_01770 38196 36877 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_01770 39170 38238 gene locus_tag LOCUS_01780 39170 38238 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_01780 40743 39271 gene locus_tag LOCUS_01790 40743 39271 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_01790 42597 40768 gene locus_tag LOCUS_01800 42597 40768 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201995.1 protein_id gnl|my_center|LOCUS_01800 45754 42647 gene locus_tag LOCUS_01810 45754 42647 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_01810 47224 45770 gene locus_tag LOCUS_01820 47224 45770 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_01820 48389 47376 gene locus_tag LOCUS_01830 48389 47376 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_01830 50810 48924 gene locus_tag LOCUS_01840 50810 48924 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764484.1 protein_id gnl|my_center|LOCUS_01840 51019 50813 gene locus_tag LOCUS_01850 51019 50813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01850 51391 52014 gene locus_tag LOCUS_01860 51391 52014 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759907.1 protein_id gnl|my_center|LOCUS_01860 52471 52163 gene locus_tag LOCUS_01870 52471 52163 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_01870 52798 52475 gene locus_tag LOCUS_01880 52798 52475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 54442 52889 gene locus_tag LOCUS_01890 54442 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 <55973 54651 gene locus_tag LOCUS_01900 <55973 54651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201999.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence005 196 3357 gene locus_tag LOCUS_01910 196 3357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_01910 3376 5061 gene locus_tag LOCUS_01920 3376 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5348 6508 gene locus_tag LOCUS_01930 5348 6508 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_01930 6514 9039 gene locus_tag LOCUS_01940 6514 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9032 10921 gene locus_tag LOCUS_01950 9032 10921 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_01950 11813 11004 gene locus_tag LOCUS_01960 11813 11004 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_01960 12753 11848 gene locus_tag LOCUS_01970 12753 11848 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_01970 13489 12806 gene locus_tag LOCUS_01980 gene mnmD 13489 12806 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_01980 14109 13630 gene locus_tag LOCUS_01990 14109 13630 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_01990 15089 14094 gene locus_tag LOCUS_02000 15089 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_02000 16552 15278 gene locus_tag LOCUS_02010 gene purD 16552 15278 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_02010 18952 16742 gene locus_tag LOCUS_02020 18952 16742 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_02020 20655 19162 gene locus_tag LOCUS_02030 20655 19162 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_02030 21743 20844 gene locus_tag LOCUS_02040 21743 20844 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_02040 22033 23004 gene locus_tag LOCUS_02050 gene cysK 22033 23004 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_02050 23162 23299 gene locus_tag LOCUS_02060 23162 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 23324 23830 gene locus_tag LOCUS_02070 23324 23830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 23844 25535 gene locus_tag LOCUS_02080 23844 25535 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_02080 26062 25586 gene locus_tag LOCUS_02090 26062 25586 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767342.1 protein_id gnl|my_center|LOCUS_02090 28367 26223 gene locus_tag LOCUS_02100 gene rnr 28367 26223 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_02100 28474 29496 gene locus_tag LOCUS_02110 28474 29496 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_02110 29558 30565 gene locus_tag LOCUS_02120 29558 30565 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_02120 30556 31521 gene locus_tag LOCUS_02130 30556 31521 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_02130 32726 31746 gene locus_tag LOCUS_02140 gene dusB 32726 31746 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_02140 32817 33275 gene locus_tag LOCUS_02150 32817 33275 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783513.1 protein_id gnl|my_center|LOCUS_02150 33357 34640 gene locus_tag LOCUS_02160 33357 34640 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_02160 34747 35178 gene locus_tag LOCUS_02170 34747 35178 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_02170 35190 36308 gene locus_tag LOCUS_02180 gene dprA 35190 36308 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_02180 37670 36915 gene locus_tag LOCUS_02190 37670 36915 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_02190 39650 37704 gene locus_tag LOCUS_02200 39650 37704 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_02200 40346 39687 gene locus_tag LOCUS_02210 40346 39687 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_02210 40683 41285 gene locus_tag LOCUS_02220 40683 41285 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_02220 42960 41335 gene locus_tag LOCUS_02230 42960 41335 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_02230 43434 42976 gene locus_tag LOCUS_02240 gene coaD 43434 42976 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783477.1 protein_id gnl|my_center|LOCUS_02240 45341 43431 gene locus_tag LOCUS_02250 45341 43431 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_02250 45812 45561 gene locus_tag LOCUS_02260 45812 45561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 47061 45925 gene locus_tag LOCUS_02270 47061 45925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_02270 48177 47143 gene locus_tag LOCUS_02280 48177 47143 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_02280 48441 48875 gene locus_tag LOCUS_02290 48441 48875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 48778 49905 gene locus_tag LOCUS_02300 48778 49905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 51120 49915 gene locus_tag LOCUS_02310 51120 49915 CDS product DUF4784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108023.1 protein_id gnl|my_center|LOCUS_02310 52240 51305 gene locus_tag LOCUS_02320 52240 51305 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_02320 <53100 52295 gene locus_tag LOCUS_02330 <53100 52295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783463.1:TonB-dependent receptor >Feature sequence006 304 1629 gene locus_tag LOCUS_02340 304 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1765 3126 gene locus_tag LOCUS_02350 1765 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3153 4505 gene locus_tag LOCUS_02360 3153 4505 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_02360 4508 6760 gene locus_tag LOCUS_02370 4508 6760 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_02370 8177 6888 gene locus_tag LOCUS_02380 gene eno 8177 6888 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_02380 8912 8244 gene locus_tag LOCUS_02390 8912 8244 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 protein_id gnl|my_center|LOCUS_02390 9303 8926 gene locus_tag LOCUS_02400 gene crcB 9303 8926 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_02400 10039 12129 gene locus_tag LOCUS_02410 10039 12129 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764740.1 protein_id gnl|my_center|LOCUS_02410 12514 13926 gene locus_tag LOCUS_02420 12514 13926 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_02420 14086 15309 gene locus_tag LOCUS_02430 gene pepT 14086 15309 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_02430 15348 16436 gene locus_tag LOCUS_02440 gene gcvT 15348 16436 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_02440 16793 16590 gene locus_tag LOCUS_02450 16793 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 17186 16935 gene locus_tag LOCUS_02460 17186 16935 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_02460 17416 18384 gene locus_tag LOCUS_02470 17416 18384 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769604.1 protein_id gnl|my_center|LOCUS_02470 18665 19669 gene locus_tag LOCUS_02480 18665 19669 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_02480 21841 19991 gene locus_tag LOCUS_02490 21841 19991 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_02490 23222 21954 gene locus_tag LOCUS_02500 23222 21954 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107940.1 protein_id gnl|my_center|LOCUS_02500 24635 23475 gene locus_tag LOCUS_02510 24635 23475 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_02510 25068 24637 gene locus_tag LOCUS_02520 25068 24637 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_02520 26021 25092 gene locus_tag LOCUS_02530 26021 25092 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767844.1 protein_id gnl|my_center|LOCUS_02530 27613 26060 gene locus_tag LOCUS_02540 27613 26060 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_02540 28085 27669 gene locus_tag LOCUS_02550 gene mce 28085 27669 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_02550 28409 29860 gene locus_tag LOCUS_02560 28409 29860 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107843.1 protein_id gnl|my_center|LOCUS_02560 29994 31355 gene locus_tag LOCUS_02570 29994 31355 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_02570 31403 32659 gene locus_tag LOCUS_02580 31403 32659 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_02580 33212 35692 gene locus_tag LOCUS_02590 33212 35692 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_02590 35851 37146 gene locus_tag LOCUS_02600 35851 37146 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_02600 37192 37758 gene locus_tag LOCUS_02610 37192 37758 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_02610 37743 38270 gene locus_tag LOCUS_02620 37743 38270 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_02620 38260 38919 gene locus_tag LOCUS_02630 38260 38919 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_02630 38909 39841 gene locus_tag LOCUS_02640 38909 39841 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_02640 39850 41022 gene locus_tag LOCUS_02650 39850 41022 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_02650 42678 41104 gene locus_tag LOCUS_02660 42678 41104 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_02660 43188 42913 gene locus_tag LOCUS_02670 43188 42913 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_02670 43346 44386 gene locus_tag LOCUS_02680 gene mutY 43346 44386 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_02680 44459 44914 gene locus_tag LOCUS_02690 gene ssb 44459 44914 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107825.1 protein_id gnl|my_center|LOCUS_02690 44938 46287 gene locus_tag LOCUS_02700 44938 46287 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_02700 46427 46939 gene locus_tag LOCUS_02710 46427 46939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02710 49571 47775 gene locus_tag LOCUS_02720 49571 47775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_02720 50235 49546 gene locus_tag LOCUS_02730 50235 49546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_02730 50545 51741 gene locus_tag LOCUS_02740 50545 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786395.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence007 <1 2035 gene locus_tag LOCUS_02750 <1 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203665.1:calcium-translocating P-type ATPase, PMCA-type 2039 2659 gene locus_tag LOCUS_02760 2039 2659 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_02760 2643 3587 gene locus_tag LOCUS_02770 2643 3587 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_02770 4570 3584 gene locus_tag LOCUS_02780 4570 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5322 6116 gene locus_tag LOCUS_02790 5322 6116 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108347.1 protein_id gnl|my_center|LOCUS_02790 6113 6778 gene locus_tag LOCUS_02800 6113 6778 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791337.1 protein_id gnl|my_center|LOCUS_02800 6975 7259 gene locus_tag LOCUS_02810 6975 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7517 7720 gene locus_tag LOCUS_02820 7517 7720 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108348.1 protein_id gnl|my_center|LOCUS_02820 8364 7939 gene locus_tag LOCUS_02830 8364 7939 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_02830 9420 8407 gene locus_tag LOCUS_02840 9420 8407 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_02840 10355 9417 gene locus_tag LOCUS_02850 10355 9417 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_02850 10585 11499 gene locus_tag LOCUS_02860 10585 11499 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791349.1 protein_id gnl|my_center|LOCUS_02860 11557 12639 gene locus_tag LOCUS_02870 gene buk 11557 12639 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814251.1 protein_id gnl|my_center|LOCUS_02870 13445 12843 gene locus_tag LOCUS_02880 13445 12843 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_02880 13720 13442 gene locus_tag LOCUS_02890 13720 13442 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_02890 14186 14788 gene locus_tag LOCUS_02900 14186 14788 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_02900 14892 17690 gene locus_tag LOCUS_02910 14892 17690 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_02910 17716 18345 gene locus_tag LOCUS_02920 17716 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 18338 19249 gene locus_tag LOCUS_02930 18338 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 19363 20895 gene locus_tag LOCUS_02940 19363 20895 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107907.1 protein_id gnl|my_center|LOCUS_02940 21091 22605 gene locus_tag LOCUS_02950 gene gpmI 21091 22605 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_02950 22717 23298 gene locus_tag LOCUS_02960 22717 23298 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_02960 25430 23469 gene locus_tag LOCUS_02970 gene gyrB 25430 23469 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_02970 26519 25545 gene locus_tag LOCUS_02980 26519 25545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 27171 26842 gene locus_tag LOCUS_02990 27171 26842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 27455 27201 gene locus_tag LOCUS_03000 gene rpsT 27455 27201 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_03000 27565 27493 gene locus_tag LOCUS_t00030 27565 27493 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27853 28581 gene locus_tag LOCUS_03010 gene recO 27853 28581 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_03010 29344 28895 gene locus_tag LOCUS_03020 29344 28895 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_03020 30727 29414 gene locus_tag LOCUS_03030 gene ftsZ 30727 29414 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_03030 32209 30761 gene locus_tag LOCUS_03040 gene ftsA 32209 30761 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_03040 33077 32337 gene locus_tag LOCUS_03050 33077 32337 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_03050 34455 33070 gene locus_tag LOCUS_03060 gene murC 34455 33070 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_03060 35675 34455 gene locus_tag LOCUS_03070 gene murG 35675 34455 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_03070 37056 35776 gene locus_tag LOCUS_03080 37056 35776 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_03080 38504 37170 gene locus_tag LOCUS_03090 gene murD 38504 37170 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_03090 39825 38557 gene locus_tag LOCUS_03100 gene mraY 39825 38557 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_03100 41370 39922 gene locus_tag LOCUS_03110 41370 39922 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108839.1 protein_id gnl|my_center|LOCUS_03110 43554 41416 gene locus_tag LOCUS_03120 43554 41416 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_03120 43991 43641 gene locus_tag LOCUS_03130 43991 43641 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763719.1 protein_id gnl|my_center|LOCUS_03130 44924 43998 gene locus_tag LOCUS_03140 gene rsmH 44924 43998 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_03140 45408 44932 gene locus_tag LOCUS_03150 gene mraZ 45408 44932 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_03150 46385 45882 gene locus_tag LOCUS_03160 46385 45882 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_03160 46947 47765 gene locus_tag LOCUS_03170 46947 47765 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_03170 47810 48787 gene locus_tag LOCUS_03180 47810 48787 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_03180 49197 49448 gene locus_tag LOCUS_03190 49197 49448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence008 1807 50 gene locus_tag LOCUS_03200 1807 50 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_03200 2007 3383 gene locus_tag LOCUS_03210 2007 3383 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_03210 3631 3455 gene locus_tag LOCUS_03220 3631 3455 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_03220 4852 3824 gene locus_tag LOCUS_03230 4852 3824 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_03230 5983 4934 gene locus_tag LOCUS_03240 5983 4934 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_03240 7146 6073 gene locus_tag LOCUS_03250 7146 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9242 7227 gene locus_tag LOCUS_03260 9242 7227 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_03260 9703 10035 gene locus_tag LOCUS_03270 9703 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03270 12599 10395 gene locus_tag LOCUS_03280 12599 10395 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_03280 12925 14331 gene locus_tag LOCUS_03290 gene potA 12925 14331 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_03290 14348 15121 gene locus_tag LOCUS_03300 14348 15121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_03300 15118 15909 gene locus_tag LOCUS_03310 15118 15909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_03310 15951 17282 gene locus_tag LOCUS_03320 15951 17282 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202988.1 protein_id gnl|my_center|LOCUS_03320 17339 18505 gene locus_tag LOCUS_03330 gene nagA 17339 18505 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788533.1 protein_id gnl|my_center|LOCUS_03330 18653 19351 gene locus_tag LOCUS_03340 18653 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 19437 20111 gene locus_tag LOCUS_03350 19437 20111 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786956.1 protein_id gnl|my_center|LOCUS_03350 21413 20265 gene locus_tag LOCUS_03360 gene cydB 21413 20265 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_03360 23008 21434 gene locus_tag LOCUS_03370 23008 21434 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_03370 23555 24904 gene locus_tag LOCUS_03380 23555 24904 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_03380 24919 26148 gene locus_tag LOCUS_03390 24919 26148 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_03390 26164 26910 gene locus_tag LOCUS_03400 26164 26910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_03400 26910 28130 gene locus_tag LOCUS_03410 26910 28130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_03410 28379 29446 gene locus_tag LOCUS_03420 28379 29446 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_03420 29443 30144 gene locus_tag LOCUS_03430 29443 30144 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_03430 31133 30387 gene locus_tag LOCUS_03440 gene pgl 31133 30387 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786873.1 protein_id gnl|my_center|LOCUS_03440 32650 31130 gene locus_tag LOCUS_03450 gene zwf 32650 31130 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800449.1 protein_id gnl|my_center|LOCUS_03450 34118 32643 gene locus_tag LOCUS_03460 gene gnd 34118 32643 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107660.1 protein_id gnl|my_center|LOCUS_03460 34241 35407 gene locus_tag LOCUS_03470 34241 35407 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_03470 35482 36558 gene locus_tag LOCUS_03480 gene gmd 35482 36558 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_03480 36585 37661 gene locus_tag LOCUS_03490 36585 37661 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_03490 38016 39674 gene locus_tag LOCUS_03500 38016 39674 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_03500 39729 41276 gene locus_tag LOCUS_03510 39729 41276 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_03510 41535 42569 gene locus_tag LOCUS_03520 41535 42569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_03520 44628 42640 gene locus_tag LOCUS_03530 44628 42640 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_03530 46302 44683 gene locus_tag LOCUS_03540 46302 44683 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_03540 46832 46653 gene locus_tag LOCUS_03550 46832 46653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 47026 48720 gene locus_tag LOCUS_03560 47026 48720 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765520.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence009 147 2609 gene locus_tag LOCUS_03570 gene pheT 147 2609 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_03570 2655 3392 gene locus_tag LOCUS_03580 2655 3392 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_03580 3392 3637 gene locus_tag LOCUS_03590 3392 3637 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_03590 3761 5017 gene locus_tag LOCUS_03600 3761 5017 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840969.1 protein_id gnl|my_center|LOCUS_03600 5059 5823 gene locus_tag LOCUS_03610 5059 5823 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_03610 5820 6290 gene locus_tag LOCUS_03620 5820 6290 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_03620 6440 6640 gene locus_tag LOCUS_03630 6440 6640 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_03630 6765 8546 gene locus_tag LOCUS_03640 gene lepA 6765 8546 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_03640 8588 9907 gene locus_tag LOCUS_03650 gene nhaA 8588 9907 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_03650 10090 10965 gene locus_tag LOCUS_03660 10090 10965 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_03660 12266 11301 gene locus_tag LOCUS_03670 12266 11301 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_03670 12559 12777 gene locus_tag LOCUS_03680 12559 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13087 13713 gene locus_tag LOCUS_03690 13087 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 14942 13710 gene locus_tag LOCUS_03700 14942 13710 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_03700 17579 14994 gene locus_tag LOCUS_03710 17579 14994 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_03710 18972 17878 gene locus_tag LOCUS_03720 gene wecB 18972 17878 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_03720 19156 19788 gene locus_tag LOCUS_03730 19156 19788 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_03730 22879 19976 gene locus_tag LOCUS_03740 22879 19976 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 protein_id gnl|my_center|LOCUS_03740 23151 23654 gene locus_tag LOCUS_03750 23151 23654 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_03750 23799 25577 gene locus_tag LOCUS_03760 23799 25577 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765908.1 protein_id gnl|my_center|LOCUS_03760 27138 25936 gene locus_tag LOCUS_03770 27138 25936 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 protein_id gnl|my_center|LOCUS_03770 27302 28702 gene locus_tag LOCUS_03780 27302 28702 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_03780 28912 30261 gene locus_tag LOCUS_03790 28912 30261 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_03790 30383 31552 gene locus_tag LOCUS_03800 30383 31552 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_03800 31567 32256 gene locus_tag LOCUS_03810 31567 32256 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_03810 32261 32896 gene locus_tag LOCUS_03820 32261 32896 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_03820 33002 33628 gene locus_tag LOCUS_03830 gene nqrE 33002 33628 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_03830 33646 34920 gene locus_tag LOCUS_03840 gene nqrF 33646 34920 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_03840 36344 35112 gene locus_tag LOCUS_03850 36344 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 37220 36366 gene locus_tag LOCUS_03860 gene map 37220 36366 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_03860 40743 37321 gene locus_tag LOCUS_03870 40743 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 41970 40759 gene locus_tag LOCUS_03880 41970 40759 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766205.1 protein_id gnl|my_center|LOCUS_03880 42672 41998 gene locus_tag LOCUS_03890 42672 41998 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_03890 43058 43795 gene locus_tag LOCUS_03900 43058 43795 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_03900 43901 45043 gene locus_tag LOCUS_03910 gene araJ 43901 45043 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_03910 45188 45520 gene locus_tag LOCUS_03920 45188 45520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 45526 45930 gene locus_tag LOCUS_03930 45526 45930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788073.1 protein_id gnl|my_center|LOCUS_03930 46907 45996 gene locus_tag LOCUS_03940 46907 45996 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_03940 48331 46934 gene locus_tag LOCUS_03950 gene rlmD 48331 46934 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence010 934 557 gene locus_tag LOCUS_03960 934 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2823 1072 gene locus_tag LOCUS_03970 2823 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_03970 3433 2972 gene locus_tag LOCUS_03980 3433 2972 CDS product DUF3836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108317.1 protein_id gnl|my_center|LOCUS_03980 3865 4872 gene locus_tag LOCUS_03990 3865 4872 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_03990 4973 5845 gene locus_tag LOCUS_04000 4973 5845 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_04000 6058 6300 gene locus_tag LOCUS_04010 6058 6300 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_04010 6458 7261 gene locus_tag LOCUS_04020 6458 7261 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_04020 7272 7988 gene locus_tag LOCUS_04030 gene truB 7272 7988 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_04030 8063 9121 gene locus_tag LOCUS_04040 gene queA 8063 9121 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_04040 9151 9606 gene locus_tag LOCUS_04050 gene folK 9151 9606 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_04050 9934 11493 gene locus_tag LOCUS_04060 9934 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11501 12409 gene locus_tag LOCUS_04070 11501 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 12399 13394 gene locus_tag LOCUS_04080 12399 13394 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_04080 13401 14135 gene locus_tag LOCUS_04090 13401 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 14261 15160 gene locus_tag LOCUS_04100 14261 15160 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_04100 15445 16737 gene locus_tag LOCUS_04110 gene metK 15445 16737 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_04110 17173 17571 gene locus_tag LOCUS_04120 17173 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 17594 18136 gene locus_tag LOCUS_04130 17594 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 18433 19023 gene locus_tag LOCUS_04140 18433 19023 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_04140 19020 19751 gene locus_tag LOCUS_04150 19020 19751 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802005.1 protein_id gnl|my_center|LOCUS_04150 19756 20508 gene locus_tag LOCUS_04160 19756 20508 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_04160 20682 21098 gene locus_tag LOCUS_04170 gene rnpA 20682 21098 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_04170 21095 21316 gene locus_tag LOCUS_04180 gene yidD 21095 21316 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_04180 21313 21978 gene locus_tag LOCUS_04190 21313 21978 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_04190 22119 23378 gene locus_tag LOCUS_04200 gene tyrS 22119 23378 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_04200 23503 23574 gene locus_tag LOCUS_t00040 23503 23574 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23858 24010 gene locus_tag LOCUS_04210 23858 24010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 24049 24852 gene locus_tag LOCUS_04220 24049 24852 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_04220 25019 26251 gene locus_tag LOCUS_04230 25019 26251 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_04230 27026 26430 gene locus_tag LOCUS_04240 27026 26430 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_04240 30589 27197 gene locus_tag LOCUS_04250 30589 27197 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_04250 31937 31293 gene locus_tag LOCUS_04260 31937 31293 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_04260 32515 31958 gene locus_tag LOCUS_04270 32515 31958 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_04270 32606 33361 gene locus_tag LOCUS_04280 32606 33361 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_04280 33824 33994 gene locus_tag LOCUS_04290 33824 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 37731 34399 gene locus_tag LOCUS_04300 37731 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 40312 37868 gene locus_tag LOCUS_04310 40312 37868 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_04310 42360 40375 gene locus_tag LOCUS_04320 42360 40375 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_04320 42900 42490 gene locus_tag LOCUS_04330 42900 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 44426 42906 gene locus_tag LOCUS_04340 44426 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 47313 44446 gene locus_tag LOCUS_04350 47313 44446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence011 746 2176 gene locus_tag LOCUS_04360 gene fucP 746 2176 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_04360 2188 3204 gene locus_tag LOCUS_04370 2188 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4154 3270 gene locus_tag LOCUS_04380 4154 3270 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_04380 4506 7343 gene locus_tag LOCUS_04390 gene leuS 4506 7343 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_04390 7412 8314 gene locus_tag LOCUS_04400 7412 8314 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_04400 8354 8932 gene locus_tag LOCUS_04410 8354 8932 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_04410 9956 9012 gene locus_tag LOCUS_04420 gene nadA 9956 9012 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_04420 10514 11041 gene locus_tag LOCUS_04430 10514 11041 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_04430 11545 12507 gene locus_tag LOCUS_04440 11545 12507 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_04440 13251 12670 gene locus_tag LOCUS_04450 13251 12670 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_04450 13400 15445 gene locus_tag LOCUS_04460 13400 15445 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_04460 15728 15525 gene locus_tag LOCUS_04470 15728 15525 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_04470 16050 15721 gene locus_tag LOCUS_04480 16050 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 16412 17185 gene locus_tag LOCUS_04490 16412 17185 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_04490 18098 17313 gene locus_tag LOCUS_04500 18098 17313 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766067.1 protein_id gnl|my_center|LOCUS_04500 18339 19301 gene locus_tag LOCUS_04510 18339 19301 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_04510 21182 19506 gene locus_tag LOCUS_04520 gene sulP 21182 19506 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_04520 21505 22083 gene locus_tag LOCUS_04530 21505 22083 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_04530 24557 22374 gene locus_tag LOCUS_04540 24557 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 26270 24588 gene locus_tag LOCUS_04550 26270 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 27926 26355 gene locus_tag LOCUS_04560 gene nadB 27926 26355 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_04560 28269 31493 gene locus_tag LOCUS_04570 28269 31493 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992680.1 protein_id gnl|my_center|LOCUS_04570 31506 33518 gene locus_tag LOCUS_04580 31506 33518 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202538.1 protein_id gnl|my_center|LOCUS_04580 33753 34124 gene locus_tag LOCUS_04590 33753 34124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 34318 35676 gene locus_tag LOCUS_04600 gene lpdA 34318 35676 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_04600 35851 37332 gene locus_tag LOCUS_04610 gene dacB 35851 37332 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_04610 37471 37953 gene locus_tag LOCUS_04620 37471 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 38023 38922 gene locus_tag LOCUS_04630 38023 38922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 39238 39480 gene locus_tag LOCUS_04640 39238 39480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 39496 40005 gene locus_tag LOCUS_04650 39496 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04650 40010 40885 gene locus_tag LOCUS_04660 40010 40885 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_04660 40891 42867 gene locus_tag LOCUS_04670 40891 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 44503 43007 gene locus_tag LOCUS_04680 44503 43007 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_04680 44978 44598 gene locus_tag LOCUS_04690 44978 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783583.1 protein_id gnl|my_center|LOCUS_04690 45366 46739 gene locus_tag LOCUS_04700 gene miaB 45366 46739 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_04700 47598 47011 gene locus_tag LOCUS_04710 47598 47011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 47853 47641 gene locus_tag LOCUS_04720 47853 47641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence012 880 5751 gene locus_tag LOCUS_04730 880 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5756 6241 gene locus_tag LOCUS_04740 5756 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6320 6616 gene locus_tag LOCUS_04750 6320 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6619 7977 gene locus_tag LOCUS_04760 6619 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8310 9497 gene locus_tag LOCUS_04770 8310 9497 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_04770 9460 9888 gene locus_tag LOCUS_04780 9460 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9885 10265 gene locus_tag LOCUS_04790 9885 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 10262 10861 gene locus_tag LOCUS_04800 10262 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 10858 11454 gene locus_tag LOCUS_04810 10858 11454 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_04810 11492 12061 gene locus_tag LOCUS_04820 11492 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 15014 13044 gene locus_tag LOCUS_04830 15014 13044 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_04830 18183 15187 gene locus_tag LOCUS_04840 gene secDF 18183 15187 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_04840 20308 18266 gene locus_tag LOCUS_04850 20308 18266 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_04850 21486 20386 gene locus_tag LOCUS_04860 21486 20386 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_04860 22462 21572 gene locus_tag LOCUS_04870 22462 21572 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_04870 23126 22443 gene locus_tag LOCUS_04880 23126 22443 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_04880 23372 23638 gene locus_tag LOCUS_04890 23372 23638 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_04890 23795 25612 gene locus_tag LOCUS_04900 gene argS 23795 25612 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_04900 25909 25730 gene locus_tag LOCUS_04910 25909 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 28119 25906 gene locus_tag LOCUS_04920 28119 25906 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_04920 30459 28135 gene locus_tag LOCUS_04930 30459 28135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 31777 30467 gene locus_tag LOCUS_04940 31777 30467 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_04940 31991 31827 gene locus_tag LOCUS_04950 31991 31827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 33041 32094 gene locus_tag LOCUS_04960 33041 32094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 33418 33059 gene locus_tag LOCUS_04970 33418 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 35011 33581 gene locus_tag LOCUS_04980 35011 33581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_04980 37859 35481 gene locus_tag LOCUS_04990 gene topA 37859 35481 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_04990 39636 38005 gene locus_tag LOCUS_05000 39636 38005 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_05000 42722 39678 gene locus_tag LOCUS_05010 42722 39678 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_05010 43366 42827 gene locus_tag LOCUS_05020 43366 42827 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_05020 43650 44171 gene locus_tag LOCUS_05030 43650 44171 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_05030 44178 45344 gene locus_tag LOCUS_05040 44178 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence013 1272 232 gene locus_tag LOCUS_05050 1272 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3453 1300 gene locus_tag LOCUS_05060 3453 1300 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203553.1 protein_id gnl|my_center|LOCUS_05060 5383 3644 gene locus_tag LOCUS_05070 5383 3644 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_05070 8676 5395 gene locus_tag LOCUS_05080 8676 5395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_05080 10042 9020 gene locus_tag LOCUS_05090 10042 9020 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201912.1 protein_id gnl|my_center|LOCUS_05090 10763 10203 gene locus_tag LOCUS_05100 10763 10203 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_05100 11975 11508 gene locus_tag LOCUS_05110 11975 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 12162 13112 gene locus_tag LOCUS_05120 12162 13112 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_05120 13336 13965 gene locus_tag LOCUS_05130 13336 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14117 15271 gene locus_tag LOCUS_05140 14117 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 15293 16189 gene locus_tag LOCUS_05150 15293 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 16223 17257 gene locus_tag LOCUS_05160 16223 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 17318 19624 gene locus_tag LOCUS_05170 17318 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 20124 22187 gene locus_tag LOCUS_05180 20124 22187 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108532.1 protein_id gnl|my_center|LOCUS_05180 23679 22225 gene locus_tag LOCUS_05190 23679 22225 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_05190 24875 23802 gene locus_tag LOCUS_05200 24875 23802 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_05200 26609 24987 gene locus_tag LOCUS_05210 26609 24987 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_05210 27771 26818 gene locus_tag LOCUS_05220 gene xerD 27771 26818 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_05220 27910 28329 gene locus_tag LOCUS_05230 gene aroQ 27910 28329 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_05230 28350 29807 gene locus_tag LOCUS_05240 gene pyk 28350 29807 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_05240 29905 30534 gene locus_tag LOCUS_05250 29905 30534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_05250 30595 30927 gene locus_tag LOCUS_05260 gene rbfA 30595 30927 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_05260 30954 32183 gene locus_tag LOCUS_05270 30954 32183 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_05270 32510 33478 gene locus_tag LOCUS_05280 32510 33478 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_05280 34119 33889 gene locus_tag LOCUS_05290 34119 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 36283 34427 gene locus_tag LOCUS_05300 36283 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 39371 36303 gene locus_tag LOCUS_05310 39371 36303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_05310 42395 39891 gene locus_tag LOCUS_05320 42395 39891 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_05320 42793 43473 gene locus_tag LOCUS_05330 gene mtnN 42793 43473 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689821.1 protein_id gnl|my_center|LOCUS_05330 43491 43982 gene locus_tag LOCUS_05340 43491 43982 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_05340 45823 44093 gene locus_tag LOCUS_05350 45823 44093 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203709.1 protein_id gnl|my_center|LOCUS_05350 46498 45923 gene locus_tag LOCUS_05360 46498 45923 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761981.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence014 <1 601 gene locus_tag LOCUS_05370 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813546.1:NigD-like protein 615 1001 gene locus_tag LOCUS_05380 615 1001 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_05380 2131 1178 gene locus_tag LOCUS_05390 2131 1178 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_05390 3423 2176 gene locus_tag LOCUS_05400 3423 2176 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_05400 4649 3495 gene locus_tag LOCUS_05410 gene proB 4649 3495 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_05410 4878 4639 gene locus_tag LOCUS_05420 4878 4639 CDS product DUF2007-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108946.1 protein_id gnl|my_center|LOCUS_05420 5793 4954 gene locus_tag LOCUS_05430 gene murI 5793 4954 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_05430 6409 5903 gene locus_tag LOCUS_05440 6409 5903 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_05440 7051 6536 gene locus_tag LOCUS_05450 7051 6536 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_05450 9732 7093 gene locus_tag LOCUS_05460 9732 7093 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_05460 10523 9786 gene locus_tag LOCUS_05470 10523 9786 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_05470 11848 10526 gene locus_tag LOCUS_05480 11848 10526 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_05480 13318 12266 gene locus_tag LOCUS_05490 gene ribD 13318 12266 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_05490 13393 14235 gene locus_tag LOCUS_05500 gene prmC 13393 14235 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_05500 14226 14702 gene locus_tag LOCUS_05510 14226 14702 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_05510 14785 15423 gene locus_tag LOCUS_05520 gene pyrE 14785 15423 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_05520 15518 15928 gene locus_tag LOCUS_05530 15518 15928 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_05530 15957 17297 gene locus_tag LOCUS_05540 gene argH 15957 17297 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_05540 17400 17473 gene locus_tag LOCUS_t00050 17400 17473 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17495 17579 gene locus_tag LOCUS_t00060 17495 17579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19174 17936 gene locus_tag LOCUS_05550 19174 17936 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765581.1 protein_id gnl|my_center|LOCUS_05550 21044 19389 gene locus_tag LOCUS_05560 21044 19389 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_05560 21606 21052 gene locus_tag LOCUS_05570 21606 21052 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_05570 22405 21632 gene locus_tag LOCUS_05580 gene proC 22405 21632 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_05580 22546 22986 gene locus_tag LOCUS_05590 22546 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 24352 23231 gene locus_tag LOCUS_05600 24352 23231 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_05600 25326 24358 gene locus_tag LOCUS_05610 gene argC 25326 24358 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_05610 26534 25323 gene locus_tag LOCUS_05620 26534 25323 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_05620 27105 26548 gene locus_tag LOCUS_05630 27105 26548 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_05630 27614 27141 gene locus_tag LOCUS_05640 gene argR 27614 27141 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_05640 27932 28225 gene locus_tag LOCUS_05650 27932 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 28308 28235 gene locus_tag LOCUS_t00070 28308 28235 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28396 28323 gene locus_tag LOCUS_t00080 28396 28323 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29534 28533 gene locus_tag LOCUS_05660 29534 28533 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_05660 29729 30565 gene locus_tag LOCUS_05670 29729 30565 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_05670 30666 31355 gene locus_tag LOCUS_05680 30666 31355 CDS product DUF4476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108321.1 protein_id gnl|my_center|LOCUS_05680 31432 32286 gene locus_tag LOCUS_05690 31432 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784416.1 protein_id gnl|my_center|LOCUS_05690 33699 32371 gene locus_tag LOCUS_05700 33699 32371 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_05700 34833 33730 gene locus_tag LOCUS_05710 34833 33730 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_05710 36152 34911 gene locus_tag LOCUS_05720 36152 34911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_05720 37417 36158 gene locus_tag LOCUS_05730 37417 36158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_05730 38188 37472 gene locus_tag LOCUS_05740 38188 37472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_05740 38365 39345 gene locus_tag LOCUS_05750 38365 39345 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_05750 40371 40018 gene locus_tag LOCUS_05760 gene rplS 40371 40018 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_05760 40937 41293 gene locus_tag LOCUS_05770 40937 41293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 41633 42202 gene locus_tag LOCUS_05780 41633 42202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 42263 42628 gene locus_tag LOCUS_05790 42263 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 43227 44003 gene locus_tag LOCUS_05800 43227 44003 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_05800 44024 44941 gene locus_tag LOCUS_05810 44024 44941 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_05810 45078 46634 gene locus_tag LOCUS_05820 45078 46634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 >Feature sequence015 227 991 gene locus_tag LOCUS_05830 227 991 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_05830 1360 2181 gene locus_tag LOCUS_05840 gene dapF 1360 2181 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_05840 2209 3441 gene locus_tag LOCUS_05850 2209 3441 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_05850 3527 4195 gene locus_tag LOCUS_05860 3527 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_05860 4274 6463 gene locus_tag LOCUS_05870 4274 6463 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_05870 6688 7983 gene locus_tag LOCUS_05880 6688 7983 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_05880 8648 8073 gene locus_tag LOCUS_05890 8648 8073 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_05890 9342 10523 gene locus_tag LOCUS_05900 gene trpB 9342 10523 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_05900 10527 11972 gene locus_tag LOCUS_05910 10527 11972 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_05910 12102 12749 gene locus_tag LOCUS_05920 12102 12749 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_05920 12891 13886 gene locus_tag LOCUS_05930 gene trpD 12891 13886 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_05930 13891 14718 gene locus_tag LOCUS_05940 gene trpC 13891 14718 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_05940 14830 15453 gene locus_tag LOCUS_05950 14830 15453 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_05950 15605 16381 gene locus_tag LOCUS_05960 gene trpA 15605 16381 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_05960 16498 17484 gene locus_tag LOCUS_05970 16498 17484 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_05970 18724 17564 gene locus_tag LOCUS_05980 18724 17564 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_05980 19600 18734 gene locus_tag LOCUS_05990 19600 18734 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_05990 20177 19614 gene locus_tag LOCUS_06000 20177 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 20389 20198 gene locus_tag LOCUS_06010 20389 20198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 21101 20928 gene locus_tag LOCUS_06020 21101 20928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 21479 21406 gene locus_tag LOCUS_t00090 21479 21406 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22325 22846 gene locus_tag LOCUS_06030 gene cobU 22325 22846 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_06030 22877 23914 gene locus_tag LOCUS_06040 gene cobT 22877 23914 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_06040 23916 24659 gene locus_tag LOCUS_06050 23916 24659 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_06050 24676 25215 gene locus_tag LOCUS_06060 gene cobC 24676 25215 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_06060 25458 25309 gene locus_tag LOCUS_06070 25458 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 25850 25632 gene locus_tag LOCUS_06080 25850 25632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 27034 26066 gene locus_tag LOCUS_06090 gene cbiB 27034 26066 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_06090 28072 27038 gene locus_tag LOCUS_06100 gene cobD 28072 27038 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_06100 29591 28065 gene locus_tag LOCUS_06110 29591 28065 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_06110 30068 29868 gene locus_tag LOCUS_06120 30068 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 30333 30040 gene locus_tag LOCUS_06130 30333 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30241 31191 gene locus_tag LOCUS_06140 30241 31191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 31204 32199 gene locus_tag LOCUS_06150 31204 32199 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777960.1 protein_id gnl|my_center|LOCUS_06150 32196 34586 gene locus_tag LOCUS_06160 32196 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 34827 36011 gene locus_tag LOCUS_06170 gene pncB 34827 36011 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_06170 36612 36043 gene locus_tag LOCUS_06180 36612 36043 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_06180 38211 36760 gene locus_tag LOCUS_06190 38211 36760 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202899.1 protein_id gnl|my_center|LOCUS_06190 38397 39827 gene locus_tag LOCUS_06200 38397 39827 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_06200 39853 40593 gene locus_tag LOCUS_06210 39853 40593 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_06210 42375 40690 gene locus_tag LOCUS_06220 42375 40690 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_06220 44035 42503 gene locus_tag LOCUS_06230 44035 42503 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_06230 44605 44090 gene locus_tag LOCUS_06240 44605 44090 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766266.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence016 480 1379 gene locus_tag LOCUS_06250 480 1379 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_06250 1391 1861 gene locus_tag LOCUS_06260 1391 1861 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_06260 1858 2517 gene locus_tag LOCUS_06270 1858 2517 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_06270 3355 2504 gene locus_tag LOCUS_06280 3355 2504 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_06280 4717 3563 gene locus_tag LOCUS_06290 4717 3563 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_06290 5380 4817 gene locus_tag LOCUS_06300 5380 4817 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784111.1 protein_id gnl|my_center|LOCUS_06300 6086 5883 gene locus_tag LOCUS_06310 6086 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6379 6149 gene locus_tag LOCUS_06320 6379 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6392 6844 gene locus_tag LOCUS_06330 6392 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7281 6961 gene locus_tag LOCUS_06340 7281 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9700 7289 gene locus_tag LOCUS_06350 9700 7289 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_06350 9875 10411 gene locus_tag LOCUS_06360 9875 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11180 10431 gene locus_tag LOCUS_06370 11180 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11798 11725 gene locus_tag LOCUS_t00100 11798 11725 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11889 11806 gene locus_tag LOCUS_t00110 11889 11806 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12457 11963 gene locus_tag LOCUS_06380 gene ribH 12457 11963 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 protein_id gnl|my_center|LOCUS_06380 13285 12602 gene locus_tag LOCUS_06390 13285 12602 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_06390 13523 14635 gene locus_tag LOCUS_06400 gene recF 13523 14635 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_06400 14632 14922 gene locus_tag LOCUS_06410 14632 14922 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_06410 15718 14927 gene locus_tag LOCUS_06420 15718 14927 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_06420 16248 15715 gene locus_tag LOCUS_06430 16248 15715 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_06430 17902 16163 gene locus_tag LOCUS_06440 17902 16163 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_06440 18410 17934 gene locus_tag LOCUS_06450 18410 17934 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_06450 18941 18423 gene locus_tag LOCUS_06460 18941 18423 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764457.1 protein_id gnl|my_center|LOCUS_06460 21040 18938 gene locus_tag LOCUS_06470 21040 18938 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_06470 22151 21141 gene locus_tag LOCUS_06480 gene gap 22151 21141 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_06480 22292 22732 gene locus_tag LOCUS_06490 gene mscL 22292 22732 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_06490 22922 23317 gene locus_tag LOCUS_06500 22922 23317 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791037.1 protein_id gnl|my_center|LOCUS_06500 23394 24947 gene locus_tag LOCUS_06510 gene guaA 23394 24947 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_06510 25112 25789 gene locus_tag LOCUS_06520 25112 25789 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_06520 26471 25809 gene locus_tag LOCUS_06530 26471 25809 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_06530 27283 26573 gene locus_tag LOCUS_06540 27283 26573 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_06540 27454 29394 gene locus_tag LOCUS_06550 27454 29394 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_06550 29409 30677 gene locus_tag LOCUS_06560 29409 30677 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_06560 30695 32110 gene locus_tag LOCUS_06570 30695 32110 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_06570 33777 32194 gene locus_tag LOCUS_06580 33777 32194 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_06580 34492 33806 gene locus_tag LOCUS_06590 34492 33806 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_06590 34872 35729 gene locus_tag LOCUS_06600 gene panC 34872 35729 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_06600 35762 36115 gene locus_tag LOCUS_06610 35762 36115 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_06610 36551 36180 gene locus_tag LOCUS_06620 36551 36180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 38958 36658 gene locus_tag LOCUS_06630 38958 36658 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_06630 40101 39220 gene locus_tag LOCUS_06640 40101 39220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 40493 40035 gene locus_tag LOCUS_06650 40493 40035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 41660 40617 gene locus_tag LOCUS_06660 41660 40617 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291639.1 protein_id gnl|my_center|LOCUS_06660 42092 41802 gene locus_tag LOCUS_06670 42092 41802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence017 2392 77 gene locus_tag LOCUS_06680 2392 77 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850355.1 protein_id gnl|my_center|LOCUS_06680 2661 3482 gene locus_tag LOCUS_06690 2661 3482 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761368.1 protein_id gnl|my_center|LOCUS_06690 3583 4194 gene locus_tag LOCUS_06700 3583 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4506 5876 gene locus_tag LOCUS_06710 4506 5876 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_06710 5866 7173 gene locus_tag LOCUS_06720 5866 7173 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_06720 7392 8720 gene locus_tag LOCUS_06730 7392 8720 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_06730 8836 10503 gene locus_tag LOCUS_06740 8836 10503 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794233.1 protein_id gnl|my_center|LOCUS_06740 12877 10724 gene locus_tag LOCUS_06750 12877 10724 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_06750 15400 12899 gene locus_tag LOCUS_06760 15400 12899 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_06760 17233 15428 gene locus_tag LOCUS_06770 17233 15428 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_06770 18743 17247 gene locus_tag LOCUS_06780 18743 17247 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108627.1 protein_id gnl|my_center|LOCUS_06780 20271 18766 gene locus_tag LOCUS_06790 20271 18766 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_06790 23204 20271 gene locus_tag LOCUS_06800 23204 20271 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_06800 25139 23523 gene locus_tag LOCUS_06810 25139 23523 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_06810 25387 26688 gene locus_tag LOCUS_06820 25387 26688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 26719 27186 gene locus_tag LOCUS_06830 26719 27186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107329.1 protein_id gnl|my_center|LOCUS_06830 28389 27253 gene locus_tag LOCUS_06840 28389 27253 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_06840 29033 28494 gene locus_tag LOCUS_06850 29033 28494 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107759.1 protein_id gnl|my_center|LOCUS_06850 32558 29292 gene locus_tag LOCUS_06860 gene carB 32558 29292 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_06860 33976 32768 gene locus_tag LOCUS_06870 gene carA 33976 32768 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107319.1 protein_id gnl|my_center|LOCUS_06870 35973 34090 gene locus_tag LOCUS_06880 35973 34090 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_06880 36572 36033 gene locus_tag LOCUS_06890 36572 36033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 36940 41490 gene locus_tag LOCUS_06900 gene gltB 36940 41490 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence018 6 2696 gene locus_tag LOCUS_06910 6 2696 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202000.1 protein_id gnl|my_center|LOCUS_06910 2716 4614 gene locus_tag LOCUS_06920 2716 4614 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_06920 5699 4692 gene locus_tag LOCUS_06930 5699 4692 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_06930 5854 7983 gene locus_tag LOCUS_06940 5854 7983 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_06940 7985 8695 gene locus_tag LOCUS_06950 7985 8695 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_06950 8760 9419 gene locus_tag LOCUS_06960 8760 9419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_06960 10632 9682 gene locus_tag LOCUS_06970 10632 9682 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_06970 12006 10639 gene locus_tag LOCUS_06980 12006 10639 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_06980 12110 12493 gene locus_tag LOCUS_06990 12110 12493 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202006.1 protein_id gnl|my_center|LOCUS_06990 13794 12496 gene locus_tag LOCUS_07000 13794 12496 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_07000 13968 14819 gene locus_tag LOCUS_07010 gene folP 13968 14819 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_07010 14838 15602 gene locus_tag LOCUS_07020 gene cdaA 14838 15602 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_07020 15725 17224 gene locus_tag LOCUS_07030 15725 17224 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_07030 17313 18632 gene locus_tag LOCUS_07040 17313 18632 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_07040 19651 18635 gene locus_tag LOCUS_07050 19651 18635 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202020.1 protein_id gnl|my_center|LOCUS_07050 20601 19687 gene locus_tag LOCUS_07060 20601 19687 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_07060 21349 20654 gene locus_tag LOCUS_07070 21349 20654 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784312.1 protein_id gnl|my_center|LOCUS_07070 21684 21346 gene locus_tag LOCUS_07080 21684 21346 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784314.1 protein_id gnl|my_center|LOCUS_07080 21999 23018 gene locus_tag LOCUS_07090 gene pta 21999 23018 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_07090 23040 24236 gene locus_tag LOCUS_07100 23040 24236 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_07100 24417 25817 gene locus_tag LOCUS_07110 24417 25817 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_07110 26135 25923 gene locus_tag LOCUS_07120 26135 25923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767859.1 protein_id gnl|my_center|LOCUS_07120 28091 26235 gene locus_tag LOCUS_07130 28091 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 28897 28133 gene locus_tag LOCUS_07140 28897 28133 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_07140 29233 28922 gene locus_tag LOCUS_07150 29233 28922 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_07150 30590 29904 gene locus_tag LOCUS_07160 gene radC 30590 29904 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_07160 31645 30656 gene locus_tag LOCUS_07170 31645 30656 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_07170 32355 31789 gene locus_tag LOCUS_07180 gene efp 32355 31789 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766998.1 protein_id gnl|my_center|LOCUS_07180 32461 32709 gene locus_tag LOCUS_07190 32461 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 33386 33970 gene locus_tag LOCUS_07200 33386 33970 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_07200 34024 35094 gene locus_tag LOCUS_07210 34024 35094 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_07210 35091 36071 gene locus_tag LOCUS_07220 35091 36071 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_07220 36077 37234 gene locus_tag LOCUS_07230 36077 37234 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence019 81 773 gene locus_tag LOCUS_07240 81 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07240 907 1557 gene locus_tag LOCUS_07250 907 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1661 1957 gene locus_tag LOCUS_07260 1661 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2316 1843 gene locus_tag LOCUS_07270 2316 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4322 2352 gene locus_tag LOCUS_07280 4322 2352 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_07280 5761 4550 gene locus_tag LOCUS_07290 5761 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6981 6658 gene locus_tag LOCUS_07300 6981 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8882 7215 gene locus_tag LOCUS_07310 8882 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_07310 10210 9437 gene locus_tag LOCUS_07320 10210 9437 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_07320 10550 10194 gene locus_tag LOCUS_07330 10550 10194 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784727.1 protein_id gnl|my_center|LOCUS_07330 10977 10612 gene locus_tag LOCUS_07340 10977 10612 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784729.1 protein_id gnl|my_center|LOCUS_07340 12631 10988 gene locus_tag LOCUS_07350 12631 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 12808 13041 gene locus_tag LOCUS_07360 12808 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_07360 13069 13509 gene locus_tag LOCUS_07370 13069 13509 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_07370 13826 13527 gene locus_tag LOCUS_07380 13826 13527 CDS product DUF4834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764000.1 protein_id gnl|my_center|LOCUS_07380 14601 13894 gene locus_tag LOCUS_07390 gene pssA 14601 13894 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_07390 15301 14615 gene locus_tag LOCUS_07400 15301 14615 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_07400 15572 19270 gene locus_tag LOCUS_07410 gene dnaE 15572 19270 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_07410 19437 19751 gene locus_tag LOCUS_07420 gene trxA 19437 19751 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_07420 19863 20195 gene locus_tag LOCUS_07430 19863 20195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759609.1 protein_id gnl|my_center|LOCUS_07430 20474 20256 gene locus_tag LOCUS_07440 20474 20256 CDS product immunity 17 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796270.1 protein_id gnl|my_center|LOCUS_07440 20937 20512 gene locus_tag LOCUS_07450 gene tsaE 20937 20512 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_07450 21767 20955 gene locus_tag LOCUS_07460 21767 20955 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_07460 22232 21804 gene locus_tag LOCUS_07470 22232 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784767.1 protein_id gnl|my_center|LOCUS_07470 23661 22357 gene locus_tag LOCUS_07480 gene aroA 23661 22357 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_07480 24674 24081 gene locus_tag LOCUS_07490 24674 24081 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_07490 25665 24658 gene locus_tag LOCUS_07500 25665 24658 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_07500 27267 25669 gene locus_tag LOCUS_07510 27267 25669 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_07510 30710 27438 gene locus_tag LOCUS_07520 30710 27438 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_07520 31565 30786 gene locus_tag LOCUS_07530 31565 30786 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_07530 31777 31703 gene locus_tag LOCUS_t00120 31777 31703 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32710 31961 gene locus_tag LOCUS_07540 32710 31961 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_07540 33121 33651 gene locus_tag LOCUS_07550 33121 33651 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790892.1 protein_id gnl|my_center|LOCUS_07550 33655 34038 gene locus_tag LOCUS_07560 33655 34038 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_07560 35075 34014 gene locus_tag LOCUS_07570 gene aroB 35075 34014 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_07570 35266 35688 gene locus_tag LOCUS_07580 35266 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784807.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence020 861 46 gene locus_tag LOCUS_07590 861 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2656 881 gene locus_tag LOCUS_07600 2656 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5892 2671 gene locus_tag LOCUS_07610 5892 2671 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_07610 7995 6298 gene locus_tag LOCUS_07620 7995 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 10048 8063 gene locus_tag LOCUS_07630 10048 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 11308 10070 gene locus_tag LOCUS_07640 11308 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13109 11388 gene locus_tag LOCUS_07650 13109 11388 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_07650 16396 13130 gene locus_tag LOCUS_07660 16396 13130 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_07660 17557 16631 gene locus_tag LOCUS_07670 17557 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 19007 17715 gene locus_tag LOCUS_07680 19007 17715 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_07680 20314 19082 gene locus_tag LOCUS_07690 20314 19082 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_07690 21331 20438 gene locus_tag LOCUS_07700 21331 20438 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_07700 24022 21659 gene locus_tag LOCUS_07710 24022 21659 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_07710 24297 26810 gene locus_tag LOCUS_07720 24297 26810 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_07720 26829 27833 gene locus_tag LOCUS_07730 26829 27833 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_07730 27885 29855 gene locus_tag LOCUS_07740 27885 29855 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_07740 30075 30713 gene locus_tag LOCUS_07750 30075 30713 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_07750 30922 31467 gene locus_tag LOCUS_07760 30922 31467 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784469.1 protein_id gnl|my_center|LOCUS_07760 34586 31629 gene locus_tag LOCUS_07770 34586 31629 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_07770 <36026 34686 gene locus_tag LOCUS_07780 <36026 34686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202059.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence021 34 1437 gene locus_tag LOCUS_07790 gene asnS 34 1437 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_07790 1555 2082 gene locus_tag LOCUS_07800 1555 2082 CDS product DUF4488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760799.1 protein_id gnl|my_center|LOCUS_07800 2365 2880 gene locus_tag LOCUS_07810 gene rplM 2365 2880 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_07810 2887 3273 gene locus_tag LOCUS_07820 gene rpsI 2887 3273 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_07820 3446 4282 gene locus_tag LOCUS_07830 gene rpsB 3446 4282 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_07830 4405 5397 gene locus_tag LOCUS_07840 gene tsf 4405 5397 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_07840 5857 5510 gene locus_tag LOCUS_07850 5857 5510 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_07850 6007 6663 gene locus_tag LOCUS_07860 6007 6663 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_07860 6663 7280 gene locus_tag LOCUS_07870 6663 7280 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_07870 7465 9084 gene locus_tag LOCUS_07880 7465 9084 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_07880 9396 12335 gene locus_tag LOCUS_07890 9396 12335 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_07890 12335 14053 gene locus_tag LOCUS_07900 12335 14053 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_07900 14070 15371 gene locus_tag LOCUS_07910 14070 15371 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_07910 15528 16007 gene locus_tag LOCUS_07920 gene ispF 15528 16007 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_07920 16118 17062 gene locus_tag LOCUS_07930 16118 17062 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764146.1 protein_id gnl|my_center|LOCUS_07930 17383 18438 gene locus_tag LOCUS_07940 17383 18438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_07940 19308 18448 gene locus_tag LOCUS_07950 19308 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791738.1 protein_id gnl|my_center|LOCUS_07950 19633 22113 gene locus_tag LOCUS_07960 19633 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108170.1 protein_id gnl|my_center|LOCUS_07960 22673 24514 gene locus_tag LOCUS_07970 22673 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 24624 26072 gene locus_tag LOCUS_07980 24624 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 26092 29262 gene locus_tag LOCUS_07990 26092 29262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_07990 29299 31365 gene locus_tag LOCUS_08000 29299 31365 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_08000 31457 32212 gene locus_tag LOCUS_08010 31457 32212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 32389 32787 gene locus_tag LOCUS_08020 32389 32787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 32739 34568 gene locus_tag LOCUS_08030 32739 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08030 >Feature sequence022 <1 1916 gene locus_tag LOCUS_08040 <1 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765565.1:glycoside hydrolase family 97 catalytic domain-containing protein 4004 1944 gene locus_tag LOCUS_08050 4004 1944 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_08050 4076 4570 gene locus_tag LOCUS_08060 4076 4570 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_08060 4979 5851 gene locus_tag LOCUS_08070 gene rfbA 4979 5851 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108090.1 protein_id gnl|my_center|LOCUS_08070 5949 7091 gene locus_tag LOCUS_08080 gene rfbB 5949 7091 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_08080 8049 7138 gene locus_tag LOCUS_08090 8049 7138 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_08090 8186 9187 gene locus_tag LOCUS_08100 8186 9187 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203412.1 protein_id gnl|my_center|LOCUS_08100 12162 9193 gene locus_tag LOCUS_08110 12162 9193 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_08110 12348 16220 gene locus_tag LOCUS_08120 12348 16220 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107956.1 protein_id gnl|my_center|LOCUS_08120 16351 17292 gene locus_tag LOCUS_08130 16351 17292 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930918.1 protein_id gnl|my_center|LOCUS_08130 17315 18046 gene locus_tag LOCUS_08140 gene nagB 17315 18046 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963511.1 protein_id gnl|my_center|LOCUS_08140 18100 19365 gene locus_tag LOCUS_08150 18100 19365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_08150 19381 21105 gene locus_tag LOCUS_08160 19381 21105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 21381 24470 gene locus_tag LOCUS_08170 21381 24470 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_08170 24495 26057 gene locus_tag LOCUS_08180 24495 26057 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08180 27531 26644 gene locus_tag LOCUS_08190 27531 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 29948 27483 gene locus_tag LOCUS_08200 29948 27483 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989326.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence023 4009 2546 gene locus_tag LOCUS_08210 4009 2546 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_08210 5276 4032 gene locus_tag LOCUS_08220 5276 4032 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797749.1 protein_id gnl|my_center|LOCUS_08220 9143 5526 gene locus_tag LOCUS_08230 9143 5526 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201938.1 protein_id gnl|my_center|LOCUS_08230 9571 11520 gene locus_tag LOCUS_08240 9571 11520 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657202.1 protein_id gnl|my_center|LOCUS_08240 12093 15749 gene locus_tag LOCUS_08250 12093 15749 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203327.1 protein_id gnl|my_center|LOCUS_08250 18572 15957 gene locus_tag LOCUS_08260 gene mutS 18572 15957 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_08260 19473 20798 gene locus_tag LOCUS_08270 19473 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 21242 21538 gene locus_tag LOCUS_08280 21242 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 23223 22366 gene locus_tag LOCUS_08290 23223 22366 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_08290 23458 23321 gene locus_tag LOCUS_08300 23458 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 25150 23525 gene locus_tag LOCUS_08310 25150 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 26178 25150 gene locus_tag LOCUS_08320 26178 25150 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_08320 27575 26181 gene locus_tag LOCUS_08330 27575 26181 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_08330 28365 28009 gene locus_tag LOCUS_08340 28365 28009 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_08340 28565 29830 gene locus_tag LOCUS_08350 28565 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 30398 30180 gene locus_tag LOCUS_08360 30398 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 <32178 30650 gene locus_tag LOCUS_08370 <32178 30650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203728.1:DUF2961 domain-containing protein >Feature sequence024 <1 1638 gene locus_tag LOCUS_08380 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792058.1:penicillin-binding protein 2 1723 3159 gene locus_tag LOCUS_08390 gene rodA 1723 3159 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_08390 3858 3373 gene locus_tag LOCUS_08400 gene gldH 3858 3373 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_08400 5203 3836 gene locus_tag LOCUS_08410 gene ricT 5203 3836 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_08410 6395 5268 gene locus_tag LOCUS_08420 6395 5268 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_08420 7421 6468 gene locus_tag LOCUS_08430 gene metF 7421 6468 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_08430 9366 7513 gene locus_tag LOCUS_08440 9366 7513 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203331.1 protein_id gnl|my_center|LOCUS_08440 9764 10681 gene locus_tag LOCUS_08450 gene metA 9764 10681 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_08450 10708 12573 gene locus_tag LOCUS_08460 10708 12573 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_08460 12608 13663 gene locus_tag LOCUS_08470 12608 13663 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_08470 16073 13665 gene locus_tag LOCUS_08480 16073 13665 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303106.1 protein_id gnl|my_center|LOCUS_08480 16948 16337 gene locus_tag LOCUS_08490 16948 16337 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_08490 18596 17016 gene locus_tag LOCUS_08500 18596 17016 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_08500 19969 18602 gene locus_tag LOCUS_08510 gene radA 19969 18602 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_08510 20090 20632 gene locus_tag LOCUS_08520 20090 20632 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763367.1 protein_id gnl|my_center|LOCUS_08520 21626 20643 gene locus_tag LOCUS_08530 21626 20643 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074859600.1 protein_id gnl|my_center|LOCUS_08530 22129 24561 gene locus_tag LOCUS_08540 gene thrA 22129 24561 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_08540 24582 25841 gene locus_tag LOCUS_08550 24582 25841 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202073.1 protein_id gnl|my_center|LOCUS_08550 25912 27213 gene locus_tag LOCUS_08560 gene thrC 25912 27213 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_08560 27921 27265 gene locus_tag LOCUS_08570 27921 27265 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202076.1 protein_id gnl|my_center|LOCUS_08570 28582 27950 gene locus_tag LOCUS_08580 gene pnuC 28582 27950 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_08580 30879 28582 gene locus_tag LOCUS_08590 30879 28582 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence025 1512 19 gene locus_tag LOCUS_08600 gene lepB 1512 19 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_08600 2283 1519 gene locus_tag LOCUS_08610 gene dapB 2283 1519 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_08610 2425 3657 gene locus_tag LOCUS_08620 2425 3657 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_08620 3735 4247 gene locus_tag LOCUS_08630 3735 4247 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783777.1 protein_id gnl|my_center|LOCUS_08630 4427 7513 gene locus_tag LOCUS_08640 4427 7513 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_08640 7553 8908 gene locus_tag LOCUS_08650 7553 8908 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_08650 9924 8974 gene locus_tag LOCUS_08660 9924 8974 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_08660 12904 10022 gene locus_tag LOCUS_08670 12904 10022 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108783.1 protein_id gnl|my_center|LOCUS_08670 14744 13125 gene locus_tag LOCUS_08680 14744 13125 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_08680 17951 14769 gene locus_tag LOCUS_08690 17951 14769 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_08690 19760 18216 gene locus_tag LOCUS_08700 19760 18216 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_08700 23921 19890 gene locus_tag LOCUS_08710 23921 19890 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_08710 24153 25235 gene locus_tag LOCUS_08720 24153 25235 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_08720 25226 25972 gene locus_tag LOCUS_08730 25226 25972 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_08730 26366 26941 gene locus_tag LOCUS_08740 26366 26941 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806119.1 protein_id gnl|my_center|LOCUS_08740 27724 29454 gene locus_tag LOCUS_08750 27724 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108178.1 protein_id gnl|my_center|LOCUS_08750 29501 29989 gene locus_tag LOCUS_08760 29501 29989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence026 2088 256 gene locus_tag LOCUS_08770 2088 256 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_08770 5244 2104 gene locus_tag LOCUS_08780 5244 2104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_08780 5836 7875 gene locus_tag LOCUS_08790 5836 7875 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_08790 7987 8562 gene locus_tag LOCUS_08800 7987 8562 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_08800 9964 8684 gene locus_tag LOCUS_08810 9964 8684 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_08810 11255 10101 gene locus_tag LOCUS_08820 11255 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11954 13030 gene locus_tag LOCUS_08830 gene aroC 11954 13030 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_08830 13040 14395 gene locus_tag LOCUS_08840 13040 14395 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_08840 14411 15490 gene locus_tag LOCUS_08850 14411 15490 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_08850 17786 15597 gene locus_tag LOCUS_08860 17786 15597 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_08860 20522 18375 gene locus_tag LOCUS_08870 gene scpA 20522 18375 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759796.1 protein_id gnl|my_center|LOCUS_08870 22422 20524 gene locus_tag LOCUS_08880 gene mutA 22422 20524 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_08880 22691 24352 gene locus_tag LOCUS_08890 22691 24352 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_08890 25088 24447 gene locus_tag LOCUS_08900 25088 24447 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_08900 26515 25160 gene locus_tag LOCUS_08910 26515 25160 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_08910 27054 28799 gene locus_tag LOCUS_08920 gene lysS 27054 28799 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence027 1072 1287 gene locus_tag LOCUS_08930 1072 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08930 1614 2204 gene locus_tag LOCUS_08940 1614 2204 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_08940 2366 2929 gene locus_tag LOCUS_08950 gene pth 2366 2929 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_08950 2926 3345 gene locus_tag LOCUS_08960 2926 3345 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_08960 3361 4347 gene locus_tag LOCUS_08970 3361 4347 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_08970 6639 4369 gene locus_tag LOCUS_08980 6639 4369 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_08980 7885 6734 gene locus_tag LOCUS_08990 gene hisB 7885 6734 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_08990 8939 7899 gene locus_tag LOCUS_09000 gene hisC 8939 7899 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_09000 10304 9030 gene locus_tag LOCUS_09010 gene hisD 10304 9030 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_09010 11357 10506 gene locus_tag LOCUS_09020 gene hisG 11357 10506 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_09020 12262 11705 gene locus_tag LOCUS_09030 12262 11705 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798782.1 protein_id gnl|my_center|LOCUS_09030 12356 12736 gene locus_tag LOCUS_09040 12356 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13386 12724 gene locus_tag LOCUS_09050 13386 12724 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766234.1 protein_id gnl|my_center|LOCUS_09050 14382 13705 gene locus_tag LOCUS_09060 14382 13705 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767382.1 protein_id gnl|my_center|LOCUS_09060 16477 14444 gene locus_tag LOCUS_09070 16477 14444 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_09070 16797 16489 gene locus_tag LOCUS_09080 16797 16489 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_09080 16900 17511 gene locus_tag LOCUS_09090 gene udk 16900 17511 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_09090 17653 18993 gene locus_tag LOCUS_09100 17653 18993 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_09100 21823 19058 gene locus_tag LOCUS_09110 gene metH 21823 19058 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_09110 22277 21825 gene locus_tag LOCUS_09120 gene smpB 22277 21825 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_09120 22858 22286 gene locus_tag LOCUS_09130 22858 22286 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_09130 23713 22862 gene locus_tag LOCUS_09140 23713 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 24364 23867 gene locus_tag LOCUS_09150 24364 23867 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_09150 24805 25506 gene locus_tag LOCUS_09160 24805 25506 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_09160 25525 26535 gene locus_tag LOCUS_09170 25525 26535 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760490.1 protein_id gnl|my_center|LOCUS_09170 26899 28098 gene locus_tag LOCUS_09180 26899 28098 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102408502.1 protein_id gnl|my_center|LOCUS_09180 28179 29021 gene locus_tag LOCUS_09190 28179 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203297.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence028 913 1413 gene locus_tag LOCUS_09200 913 1413 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815892.1 protein_id gnl|my_center|LOCUS_09200 2822 1686 gene locus_tag LOCUS_09210 2822 1686 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_09210 3949 2819 gene locus_tag LOCUS_09220 gene tgt 3949 2819 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_09220 6426 3946 gene locus_tag LOCUS_09230 gene lon 6426 3946 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_09230 6597 7304 gene locus_tag LOCUS_09240 6597 7304 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_09240 7391 7466 gene locus_tag LOCUS_t00130 7391 7466 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8486 7521 gene locus_tag LOCUS_09250 8486 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9856 8483 gene locus_tag LOCUS_09260 9856 8483 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_09260 10084 11601 gene locus_tag LOCUS_09270 10084 11601 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_09270 11666 12928 gene locus_tag LOCUS_09280 11666 12928 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_09280 13042 13716 gene locus_tag LOCUS_09290 13042 13716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_09290 13867 16209 gene locus_tag LOCUS_09300 13867 16209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107500.1 protein_id gnl|my_center|LOCUS_09300 16866 16180 gene locus_tag LOCUS_09310 16866 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_09310 17205 17017 gene locus_tag LOCUS_09320 17205 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18019 17213 gene locus_tag LOCUS_09330 18019 17213 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_09330 18995 18120 gene locus_tag LOCUS_09340 18995 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 19302 18910 gene locus_tag LOCUS_09350 19302 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 18931 18940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19510 20550 gene locus_tag LOCUS_09360 19510 20550 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_09360 20682 22439 gene locus_tag LOCUS_09370 gene aspS 20682 22439 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_09370 22461 22841 gene locus_tag LOCUS_09380 22461 22841 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761542.1 protein_id gnl|my_center|LOCUS_09380 23760 22873 gene locus_tag LOCUS_09390 23760 22873 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_09390 24915 23800 gene locus_tag LOCUS_09400 24915 23800 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_09400 25590 25054 gene locus_tag LOCUS_09410 25590 25054 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761545.1 protein_id gnl|my_center|LOCUS_09410 25684 26307 gene locus_tag LOCUS_09420 25684 26307 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761546.1 protein_id gnl|my_center|LOCUS_09420 26319 27128 gene locus_tag LOCUS_09430 26319 27128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761547.1 protein_id gnl|my_center|LOCUS_09430 27255 28349 gene locus_tag LOCUS_09440 27255 28349 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765714.1 protein_id gnl|my_center|LOCUS_09440 28355 29194 gene locus_tag LOCUS_09450 28355 29194 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence029 1 621 gene locus_tag LOCUS_09460 1 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 623 1324 gene locus_tag LOCUS_09470 623 1324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_09470 1592 1416 gene locus_tag LOCUS_09480 1592 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2230 1784 gene locus_tag LOCUS_09490 2230 1784 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_09490 2390 2734 gene locus_tag LOCUS_09500 gene rpsF 2390 2734 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_09500 2737 3009 gene locus_tag LOCUS_09510 gene rpsR 2737 3009 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_09510 3025 3471 gene locus_tag LOCUS_09520 gene rplI 3025 3471 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_09520 3982 3743 gene locus_tag LOCUS_09530 3982 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5786 4113 gene locus_tag LOCUS_09540 5786 4113 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_09540 5872 7188 gene locus_tag LOCUS_09550 gene mtaB 5872 7188 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203485.1 protein_id gnl|my_center|LOCUS_09550 7233 8132 gene locus_tag LOCUS_09560 7233 8132 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_09560 8125 9141 gene locus_tag LOCUS_09570 8125 9141 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_09570 9353 9871 gene locus_tag LOCUS_09580 9353 9871 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790931.1 protein_id gnl|my_center|LOCUS_09580 10760 10065 gene locus_tag LOCUS_09590 10760 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11442 10816 gene locus_tag LOCUS_09600 11442 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13288 11579 gene locus_tag LOCUS_09610 13288 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109286.1 protein_id gnl|my_center|LOCUS_09610 13939 13574 gene locus_tag LOCUS_09620 gene folB 13939 13574 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_09620 16846 14153 gene locus_tag LOCUS_09630 16846 14153 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_09630 19515 16978 gene locus_tag LOCUS_09640 19515 16978 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_09640 20047 20667 gene locus_tag LOCUS_09650 20047 20667 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203459.1 protein_id gnl|my_center|LOCUS_09650 22112 20709 gene locus_tag LOCUS_09660 gene dnaA 22112 20709 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_09660 23341 22448 gene locus_tag LOCUS_09670 23341 22448 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_09670 24542 23355 gene locus_tag LOCUS_09680 24542 23355 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_09680 24780 25736 gene locus_tag LOCUS_09690 24780 25736 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_09690 26177 25887 gene locus_tag LOCUS_09700 26177 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 27371 26400 gene locus_tag LOCUS_09710 27371 26400 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_09710 27816 28274 gene locus_tag LOCUS_09720 27816 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 28289 29485 gene locus_tag LOCUS_09730 28289 29485 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107385.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence030 1753 950 gene locus_tag LOCUS_09740 1753 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3480 2269 gene locus_tag LOCUS_09750 3480 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_09750 3612 4790 gene locus_tag LOCUS_09760 3612 4790 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_09760 4833 8390 gene locus_tag LOCUS_09770 gene nifJ 4833 8390 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_09770 8480 8668 gene locus_tag LOCUS_09780 8480 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107961.1 protein_id gnl|my_center|LOCUS_09780 11513 8787 gene locus_tag LOCUS_09790 11513 8787 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_09790 11912 12355 gene locus_tag LOCUS_09800 11912 12355 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071088.1 protein_id gnl|my_center|LOCUS_09800 13426 12539 gene locus_tag LOCUS_09810 13426 12539 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_09810 14832 13660 gene locus_tag LOCUS_09820 14832 13660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_09820 16715 14829 gene locus_tag LOCUS_09830 16715 14829 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_09830 19179 17044 gene locus_tag LOCUS_09840 19179 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21038 19254 gene locus_tag LOCUS_09850 21038 19254 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_09850 23988 21058 gene locus_tag LOCUS_09860 23988 21058 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_09860 25389 24544 gene locus_tag LOCUS_09870 25389 24544 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_09870 25482 26684 gene locus_tag LOCUS_09880 25482 26684 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_09880 26899 28530 gene locus_tag LOCUS_09890 26899 28530 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108027.1 protein_id gnl|my_center|LOCUS_09890 28696 29055 gene locus_tag LOCUS_09900 28696 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence031 999 1973 gene locus_tag LOCUS_09910 999 1973 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_09910 2962 2060 gene locus_tag LOCUS_09920 gene deoC 2962 2060 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_09920 3287 2949 gene locus_tag LOCUS_09930 3287 2949 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_09930 3739 3287 gene locus_tag LOCUS_09940 gene dtd 3739 3287 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_09940 5972 4143 gene locus_tag LOCUS_09950 gene uvrC 5972 4143 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783702.1 protein_id gnl|my_center|LOCUS_09950 6634 6110 gene locus_tag LOCUS_09960 6634 6110 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_09960 8565 6691 gene locus_tag LOCUS_09970 gene mnmG 8565 6691 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_09970 9203 10870 gene locus_tag LOCUS_09980 9203 10870 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_09980 11053 14910 gene locus_tag LOCUS_09990 11053 14910 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_09990 15213 18224 gene locus_tag LOCUS_10000 15213 18224 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_10000 18247 19824 gene locus_tag LOCUS_10010 18247 19824 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_10010 19963 22551 gene locus_tag LOCUS_10020 19963 22551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 22797 23765 gene locus_tag LOCUS_10030 22797 23765 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_10030 23769 24743 gene locus_tag LOCUS_10040 23769 24743 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765249.1 protein_id gnl|my_center|LOCUS_10040 24740 25774 gene locus_tag LOCUS_10050 24740 25774 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_10050 25877 27877 gene locus_tag LOCUS_10060 25877 27877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791934.1 protein_id gnl|my_center|LOCUS_10060 27907 29043 gene locus_tag LOCUS_10070 27907 29043 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108863.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence032 947 1810 gene locus_tag LOCUS_10080 947 1810 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_10080 3924 2107 gene locus_tag LOCUS_10090 3924 2107 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203553.1 protein_id gnl|my_center|LOCUS_10090 5008 4064 gene locus_tag LOCUS_10100 5008 4064 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_10100 5600 7417 gene locus_tag LOCUS_10110 5600 7417 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_10110 7531 11421 gene locus_tag LOCUS_10120 7531 11421 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_10120 11593 13236 gene locus_tag LOCUS_10130 11593 13236 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_10130 13233 14696 gene locus_tag LOCUS_10140 13233 14696 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_10140 14861 16129 gene locus_tag LOCUS_10150 14861 16129 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108221.1 protein_id gnl|my_center|LOCUS_10150 16126 17064 gene locus_tag LOCUS_10160 16126 17064 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_10160 17097 18362 gene locus_tag LOCUS_10170 17097 18362 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 protein_id gnl|my_center|LOCUS_10170 18429 21677 gene locus_tag LOCUS_10180 18429 21677 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108218.1 protein_id gnl|my_center|LOCUS_10180 21914 22336 gene locus_tag LOCUS_10190 21914 22336 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 protein_id gnl|my_center|LOCUS_10190 22466 23554 gene locus_tag LOCUS_10200 22466 23554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 23697 24359 gene locus_tag LOCUS_10210 23697 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 24540 24349 gene locus_tag LOCUS_10220 24540 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 24561 25826 gene locus_tag LOCUS_10230 24561 25826 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence033 376 1872 gene locus_tag LOCUS_10240 376 1872 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_10240 1992 3386 gene locus_tag LOCUS_10250 gene leuC 1992 3386 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_10250 3504 4109 gene locus_tag LOCUS_10260 gene leuD 3504 4109 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_10260 4106 4531 gene locus_tag LOCUS_10270 4106 4531 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_10270 4578 6113 gene locus_tag LOCUS_10280 4578 6113 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_10280 6117 6368 gene locus_tag LOCUS_10290 6117 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6373 7434 gene locus_tag LOCUS_10300 gene leuB 6373 7434 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_10300 7843 8793 gene locus_tag LOCUS_10310 gene cysK 7843 8793 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767706.1 protein_id gnl|my_center|LOCUS_10310 8850 9659 gene locus_tag LOCUS_10320 8850 9659 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_10320 11474 9663 gene locus_tag LOCUS_10330 gene recQ 11474 9663 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_10330 11757 12230 gene locus_tag LOCUS_10340 11757 12230 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789808.1 protein_id gnl|my_center|LOCUS_10340 12355 14382 gene locus_tag LOCUS_10350 12355 14382 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_10350 14389 15063 gene locus_tag LOCUS_10360 14389 15063 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_10360 15165 15680 gene locus_tag LOCUS_10370 15165 15680 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767710.1 protein_id gnl|my_center|LOCUS_10370 15677 16948 gene locus_tag LOCUS_10380 15677 16948 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_10380 17052 18356 gene locus_tag LOCUS_10390 17052 18356 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_10390 18498 19193 gene locus_tag LOCUS_10400 18498 19193 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_10400 19844 21052 gene locus_tag LOCUS_10410 19844 21052 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200755826.1 protein_id gnl|my_center|LOCUS_10410 21049 21420 gene locus_tag LOCUS_10420 21049 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 21690 22883 gene locus_tag LOCUS_10430 21690 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 23468 24838 gene locus_tag LOCUS_10440 gene mobV 23468 24838 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_10440 25480 24917 gene locus_tag LOCUS_10450 25480 24917 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_10450 25641 25967 gene locus_tag LOCUS_10460 25641 25967 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_10460 25981 27162 gene locus_tag LOCUS_10470 25981 27162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence034 <1 570 gene locus_tag LOCUS_10480 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801462.1:6-bladed beta-propeller 606 2813 gene locus_tag LOCUS_10490 606 2813 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_10490 2817 4127 gene locus_tag LOCUS_10500 2817 4127 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_10500 5155 4133 gene locus_tag LOCUS_10510 5155 4133 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_10510 5847 5233 gene locus_tag LOCUS_10520 5847 5233 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_10520 7653 5911 gene locus_tag LOCUS_10530 7653 5911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_10530 8479 7691 gene locus_tag LOCUS_10540 8479 7691 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_10540 8574 9467 gene locus_tag LOCUS_10550 gene menA 8574 9467 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_10550 9464 10078 gene locus_tag LOCUS_10560 9464 10078 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732447.1 protein_id gnl|my_center|LOCUS_10560 10287 11456 gene locus_tag LOCUS_10570 10287 11456 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109125.1 protein_id gnl|my_center|LOCUS_10570 11538 13205 gene locus_tag LOCUS_10580 11538 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 13417 15783 gene locus_tag LOCUS_10590 13417 15783 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_10590 17397 15844 gene locus_tag LOCUS_10600 17397 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 21386 17493 gene locus_tag LOCUS_10610 21386 17493 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143260301.1 protein_id gnl|my_center|LOCUS_10610 21672 24857 gene locus_tag LOCUS_10620 21672 24857 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10620 24934 26586 gene locus_tag LOCUS_10630 24934 26586 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence035 <1 1158 gene locus_tag LOCUS_10640 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798684.1:efflux transporter outer membrane subunit 1550 1245 gene locus_tag LOCUS_10650 1550 1245 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761179.1 protein_id gnl|my_center|LOCUS_10650 1859 3505 gene locus_tag LOCUS_10660 1859 3505 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_10660 3717 3547 gene locus_tag LOCUS_10670 3717 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3812 4438 gene locus_tag LOCUS_10680 3812 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4641 5903 gene locus_tag LOCUS_10690 4641 5903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202447.1 protein_id gnl|my_center|LOCUS_10690 5968 7194 gene locus_tag LOCUS_10700 5968 7194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202446.1 protein_id gnl|my_center|LOCUS_10700 8073 7228 gene locus_tag LOCUS_10710 gene prmA 8073 7228 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_10710 8355 9761 gene locus_tag LOCUS_10720 8355 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766149.1 protein_id gnl|my_center|LOCUS_10720 9816 11483 gene locus_tag LOCUS_10730 9816 11483 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_10730 12500 11595 gene locus_tag LOCUS_10740 12500 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107199.1 protein_id gnl|my_center|LOCUS_10740 12991 12521 gene locus_tag LOCUS_10750 12991 12521 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841026.1 protein_id gnl|my_center|LOCUS_10750 13466 13005 gene locus_tag LOCUS_10760 13466 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768304.1 protein_id gnl|my_center|LOCUS_10760 13987 13463 gene locus_tag LOCUS_10770 13987 13463 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_10770 14918 14361 gene locus_tag LOCUS_10780 14918 14361 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_10780 15379 14945 gene locus_tag LOCUS_10790 15379 14945 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_10790 15684 17609 gene locus_tag LOCUS_10800 15684 17609 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10800 18667 17837 gene locus_tag LOCUS_10810 18667 17837 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107201.1 protein_id gnl|my_center|LOCUS_10810 20832 18679 gene locus_tag LOCUS_10820 20832 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 21687 21142 gene locus_tag LOCUS_10830 21687 21142 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_10830 22471 21710 gene locus_tag LOCUS_10840 22471 21710 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_10840 22657 22484 gene locus_tag LOCUS_10850 22657 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776430.1 protein_id gnl|my_center|LOCUS_10850 23739 22654 gene locus_tag LOCUS_10860 23739 22654 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_10860 23986 23759 gene locus_tag LOCUS_10870 23986 23759 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_10870 24278 24003 gene locus_tag LOCUS_10880 24278 24003 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_10880 24457 26184 gene locus_tag LOCUS_10890 24457 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence036 <1 1958 gene locus_tag LOCUS_10900 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I 2237 2629 gene locus_tag LOCUS_10910 2237 2629 CDS product DUF3836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783692.1 protein_id gnl|my_center|LOCUS_10910 4317 2761 gene locus_tag LOCUS_10920 4317 2761 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_10920 5399 4731 gene locus_tag LOCUS_10930 5399 4731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795152.1 protein_id gnl|my_center|LOCUS_10930 7822 5417 gene locus_tag LOCUS_10940 7822 5417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_10940 9087 7822 gene locus_tag LOCUS_10950 9087 7822 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_10950 10430 9183 gene locus_tag LOCUS_10960 10430 9183 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694823.1 protein_id gnl|my_center|LOCUS_10960 10992 12326 gene locus_tag LOCUS_10970 10992 12326 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_10970 12333 13400 gene locus_tag LOCUS_10980 12333 13400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 13532 14635 gene locus_tag LOCUS_10990 gene ychF 13532 14635 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_10990 14651 15571 gene locus_tag LOCUS_11000 14651 15571 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_11000 15659 16561 gene locus_tag LOCUS_11010 gene lgt 15659 16561 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_11010 19394 16767 gene locus_tag LOCUS_11020 19394 16767 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_11020 21521 19410 gene locus_tag LOCUS_11030 21521 19410 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_11030 22917 21784 gene locus_tag LOCUS_11040 22917 21784 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108035.1 protein_id gnl|my_center|LOCUS_11040 24011 22932 gene locus_tag LOCUS_11050 24011 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 25820 24114 gene locus_tag LOCUS_11060 25820 24114 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_11060 24777 24786 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <26681 25836 gene locus_tag LOCUS_11070 <26681 25836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791110.1:TonB-dependent receptor >Feature sequence037 94 3306 gene locus_tag LOCUS_11080 94 3306 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_11080 3326 4960 gene locus_tag LOCUS_11090 3326 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4992 5768 gene locus_tag LOCUS_11100 4992 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5956 7212 gene locus_tag LOCUS_11110 gene hflX 5956 7212 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_11110 7321 9312 gene locus_tag LOCUS_11120 7321 9312 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_11120 9446 11086 gene locus_tag LOCUS_11130 9446 11086 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_11130 13067 11427 gene locus_tag LOCUS_11140 13067 11427 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_11140 14441 13116 gene locus_tag LOCUS_11150 14441 13116 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_11150 17416 14438 gene locus_tag LOCUS_11160 17416 14438 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_11160 18659 17577 gene locus_tag LOCUS_11170 18659 17577 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_11170 19675 18782 gene locus_tag LOCUS_11180 gene rsgA 19675 18782 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_11180 20381 19821 gene locus_tag LOCUS_11190 gene frr 20381 19821 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_11190 21214 20504 gene locus_tag LOCUS_11200 gene pyrH 21214 20504 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_11200 22723 21782 gene locus_tag LOCUS_11210 22723 21782 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_11210 25334 22812 gene locus_tag LOCUS_11220 25334 22812 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_11220 26060 25467 gene locus_tag LOCUS_11230 26060 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 26304 26107 gene locus_tag LOCUS_11240 26304 26107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence038 1120 2490 gene locus_tag LOCUS_11250 1120 2490 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_11250 2555 3145 gene locus_tag LOCUS_11260 2555 3145 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_11260 3236 3898 gene locus_tag LOCUS_11270 3236 3898 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 protein_id gnl|my_center|LOCUS_11270 4953 3889 gene locus_tag LOCUS_11280 gene mnmA 4953 3889 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 protein_id gnl|my_center|LOCUS_11280 6262 4976 gene locus_tag LOCUS_11290 6262 4976 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786117.1 protein_id gnl|my_center|LOCUS_11290 6486 7868 gene locus_tag LOCUS_11300 6486 7868 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_11300 7930 8787 gene locus_tag LOCUS_11310 7930 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 9608 8796 gene locus_tag LOCUS_11320 9608 8796 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_11320 9703 10995 gene locus_tag LOCUS_11330 9703 10995 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202405.1 protein_id gnl|my_center|LOCUS_11330 11052 11519 gene locus_tag LOCUS_11340 11052 11519 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107139.1 protein_id gnl|my_center|LOCUS_11340 11680 12114 gene locus_tag LOCUS_11350 11680 12114 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797803.1 protein_id gnl|my_center|LOCUS_11350 12641 12811 gene locus_tag LOCUS_11360 12641 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 12948 13394 gene locus_tag LOCUS_11370 12948 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 13524 13733 gene locus_tag LOCUS_11380 13524 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 13730 13960 gene locus_tag LOCUS_11390 13730 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 14031 14177 gene locus_tag LOCUS_11400 14031 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 14191 15048 gene locus_tag LOCUS_11410 14191 15048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107575.1 protein_id gnl|my_center|LOCUS_11410 15091 15780 gene locus_tag LOCUS_11420 15091 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107379.1 protein_id gnl|my_center|LOCUS_11420 15813 16124 gene locus_tag LOCUS_11430 gene clpS 15813 16124 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_11430 16140 18380 gene locus_tag LOCUS_11440 gene clpA 16140 18380 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 protein_id gnl|my_center|LOCUS_11440 18385 19035 gene locus_tag LOCUS_11450 gene aat 18385 19035 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_11450 19108 20736 gene locus_tag LOCUS_11460 19108 20736 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_11460 20775 21245 gene locus_tag LOCUS_11470 20775 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 21258 21647 gene locus_tag LOCUS_11480 21258 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 22494 21652 gene locus_tag LOCUS_11490 gene nfo 22494 21652 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_11490 22816 22499 gene locus_tag LOCUS_11500 22816 22499 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802790.1 protein_id gnl|my_center|LOCUS_11500 23138 22875 gene locus_tag LOCUS_11510 23138 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 23355 23813 gene locus_tag LOCUS_11520 23355 23813 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948662.1 protein_id gnl|my_center|LOCUS_11520 23850 24128 gene locus_tag LOCUS_11530 23850 24128 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_11530 24089 24487 gene locus_tag LOCUS_11540 24089 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 24642 24433 gene locus_tag LOCUS_11550 24642 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760151.1 protein_id gnl|my_center|LOCUS_11550 25106 24642 gene locus_tag LOCUS_11560 25106 24642 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence039 55 1224 gene locus_tag LOCUS_11570 55 1224 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_11570 5166 1807 gene locus_tag LOCUS_11580 5166 1807 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_11580 6054 5980 gene locus_tag LOCUS_t00140 6054 5980 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6311 6697 gene locus_tag LOCUS_11590 6311 6697 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763744.1 protein_id gnl|my_center|LOCUS_11590 6822 8675 gene locus_tag LOCUS_11600 6822 8675 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_11600 8690 9904 gene locus_tag LOCUS_11610 8690 9904 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_11610 9986 11179 gene locus_tag LOCUS_11620 9986 11179 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_11620 11686 11516 gene locus_tag LOCUS_11630 11686 11516 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_11630 14328 12514 gene locus_tag LOCUS_11640 14328 12514 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_11640 14470 14778 gene locus_tag LOCUS_11650 14470 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14775 15119 gene locus_tag LOCUS_11660 14775 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_11660 16544 15213 gene locus_tag LOCUS_11670 16544 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 18083 16572 gene locus_tag LOCUS_11680 18083 16572 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_11680 19641 18115 gene locus_tag LOCUS_11690 19641 18115 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_11690 22575 19660 gene locus_tag LOCUS_11700 22575 19660 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_11700 23051 24730 gene locus_tag LOCUS_11710 23051 24730 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence040 2630 1299 gene locus_tag LOCUS_11720 2630 1299 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_11720 4675 2822 gene locus_tag LOCUS_11730 gene yidC 4675 2822 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_11730 6326 4707 gene locus_tag LOCUS_11740 6326 4707 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_11740 6656 8038 gene locus_tag LOCUS_11750 6656 8038 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_11750 8288 8297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8745 9710 gene locus_tag LOCUS_11760 8745 9710 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_11760 9771 11108 gene locus_tag LOCUS_11770 gene rsxC 9771 11108 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_11770 11115 12107 gene locus_tag LOCUS_11780 11115 12107 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_11780 12104 12769 gene locus_tag LOCUS_11790 12104 12769 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_11790 12786 13370 gene locus_tag LOCUS_11800 12786 13370 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_11800 13439 14017 gene locus_tag LOCUS_11810 gene rsxA 13439 14017 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_11810 14152 15186 gene locus_tag LOCUS_11820 gene galE 14152 15186 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_11820 15857 17377 gene locus_tag LOCUS_11830 gene atpD 15857 17377 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_11830 17499 17744 gene locus_tag LOCUS_11840 gene atpC 17499 17744 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_11840 17853 18035 gene locus_tag LOCUS_11850 17853 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 18016 19089 gene locus_tag LOCUS_11860 gene atpB 18016 19089 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_11860 19164 19421 gene locus_tag LOCUS_11870 gene atpE 19164 19421 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_11870 19510 20016 gene locus_tag LOCUS_11880 gene atpF 19510 20016 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_11880 20028 20588 gene locus_tag LOCUS_11890 20028 20588 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761392.1 protein_id gnl|my_center|LOCUS_11890 20712 22310 gene locus_tag LOCUS_11900 gene atpA 20712 22310 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_11900 22326 23216 gene locus_tag LOCUS_11910 22326 23216 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_11910 24165 23266 gene locus_tag LOCUS_11920 24165 23266 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_11920 24813 24250 gene locus_tag LOCUS_11930 24813 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787524.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence041 719 1258 gene locus_tag LOCUS_11940 719 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1275 1796 gene locus_tag LOCUS_11950 1275 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3107 2061 gene locus_tag LOCUS_11960 3107 2061 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_11960 3931 3134 gene locus_tag LOCUS_11970 3931 3134 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_11970 4165 3959 gene locus_tag LOCUS_11980 4165 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4537 4977 gene locus_tag LOCUS_11990 4537 4977 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_11990 7795 5123 gene locus_tag LOCUS_12000 7795 5123 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_12000 8179 7847 gene locus_tag LOCUS_12010 8179 7847 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661089.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12010 9550 9176 gene locus_tag LOCUS_12020 9550 9176 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_12020 10735 9629 gene locus_tag LOCUS_12030 gene dinB 10735 9629 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_12030 11189 12919 gene locus_tag LOCUS_12040 11189 12919 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840776.1 protein_id gnl|my_center|LOCUS_12040 12925 13359 gene locus_tag LOCUS_12050 12925 13359 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_12050 13808 13476 gene locus_tag LOCUS_12060 13808 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 14408 14971 gene locus_tag LOCUS_12070 14408 14971 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_12070 15051 16055 gene locus_tag LOCUS_12080 15051 16055 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_12080 16295 19618 gene locus_tag LOCUS_12090 16295 19618 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107893.1 protein_id gnl|my_center|LOCUS_12090 19710 21485 gene locus_tag LOCUS_12100 19710 21485 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107894.1 protein_id gnl|my_center|LOCUS_12100 21829 23145 gene locus_tag LOCUS_12110 21829 23145 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107895.1 protein_id gnl|my_center|LOCUS_12110 23158 24648 gene locus_tag LOCUS_12120 23158 24648 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence042 836 1099 gene locus_tag LOCUS_12130 836 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1585 2049 gene locus_tag LOCUS_12140 1585 2049 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_12140 2113 2778 gene locus_tag LOCUS_12150 2113 2778 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_12150 2797 3774 gene locus_tag LOCUS_12160 2797 3774 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_12160 5633 3867 gene locus_tag LOCUS_12170 5633 3867 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_12170 7280 5955 gene locus_tag LOCUS_12180 7280 5955 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_12180 7449 8702 gene locus_tag LOCUS_12190 7449 8702 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_12190 9044 8670 gene locus_tag LOCUS_12200 9044 8670 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_12200 10968 9265 gene locus_tag LOCUS_12210 10968 9265 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_12210 11712 10972 gene locus_tag LOCUS_12220 gene rlmB 11712 10972 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_12220 12094 11717 gene locus_tag LOCUS_12230 12094 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 13909 12239 gene locus_tag LOCUS_12240 gene recN 13909 12239 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_12240 15172 13943 gene locus_tag LOCUS_12250 gene coaBC 15172 13943 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_12250 15943 15173 gene locus_tag LOCUS_12260 15943 15173 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_12260 17207 16083 gene locus_tag LOCUS_12270 gene dnaN 17207 16083 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_12270 17373 17741 gene locus_tag LOCUS_12280 17373 17741 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_12280 19532 17898 gene locus_tag LOCUS_12290 19532 17898 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203086.1 protein_id gnl|my_center|LOCUS_12290 20228 19605 gene locus_tag LOCUS_12300 20228 19605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_12300 21404 20385 gene locus_tag LOCUS_12310 gene murB 21404 20385 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_12310 22164 21385 gene locus_tag LOCUS_12320 22164 21385 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_12320 23210 22254 gene locus_tag LOCUS_12330 23210 22254 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence043 356 550 gene locus_tag LOCUS_12340 356 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 588 1217 gene locus_tag LOCUS_12350 588 1217 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_12350 1363 2457 gene locus_tag LOCUS_12360 gene trpS 1363 2457 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_12360 4479 2566 gene locus_tag LOCUS_12370 gene mutL 4479 2566 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_12370 4844 4554 gene locus_tag LOCUS_12380 4844 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791850.1 protein_id gnl|my_center|LOCUS_12380 6570 4849 gene locus_tag LOCUS_12390 6570 4849 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_12390 7964 6597 gene locus_tag LOCUS_12400 7964 6597 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_12400 8739 7975 gene locus_tag LOCUS_12410 8739 7975 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_12410 10443 8881 gene locus_tag LOCUS_12420 10443 8881 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203579.1 protein_id gnl|my_center|LOCUS_12420 12008 10533 gene locus_tag LOCUS_12430 gene guaB 12008 10533 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_12430 14294 12111 gene locus_tag LOCUS_12440 gene recQ 14294 12111 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_12440 15632 14469 gene locus_tag LOCUS_12450 gene clpX 15632 14469 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_12450 16378 15716 gene locus_tag LOCUS_12460 gene clpP 16378 15716 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_12460 17865 16510 gene locus_tag LOCUS_12470 gene tig 17865 16510 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_12470 18257 18505 gene locus_tag LOCUS_12480 18257 18505 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297160.1 protein_id gnl|my_center|LOCUS_12480 19431 18586 gene locus_tag LOCUS_12490 gene lptB 19431 18586 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_12490 19509 20252 gene locus_tag LOCUS_12500 19509 20252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_12500 20249 21019 gene locus_tag LOCUS_12510 20249 21019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_12510 21250 23481 gene locus_tag LOCUS_12520 21250 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202476.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence044 183 398 gene locus_tag LOCUS_12530 183 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 601 786 gene locus_tag LOCUS_12540 601 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1002 1811 gene locus_tag LOCUS_12550 1002 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1822 4455 gene locus_tag LOCUS_12560 1822 4455 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_12560 5364 4597 gene locus_tag LOCUS_12570 gene lpxA 5364 4597 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_12570 6849 5464 gene locus_tag LOCUS_12580 6849 5464 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_12580 10285 6869 gene locus_tag LOCUS_12590 10285 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11564 10389 gene locus_tag LOCUS_12600 11564 10389 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_12600 11845 13821 gene locus_tag LOCUS_12610 11845 13821 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_12610 13847 14650 gene locus_tag LOCUS_12620 13847 14650 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_12620 15038 14595 gene locus_tag LOCUS_12630 15038 14595 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_12630 15204 16403 gene locus_tag LOCUS_12640 15204 16403 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_12640 16400 17944 gene locus_tag LOCUS_12650 16400 17944 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_12650 19768 18296 gene locus_tag LOCUS_12660 gene cysS 19768 18296 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_12660 19855 20946 gene locus_tag LOCUS_12670 gene mnmA 19855 20946 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813829.1 protein_id gnl|my_center|LOCUS_12670 22480 20969 gene locus_tag LOCUS_12680 22480 20969 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_12680 22603 23613 gene locus_tag LOCUS_12690 22603 23613 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence045 <1 2125 gene locus_tag LOCUS_12700 <1 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767023.1:hybrid sensor histidine kinase/response regulator transcription factor 2360 5650 gene locus_tag LOCUS_12710 2360 5650 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761957.1 protein_id gnl|my_center|LOCUS_12710 5713 7770 gene locus_tag LOCUS_12720 5713 7770 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761956.1 protein_id gnl|my_center|LOCUS_12720 7871 8506 gene locus_tag LOCUS_12730 7871 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 8545 8958 gene locus_tag LOCUS_12740 8545 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 10583 9186 gene locus_tag LOCUS_12750 10583 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12750 11216 10632 gene locus_tag LOCUS_12760 11216 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12760 11899 11279 gene locus_tag LOCUS_12770 11899 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 13093 12062 gene locus_tag LOCUS_12780 13093 12062 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_12780 13306 14208 gene locus_tag LOCUS_12790 13306 14208 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_12790 14222 14557 gene locus_tag LOCUS_12800 14222 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 14696 16312 gene locus_tag LOCUS_12810 14696 16312 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764376.1 protein_id gnl|my_center|LOCUS_12810 19950 16630 gene locus_tag LOCUS_12820 19950 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 20263 22419 gene locus_tag LOCUS_12830 20263 22419 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence046 <1 3183 gene locus_tag LOCUS_12840 <1 3183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202065.1:TonB-dependent receptor 3203 4708 gene locus_tag LOCUS_12850 3203 4708 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_12850 5056 6921 gene locus_tag LOCUS_12860 5056 6921 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392453.1 protein_id gnl|my_center|LOCUS_12860 6960 8084 gene locus_tag LOCUS_12870 6960 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8239 9474 gene locus_tag LOCUS_12880 8239 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9493 10233 gene locus_tag LOCUS_12890 9493 10233 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_12890 10340 12532 gene locus_tag LOCUS_12900 gene bglX 10340 12532 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108030.1 protein_id gnl|my_center|LOCUS_12900 12708 12956 gene locus_tag LOCUS_12910 12708 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12968 14521 gene locus_tag LOCUS_12920 12968 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 15190 14675 gene locus_tag LOCUS_12930 15190 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 15731 15988 gene locus_tag LOCUS_12940 15731 15988 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_12940 16019 16315 gene locus_tag LOCUS_12950 16019 16315 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766979.1 protein_id gnl|my_center|LOCUS_12950 16680 17612 gene locus_tag LOCUS_12960 16680 17612 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731124.1 protein_id gnl|my_center|LOCUS_12960 17857 18153 gene locus_tag LOCUS_12970 17857 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766981.1 protein_id gnl|my_center|LOCUS_12970 18207 18413 gene locus_tag LOCUS_12980 18207 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107961.1 protein_id gnl|my_center|LOCUS_12980 19761 18538 gene locus_tag LOCUS_12990 19761 18538 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_12990 21030 19888 gene locus_tag LOCUS_13000 21030 19888 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_13000 21517 22599 gene locus_tag LOCUS_13010 21517 22599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22733 22957 gene locus_tag LOCUS_13020 22733 22957 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797079.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence047 <1 1149 gene locus_tag LOCUS_13030 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791295.1:glucoamylase family protein 1206 2057 gene locus_tag LOCUS_13040 1206 2057 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_13040 2279 3853 gene locus_tag LOCUS_13050 2279 3853 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762102.1 protein_id gnl|my_center|LOCUS_13050 3912 5636 gene locus_tag LOCUS_13060 3912 5636 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_13060 5780 6415 gene locus_tag LOCUS_13070 5780 6415 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_13070 6412 6597 gene locus_tag LOCUS_13080 6412 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 7516 6602 gene locus_tag LOCUS_13090 gene glsB 7516 6602 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805043.1 protein_id gnl|my_center|LOCUS_13090 9392 7527 gene locus_tag LOCUS_13100 9392 7527 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_13100 9972 9463 gene locus_tag LOCUS_13110 gene purE 9972 9463 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_13110 10380 9994 gene locus_tag LOCUS_13120 gene gcvH 10380 9994 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_13120 11087 10425 gene locus_tag LOCUS_13130 11087 10425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_13130 12652 11162 gene locus_tag LOCUS_13140 gene rpoN 12652 11162 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_13140 12831 14204 gene locus_tag LOCUS_13150 12831 14204 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108334.1 protein_id gnl|my_center|LOCUS_13150 14253 15446 gene locus_tag LOCUS_13160 14253 15446 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_13160 18888 15565 gene locus_tag LOCUS_13170 18888 15565 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_13170 20975 19215 gene locus_tag LOCUS_13180 20975 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 21201 20980 gene locus_tag LOCUS_13190 21201 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence048 243 440 gene locus_tag LOCUS_13200 243 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1552 3783 gene locus_tag LOCUS_13210 gene bioA 1552 3783 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107782.1 protein_id gnl|my_center|LOCUS_13210 3793 4965 gene locus_tag LOCUS_13220 3793 4965 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_13220 4994 5782 gene locus_tag LOCUS_13230 4994 5782 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107784.1 protein_id gnl|my_center|LOCUS_13230 5797 6615 gene locus_tag LOCUS_13240 5797 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6615 7262 gene locus_tag LOCUS_13250 gene bioD 6615 7262 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_13250 7292 8464 gene locus_tag LOCUS_13260 7292 8464 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107806.1 protein_id gnl|my_center|LOCUS_13260 9714 8470 gene locus_tag LOCUS_13270 9714 8470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_13270 10989 9814 gene locus_tag LOCUS_13280 10989 9814 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_13280 11065 11247 gene locus_tag LOCUS_13290 11065 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11271 12506 gene locus_tag LOCUS_13300 11271 12506 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_13300 13838 12591 gene locus_tag LOCUS_13310 13838 12591 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_13310 15109 13877 gene locus_tag LOCUS_13320 15109 13877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202449.1 protein_id gnl|my_center|LOCUS_13320 15782 15135 gene locus_tag LOCUS_13330 15782 15135 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786293.1 protein_id gnl|my_center|LOCUS_13330 17191 15929 gene locus_tag LOCUS_13340 17191 15929 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_13340 18479 17205 gene locus_tag LOCUS_13350 18479 17205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764773.1 protein_id gnl|my_center|LOCUS_13350 19196 18531 gene locus_tag LOCUS_13360 19196 18531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_13360 19802 19356 gene locus_tag LOCUS_13370 19802 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 21046 19799 gene locus_tag LOCUS_13380 21046 19799 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107845.1 protein_id gnl|my_center|LOCUS_13380 21222 21058 gene locus_tag LOCUS_13390 21222 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 22311 21388 gene locus_tag LOCUS_13400 22311 21388 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_13400 22415 22897 gene locus_tag LOCUS_13410 22415 22897 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence049 1125 667 gene locus_tag LOCUS_13420 1125 667 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_13420 1959 1135 gene locus_tag LOCUS_13430 gene pyrF 1959 1135 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_13430 3167 2055 gene locus_tag LOCUS_13440 gene prfA 3167 2055 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_13440 3435 3232 gene locus_tag LOCUS_13450 3435 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4607 3438 gene locus_tag LOCUS_13460 4607 3438 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_13460 5992 4694 gene locus_tag LOCUS_13470 5992 4694 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_13470 6957 5989 gene locus_tag LOCUS_13480 6957 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108824.1 protein_id gnl|my_center|LOCUS_13480 7715 7134 gene locus_tag LOCUS_13490 7715 7134 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_13490 8755 7856 gene locus_tag LOCUS_13500 8755 7856 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_13500 9791 8796 gene locus_tag LOCUS_13510 9791 8796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_13510 10537 9791 gene locus_tag LOCUS_13520 10537 9791 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_13520 11359 10622 gene locus_tag LOCUS_13530 gene ubiE 11359 10622 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_13530 12374 11430 gene locus_tag LOCUS_13540 12374 11430 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_13540 13402 12401 gene locus_tag LOCUS_13550 13402 12401 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_13550 14134 13412 gene locus_tag LOCUS_13560 14134 13412 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760060.1 protein_id gnl|my_center|LOCUS_13560 14809 14144 gene locus_tag LOCUS_13570 14809 14144 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_13570 15636 14809 gene locus_tag LOCUS_13580 gene pgeF 15636 14809 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_13580 16814 15633 gene locus_tag LOCUS_13590 gene obgE 16814 15633 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_13590 17401 16829 gene locus_tag LOCUS_13600 17401 16829 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_13600 17980 17444 gene locus_tag LOCUS_13610 gene hpt 17980 17444 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_13610 19560 18022 gene locus_tag LOCUS_13620 19560 18022 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_13620 19907 21418 gene locus_tag LOCUS_13630 19907 21418 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_13630 22043 21447 gene locus_tag LOCUS_13640 22043 21447 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785158.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence050 <1 708 gene locus_tag LOCUS_13650 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791704.1:TolC family protein 801 1790 gene locus_tag LOCUS_13660 801 1790 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_13660 1815 2996 gene locus_tag LOCUS_13670 1815 2996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_13670 2996 4234 gene locus_tag LOCUS_13680 2996 4234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_13680 6146 4599 gene locus_tag LOCUS_13690 6146 4599 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_13690 10104 6244 gene locus_tag LOCUS_13700 10104 6244 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_13700 12355 10295 gene locus_tag LOCUS_13710 12355 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 13475 12654 gene locus_tag LOCUS_13720 13475 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 15411 13546 gene locus_tag LOCUS_13730 15411 13546 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_13730 18561 15412 gene locus_tag LOCUS_13740 18561 15412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_13740 20070 18889 gene locus_tag LOCUS_13750 20070 18889 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201912.1 protein_id gnl|my_center|LOCUS_13750 20644 20132 gene locus_tag LOCUS_13760 20644 20132 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_13760 21230 21559 gene locus_tag LOCUS_13770 21230 21559 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791717.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence051 71 1108 gene locus_tag LOCUS_13780 71 1108 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_13780 1115 4159 gene locus_tag LOCUS_13790 1115 4159 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_13790 4607 4768 gene locus_tag LOCUS_13800 4607 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4787 5098 gene locus_tag LOCUS_13810 4787 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5291 5548 gene locus_tag LOCUS_13820 5291 5548 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798575.1 protein_id gnl|my_center|LOCUS_13820 5587 7422 gene locus_tag LOCUS_13830 5587 7422 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_13830 7422 8657 gene locus_tag LOCUS_13840 7422 8657 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_13840 10018 8744 gene locus_tag LOCUS_13850 10018 8744 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813712.1 protein_id gnl|my_center|LOCUS_13850 13082 10053 gene locus_tag LOCUS_13860 13082 10053 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798910.1 protein_id gnl|my_center|LOCUS_13860 14184 13132 gene locus_tag LOCUS_13870 14184 13132 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789585.1 protein_id gnl|my_center|LOCUS_13870 16673 14358 gene locus_tag LOCUS_13880 16673 14358 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292939.1 protein_id gnl|my_center|LOCUS_13880 18372 16999 gene locus_tag LOCUS_13890 18372 16999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_13890 19396 18464 gene locus_tag LOCUS_13900 19396 18464 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_13900 19612 20787 gene locus_tag LOCUS_13910 19612 20787 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence052 611 237 gene locus_tag LOCUS_13920 611 237 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_13920 1433 708 gene locus_tag LOCUS_13930 1433 708 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761172.1 protein_id gnl|my_center|LOCUS_13930 1627 2484 gene locus_tag LOCUS_13940 1627 2484 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108046.1 protein_id gnl|my_center|LOCUS_13940 3812 2799 gene locus_tag LOCUS_13950 3812 2799 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797797.1 protein_id gnl|my_center|LOCUS_13950 3953 5233 gene locus_tag LOCUS_13960 3953 5233 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_13960 7797 5338 gene locus_tag LOCUS_13970 7797 5338 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598584.1 protein_id gnl|my_center|LOCUS_13970 8018 10306 gene locus_tag LOCUS_13980 8018 10306 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_13980 10713 12050 gene locus_tag LOCUS_13990 10713 12050 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_13990 13271 12144 gene locus_tag LOCUS_14000 13271 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 13828 13980 gene locus_tag LOCUS_14010 13828 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 14754 14224 gene locus_tag LOCUS_14020 14754 14224 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_14020 14959 14738 gene locus_tag LOCUS_14030 14959 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780694.1 protein_id gnl|my_center|LOCUS_14030 16389 14956 gene locus_tag LOCUS_14040 16389 14956 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_14040 16583 18046 gene locus_tag LOCUS_14050 16583 18046 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_14050 19597 18146 gene locus_tag LOCUS_14060 19597 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_14060 21232 19652 gene locus_tag LOCUS_14070 21232 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence053 791 261 gene locus_tag LOCUS_14080 791 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2312 978 gene locus_tag LOCUS_14090 2312 978 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_14090 3464 2409 gene locus_tag LOCUS_14100 3464 2409 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_14100 3805 4830 gene locus_tag LOCUS_14110 3805 4830 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_14110 5102 5770 gene locus_tag LOCUS_14120 5102 5770 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_14120 7467 6574 gene locus_tag LOCUS_14130 7467 6574 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203645.1 protein_id gnl|my_center|LOCUS_14130 7694 7476 gene locus_tag LOCUS_14140 7694 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 8013 9506 gene locus_tag LOCUS_14150 gene proS 8013 9506 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_14150 10433 9924 gene locus_tag LOCUS_14160 10433 9924 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802390.1 protein_id gnl|my_center|LOCUS_14160 10710 10970 gene locus_tag LOCUS_14170 10710 10970 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_14170 13232 11100 gene locus_tag LOCUS_14180 13232 11100 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203399.1 protein_id gnl|my_center|LOCUS_14180 13678 13355 gene locus_tag LOCUS_14190 13678 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13991 14200 gene locus_tag LOCUS_14200 13991 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14454 15050 gene locus_tag LOCUS_14210 14454 15050 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790534.1 protein_id gnl|my_center|LOCUS_14210 16183 16040 gene locus_tag LOCUS_14220 16183 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16506 16688 gene locus_tag LOCUS_14230 16506 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 16858 16685 gene locus_tag LOCUS_14240 16858 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 17529 18014 gene locus_tag LOCUS_14250 17529 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18011 19159 gene locus_tag LOCUS_14260 18011 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 19204 20517 gene locus_tag LOCUS_14270 19204 20517 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107720.1 protein_id gnl|my_center|LOCUS_14270 20492 21442 gene locus_tag LOCUS_14280 20492 21442 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence054 180 1364 gene locus_tag LOCUS_14290 180 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1505 3052 gene locus_tag LOCUS_14300 1505 3052 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107907.1 protein_id gnl|my_center|LOCUS_14300 3643 3311 gene locus_tag LOCUS_14310 3643 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4660 4193 gene locus_tag LOCUS_14320 4660 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4681 5202 gene locus_tag LOCUS_14330 4681 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5383 5982 gene locus_tag LOCUS_14340 5383 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 6338 7945 gene locus_tag LOCUS_14350 6338 7945 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_14350 8059 9591 gene locus_tag LOCUS_14360 8059 9591 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 9567 9713 gene locus_tag LOCUS_14370 9567 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9781 9990 gene locus_tag LOCUS_14380 9781 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10292 10834 gene locus_tag LOCUS_14390 10292 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11344 11553 gene locus_tag LOCUS_14400 11344 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 11867 11792 gene locus_tag LOCUS_t00150 11867 11792 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13078 11963 gene locus_tag LOCUS_14410 13078 11963 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_14410 13708 13103 gene locus_tag LOCUS_14420 13708 13103 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_14420 13819 14403 gene locus_tag LOCUS_14430 13819 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461645.1 protein_id gnl|my_center|LOCUS_14430 14417 15091 gene locus_tag LOCUS_14440 gene rsmI 14417 15091 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_14440 15165 16004 gene locus_tag LOCUS_14450 15165 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_14450 16091 16789 gene locus_tag LOCUS_14460 16091 16789 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_14460 16944 17507 gene locus_tag LOCUS_14470 16944 17507 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763832.1 protein_id gnl|my_center|LOCUS_14470 18933 17566 gene locus_tag LOCUS_14480 18933 17566 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_14480 21899 19101 gene locus_tag LOCUS_14490 21899 19101 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202099.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence055 729 2120 gene locus_tag LOCUS_14500 729 2120 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_14500 2280 3875 gene locus_tag LOCUS_14510 2280 3875 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_14510 4089 8069 gene locus_tag LOCUS_14520 4089 8069 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_14520 8197 9603 gene locus_tag LOCUS_14530 8197 9603 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797085.1 protein_id gnl|my_center|LOCUS_14530 9688 10770 gene locus_tag LOCUS_14540 9688 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10778 12904 gene locus_tag LOCUS_14550 10778 12904 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_14550 13508 15349 gene locus_tag LOCUS_14560 gene ilvD 13508 15349 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761033.1 protein_id gnl|my_center|LOCUS_14560 15531 17192 gene locus_tag LOCUS_14570 gene ilvB 15531 17192 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_14570 17186 17785 gene locus_tag LOCUS_14580 gene ilvN 17186 17785 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 protein_id gnl|my_center|LOCUS_14580 17782 18534 gene locus_tag LOCUS_14590 17782 18534 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_14590 18585 19628 gene locus_tag LOCUS_14600 gene ilvC 18585 19628 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_14600 21610 19697 gene locus_tag LOCUS_14610 21610 19697 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence056 85 1308 gene locus_tag LOCUS_14620 85 1308 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_14620 2377 1622 gene locus_tag LOCUS_14630 2377 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3619 2432 gene locus_tag LOCUS_14640 3619 2432 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_14640 5039 3645 gene locus_tag LOCUS_14650 5039 3645 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_14650 6229 5054 gene locus_tag LOCUS_14660 6229 5054 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_14660 7374 6253 gene locus_tag LOCUS_14670 7374 6253 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_14670 8968 7499 gene locus_tag LOCUS_14680 8968 7499 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_14680 10736 8970 gene locus_tag LOCUS_14690 10736 8970 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_14690 12262 10787 gene locus_tag LOCUS_14700 12262 10787 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_14700 13717 12266 gene locus_tag LOCUS_14710 13717 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 14303 13689 gene locus_tag LOCUS_14720 14303 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 15436 14315 gene locus_tag LOCUS_14730 15436 14315 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_14730 15573 17126 gene locus_tag LOCUS_14740 15573 17126 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_14740 18634 17306 gene locus_tag LOCUS_14750 18634 17306 CDS product DUF3874 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109169.1 protein_id gnl|my_center|LOCUS_14750 18969 19634 gene locus_tag LOCUS_14760 18969 19634 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759907.1 protein_id gnl|my_center|LOCUS_14760 20850 19885 gene locus_tag LOCUS_14770 20850 19885 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_14770 21856 21167 gene locus_tag LOCUS_14780 21856 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence057 190 1308 gene locus_tag LOCUS_14790 190 1308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_14790 1354 2679 gene locus_tag LOCUS_14800 1354 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_14800 2685 3311 gene locus_tag LOCUS_14810 gene lptC 2685 3311 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_14810 3316 4572 gene locus_tag LOCUS_14820 3316 4572 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_14820 4695 6833 gene locus_tag LOCUS_14830 4695 6833 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_14830 6975 8027 gene locus_tag LOCUS_14840 gene rlmN 6975 8027 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_14840 8177 9154 gene locus_tag LOCUS_14850 8177 9154 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_14850 9160 10257 gene locus_tag LOCUS_14860 gene pdxA 9160 10257 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_14860 10259 11509 gene locus_tag LOCUS_14870 10259 11509 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_14870 11496 12020 gene locus_tag LOCUS_14880 11496 12020 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_14880 12025 12798 gene locus_tag LOCUS_14890 12025 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_14890 12803 13192 gene locus_tag LOCUS_14900 gene secG 12803 13192 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_14900 13348 14739 gene locus_tag LOCUS_14910 13348 14739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_14910 14759 15112 gene locus_tag LOCUS_14920 14759 15112 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785477.1 protein_id gnl|my_center|LOCUS_14920 16151 15120 gene locus_tag LOCUS_14930 16151 15120 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_14930 17346 16240 gene locus_tag LOCUS_14940 17346 16240 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_14940 20209 17381 gene locus_tag LOCUS_14950 20209 17381 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence058 1767 193 gene locus_tag LOCUS_14960 1767 193 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_14960 2626 1859 gene locus_tag LOCUS_14970 2626 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4238 2718 gene locus_tag LOCUS_14980 4238 2718 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_14980 7206 4258 gene locus_tag LOCUS_14990 7206 4258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_14990 9997 7697 gene locus_tag LOCUS_15000 gene bglX 9997 7697 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_15000 12894 10156 gene locus_tag LOCUS_15010 12894 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_15010 14569 13109 gene locus_tag LOCUS_15020 14569 13109 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_15020 16405 14741 gene locus_tag LOCUS_15030 16405 14741 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_15030 17438 16455 gene locus_tag LOCUS_15040 17438 16455 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_15040 17520 17594 gene locus_tag LOCUS_t00160 17520 17594 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 17616 17690 gene locus_tag LOCUS_t00170 17616 17690 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 17691 17790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18057 18596 gene locus_tag LOCUS_15050 18057 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 19182 18598 gene locus_tag LOCUS_15060 19182 18598 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_15060 20153 19356 gene locus_tag LOCUS_15070 20153 19356 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_15070 20630 20163 gene locus_tag LOCUS_15080 20630 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 21358 20741 gene locus_tag LOCUS_15090 21358 20741 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108180.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence059 411 881 gene locus_tag LOCUS_15100 411 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 948 1442 gene locus_tag LOCUS_15110 948 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1560 1844 gene locus_tag LOCUS_15120 1560 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2270 1875 gene locus_tag LOCUS_15130 2270 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4392 2386 gene locus_tag LOCUS_15140 gene mobC 4392 2386 CDS product conjugal transfer protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107111.1 protein_id gnl|my_center|LOCUS_15140 5897 4650 gene locus_tag LOCUS_15150 gene mobB 5897 4650 CDS product conjugal transfer protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107110.1 protein_id gnl|my_center|LOCUS_15150 6322 5894 gene locus_tag LOCUS_15160 gene mobA 6322 5894 CDS product conjugal transfer protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202719.1 protein_id gnl|my_center|LOCUS_15160 7079 7837 gene locus_tag LOCUS_15170 7079 7837 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107109.1 protein_id gnl|my_center|LOCUS_15170 7818 8222 gene locus_tag LOCUS_15180 7818 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8242 8829 gene locus_tag LOCUS_15190 8242 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8848 9147 gene locus_tag LOCUS_15200 8848 9147 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040014.1 protein_id gnl|my_center|LOCUS_15200 9159 9482 gene locus_tag LOCUS_15210 9159 9482 CDS product DUF4133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008648476.1 protein_id gnl|my_center|LOCUS_15210 9479 11980 gene locus_tag LOCUS_15220 9479 11980 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_15220 12196 12558 gene locus_tag LOCUS_15230 12196 12558 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107103.1 protein_id gnl|my_center|LOCUS_15230 12563 13192 gene locus_tag LOCUS_15240 12563 13192 CDS product DUF4141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308758.1 protein_id gnl|my_center|LOCUS_15240 13241 14245 gene locus_tag LOCUS_15250 gene traJ 13241 14245 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_15250 14379 14918 gene locus_tag LOCUS_15260 gene traK 14379 14918 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_15260 14924 15208 gene locus_tag LOCUS_15270 14924 15208 CDS product TraL conjugative transposon family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107099.1 protein_id gnl|my_center|LOCUS_15270 15147 16349 gene locus_tag LOCUS_15280 15147 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 16370 17725 gene locus_tag LOCUS_15290 gene traM 16370 17725 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107098.1 protein_id gnl|my_center|LOCUS_15290 18009 18947 gene locus_tag LOCUS_15300 gene traN 18009 18947 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107097.1 protein_id gnl|my_center|LOCUS_15300 19035 19532 gene locus_tag LOCUS_15310 19035 19532 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992388.1 protein_id gnl|my_center|LOCUS_15310 19565 20005 gene locus_tag LOCUS_15320 19565 20005 CDS product DUF3872 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107096.1 protein_id gnl|my_center|LOCUS_15320 19992 20648 gene locus_tag LOCUS_15330 19992 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 20693 21520 gene locus_tag LOCUS_15340 20693 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence060 95 778 gene locus_tag LOCUS_15350 95 778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_15350 824 997 gene locus_tag LOCUS_15360 824 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1025 3349 gene locus_tag LOCUS_15370 1025 3349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768704.1 protein_id gnl|my_center|LOCUS_15370 3421 4146 gene locus_tag LOCUS_15380 3421 4146 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_15380 4193 5011 gene locus_tag LOCUS_15390 gene panB 4193 5011 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_15390 5040 5969 gene locus_tag LOCUS_15400 5040 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6316 5945 gene locus_tag LOCUS_15410 6316 5945 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_15410 8556 6337 gene locus_tag LOCUS_15420 8556 6337 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_15420 8663 10180 gene locus_tag LOCUS_15430 8663 10180 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_15430 10313 11479 gene locus_tag LOCUS_15440 gene purT 10313 11479 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_15440 12475 11642 gene locus_tag LOCUS_15450 gene ispE 12475 11642 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_15450 12799 14250 gene locus_tag LOCUS_15460 gene dnaB 12799 14250 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_15460 18930 14410 gene locus_tag LOCUS_15470 18930 14410 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_15470 19078 20100 gene locus_tag LOCUS_15480 gene tsaD 19078 20100 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_15480 20122 20589 gene locus_tag LOCUS_15490 20122 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20747 20971 gene locus_tag LOCUS_15500 gene rpmB 20747 20971 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765736.1 protein_id gnl|my_center|LOCUS_15500 20992 21180 gene locus_tag LOCUS_15510 gene rpmG 20992 21180 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_15510 21195 21353 gene locus_tag LOCUS_15520 21195 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence061 2592 334 gene locus_tag LOCUS_15530 2592 334 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_15530 3985 2669 gene locus_tag LOCUS_15540 3985 2669 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_15540 4849 4013 gene locus_tag LOCUS_15550 4849 4013 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784846.1 protein_id gnl|my_center|LOCUS_15550 5734 4850 gene locus_tag LOCUS_15560 5734 4850 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_15560 6620 5865 gene locus_tag LOCUS_15570 6620 5865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_15570 7432 6974 gene locus_tag LOCUS_15580 7432 6974 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790892.1 protein_id gnl|my_center|LOCUS_15580 7823 8350 gene locus_tag LOCUS_15590 7823 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8347 9024 gene locus_tag LOCUS_15600 8347 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766128.1 protein_id gnl|my_center|LOCUS_15600 9523 9050 gene locus_tag LOCUS_15610 9523 9050 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_15610 11005 9569 gene locus_tag LOCUS_15620 11005 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 11163 11927 gene locus_tag LOCUS_15630 gene surE 11163 11927 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_15630 11952 13094 gene locus_tag LOCUS_15640 gene lpxB 11952 13094 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_15640 13244 13948 gene locus_tag LOCUS_15650 13244 13948 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992150.1 protein_id gnl|my_center|LOCUS_15650 14905 14063 gene locus_tag LOCUS_15660 14905 14063 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_15660 16907 14895 gene locus_tag LOCUS_15670 gene ftsH 16907 14895 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_15670 17276 16917 gene locus_tag LOCUS_15680 gene rsfS 17276 16917 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_15680 17493 17567 gene locus_tag LOCUS_t00180 17493 17567 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18392 18033 gene locus_tag LOCUS_15690 18392 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 19173 18466 gene locus_tag LOCUS_15700 19173 18466 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_15700 20361 19180 gene locus_tag LOCUS_15710 20361 19180 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_15710 <21151 20383 gene locus_tag LOCUS_15720 <21151 20383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906177.1:aldo/keto reductase >Feature sequence062 2244 3176 gene locus_tag LOCUS_15730 gene pyrB 2244 3176 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_15730 3219 3683 gene locus_tag LOCUS_15740 gene pyrI 3219 3683 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_15740 3680 4246 gene locus_tag LOCUS_15750 3680 4246 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_15750 4271 5041 gene locus_tag LOCUS_15760 4271 5041 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787542.1 protein_id gnl|my_center|LOCUS_15760 5144 6424 gene locus_tag LOCUS_15770 5144 6424 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_15770 8192 6522 gene locus_tag LOCUS_15780 8192 6522 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_15780 9385 8264 gene locus_tag LOCUS_15790 9385 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11745 9574 gene locus_tag LOCUS_15800 11745 9574 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202778.1 protein_id gnl|my_center|LOCUS_15800 11929 13464 gene locus_tag LOCUS_15810 11929 13464 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_15810 13538 14257 gene locus_tag LOCUS_15820 13538 14257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_15820 14408 15007 gene locus_tag LOCUS_15830 14408 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787524.1 protein_id gnl|my_center|LOCUS_15830 15033 15833 gene locus_tag LOCUS_15840 15033 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 17674 15938 gene locus_tag LOCUS_15850 17674 15938 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_15850 20741 17697 gene locus_tag LOCUS_15860 20741 17697 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence063 550 876 gene locus_tag LOCUS_15870 550 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 909 1397 gene locus_tag LOCUS_15880 909 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2078 1449 gene locus_tag LOCUS_15890 2078 1449 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648594.1 protein_id gnl|my_center|LOCUS_15890 3253 2342 gene locus_tag LOCUS_15900 3253 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3434 3222 gene locus_tag LOCUS_15910 3434 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5334 3733 gene locus_tag LOCUS_15920 5334 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5672 5598 gene locus_tag LOCUS_t00190 5672 5598 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5776 6081 gene locus_tag LOCUS_15930 5776 6081 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767861.1 protein_id gnl|my_center|LOCUS_15930 6078 6656 gene locus_tag LOCUS_15940 gene ruvC 6078 6656 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_15940 6681 8678 gene locus_tag LOCUS_15950 gene pulA 6681 8678 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_15950 8686 10158 gene locus_tag LOCUS_15960 8686 10158 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_15960 10177 11469 gene locus_tag LOCUS_15970 10177 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 11647 12864 gene locus_tag LOCUS_15980 11647 12864 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202987.1 protein_id gnl|my_center|LOCUS_15980 12963 13397 gene locus_tag LOCUS_15990 12963 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 13581 15401 gene locus_tag LOCUS_16000 13581 15401 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_16000 15434 16114 gene locus_tag LOCUS_16010 15434 16114 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_16010 18576 16111 gene locus_tag LOCUS_16020 18576 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 19730 18867 gene locus_tag LOCUS_16030 19730 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence064 194 277 gene locus_tag LOCUS_t00200 194 277 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 294 366 gene locus_tag LOCUS_t00210 294 366 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 416 1600 gene locus_tag LOCUS_16040 gene tuf 416 1600 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_16040 1657 1730 gene locus_tag LOCUS_t00220 1657 1730 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1744 1932 gene locus_tag LOCUS_16050 gene secE 1744 1932 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_16050 1945 2487 gene locus_tag LOCUS_16060 gene nusG 1945 2487 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_16060 2547 2990 gene locus_tag LOCUS_16070 gene rplK 2547 2990 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_16070 3006 3704 gene locus_tag LOCUS_16080 gene rplA 3006 3704 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_16080 3720 4241 gene locus_tag LOCUS_16090 gene rplJ 3720 4241 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_16090 4303 4680 gene locus_tag LOCUS_16100 gene rplL 4303 4680 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_16100 4786 8598 gene locus_tag LOCUS_16110 gene rpoB 4786 8598 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_16110 8707 13002 gene locus_tag LOCUS_16120 gene rpoC 8707 13002 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108455.1 protein_id gnl|my_center|LOCUS_16120 13343 13654 gene locus_tag LOCUS_16130 13343 13654 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_16130 13770 14168 gene locus_tag LOCUS_16140 gene rpsL 13770 14168 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_16140 14269 14799 gene locus_tag LOCUS_16150 gene rpsG 14269 14799 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762032.1 protein_id gnl|my_center|LOCUS_16150 14851 16968 gene locus_tag LOCUS_16160 gene fusA 14851 16968 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_16160 17057 17362 gene locus_tag LOCUS_16170 gene rpsJ 17057 17362 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_16170 17384 18001 gene locus_tag LOCUS_16180 gene rplC 17384 18001 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762034.1 protein_id gnl|my_center|LOCUS_16180 18001 18627 gene locus_tag LOCUS_16190 gene rplD 18001 18627 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_16190 18644 18937 gene locus_tag LOCUS_16200 gene rplW 18644 18937 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_16200 18943 19767 gene locus_tag LOCUS_16210 gene rplB 18943 19767 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_16210 19788 20057 gene locus_tag LOCUS_16220 gene rpsS 19788 20057 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence065 38 640 gene locus_tag LOCUS_16230 38 640 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_16230 653 1192 gene locus_tag LOCUS_16240 653 1192 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_16240 2592 1273 gene locus_tag LOCUS_16250 2592 1273 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_16250 3219 4421 gene locus_tag LOCUS_16260 3219 4421 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_16260 4524 5696 gene locus_tag LOCUS_16270 4524 5696 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_16270 5693 7027 gene locus_tag LOCUS_16280 5693 7027 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_16280 7375 8904 gene locus_tag LOCUS_16290 7375 8904 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_16290 9097 9957 gene locus_tag LOCUS_16300 9097 9957 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16300 10148 10546 gene locus_tag LOCUS_16310 10148 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798505.1 protein_id gnl|my_center|LOCUS_16310 10558 12309 gene locus_tag LOCUS_16320 10558 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12488 14965 gene locus_tag LOCUS_16330 12488 14965 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_16330 14977 15333 gene locus_tag LOCUS_16340 14977 15333 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_16340 15593 18502 gene locus_tag LOCUS_16350 15593 18502 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_16350 18982 18509 gene locus_tag LOCUS_16360 gene rlmH 18982 18509 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_16360 19128 19469 gene locus_tag LOCUS_16370 19128 19469 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence066 187 2166 gene locus_tag LOCUS_16380 187 2166 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_16380 2279 3238 gene locus_tag LOCUS_16390 2279 3238 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203527.1 protein_id gnl|my_center|LOCUS_16390 3299 4009 gene locus_tag LOCUS_16400 3299 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4304 5152 gene locus_tag LOCUS_16410 4304 5152 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_16410 5127 6308 gene locus_tag LOCUS_16420 5127 6308 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_16420 6524 7591 gene locus_tag LOCUS_16430 6524 7591 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_16430 7657 8400 gene locus_tag LOCUS_16440 7657 8400 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_16440 8528 9490 gene locus_tag LOCUS_16450 8528 9490 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_16450 10035 10625 gene locus_tag LOCUS_16460 10035 10625 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_16460 10641 12092 gene locus_tag LOCUS_16470 10641 12092 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103878196.1 protein_id gnl|my_center|LOCUS_16470 12190 14097 gene locus_tag LOCUS_16480 12190 14097 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108434.1 protein_id gnl|my_center|LOCUS_16480 14155 15129 gene locus_tag LOCUS_16490 14155 15129 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 protein_id gnl|my_center|LOCUS_16490 15207 16550 gene locus_tag LOCUS_16500 15207 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 16656 19850 gene locus_tag LOCUS_16510 16656 19850 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108431.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence067 125 328 gene locus_tag LOCUS_16520 125 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3522 739 gene locus_tag LOCUS_16530 gene uvrA 3522 739 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_16530 3772 5253 gene locus_tag LOCUS_16540 3772 5253 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_16540 6111 5563 gene locus_tag LOCUS_16550 6111 5563 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_16550 6663 6121 gene locus_tag LOCUS_16560 6663 6121 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_16560 10725 7021 gene locus_tag LOCUS_16570 gene purL 10725 7021 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_16570 11195 11848 gene locus_tag LOCUS_16580 11195 11848 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_16580 11911 12456 gene locus_tag LOCUS_16590 11911 12456 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_16590 12531 13385 gene locus_tag LOCUS_16600 gene rfbD 12531 13385 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_16600 13407 14981 gene locus_tag LOCUS_16610 13407 14981 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_16610 15156 15401 gene locus_tag LOCUS_16620 15156 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 15379 16185 gene locus_tag LOCUS_16630 15379 16185 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765764.1 protein_id gnl|my_center|LOCUS_16630 16200 16709 gene locus_tag LOCUS_16640 16200 16709 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_16640 16733 17638 gene locus_tag LOCUS_16650 16733 17638 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_16650 17760 18743 gene locus_tag LOCUS_16660 17760 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence068 3129 3470 gene locus_tag LOCUS_16670 3129 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4198 3737 gene locus_tag LOCUS_16680 4198 3737 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_16680 6685 4220 gene locus_tag LOCUS_16690 gene priA 6685 4220 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_16690 9929 6873 gene locus_tag LOCUS_16700 9929 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762274.1 protein_id gnl|my_center|LOCUS_16700 11363 10416 gene locus_tag LOCUS_16710 11363 10416 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765148.1 protein_id gnl|my_center|LOCUS_16710 11745 14834 gene locus_tag LOCUS_16720 11745 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 14950 15258 gene locus_tag LOCUS_16730 14950 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 15590 16717 gene locus_tag LOCUS_16740 15590 16717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_16740 16848 17129 gene locus_tag LOCUS_16750 16848 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16750 17152 17310 gene locus_tag LOCUS_16760 17152 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 17568 17804 gene locus_tag LOCUS_16770 17568 17804 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_16770 17801 18112 gene locus_tag LOCUS_16780 17801 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 19284 18181 gene locus_tag LOCUS_16790 19284 18181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence069 719 123 gene locus_tag LOCUS_16800 719 123 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_16800 1375 716 gene locus_tag LOCUS_16810 gene lipB 1375 716 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_16810 1613 4459 gene locus_tag LOCUS_16820 1613 4459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107990.1 protein_id gnl|my_center|LOCUS_16820 4552 5385 gene locus_tag LOCUS_16830 4552 5385 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_16830 5687 5397 gene locus_tag LOCUS_16840 5687 5397 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787238.1 protein_id gnl|my_center|LOCUS_16840 7953 5737 gene locus_tag LOCUS_16850 7953 5737 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_16850 8169 7987 gene locus_tag LOCUS_16860 8169 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8320 9111 gene locus_tag LOCUS_16870 8320 9111 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_16870 9148 9768 gene locus_tag LOCUS_16880 gene rsmG 9148 9768 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_16880 9884 10495 gene locus_tag LOCUS_16890 9884 10495 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_16890 10526 13375 gene locus_tag LOCUS_16900 gene gcvP 10526 13375 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202698.1 protein_id gnl|my_center|LOCUS_16900 14025 13462 gene locus_tag LOCUS_16910 14025 13462 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_16910 15217 14093 gene locus_tag LOCUS_16920 15217 14093 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794495.1 protein_id gnl|my_center|LOCUS_16920 15840 15244 gene locus_tag LOCUS_16930 15840 15244 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_16930 15929 17122 gene locus_tag LOCUS_16940 15929 17122 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_16940 18461 17112 gene locus_tag LOCUS_16950 18461 17112 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_16950 18742 18557 gene locus_tag LOCUS_16960 18742 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence070 530 2695 gene locus_tag LOCUS_16970 530 2695 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_16970 2849 5446 gene locus_tag LOCUS_16980 2849 5446 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_16980 5645 6601 gene locus_tag LOCUS_16990 5645 6601 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_16990 6614 7972 gene locus_tag LOCUS_17000 6614 7972 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785063.1 protein_id gnl|my_center|LOCUS_17000 8039 8248 gene locus_tag LOCUS_17010 8039 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8562 9944 gene locus_tag LOCUS_17020 8562 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_17020 9974 11125 gene locus_tag LOCUS_17030 9974 11125 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680409.1 protein_id gnl|my_center|LOCUS_17030 11376 12668 gene locus_tag LOCUS_17040 11376 12668 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_17040 12698 13909 gene locus_tag LOCUS_17050 12698 13909 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_17050 13910 14650 gene locus_tag LOCUS_17060 13910 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680413.1 protein_id gnl|my_center|LOCUS_17060 14716 15870 gene locus_tag LOCUS_17070 14716 15870 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_17070 16112 15882 gene locus_tag LOCUS_17080 16112 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 16212 17948 gene locus_tag LOCUS_17090 gene ccsA 16212 17948 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680415.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence071 365 96 gene locus_tag LOCUS_17100 gene rpsO 365 96 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_17100 525 2324 gene locus_tag LOCUS_17110 gene typA 525 2324 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_17110 3069 2416 gene locus_tag LOCUS_17120 3069 2416 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_17120 4075 3215 gene locus_tag LOCUS_17130 4075 3215 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788909.1 protein_id gnl|my_center|LOCUS_17130 6019 4088 gene locus_tag LOCUS_17140 6019 4088 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_17140 9179 6030 gene locus_tag LOCUS_17150 9179 6030 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203145.1 protein_id gnl|my_center|LOCUS_17150 11531 9924 gene locus_tag LOCUS_17160 gene pckA 11531 9924 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_17160 11828 12487 gene locus_tag LOCUS_17170 gene upp 11828 12487 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_17170 13591 12587 gene locus_tag LOCUS_17180 13591 12587 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_17180 15467 13620 gene locus_tag LOCUS_17190 15467 13620 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_17190 15794 15866 gene locus_tag LOCUS_t00230 15794 15866 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15972 17294 gene locus_tag LOCUS_17200 15972 17294 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108551.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence072 281 1594 gene locus_tag LOCUS_17210 gene fucP 281 1594 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_17210 1846 2247 gene locus_tag LOCUS_17220 1846 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787390.1 protein_id gnl|my_center|LOCUS_17220 2250 3539 gene locus_tag LOCUS_17230 2250 3539 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763519.1 protein_id gnl|my_center|LOCUS_17230 3536 4072 gene locus_tag LOCUS_17240 3536 4072 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763520.1 protein_id gnl|my_center|LOCUS_17240 7177 4268 gene locus_tag LOCUS_17250 7177 4268 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_17250 10514 7215 gene locus_tag LOCUS_17260 10514 7215 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_17260 12650 10590 gene locus_tag LOCUS_17270 gene uvrB 12650 10590 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_17270 12767 14065 gene locus_tag LOCUS_17280 12767 14065 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_17280 14093 14518 gene locus_tag LOCUS_17290 14093 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778250.1 protein_id gnl|my_center|LOCUS_17290 14662 15477 gene locus_tag LOCUS_17300 gene bamD 14662 15477 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_17300 15604 15939 gene locus_tag LOCUS_17310 15604 15939 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_17310 15939 16400 gene locus_tag LOCUS_17320 15939 16400 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_17320 17387 16686 gene locus_tag LOCUS_17330 17387 16686 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_17330 <17932 17419 gene locus_tag LOCUS_17340 <17932 17419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202945.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence073 1481 627 gene locus_tag LOCUS_17350 1481 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3545 1623 gene locus_tag LOCUS_17360 3545 1623 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_17360 6585 3559 gene locus_tag LOCUS_17370 6585 3559 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798155.1 protein_id gnl|my_center|LOCUS_17370 7975 6863 gene locus_tag LOCUS_17380 7975 6863 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_17380 9161 8088 gene locus_tag LOCUS_17390 9161 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 9355 9543 gene locus_tag LOCUS_17400 9355 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 11545 9638 gene locus_tag LOCUS_17410 11545 9638 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_17410 14640 11662 gene locus_tag LOCUS_17420 14640 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 16764 14668 gene locus_tag LOCUS_17430 16764 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 <17735 16787 gene locus_tag LOCUS_17440 <17735 16787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104520.1:DUF4185 domain-containing protein >Feature sequence074 2068 1550 gene locus_tag LOCUS_17450 2068 1550 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203608.1 protein_id gnl|my_center|LOCUS_17450 2562 4682 gene locus_tag LOCUS_17460 2562 4682 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_17460 4708 6504 gene locus_tag LOCUS_17470 gene glaB 4708 6504 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_17470 6526 7023 gene locus_tag LOCUS_17480 6526 7023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_17480 9578 7137 gene locus_tag LOCUS_17490 9578 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 9926 9705 gene locus_tag LOCUS_17500 9926 9705 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_17500 10551 9997 gene locus_tag LOCUS_17510 10551 9997 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_17510 11233 10601 gene locus_tag LOCUS_17520 11233 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_17520 12734 11238 gene locus_tag LOCUS_17530 12734 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 15376 12914 gene locus_tag LOCUS_17540 15376 12914 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_17540 17594 15381 gene locus_tag LOCUS_17550 17594 15381 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence075 283 1632 gene locus_tag LOCUS_17560 283 1632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803428.1 protein_id gnl|my_center|LOCUS_17560 1616 2329 gene locus_tag LOCUS_17570 1616 2329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_17570 2438 3670 gene locus_tag LOCUS_17580 2438 3670 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_17580 4953 3727 gene locus_tag LOCUS_17590 4953 3727 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_17590 8068 4946 gene locus_tag LOCUS_17600 8068 4946 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_17600 9470 8250 gene locus_tag LOCUS_17610 9470 8250 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_17610 11927 10293 gene locus_tag LOCUS_17620 11927 10293 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_17620 13109 12351 gene locus_tag LOCUS_17630 13109 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_17630 13296 14729 gene locus_tag LOCUS_17640 13296 14729 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_17640 16975 14732 gene locus_tag LOCUS_17650 16975 14732 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_17650 17210 17512 gene locus_tag LOCUS_17660 17210 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence076 908 99 gene locus_tag LOCUS_17670 908 99 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_17670 2088 979 gene locus_tag LOCUS_17680 2088 979 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786560.1 protein_id gnl|my_center|LOCUS_17680 3071 2145 gene locus_tag LOCUS_17690 3071 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4191 3085 gene locus_tag LOCUS_17700 4191 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786554.1 protein_id gnl|my_center|LOCUS_17700 4455 4838 gene locus_tag LOCUS_17710 4455 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5809 4835 gene locus_tag LOCUS_17720 5809 4835 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_17720 6932 5826 gene locus_tag LOCUS_17730 6932 5826 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_17730 8497 7034 gene locus_tag LOCUS_17740 gene cysN 8497 7034 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107258.1 protein_id gnl|my_center|LOCUS_17740 9448 8537 gene locus_tag LOCUS_17750 gene cysD 9448 8537 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_17750 10060 9455 gene locus_tag LOCUS_17760 gene cysC 10060 9455 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_17760 11636 10083 gene locus_tag LOCUS_17770 11636 10083 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_17770 12468 11644 gene locus_tag LOCUS_17780 gene cysQ 12468 11644 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_17780 13263 12763 gene locus_tag LOCUS_17790 13263 12763 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786521.1 protein_id gnl|my_center|LOCUS_17790 13718 13314 gene locus_tag LOCUS_17800 13718 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 13892 15166 gene locus_tag LOCUS_17810 13892 15166 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_17810 15340 15549 gene locus_tag LOCUS_17820 15340 15549 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760688.1 protein_id gnl|my_center|LOCUS_17820 15569 15922 gene locus_tag LOCUS_17830 15569 15922 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760687.1 protein_id gnl|my_center|LOCUS_17830 15935 16195 gene locus_tag LOCUS_17840 15935 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 17247 16276 gene locus_tag LOCUS_17850 17247 16276 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence077 171 4718 gene locus_tag LOCUS_17860 171 4718 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_17860 4798 7152 gene locus_tag LOCUS_17870 4798 7152 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_17870 7307 8218 gene locus_tag LOCUS_17880 7307 8218 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_17880 8721 10682 gene locus_tag LOCUS_17890 8721 10682 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_17890 10868 12739 gene locus_tag LOCUS_17900 10868 12739 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_17900 12900 14423 gene locus_tag LOCUS_17910 gene purH 12900 14423 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_17910 14539 15561 gene locus_tag LOCUS_17920 14539 15561 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_17920 15561 16403 gene locus_tag LOCUS_17930 gene mreC 15561 16403 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_17930 16457 16960 gene locus_tag LOCUS_17940 gene mreD 16457 16960 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence078 1208 246 gene locus_tag LOCUS_17950 1208 246 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_17950 1309 2034 gene locus_tag LOCUS_17960 1309 2034 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_17960 2247 3122 gene locus_tag LOCUS_17970 2247 3122 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_17970 4401 3220 gene locus_tag LOCUS_17980 4401 3220 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694591.1 protein_id gnl|my_center|LOCUS_17980 5817 4408 gene locus_tag LOCUS_17990 5817 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8167 5861 gene locus_tag LOCUS_18000 8167 5861 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_18000 9278 8817 gene locus_tag LOCUS_18010 gene queF 9278 8817 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762202.1 protein_id gnl|my_center|LOCUS_18010 9960 9304 gene locus_tag LOCUS_18020 gene queC 9960 9304 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762201.1 protein_id gnl|my_center|LOCUS_18020 10755 10075 gene locus_tag LOCUS_18030 10755 10075 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_18030 11147 10935 gene locus_tag LOCUS_18040 11147 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 12720 11263 gene locus_tag LOCUS_18050 12720 11263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_18050 13138 13872 gene locus_tag LOCUS_18060 13138 13872 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_18060 13959 15050 gene locus_tag LOCUS_18070 13959 15050 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_18070 15100 15477 gene locus_tag LOCUS_18080 15100 15477 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_18080 15474 15692 gene locus_tag LOCUS_18090 15474 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 15689 16426 gene locus_tag LOCUS_18100 15689 16426 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence079 801 1991 gene locus_tag LOCUS_18110 801 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2355 2032 gene locus_tag LOCUS_18120 2355 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3121 2348 gene locus_tag LOCUS_18130 3121 2348 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_18130 3398 3123 gene locus_tag LOCUS_18140 3398 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3642 3391 gene locus_tag LOCUS_18150 3642 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4082 4687 gene locus_tag LOCUS_18160 4082 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4696 5343 gene locus_tag LOCUS_18170 4696 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5363 6598 gene locus_tag LOCUS_18180 5363 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6610 6936 gene locus_tag LOCUS_18190 6610 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 6942 7277 gene locus_tag LOCUS_18200 6942 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7279 7611 gene locus_tag LOCUS_18210 7279 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7611 8072 gene locus_tag LOCUS_18220 7611 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8069 8494 gene locus_tag LOCUS_18230 8069 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 8510 9019 gene locus_tag LOCUS_18240 8510 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9088 9744 gene locus_tag LOCUS_18250 9088 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9977 15376 gene locus_tag LOCUS_18260 9977 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15379 15888 gene locus_tag LOCUS_18270 15379 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence080 331 549 gene locus_tag LOCUS_18280 331 549 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_18280 708 1727 gene locus_tag LOCUS_18290 708 1727 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_18290 4409 1899 gene locus_tag LOCUS_18300 4409 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4718 5686 gene locus_tag LOCUS_18310 4718 5686 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_18310 5686 5997 gene locus_tag LOCUS_18320 5686 5997 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_18320 7880 6135 gene locus_tag LOCUS_18330 7880 6135 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_18330 9076 8057 gene locus_tag LOCUS_18340 9076 8057 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_18340 10058 9165 gene locus_tag LOCUS_18350 10058 9165 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_18350 10638 11234 gene locus_tag LOCUS_18360 10638 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 11236 11787 gene locus_tag LOCUS_18370 11236 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 11994 13754 gene locus_tag LOCUS_18380 11994 13754 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_18380 14765 14139 gene locus_tag LOCUS_18390 14765 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 16178 14778 gene locus_tag LOCUS_18400 16178 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence081 765 7 gene locus_tag LOCUS_18410 gene rnc 765 7 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_18410 646 882 gene locus_tag LOCUS_18420 646 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2158 893 gene locus_tag LOCUS_18430 gene fabF 2158 893 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_18430 2416 2180 gene locus_tag LOCUS_18440 2416 2180 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_18440 2566 3153 gene locus_tag LOCUS_18450 gene purN 2566 3153 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_18450 4997 3144 gene locus_tag LOCUS_18460 4997 3144 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925712.1 protein_id gnl|my_center|LOCUS_18460 6157 5114 gene locus_tag LOCUS_18470 gene pdxB 6157 5114 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_18470 6427 6221 gene locus_tag LOCUS_18480 6427 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6786 7931 gene locus_tag LOCUS_18490 6786 7931 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_18490 7935 8972 gene locus_tag LOCUS_18500 gene hisC 7935 8972 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_18500 8969 9700 gene locus_tag LOCUS_18510 8969 9700 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_18510 9718 10545 gene locus_tag LOCUS_18520 9718 10545 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_18520 11484 10567 gene locus_tag LOCUS_18530 11484 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 11847 12791 gene locus_tag LOCUS_18540 11847 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 14202 12772 gene locus_tag LOCUS_18550 gene rfaE1 14202 12772 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_18550 14687 14199 gene locus_tag LOCUS_18560 14687 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 15261 14680 gene locus_tag LOCUS_18570 15261 14680 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_18570 16047 15298 gene locus_tag LOCUS_18580 16047 15298 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence082 3727 4401 gene locus_tag LOCUS_18590 3727 4401 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_18590 4423 5784 gene locus_tag LOCUS_18600 4423 5784 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762063.1 protein_id gnl|my_center|LOCUS_18600 5800 6816 gene locus_tag LOCUS_18610 5800 6816 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_18610 6915 10085 gene locus_tag LOCUS_18620 6915 10085 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_18620 10167 10460 gene locus_tag LOCUS_18630 10167 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_18630 11062 12435 gene locus_tag LOCUS_18640 11062 12435 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_18640 12455 13324 gene locus_tag LOCUS_18650 12455 13324 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694299.1 protein_id gnl|my_center|LOCUS_18650 13305 14819 gene locus_tag LOCUS_18660 13305 14819 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_18660 15164 15883 gene locus_tag LOCUS_18670 15164 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence083 177 389 gene locus_tag LOCUS_18680 177 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 428 856 gene locus_tag LOCUS_18690 428 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1435 1016 gene locus_tag LOCUS_18700 1435 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1678 1481 gene locus_tag LOCUS_18710 1678 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2186 2536 gene locus_tag LOCUS_18720 2186 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3212 2739 gene locus_tag LOCUS_18730 3212 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3545 3471 gene locus_tag LOCUS_t00240 3545 3471 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5376 3925 gene locus_tag LOCUS_18740 5376 3925 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202795.1 protein_id gnl|my_center|LOCUS_18740 6097 5369 gene locus_tag LOCUS_18750 6097 5369 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_18750 10366 6101 gene locus_tag LOCUS_18760 10366 6101 CDS product DUF5113 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107427.1 protein_id gnl|my_center|LOCUS_18760 10668 11510 gene locus_tag LOCUS_18770 10668 11510 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_18770 12772 11609 gene locus_tag LOCUS_18780 12772 11609 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_18780 14136 12847 gene locus_tag LOCUS_18790 14136 12847 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_18790 14907 14152 gene locus_tag LOCUS_18800 gene kdsB 14907 14152 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_18800 15331 14966 gene locus_tag LOCUS_18810 15331 14966 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761418.1 protein_id gnl|my_center|LOCUS_18810 <15984 15345 gene locus_tag LOCUS_18820 <15984 15345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202791.1:transglycosylase domain-containing protein >Feature sequence084 <1 1811 gene locus_tag LOCUS_18830 <1 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202543.1:family 20 glycosylhydrolase 1834 4155 gene locus_tag LOCUS_18840 1834 4155 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_18840 4267 8457 gene locus_tag LOCUS_18850 4267 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 8441 10966 gene locus_tag LOCUS_18860 gene galB 8441 10966 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_18860 11802 13439 gene locus_tag LOCUS_18870 11802 13439 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786655.1 protein_id gnl|my_center|LOCUS_18870 13532 14752 gene locus_tag LOCUS_18880 13532 14752 CDS product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202544.1 protein_id gnl|my_center|LOCUS_18880 14847 15452 gene locus_tag LOCUS_18890 14847 15452 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence085 <1 831 gene locus_tag LOCUS_18900 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786507.1:MFS transporter 892 2046 gene locus_tag LOCUS_18910 gene galK 892 2046 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_18910 2352 3452 gene locus_tag LOCUS_18920 2352 3452 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_18920 3480 4379 gene locus_tag LOCUS_18930 3480 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18930 4376 5173 gene locus_tag LOCUS_18940 4376 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 5232 5909 gene locus_tag LOCUS_18950 5232 5909 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_18950 5951 6637 gene locus_tag LOCUS_18960 5951 6637 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_18960 6676 8184 gene locus_tag LOCUS_18970 gene araA 6676 8184 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_18970 8309 9907 gene locus_tag LOCUS_18980 8309 9907 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_18980 9932 11476 gene locus_tag LOCUS_18990 9932 11476 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_18990 11667 13676 gene locus_tag LOCUS_19000 11667 13676 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_19000 13768 14202 gene locus_tag LOCUS_19010 gene rpiB 13768 14202 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_19010 15815 14619 gene locus_tag LOCUS_19020 15815 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence086 318 1205 gene locus_tag LOCUS_19030 gene fabD 318 1205 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_19030 1317 1859 gene locus_tag LOCUS_19040 1317 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793498.1 protein_id gnl|my_center|LOCUS_19040 2096 2293 gene locus_tag LOCUS_19050 gene thiS 2096 2293 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_19050 2299 2934 gene locus_tag LOCUS_19060 2299 2934 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_19060 2968 3744 gene locus_tag LOCUS_19070 2968 3744 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_19070 3757 5439 gene locus_tag LOCUS_19080 gene thiC 3757 5439 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_19080 5488 6618 gene locus_tag LOCUS_19090 gene thiH 5488 6618 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_19090 6626 7369 gene locus_tag LOCUS_19100 6626 7369 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788057.1 protein_id gnl|my_center|LOCUS_19100 7388 8002 gene locus_tag LOCUS_19110 7388 8002 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_19110 8010 8837 gene locus_tag LOCUS_19120 gene thiD 8010 8837 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_19120 9583 8936 gene locus_tag LOCUS_19130 9583 8936 CDS product DUF4476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784415.1 protein_id gnl|my_center|LOCUS_19130 9752 10873 gene locus_tag LOCUS_19140 9752 10873 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_19140 10943 11452 gene locus_tag LOCUS_19150 10943 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761477.1 protein_id gnl|my_center|LOCUS_19150 11572 11754 gene locus_tag LOCUS_19160 11572 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 11878 12687 gene locus_tag LOCUS_19170 11878 12687 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_19170 12720 14417 gene locus_tag LOCUS_19180 12720 14417 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_19180 14753 14523 gene locus_tag LOCUS_19190 14753 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786876.1 protein_id gnl|my_center|LOCUS_19190 15086 15751 gene locus_tag LOCUS_19200 15086 15751 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence087 103 900 gene locus_tag LOCUS_19210 103 900 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665481.1 protein_id gnl|my_center|LOCUS_19210 913 1722 gene locus_tag LOCUS_19220 913 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1857 4790 gene locus_tag LOCUS_19230 1857 4790 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_19230 4806 5672 gene locus_tag LOCUS_19240 4806 5672 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_19240 5699 6841 gene locus_tag LOCUS_19250 5699 6841 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_19250 6859 8463 gene locus_tag LOCUS_19260 6859 8463 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_19260 8643 9929 gene locus_tag LOCUS_19270 8643 9929 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794945.1 protein_id gnl|my_center|LOCUS_19270 10043 12247 gene locus_tag LOCUS_19280 10043 12247 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_19280 12260 13708 gene locus_tag LOCUS_19290 12260 13708 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659530.1 protein_id gnl|my_center|LOCUS_19290 14732 13710 gene locus_tag LOCUS_19300 14732 13710 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence088 719 1540 gene locus_tag LOCUS_19310 719 1540 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814311.1 protein_id gnl|my_center|LOCUS_19310 2374 1544 gene locus_tag LOCUS_19320 gene coaW 2374 1544 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 protein_id gnl|my_center|LOCUS_19320 4694 2475 gene locus_tag LOCUS_19330 4694 2475 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_19330 5275 7344 gene locus_tag LOCUS_19340 5275 7344 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785391.1 protein_id gnl|my_center|LOCUS_19340 7560 8261 gene locus_tag LOCUS_19350 7560 8261 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_19350 9609 8659 gene locus_tag LOCUS_19360 gene trxB 9609 8659 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_19360 10278 9640 gene locus_tag LOCUS_19370 10278 9640 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_19370 12716 10347 gene locus_tag LOCUS_19380 12716 10347 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_19380 13692 13531 gene locus_tag LOCUS_19390 13692 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 13930 14484 gene locus_tag LOCUS_19400 13930 14484 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_19400 14488 15111 gene locus_tag LOCUS_19410 14488 15111 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence089 262 1119 gene locus_tag LOCUS_19420 262 1119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_19420 1116 1961 gene locus_tag LOCUS_19430 1116 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791993.1 protein_id gnl|my_center|LOCUS_19430 1966 2334 gene locus_tag LOCUS_19440 1966 2334 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_19440 2353 3183 gene locus_tag LOCUS_19450 2353 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203593.1 protein_id gnl|my_center|LOCUS_19450 3311 4621 gene locus_tag LOCUS_19460 3311 4621 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_19460 5990 5556 gene locus_tag LOCUS_19470 5990 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6169 7728 gene locus_tag LOCUS_19480 6169 7728 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_19480 7981 7908 gene locus_tag LOCUS_t00250 7981 7908 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8219 8803 gene locus_tag LOCUS_19490 8219 8803 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_19490 8835 9581 gene locus_tag LOCUS_19500 gene fabG 8835 9581 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_19500 9670 10341 gene locus_tag LOCUS_19510 9670 10341 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_19510 10352 12889 gene locus_tag LOCUS_19520 10352 12889 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_19520 13304 13122 gene locus_tag LOCUS_19530 13304 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 14868 13528 gene locus_tag LOCUS_19540 14868 13528 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence090 2058 1153 gene locus_tag LOCUS_19550 2058 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3704 2310 gene locus_tag LOCUS_19560 gene mnmE 3704 2310 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_19560 3929 4162 gene locus_tag LOCUS_19570 3929 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4438 4674 gene locus_tag LOCUS_19580 4438 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6260 5382 gene locus_tag LOCUS_19590 6260 5382 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_19590 7356 6355 gene locus_tag LOCUS_19600 gene floA 7356 6355 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_19600 7875 7405 gene locus_tag LOCUS_19610 7875 7405 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785717.1 protein_id gnl|my_center|LOCUS_19610 9314 7884 gene locus_tag LOCUS_19620 9314 7884 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 protein_id gnl|my_center|LOCUS_19620 9474 10223 gene locus_tag LOCUS_19630 9474 10223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_19630 11651 10635 gene locus_tag LOCUS_19640 11651 10635 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_19640 12259 11681 gene locus_tag LOCUS_19650 12259 11681 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_19650 13033 12266 gene locus_tag LOCUS_19660 13033 12266 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_19660 13487 13002 gene locus_tag LOCUS_19670 13487 13002 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785734.1 protein_id gnl|my_center|LOCUS_19670 14443 13490 gene locus_tag LOCUS_19680 14443 13490 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_19680 <15068 14498 gene locus_tag LOCUS_19690 <15068 14498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202309.1:DUF4199 domain-containing protein >Feature sequence091 2290 734 gene locus_tag LOCUS_19700 2290 734 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_19700 2554 4335 gene locus_tag LOCUS_19710 2554 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4556 8638 gene locus_tag LOCUS_19720 4556 8638 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_19720 8777 11659 gene locus_tag LOCUS_19730 8777 11659 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918674.1 protein_id gnl|my_center|LOCUS_19730 11801 14383 gene locus_tag LOCUS_19740 11801 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence092 531 1490 gene locus_tag LOCUS_19750 531 1490 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_19750 1629 2192 gene locus_tag LOCUS_19760 1629 2192 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_19760 2201 3991 gene locus_tag LOCUS_19770 2201 3991 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_19770 4126 5097 gene locus_tag LOCUS_19780 gene fmt 4126 5097 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_19780 5363 6013 gene locus_tag LOCUS_19790 gene rpe 5363 6013 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_19790 6246 8108 gene locus_tag LOCUS_19800 6246 8108 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_19800 8179 9216 gene locus_tag LOCUS_19810 8179 9216 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_19810 9303 10391 gene locus_tag LOCUS_19820 9303 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 11534 10326 gene locus_tag LOCUS_19830 11534 10326 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_19830 11787 12704 gene locus_tag LOCUS_19840 11787 12704 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_19840 12710 13894 gene locus_tag LOCUS_19850 12710 13894 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence093 257 811 gene locus_tag LOCUS_19860 257 811 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_19860 834 1640 gene locus_tag LOCUS_19870 834 1640 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_19870 2313 1612 gene locus_tag LOCUS_19880 2313 1612 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_19880 2762 3928 gene locus_tag LOCUS_19890 gene nagA 2762 3928 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 protein_id gnl|my_center|LOCUS_19890 4023 6014 gene locus_tag LOCUS_19900 4023 6014 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_19900 6280 9132 gene locus_tag LOCUS_19910 6280 9132 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_19910 9257 9571 gene locus_tag LOCUS_19920 9257 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_19920 9572 9787 gene locus_tag LOCUS_19930 9572 9787 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788955.1 protein_id gnl|my_center|LOCUS_19930 9787 11625 gene locus_tag LOCUS_19940 9787 11625 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_19940 11708 12307 gene locus_tag LOCUS_19950 11708 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 12733 14028 gene locus_tag LOCUS_19960 12733 14028 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence094 881 1114 gene locus_tag LOCUS_19970 881 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1199 2239 gene locus_tag LOCUS_19980 gene lpxD 1199 2239 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_19980 2243 3628 gene locus_tag LOCUS_19990 2243 3628 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_19990 3759 4535 gene locus_tag LOCUS_20000 gene lpxA 3759 4535 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764415.1 protein_id gnl|my_center|LOCUS_20000 4592 5146 gene locus_tag LOCUS_20010 4592 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764414.1 protein_id gnl|my_center|LOCUS_20010 5258 6142 gene locus_tag LOCUS_20020 gene miaA 5258 6142 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_20020 6661 6173 gene locus_tag LOCUS_20030 6661 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8755 6674 gene locus_tag LOCUS_20040 8755 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9374 9012 gene locus_tag LOCUS_20050 9374 9012 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_20050 9586 10290 gene locus_tag LOCUS_20060 9586 10290 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_20060 10280 10894 gene locus_tag LOCUS_20070 10280 10894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_20070 11610 11110 gene locus_tag LOCUS_20080 11610 11110 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791037.1 protein_id gnl|my_center|LOCUS_20080 13352 11790 gene locus_tag LOCUS_20090 13352 11790 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195435952.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence095 232 762 gene locus_tag LOCUS_20100 232 762 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_20100 864 1445 gene locus_tag LOCUS_20110 864 1445 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_20110 3634 1442 gene locus_tag LOCUS_20120 3634 1442 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_20120 5242 3728 gene locus_tag LOCUS_20130 5242 3728 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_20130 6357 5299 gene locus_tag LOCUS_20140 6357 5299 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_20140 7756 6500 gene locus_tag LOCUS_20150 7756 6500 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_20150 8521 7847 gene locus_tag LOCUS_20160 gene nth 8521 7847 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_20160 9714 8518 gene locus_tag LOCUS_20170 9714 8518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769619.1 protein_id gnl|my_center|LOCUS_20170 10857 9823 gene locus_tag LOCUS_20180 gene pheS 10857 9823 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_20180 11258 13852 gene locus_tag LOCUS_20190 11258 13852 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202756.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence096 81 518 gene locus_tag LOCUS_20200 81 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 484 1149 gene locus_tag LOCUS_20210 484 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 1307 2926 gene locus_tag LOCUS_20220 1307 2926 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555802.1 protein_id gnl|my_center|LOCUS_20220 3130 4164 gene locus_tag LOCUS_20230 3130 4164 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_20230 4252 7341 gene locus_tag LOCUS_20240 4252 7341 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_20240 7338 8819 gene locus_tag LOCUS_20250 7338 8819 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_20250 9038 8784 gene locus_tag LOCUS_20260 9038 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 9010 12045 gene locus_tag LOCUS_20270 9010 12045 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence097 255 1061 gene locus_tag LOCUS_20280 255 1061 CDS product DUF3805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107812.1 protein_id gnl|my_center|LOCUS_20280 1152 3014 gene locus_tag LOCUS_20290 1152 3014 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_20290 3113 3898 gene locus_tag LOCUS_20300 3113 3898 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_20300 4402 3974 gene locus_tag LOCUS_20310 4402 3974 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766216.1 protein_id gnl|my_center|LOCUS_20310 4708 4412 gene locus_tag LOCUS_20320 gene trxA 4708 4412 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_20320 6866 4779 gene locus_tag LOCUS_20330 6866 4779 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_20330 9243 7078 gene locus_tag LOCUS_20340 9243 7078 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_20340 10530 9295 gene locus_tag LOCUS_20350 10530 9295 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_20350 10665 11414 gene locus_tag LOCUS_20360 10665 11414 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_20360 12296 11496 gene locus_tag LOCUS_20370 12296 11496 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_20370 12538 13566 gene locus_tag LOCUS_20380 12538 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence098 738 2057 gene locus_tag LOCUS_20390 738 2057 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_20390 2044 2664 gene locus_tag LOCUS_20400 2044 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3159 2728 gene locus_tag LOCUS_20410 3159 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 3651 4406 gene locus_tag LOCUS_20420 3651 4406 CDS product DUF4099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203043.1 protein_id gnl|my_center|LOCUS_20420 4886 4491 gene locus_tag LOCUS_20430 4886 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5307 6638 gene locus_tag LOCUS_20440 5307 6638 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074435184.1 protein_id gnl|my_center|LOCUS_20440 6642 7979 gene locus_tag LOCUS_20450 6642 7979 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202682.1 protein_id gnl|my_center|LOCUS_20450 7969 8361 gene locus_tag LOCUS_20460 7969 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109069.1 protein_id gnl|my_center|LOCUS_20460 8756 8454 gene locus_tag LOCUS_20470 8756 8454 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108660.1 protein_id gnl|my_center|LOCUS_20470 9109 8798 gene locus_tag LOCUS_20480 9109 8798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008628599.1 protein_id gnl|my_center|LOCUS_20480 9656 10096 gene locus_tag LOCUS_20490 9656 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 10278 10643 gene locus_tag LOCUS_20500 10278 10643 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108661.1 protein_id gnl|my_center|LOCUS_20500 10653 11591 gene locus_tag LOCUS_20510 10653 11591 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_20510 11594 12256 gene locus_tag LOCUS_20520 11594 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 12262 13470 gene locus_tag LOCUS_20530 12262 13470 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence099 <1 699 gene locus_tag LOCUS_20540 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760381.1:TrkA family potassium uptake protein 2263 755 gene locus_tag LOCUS_20550 2263 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2558 3178 gene locus_tag LOCUS_20560 2558 3178 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108342.1 protein_id gnl|my_center|LOCUS_20560 3239 3766 gene locus_tag LOCUS_20570 3239 3766 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_20570 4195 4671 gene locus_tag LOCUS_20580 4195 4671 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765180.1 protein_id gnl|my_center|LOCUS_20580 4800 5027 gene locus_tag LOCUS_20590 4800 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 5161 5613 gene locus_tag LOCUS_20600 5161 5613 CDS product DUF4890 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202341.1 protein_id gnl|my_center|LOCUS_20600 5673 6218 gene locus_tag LOCUS_20610 5673 6218 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760389.1 protein_id gnl|my_center|LOCUS_20610 6268 6945 gene locus_tag LOCUS_20620 6268 6945 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_20620 6942 8219 gene locus_tag LOCUS_20630 6942 8219 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_20630 8315 8764 gene locus_tag LOCUS_20640 8315 8764 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785921.1 protein_id gnl|my_center|LOCUS_20640 8791 9300 gene locus_tag LOCUS_20650 8791 9300 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816392.1 protein_id gnl|my_center|LOCUS_20650 10526 9372 gene locus_tag LOCUS_20660 10526 9372 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_20660 13173 10636 gene locus_tag LOCUS_20670 13173 10636 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence100 440 1150 gene locus_tag LOCUS_20680 440 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1157 1861 gene locus_tag LOCUS_20690 1157 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1912 2520 gene locus_tag LOCUS_20700 1912 2520 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850560.1 protein_id gnl|my_center|LOCUS_20700 2507 3604 gene locus_tag LOCUS_20710 2507 3604 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992462.1 protein_id gnl|my_center|LOCUS_20710 3624 4181 gene locus_tag LOCUS_20720 3624 4181 CDS product DUF4943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795312.1 protein_id gnl|my_center|LOCUS_20720 4186 4848 gene locus_tag LOCUS_20730 4186 4848 CDS product DUF4858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303197.1 protein_id gnl|my_center|LOCUS_20730 4981 5874 gene locus_tag LOCUS_20740 4981 5874 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107858.1 protein_id gnl|my_center|LOCUS_20740 7350 6247 gene locus_tag LOCUS_20750 gene ald 7350 6247 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_20750 7593 9281 gene locus_tag LOCUS_20760 7593 9281 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767962.1 protein_id gnl|my_center|LOCUS_20760 9449 11092 gene locus_tag LOCUS_20770 9449 11092 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_20770 11174 12916 gene locus_tag LOCUS_20780 11174 12916 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence101 134 1354 gene locus_tag LOCUS_20790 134 1354 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_20790 1347 1511 gene locus_tag LOCUS_20800 1347 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1529 2035 gene locus_tag LOCUS_20810 1529 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2038 2985 gene locus_tag LOCUS_20820 2038 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2937 3923 gene locus_tag LOCUS_20830 2937 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 4127 6382 gene locus_tag LOCUS_20840 4127 6382 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_20840 6591 9686 gene locus_tag LOCUS_20850 6591 9686 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_20850 10385 9813 gene locus_tag LOCUS_20860 10385 9813 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 protein_id gnl|my_center|LOCUS_20860 10947 12953 gene locus_tag LOCUS_20870 10947 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence102 222 470 gene locus_tag LOCUS_20880 222 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 560 907 gene locus_tag LOCUS_20890 560 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 912 1493 gene locus_tag LOCUS_20900 912 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1620 2327 gene locus_tag LOCUS_20910 1620 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2419 3465 gene locus_tag LOCUS_20920 2419 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3836 3462 gene locus_tag LOCUS_20930 3836 3462 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_20930 4023 5747 gene locus_tag LOCUS_20940 4023 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5784 6320 gene locus_tag LOCUS_20950 5784 6320 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_20950 6556 9177 gene locus_tag LOCUS_20960 6556 9177 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_20960 9843 9181 gene locus_tag LOCUS_20970 gene ung 9843 9181 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_20970 10987 9950 gene locus_tag LOCUS_20980 gene asnA 10987 9950 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_20980 11200 11273 gene locus_tag LOCUS_t00260 11200 11273 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11771 12235 gene locus_tag LOCUS_20990 11771 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 12872 12450 gene locus_tag LOCUS_21000 12872 12450 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765741.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence103 224 39 gene locus_tag LOCUS_21010 224 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1240 221 gene locus_tag LOCUS_21020 1240 221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_21020 2273 1233 gene locus_tag LOCUS_21030 2273 1233 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_21030 3439 2270 gene locus_tag LOCUS_21040 3439 2270 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_21040 4897 3542 gene locus_tag LOCUS_21050 4897 3542 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_21050 5492 4902 gene locus_tag LOCUS_21060 5492 4902 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786253.1 protein_id gnl|my_center|LOCUS_21060 6440 5583 gene locus_tag LOCUS_21070 6440 5583 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_21070 6558 7271 gene locus_tag LOCUS_21080 6558 7271 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787514.1 protein_id gnl|my_center|LOCUS_21080 7364 7759 gene locus_tag LOCUS_21090 7364 7759 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_21090 7855 9846 gene locus_tag LOCUS_21100 7855 9846 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_21100 9940 10809 gene locus_tag LOCUS_21110 9940 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 10952 11740 gene locus_tag LOCUS_21120 10952 11740 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_21120 <12912 11819 gene locus_tag LOCUS_21130 <12912 11819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_195435952.1:ATP-binding protein >Feature sequence104 113 1465 gene locus_tag LOCUS_21140 113 1465 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_21140 1843 2451 gene locus_tag LOCUS_21150 1843 2451 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_21150 2935 2444 gene locus_tag LOCUS_21160 2935 2444 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_21160 3449 3000 gene locus_tag LOCUS_21170 3449 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202710.1 protein_id gnl|my_center|LOCUS_21170 4116 3499 gene locus_tag LOCUS_21180 gene recR 4116 3499 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_21180 4209 4814 gene locus_tag LOCUS_21190 gene yihA 4209 4814 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_21190 4829 5425 gene locus_tag LOCUS_21200 4829 5425 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787260.1 protein_id gnl|my_center|LOCUS_21200 5586 5513 gene locus_tag LOCUS_t00270 5586 5513 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5587 5686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5760 5687 gene locus_tag LOCUS_t00280 5760 5687 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7016 5871 gene locus_tag LOCUS_21210 gene nspC 7016 5871 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_21210 9545 7191 gene locus_tag LOCUS_21220 9545 7191 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_21220 9726 10310 gene locus_tag LOCUS_21230 9726 10310 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_21230 10479 11087 gene locus_tag LOCUS_21240 10479 11087 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_21240 12308 11856 gene locus_tag LOCUS_21250 12308 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 12453 12644 gene locus_tag LOCUS_21260 12453 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence105 88 1590 gene locus_tag LOCUS_21270 88 1590 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470526.1 protein_id gnl|my_center|LOCUS_21270 1661 2848 gene locus_tag LOCUS_21280 1661 2848 CDS product DUF6043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470527.1 protein_id gnl|my_center|LOCUS_21280 3029 3349 gene locus_tag LOCUS_21290 3029 3349 CDS product DUF3853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809723.1 protein_id gnl|my_center|LOCUS_21290 3351 4736 gene locus_tag LOCUS_21300 3351 4736 CDS product virulence-associated E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055169705.1 protein_id gnl|my_center|LOCUS_21300 4872 5219 gene locus_tag LOCUS_21310 4872 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5270 5800 gene locus_tag LOCUS_21320 5270 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5972 6370 gene locus_tag LOCUS_21330 5972 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108565.1 protein_id gnl|my_center|LOCUS_21330 6376 7587 gene locus_tag LOCUS_21340 6376 7587 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108566.1 protein_id gnl|my_center|LOCUS_21340 7612 8154 gene locus_tag LOCUS_21350 7612 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 10891 8468 gene locus_tag LOCUS_21360 10891 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence106 <1 1073 gene locus_tag LOCUS_21370 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791116.1:DoxX family protein 1123 1878 gene locus_tag LOCUS_21380 gene tpiA 1123 1878 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_21380 1985 2443 gene locus_tag LOCUS_21390 1985 2443 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_21390 2453 3040 gene locus_tag LOCUS_21400 gene folE 2453 3040 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_21400 5165 3063 gene locus_tag LOCUS_21410 gene dnaG 5165 3063 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109025.1 protein_id gnl|my_center|LOCUS_21410 5588 7360 gene locus_tag LOCUS_21420 5588 7360 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108953.1 protein_id gnl|my_center|LOCUS_21420 7374 9182 gene locus_tag LOCUS_21430 7374 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762677.1 protein_id gnl|my_center|LOCUS_21430 11172 9238 gene locus_tag LOCUS_21440 11172 9238 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108434.1 protein_id gnl|my_center|LOCUS_21440 <12500 11627 gene locus_tag LOCUS_21450 <12500 11627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107815.1:DUF5106 domain-containing protein >Feature sequence107 <1 627 gene locus_tag LOCUS_21460 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007485431.1:ribonucleotide-diphosphate reductase subunit beta 1508 921 gene locus_tag LOCUS_21470 1508 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2373 1537 gene locus_tag LOCUS_21480 2373 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3211 2558 gene locus_tag LOCUS_21490 3211 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3592 3257 gene locus_tag LOCUS_21500 3592 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5564 3681 gene locus_tag LOCUS_21510 5564 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 6401 7375 gene locus_tag LOCUS_21520 6401 7375 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109637.1 protein_id gnl|my_center|LOCUS_21520 7447 8103 gene locus_tag LOCUS_21530 7447 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8544 10211 gene locus_tag LOCUS_21540 8544 10211 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659497.1 protein_id gnl|my_center|LOCUS_21540 10321 10542 gene locus_tag LOCUS_21550 10321 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203040.1 protein_id gnl|my_center|LOCUS_21550 10922 11365 gene locus_tag LOCUS_21560 10922 11365 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_21560 12241 11465 gene locus_tag LOCUS_21570 12241 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence108 306 1814 gene locus_tag LOCUS_21580 306 1814 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768920.1 protein_id gnl|my_center|LOCUS_21580 1962 3998 gene locus_tag LOCUS_21590 1962 3998 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_21590 4033 4857 gene locus_tag LOCUS_21600 4033 4857 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_21600 5067 5966 gene locus_tag LOCUS_21610 5067 5966 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_21610 6045 7475 gene locus_tag LOCUS_21620 gene cobJ 6045 7475 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_21620 7602 8840 gene locus_tag LOCUS_21630 7602 8840 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_21630 8852 10705 gene locus_tag LOCUS_21640 gene cobM 8852 10705 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence109 907 2037 gene locus_tag LOCUS_21650 gene hemW 907 2037 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_21650 2058 2603 gene locus_tag LOCUS_21660 2058 2603 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_21660 2890 3408 gene locus_tag LOCUS_21670 2890 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3462 6152 gene locus_tag LOCUS_21680 3462 6152 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_21680 6168 7310 gene locus_tag LOCUS_21690 6168 7310 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763957.1 protein_id gnl|my_center|LOCUS_21690 7602 7955 gene locus_tag LOCUS_21700 7602 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790982.1 protein_id gnl|my_center|LOCUS_21700 8855 8103 gene locus_tag LOCUS_21710 8855 8103 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796993.1 protein_id gnl|my_center|LOCUS_21710 10823 8988 gene locus_tag LOCUS_21720 10823 8988 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_21720 11346 11549 gene locus_tag LOCUS_21730 11346 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 <12344 11609 gene locus_tag LOCUS_21740 <12344 11609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203494.1:DUF2027 domain-containing protein >Feature sequence110 824 1243 gene locus_tag LOCUS_21750 824 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1250 1522 gene locus_tag LOCUS_21760 1250 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1538 2434 gene locus_tag LOCUS_21770 1538 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2431 4632 gene locus_tag LOCUS_21780 2431 4632 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_21780 4629 5780 gene locus_tag LOCUS_21790 4629 5780 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 protein_id gnl|my_center|LOCUS_21790 5804 6010 gene locus_tag LOCUS_21800 5804 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 5997 6629 gene locus_tag LOCUS_21810 5997 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 6602 7504 gene locus_tag LOCUS_21820 6602 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 7497 8057 gene locus_tag LOCUS_21830 7497 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 9047 8070 gene locus_tag LOCUS_21840 9047 8070 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_21840 9183 9977 gene locus_tag LOCUS_21850 gene rsmA 9183 9977 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_21850 10004 11350 gene locus_tag LOCUS_21860 gene mgtE 10004 11350 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence111 1072 560 gene locus_tag LOCUS_21870 1072 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1553 1242 gene locus_tag LOCUS_21880 1553 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2899 1727 gene locus_tag LOCUS_21890 2899 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 4280 2910 gene locus_tag LOCUS_21900 4280 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4509 4931 gene locus_tag LOCUS_21910 4509 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5011 5625 gene locus_tag LOCUS_21920 gene traK 5011 5625 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310175.1 protein_id gnl|my_center|LOCUS_21920 5627 5962 gene locus_tag LOCUS_21930 5627 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310174.1 protein_id gnl|my_center|LOCUS_21930 5949 7196 gene locus_tag LOCUS_21940 gene traM 5949 7196 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310172.1 protein_id gnl|my_center|LOCUS_21940 7328 8173 gene locus_tag LOCUS_21950 gene traN 7328 8173 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310170.1 protein_id gnl|my_center|LOCUS_21950 8185 8706 gene locus_tag LOCUS_21960 8185 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310169.1 protein_id gnl|my_center|LOCUS_21960 8764 9453 gene locus_tag LOCUS_21970 8764 9453 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310168.1 protein_id gnl|my_center|LOCUS_21970 9472 11655 gene locus_tag LOCUS_21980 9472 11655 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310166.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence112 323 1354 gene locus_tag LOCUS_21990 323 1354 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768081.1 protein_id gnl|my_center|LOCUS_21990 1344 1952 gene locus_tag LOCUS_22000 gene coaE 1344 1952 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_22000 2062 2493 gene locus_tag LOCUS_22010 2062 2493 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_22010 5173 2579 gene locus_tag LOCUS_22020 gene clpB 5173 2579 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_22020 5717 6313 gene locus_tag LOCUS_22030 5717 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785774.1 protein_id gnl|my_center|LOCUS_22030 6328 7215 gene locus_tag LOCUS_22040 6328 7215 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_22040 7365 8351 gene locus_tag LOCUS_22050 7365 8351 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_22050 9192 8653 gene locus_tag LOCUS_22060 9192 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9407 9751 gene locus_tag LOCUS_22070 9407 9751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768079.1 protein_id gnl|my_center|LOCUS_22070 9880 10395 gene locus_tag LOCUS_22080 9880 10395 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_22080 10376 10900 gene locus_tag LOCUS_22090 10376 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795692.1 protein_id gnl|my_center|LOCUS_22090 10907 11617 gene locus_tag LOCUS_22100 10907 11617 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785780.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence113 1304 51 gene locus_tag LOCUS_22110 gene xseA 1304 51 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_22110 2672 1311 gene locus_tag LOCUS_22120 2672 1311 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_22120 3781 2669 gene locus_tag LOCUS_22130 gene mnmA 3781 2669 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203548.1 protein_id gnl|my_center|LOCUS_22130 5460 4372 gene locus_tag LOCUS_22140 5460 4372 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767707.1 protein_id gnl|my_center|LOCUS_22140 6627 5623 gene locus_tag LOCUS_22150 6627 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 9080 6756 gene locus_tag LOCUS_22160 9080 6756 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_22160 11572 9083 gene locus_tag LOCUS_22170 11572 9083 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658082.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence114 513 1706 gene locus_tag LOCUS_22180 513 1706 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_22180 2895 1903 gene locus_tag LOCUS_22190 2895 1903 CDS product DUF3843 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761131.1 protein_id gnl|my_center|LOCUS_22190 3494 2892 gene locus_tag LOCUS_22200 gene ruvA 3494 2892 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_22200 3690 4589 gene locus_tag LOCUS_22210 3690 4589 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_22210 6064 4733 gene locus_tag LOCUS_22220 gene rseP 6064 4733 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_22220 7321 6176 gene locus_tag LOCUS_22230 7321 6176 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_22230 8215 7358 gene locus_tag LOCUS_22240 8215 7358 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_22240 8748 8212 gene locus_tag LOCUS_22250 gene rimM 8748 8212 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657443.1 protein_id gnl|my_center|LOCUS_22250 10057 8750 gene locus_tag LOCUS_22260 gene murA 10057 8750 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_22260 10697 10077 gene locus_tag LOCUS_22270 10697 10077 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_22270 11441 10749 gene locus_tag LOCUS_22280 gene tsaB 11441 10749 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence115 <1 644 gene locus_tag LOCUS_22290 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109052.1:GH92 family glycosyl hydrolase 882 1130 gene locus_tag LOCUS_22300 882 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2517 1633 gene locus_tag LOCUS_22310 2517 1633 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_22310 3107 2595 gene locus_tag LOCUS_22320 3107 2595 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202236.1 protein_id gnl|my_center|LOCUS_22320 3913 3104 gene locus_tag LOCUS_22330 3913 3104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759988.1 protein_id gnl|my_center|LOCUS_22330 5426 3939 gene locus_tag LOCUS_22340 5426 3939 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759989.1 protein_id gnl|my_center|LOCUS_22340 8266 5510 gene locus_tag LOCUS_22350 8266 5510 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_22350 9248 8448 gene locus_tag LOCUS_22360 gene kdsA 9248 8448 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_22360 10198 9272 gene locus_tag LOCUS_22370 10198 9272 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759992.1 protein_id gnl|my_center|LOCUS_22370 11241 10258 gene locus_tag LOCUS_22380 gene miaA 11241 10258 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence116 1616 1434 gene locus_tag LOCUS_22390 1616 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1827 1588 gene locus_tag LOCUS_22400 1827 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2219 1833 gene locus_tag LOCUS_22410 2219 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2374 2724 gene locus_tag LOCUS_22420 2374 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2982 4202 gene locus_tag LOCUS_22430 2982 4202 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_22430 4202 5770 gene locus_tag LOCUS_22440 4202 5770 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_22440 5867 9193 gene locus_tag LOCUS_22450 gene secA 5867 9193 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_22450 9372 10472 gene locus_tag LOCUS_22460 9372 10472 CDS product DUF6340 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785441.1 protein_id gnl|my_center|LOCUS_22460 10539 10985 gene locus_tag LOCUS_22470 10539 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_22470 11390 11094 gene locus_tag LOCUS_22480 11390 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence117 3093 475 gene locus_tag LOCUS_22490 gene alaS 3093 475 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_22490 3307 4275 gene locus_tag LOCUS_22500 3307 4275 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_22500 5186 4821 gene locus_tag LOCUS_22510 5186 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5871 5242 gene locus_tag LOCUS_22520 5871 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 6100 5897 gene locus_tag LOCUS_22530 6100 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6247 6813 gene locus_tag LOCUS_22540 6247 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6823 7038 gene locus_tag LOCUS_22550 6823 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7288 7503 gene locus_tag LOCUS_22560 7288 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 8405 8001 gene locus_tag LOCUS_22570 8405 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9362 8451 gene locus_tag LOCUS_22580 9362 8451 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_22580 9515 9904 gene locus_tag LOCUS_22590 9515 9904 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_22590 10953 10318 gene locus_tag LOCUS_22600 10953 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence118 271 1275 gene locus_tag LOCUS_22610 271 1275 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_22610 1276 2289 gene locus_tag LOCUS_22620 gene pseI 1276 2289 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_22620 3050 2637 gene locus_tag LOCUS_22630 3050 2637 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_22630 3692 3207 gene locus_tag LOCUS_22640 3692 3207 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107909.1 protein_id gnl|my_center|LOCUS_22640 3901 4119 gene locus_tag LOCUS_22650 3901 4119 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765886.1 protein_id gnl|my_center|LOCUS_22650 6026 4251 gene locus_tag LOCUS_22660 6026 4251 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107945.1 protein_id gnl|my_center|LOCUS_22660 6662 6081 gene locus_tag LOCUS_22670 6662 6081 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767888.1 protein_id gnl|my_center|LOCUS_22670 6961 7122 gene locus_tag LOCUS_22680 6961 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 7239 8807 gene locus_tag LOCUS_22690 7239 8807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_22690 8978 9127 gene locus_tag LOCUS_22700 8978 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 9638 11071 gene locus_tag LOCUS_22710 9638 11071 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107921.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence119 326 6196 gene locus_tag LOCUS_22720 326 6196 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_22720 6753 6448 gene locus_tag LOCUS_22730 6753 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7063 8715 gene locus_tag LOCUS_22740 gene cas3 7063 8715 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_22740 8844 9533 gene locus_tag LOCUS_22750 gene cas5c 8844 9533 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence120 3644 255 gene locus_tag LOCUS_22760 gene mfd 3644 255 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_22760 4297 5040 gene locus_tag LOCUS_22770 4297 5040 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_22770 5105 6451 gene locus_tag LOCUS_22780 5105 6451 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788965.1 protein_id gnl|my_center|LOCUS_22780 6478 7404 gene locus_tag LOCUS_22790 6478 7404 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766201.1 protein_id gnl|my_center|LOCUS_22790 7618 8103 gene locus_tag LOCUS_22800 7618 8103 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_22800 8108 8734 gene locus_tag LOCUS_22810 8108 8734 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760546.1 protein_id gnl|my_center|LOCUS_22810 8722 9897 gene locus_tag LOCUS_22820 8722 9897 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_22820 10146 9883 gene locus_tag LOCUS_22830 10146 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence121 629 1897 gene locus_tag LOCUS_22840 629 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 6047 2052 gene locus_tag LOCUS_22850 6047 2052 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109062.1 protein_id gnl|my_center|LOCUS_22850 7070 6054 gene locus_tag LOCUS_22860 7070 6054 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_22860 8531 7323 gene locus_tag LOCUS_22870 8531 7323 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109064.1 protein_id gnl|my_center|LOCUS_22870 9322 8546 gene locus_tag LOCUS_22880 9322 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 <10393 9319 gene locus_tag LOCUS_22890 <10393 9319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004313935.1:relaxase/mobilization nuclease domain-containing protein >Feature sequence122 1635 43 gene locus_tag LOCUS_22900 1635 43 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_22900 4815 1654 gene locus_tag LOCUS_22910 4815 1654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_22910 5813 4989 gene locus_tag LOCUS_22920 5813 4989 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_22920 6752 5898 gene locus_tag LOCUS_22930 6752 5898 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794959.1 protein_id gnl|my_center|LOCUS_22930 8272 7505 gene locus_tag LOCUS_22940 gene yaaA 8272 7505 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109003.1 protein_id gnl|my_center|LOCUS_22940 8469 10184 gene locus_tag LOCUS_22950 gene recJ 8469 10184 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence123 674 600 gene locus_tag LOCUS_t00290 674 600 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1078 767 gene locus_tag LOCUS_22960 1078 767 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_22960 1552 1088 gene locus_tag LOCUS_22970 1552 1088 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_22970 2646 1780 gene locus_tag LOCUS_22980 2646 1780 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_22980 3258 2665 gene locus_tag LOCUS_22990 3258 2665 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_22990 3441 4157 gene locus_tag LOCUS_23000 3441 4157 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_23000 5077 4331 gene locus_tag LOCUS_23010 5077 4331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_23010 6335 5070 gene locus_tag LOCUS_23020 6335 5070 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_23020 6730 6338 gene locus_tag LOCUS_23030 6730 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 7759 6833 gene locus_tag LOCUS_23040 7759 6833 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_23040 8628 7756 gene locus_tag LOCUS_23050 8628 7756 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_23050 9595 8684 gene locus_tag LOCUS_23060 9595 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 <10310 9592 gene locus_tag LOCUS_23070 <10310 9592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108540.1:lipopolysaccharide biosynthesis protein >Feature sequence124 <1 3159 gene locus_tag LOCUS_23080 <1 3159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202526.1:TonB-dependent receptor 3182 4777 gene locus_tag LOCUS_23090 3182 4777 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795013.1 protein_id gnl|my_center|LOCUS_23090 5052 7025 gene locus_tag LOCUS_23100 5052 7025 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_23100 7399 8856 gene locus_tag LOCUS_23110 7399 8856 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555717.1 protein_id gnl|my_center|LOCUS_23110 9410 8964 gene locus_tag LOCUS_23120 9410 8964 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_23120 <10132 9424 gene locus_tag LOCUS_23130 <10132 9424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793004.1:MFS transporter >Feature sequence125 915 1076 gene locus_tag LOCUS_23140 915 1076 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804009.1 protein_id gnl|my_center|LOCUS_23140 2770 1073 gene locus_tag LOCUS_23150 2770 1073 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_23150 2925 4526 gene locus_tag LOCUS_23160 2925 4526 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_23160 4654 6075 gene locus_tag LOCUS_23170 4654 6075 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_23170 6552 8195 gene locus_tag LOCUS_23180 6552 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108178.1 protein_id gnl|my_center|LOCUS_23180 8322 8723 gene locus_tag LOCUS_23190 8322 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8795 8995 gene locus_tag LOCUS_23200 8795 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence126 60 893 gene locus_tag LOCUS_23210 60 893 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959197.1 protein_id gnl|my_center|LOCUS_23210 1002 1334 gene locus_tag LOCUS_23220 gene queD 1002 1334 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_23220 1321 1866 gene locus_tag LOCUS_23230 1321 1866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_23230 1996 1923 gene locus_tag LOCUS_t00300 1996 1923 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2647 2072 gene locus_tag LOCUS_23240 2647 2072 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_23240 3464 2838 gene locus_tag LOCUS_23250 3464 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_23250 4580 3939 gene locus_tag LOCUS_23260 4580 3939 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_23260 4730 4906 gene locus_tag LOCUS_23270 4730 4906 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_23270 5000 6265 gene locus_tag LOCUS_23280 5000 6265 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764634.1 protein_id gnl|my_center|LOCUS_23280 6262 7035 gene locus_tag LOCUS_23290 6262 7035 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_23290 8422 7442 gene locus_tag LOCUS_23300 8422 7442 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_23300 9190 8465 gene locus_tag LOCUS_23310 9190 8465 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_23310 9613 9203 gene locus_tag LOCUS_23320 9613 9203 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence127 404 1681 gene locus_tag LOCUS_23330 404 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1944 2396 gene locus_tag LOCUS_23340 1944 2396 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765180.1 protein_id gnl|my_center|LOCUS_23340 2912 2736 gene locus_tag LOCUS_23350 2912 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4713 3250 gene locus_tag LOCUS_23360 4713 3250 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_23360 5750 4725 gene locus_tag LOCUS_23370 5750 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 7904 6273 gene locus_tag LOCUS_23380 7904 6273 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_23380 <9640 7931 gene locus_tag LOCUS_23390 <9640 7931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202210.1:TonB-dependent receptor >Feature sequence128 135 1016 gene locus_tag LOCUS_23400 135 1016 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310189.1 protein_id gnl|my_center|LOCUS_23400 1097 2521 gene locus_tag LOCUS_23410 1097 2521 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_23410 2893 2579 gene locus_tag LOCUS_23420 2893 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323447.1 protein_id gnl|my_center|LOCUS_23420 4114 2981 gene locus_tag LOCUS_23430 gene dnaN 4114 2981 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_23430 4556 4972 gene locus_tag LOCUS_23440 4556 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4950 5306 gene locus_tag LOCUS_23450 4950 5306 CDS product DUF4134 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028728589.1 protein_id gnl|my_center|LOCUS_23450 5362 5727 gene locus_tag LOCUS_23460 5362 5727 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322059.1 protein_id gnl|my_center|LOCUS_23460 5734 6036 gene locus_tag LOCUS_23470 5734 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322060.1 protein_id gnl|my_center|LOCUS_23470 6033 7568 gene locus_tag LOCUS_23480 6033 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7590 8003 gene locus_tag LOCUS_23490 7590 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8000 9436 gene locus_tag LOCUS_23500 8000 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence129 32 1552 gene locus_tag LOCUS_23510 32 1552 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_23510 2139 1642 gene locus_tag LOCUS_23520 2139 1642 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_23520 2247 3707 gene locus_tag LOCUS_23530 2247 3707 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763223.1 protein_id gnl|my_center|LOCUS_23530 3712 4782 gene locus_tag LOCUS_23540 gene hydE 3712 4782 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_23540 4772 6253 gene locus_tag LOCUS_23550 gene hydG 4772 6253 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_23550 6281 7471 gene locus_tag LOCUS_23560 gene hydF 6281 7471 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_23560 7753 8079 gene locus_tag LOCUS_23570 7753 8079 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_23570 8162 9271 gene locus_tag LOCUS_23580 8162 9271 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence130 188 343 gene locus_tag LOCUS_23590 188 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1076 2248 gene locus_tag LOCUS_23600 1076 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2263 4431 gene locus_tag LOCUS_23610 2263 4431 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_23610 6079 4622 gene locus_tag LOCUS_23620 6079 4622 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_23620 6246 6968 gene locus_tag LOCUS_23630 6246 6968 CDS product DUF6249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790632.1 protein_id gnl|my_center|LOCUS_23630 6965 7510 gene locus_tag LOCUS_23640 6965 7510 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790634.1 protein_id gnl|my_center|LOCUS_23640 7491 7823 gene locus_tag LOCUS_23650 7491 7823 CDS product DUF5056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790636.1 protein_id gnl|my_center|LOCUS_23650 8102 9250 gene locus_tag LOCUS_23660 gene cls 8102 9250 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766459.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence131 52 1671 gene locus_tag LOCUS_23670 52 1671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_23670 2291 2037 gene locus_tag LOCUS_23680 2291 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3024 2323 gene locus_tag LOCUS_23690 3024 2323 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766768.1 protein_id gnl|my_center|LOCUS_23690 3207 3755 gene locus_tag LOCUS_23700 3207 3755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_23700 3756 5084 gene locus_tag LOCUS_23710 3756 5084 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_23710 6261 5536 gene locus_tag LOCUS_23720 gene pflA 6261 5536 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303181.1 protein_id gnl|my_center|LOCUS_23720 8491 6263 gene locus_tag LOCUS_23730 gene pflB 8491 6263 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786073.1 protein_id gnl|my_center|LOCUS_23730 9024 9109 gene locus_tag LOCUS_t00310 9024 9109 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 221 90 gene locus_tag LOCUS_23740 221 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2071 278 gene locus_tag LOCUS_23750 2071 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2609 5770 gene locus_tag LOCUS_23760 2609 5770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_23760 5789 7507 gene locus_tag LOCUS_23770 5789 7507 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_23770 7576 8847 gene locus_tag LOCUS_23780 7576 8847 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence133 1763 741 gene locus_tag LOCUS_23790 1763 741 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_23790 2483 1797 gene locus_tag LOCUS_23800 2483 1797 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_23800 2809 3450 gene locus_tag LOCUS_23810 gene cmk 2809 3450 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_23810 3458 4324 gene locus_tag LOCUS_23820 3458 4324 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_23820 4463 5443 gene locus_tag LOCUS_23830 gene pfkA 4463 5443 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_23830 6355 5516 gene locus_tag LOCUS_23840 6355 5516 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108118.1 protein_id gnl|my_center|LOCUS_23840 7615 6392 gene locus_tag LOCUS_23850 7615 6392 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108119.1 protein_id gnl|my_center|LOCUS_23850 8417 7647 gene locus_tag LOCUS_23860 8417 7647 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence134 2299 974 gene locus_tag LOCUS_23870 2299 974 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788816.1 protein_id gnl|my_center|LOCUS_23870 3123 2422 gene locus_tag LOCUS_23880 3123 2422 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_23880 3760 3152 gene locus_tag LOCUS_23890 gene hisIE 3760 3152 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_23890 4535 3780 gene locus_tag LOCUS_23900 gene hisF 4535 3780 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_23900 5309 4587 gene locus_tag LOCUS_23910 gene hisA 5309 4587 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_23910 5920 5330 gene locus_tag LOCUS_23920 gene hisH 5920 5330 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_23920 6379 5990 gene locus_tag LOCUS_23930 6379 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23930 6846 6343 gene locus_tag LOCUS_23940 6846 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23940 7201 7275 gene locus_tag LOCUS_t00320 7201 7275 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 547 1647 gene locus_tag LOCUS_23950 547 1647 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_23950 2774 1800 gene locus_tag LOCUS_23960 2774 1800 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202971.1 protein_id gnl|my_center|LOCUS_23960 3194 5401 gene locus_tag LOCUS_23970 3194 5401 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_23970 5525 6031 gene locus_tag LOCUS_23980 gene nrdG 5525 6031 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_23980 7429 6083 gene locus_tag LOCUS_23990 7429 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 7541 8263 gene locus_tag LOCUS_24000 7541 8263 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765763.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence136 51 1250 gene locus_tag LOCUS_24010 51 1250 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_24010 1304 2116 gene locus_tag LOCUS_24020 gene nagB 1304 2116 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_24020 2265 3407 gene locus_tag LOCUS_24030 2265 3407 CDS product TolB-like 6-bladed beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789047.1 protein_id gnl|my_center|LOCUS_24030 4291 3416 gene locus_tag LOCUS_24040 4291 3416 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_24040 4592 5689 gene locus_tag LOCUS_24050 4592 5689 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298120.1 protein_id gnl|my_center|LOCUS_24050 5824 6045 gene locus_tag LOCUS_24060 5824 6045 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797079.1 protein_id gnl|my_center|LOCUS_24060 6268 6495 gene locus_tag LOCUS_24070 6268 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 6654 7757 gene locus_tag LOCUS_24080 6654 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7765 7980 gene locus_tag LOCUS_24090 7765 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 8155 8355 gene locus_tag LOCUS_24100 8155 8355 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797079.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence137 1634 1044 gene locus_tag LOCUS_24110 1634 1044 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_24110 2156 1644 gene locus_tag LOCUS_24120 2156 1644 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_24120 2693 2283 gene locus_tag LOCUS_24130 2693 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3130 2699 gene locus_tag LOCUS_24140 3130 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4498 3281 gene locus_tag LOCUS_24150 4498 3281 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 protein_id gnl|my_center|LOCUS_24150 6119 4500 gene locus_tag LOCUS_24160 6119 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 8508 6385 gene locus_tag LOCUS_24170 8508 6385 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence138 995 186 gene locus_tag LOCUS_24180 995 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2368 1076 gene locus_tag LOCUS_24190 2368 1076 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_24190 2662 3276 gene locus_tag LOCUS_24200 2662 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_24200 3295 4074 gene locus_tag LOCUS_24210 3295 4074 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_24210 4065 4598 gene locus_tag LOCUS_24220 4065 4598 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_24220 6107 4662 gene locus_tag LOCUS_24230 gene cls 6107 4662 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_24230 <8461 6526 gene locus_tag LOCUS_24240 <8461 6526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796251.1:TonB-dependent receptor >Feature sequence139 622 20 gene locus_tag LOCUS_24250 622 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1841 627 gene locus_tag LOCUS_24260 1841 627 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_24260 2903 2190 gene locus_tag LOCUS_24270 2903 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 3761 2907 gene locus_tag LOCUS_24280 3761 2907 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286575.1 protein_id gnl|my_center|LOCUS_24280 4571 3810 gene locus_tag LOCUS_24290 4571 3810 CDS product DUF5045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310178.1 protein_id gnl|my_center|LOCUS_24290 5316 4582 gene locus_tag LOCUS_24300 5316 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322064.1 protein_id gnl|my_center|LOCUS_24300 7873 5309 gene locus_tag LOCUS_24310 7873 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203017.1 protein_id gnl|my_center|LOCUS_24310 8219 7896 gene locus_tag LOCUS_24320 8219 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence140 67 2790 gene locus_tag LOCUS_24330 gene ppdK 67 2790 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_24330 3077 4489 gene locus_tag LOCUS_24340 3077 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4793 4581 gene locus_tag LOCUS_24350 4793 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 5668 6054 gene locus_tag LOCUS_24360 5668 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 6173 7750 gene locus_tag LOCUS_24370 6173 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 8068 7784 gene locus_tag LOCUS_24380 8068 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence141 270 4139 gene locus_tag LOCUS_24390 270 4139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766976.1 protein_id gnl|my_center|LOCUS_24390 5293 4259 gene locus_tag LOCUS_24400 5293 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 6662 5751 gene locus_tag LOCUS_24410 gene lepB 6662 5751 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_24410 8156 6669 gene locus_tag LOCUS_24420 8156 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence142 1516 758 gene locus_tag LOCUS_24430 1516 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1977 1543 gene locus_tag LOCUS_24440 1977 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2603 2022 gene locus_tag LOCUS_24450 2603 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2790 2590 gene locus_tag LOCUS_24460 2790 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3166 2735 gene locus_tag LOCUS_24470 3166 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 3899 3171 gene locus_tag LOCUS_24480 3899 3171 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390536.1 protein_id gnl|my_center|LOCUS_24480 4844 3906 gene locus_tag LOCUS_24490 4844 3906 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_24490 6814 4853 gene locus_tag LOCUS_24500 6814 4853 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774194.1 protein_id gnl|my_center|LOCUS_24500 7100 6816 gene locus_tag LOCUS_24510 7100 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 7316 7104 gene locus_tag LOCUS_24520 7316 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 7882 7331 gene locus_tag LOCUS_24530 7882 7331 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107489.1 protein_id gnl|my_center|LOCUS_24530 8124 7879 gene locus_tag LOCUS_24540 8124 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence143 <1 1555 gene locus_tag LOCUS_24550 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764128.1:RagB/SusD family nutrient uptake outer membrane protein 1581 2297 gene locus_tag LOCUS_24560 1581 2297 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764129.1 protein_id gnl|my_center|LOCUS_24560 2369 5383 gene locus_tag LOCUS_24570 2369 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence144 354 2000 gene locus_tag LOCUS_24580 354 2000 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_24580 2106 2285 gene locus_tag LOCUS_24590 2106 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2318 3814 gene locus_tag LOCUS_24600 2318 3814 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_24600 3863 5266 gene locus_tag LOCUS_24610 3863 5266 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_24610 6984 5497 gene locus_tag LOCUS_24620 6984 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766136.1 protein_id gnl|my_center|LOCUS_24620 <8167 6971 gene locus_tag LOCUS_24630 <8167 6971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766137.1:AAA family ATPase >Feature sequence145 66 1424 gene locus_tag LOCUS_24640 66 1424 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_24640 4914 1648 gene locus_tag LOCUS_24650 4914 1648 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_24650 5951 5010 gene locus_tag LOCUS_24660 gene mdh 5951 5010 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 protein_id gnl|my_center|LOCUS_24660 6180 7058 gene locus_tag LOCUS_24670 6180 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence146 6463 641 gene locus_tag LOCUS_24680 6463 641 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108226.1 protein_id gnl|my_center|LOCUS_24680 7004 6450 gene locus_tag LOCUS_24690 7004 6450 CDS product DUF1896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485366.1 protein_id gnl|my_center|LOCUS_24690 <7979 7213 gene locus_tag LOCUS_24700 <7979 7213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202386.1:type IA DNA topoisomerase >Feature sequence147 186 347 gene locus_tag LOCUS_24710 186 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1652 525 gene locus_tag LOCUS_24720 1652 525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_24720 1846 3267 gene locus_tag LOCUS_24730 1846 3267 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_24730 5955 3421 gene locus_tag LOCUS_24740 5955 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 <7963 6283 gene locus_tag LOCUS_24750 <7963 6283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092901243.1:ATP-binding protein >Feature sequence148 345 58 gene locus_tag LOCUS_24760 345 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1632 451 gene locus_tag LOCUS_24770 1632 451 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_24770 2599 1661 gene locus_tag LOCUS_24780 2599 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3991 2927 gene locus_tag LOCUS_24790 3991 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4222 5226 gene locus_tag LOCUS_24800 4222 5226 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_24800 5303 7090 gene locus_tag LOCUS_24810 gene fucI 5303 7090 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence149 1915 1481 gene locus_tag LOCUS_24820 1915 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4217 1884 gene locus_tag LOCUS_24830 4217 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5597 4233 gene locus_tag LOCUS_24840 5597 4233 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_24840 5867 5667 gene locus_tag LOCUS_24850 5867 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6554 6321 gene locus_tag LOCUS_24860 6554 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence150 1429 350 gene locus_tag LOCUS_24870 1429 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_24870 2306 1437 gene locus_tag LOCUS_24880 2306 1437 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_24880 3471 2476 gene locus_tag LOCUS_24890 3471 2476 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_24890 4884 3667 gene locus_tag LOCUS_24900 4884 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 5181 4909 gene locus_tag LOCUS_24910 5181 4909 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_24910 6330 5260 gene locus_tag LOCUS_24920 gene rimO 6330 5260 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24920 6558 6337 gene locus_tag LOCUS_24930 6558 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24930 7514 6555 gene locus_tag LOCUS_24940 gene ftsY 7514 6555 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence151 <1 600 gene locus_tag LOCUS_24950 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303152.1:HAMP domain-containing sensor histidine kinase 646 1329 gene locus_tag LOCUS_24960 646 1329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_24960 2631 1573 gene locus_tag LOCUS_24970 2631 1573 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_24970 4128 2671 gene locus_tag LOCUS_24980 4128 2671 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_24980 4361 4600 gene locus_tag LOCUS_24990 4361 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_24990 4626 5228 gene locus_tag LOCUS_25000 4626 5228 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_25000 6129 5317 gene locus_tag LOCUS_25010 6129 5317 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_25010 <7430 6216 gene locus_tag LOCUS_25020 <7430 6216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790424.1:ribonuclease Y >Feature sequence152 2497 2165 gene locus_tag LOCUS_25030 2497 2165 CDS product DUF4133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291514.1 protein_id gnl|my_center|LOCUS_25030 2826 2509 gene locus_tag LOCUS_25040 2826 2509 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560983.1 protein_id gnl|my_center|LOCUS_25040 3743 3027 gene locus_tag LOCUS_25050 3743 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304280.1 protein_id gnl|my_center|LOCUS_25050 3982 3740 gene locus_tag LOCUS_25060 3982 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4355 4002 gene locus_tag LOCUS_25070 4355 4002 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291505.1 protein_id gnl|my_center|LOCUS_25070 4797 4357 gene locus_tag LOCUS_25080 4797 4357 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291503.1 protein_id gnl|my_center|LOCUS_25080 5561 4800 gene locus_tag LOCUS_25090 5561 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25090 6270 6698 gene locus_tag LOCUS_25100 gene mobA 6270 6698 CDS product conjugal transfer protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291488.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence153 343 939 gene locus_tag LOCUS_25110 343 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 943 2013 gene locus_tag LOCUS_25120 943 2013 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703827.1 protein_id gnl|my_center|LOCUS_25120 2070 2243 gene locus_tag LOCUS_25130 2070 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_25130 6240 2302 gene locus_tag LOCUS_25140 6240 2302 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109062.1 protein_id gnl|my_center|LOCUS_25140 7260 6241 gene locus_tag LOCUS_25150 7260 6241 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence154 615 1229 gene locus_tag LOCUS_25160 615 1229 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763992.1 protein_id gnl|my_center|LOCUS_25160 1226 2449 gene locus_tag LOCUS_25170 1226 2449 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_25170 2461 3435 gene locus_tag LOCUS_25180 2461 3435 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_25180 3432 4742 gene locus_tag LOCUS_25190 3432 4742 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_25190 5972 7189 gene locus_tag LOCUS_25200 gene nicX 5972 7189 CDS product group II intron reverse transcriptase/nicotine-degrading enzyme NicX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108394.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence155 333 1916 gene locus_tag LOCUS_25210 333 1916 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_25210 1954 2853 gene locus_tag LOCUS_25220 1954 2853 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762845.1 protein_id gnl|my_center|LOCUS_25220 2853 4163 gene locus_tag LOCUS_25230 2853 4163 CDS product DUF4302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767466.1 protein_id gnl|my_center|LOCUS_25230 4166 5197 gene locus_tag LOCUS_25240 4166 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 6081 5629 gene locus_tag LOCUS_25250 6081 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 6674 6093 gene locus_tag LOCUS_25260 6674 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203601.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence156 88 693 gene locus_tag LOCUS_25270 88 693 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_25270 690 2516 gene locus_tag LOCUS_25280 690 2516 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100251.1 protein_id gnl|my_center|LOCUS_25280 2550 2969 gene locus_tag LOCUS_25290 2550 2969 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_25290 3109 2930 gene locus_tag LOCUS_25300 3109 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3267 4928 gene locus_tag LOCUS_25310 3267 4928 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence157 1393 494 gene locus_tag LOCUS_25320 1393 494 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_25320 1666 4305 gene locus_tag LOCUS_25330 1666 4305 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_25330 4506 4709 gene locus_tag LOCUS_25340 4506 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4716 5057 gene locus_tag LOCUS_25350 4716 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4997 6010 gene locus_tag LOCUS_25360 4997 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6618 6112 gene locus_tag LOCUS_25370 6618 6112 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence158 499 2268 gene locus_tag LOCUS_25380 gene sppA 499 2268 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_25380 2407 3399 gene locus_tag LOCUS_25390 gene lpxK 2407 3399 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_25390 3383 4147 gene locus_tag LOCUS_25400 3383 4147 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_25400 4154 5203 gene locus_tag LOCUS_25410 gene thiL 4154 5203 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_25410 5347 5420 gene locus_tag LOCUS_t00330 5347 5420 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5692 6462 gene locus_tag LOCUS_25420 5692 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence159 <1 3370 gene locus_tag LOCUS_25430 <1 3370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202757.1:SusC/RagA family TonB-linked outer membrane protein 3390 4727 gene locus_tag LOCUS_25440 3390 4727 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_25440 5071 6060 gene locus_tag LOCUS_25450 5071 6060 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660204.1 protein_id gnl|my_center|LOCUS_25450 6829 6755 gene locus_tag LOCUS_t00340 6829 6755 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 409 29 gene locus_tag LOCUS_25460 gene rpsM 409 29 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_25460 788 570 gene locus_tag LOCUS_25470 gene infA 788 570 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_25470 1598 798 gene locus_tag LOCUS_25480 gene map 1598 798 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_25480 2955 1612 gene locus_tag LOCUS_25490 gene secY 2955 1612 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_25490 3406 2960 gene locus_tag LOCUS_25500 gene rplO 3406 2960 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_25500 3613 3437 gene locus_tag LOCUS_25510 gene rpmD 3613 3437 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_25510 4143 3625 gene locus_tag LOCUS_25520 gene rpsE 4143 3625 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791564.1 protein_id gnl|my_center|LOCUS_25520 4412 4149 gene locus_tag LOCUS_25530 gene rplR 4412 4149 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_25530 5083 4514 gene locus_tag LOCUS_25540 gene rplF 5083 4514 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_25540 5494 5099 gene locus_tag LOCUS_25550 gene rpsH 5494 5099 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_25550 5849 5550 gene locus_tag LOCUS_25560 gene rpsN 5849 5550 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_25560 6411 5854 gene locus_tag LOCUS_25570 gene rplE 6411 5854 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_25570 6731 6411 gene locus_tag LOCUS_25580 gene rplX 6731 6411 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence161 <1 2482 gene locus_tag LOCUS_25590 <1 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202522.1:SLBB domain-containing protein 2491 3597 gene locus_tag LOCUS_25600 2491 3597 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_25600 3594 3923 gene locus_tag LOCUS_25610 3594 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3920 4378 gene locus_tag LOCUS_25620 3920 4378 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_25620 5700 4528 gene locus_tag LOCUS_25630 gene dnaJ 5700 4528 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_25630 6344 5712 gene locus_tag LOCUS_25640 6344 5712 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence162 2465 423 gene locus_tag LOCUS_25650 gene metG 2465 423 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_25650 2626 3483 gene locus_tag LOCUS_25660 2626 3483 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202990.1 protein_id gnl|my_center|LOCUS_25660 4132 3692 gene locus_tag LOCUS_25670 4132 3692 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_25670 <6599 4455 gene locus_tag LOCUS_25680 <6599 4455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082478.1:beta-glucosidase >Feature sequence163 1547 1110 gene locus_tag LOCUS_25690 1547 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2072 1632 gene locus_tag LOCUS_25700 2072 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2488 2072 gene locus_tag LOCUS_25710 2488 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2742 2485 gene locus_tag LOCUS_25720 2742 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3754 2744 gene locus_tag LOCUS_25730 3754 2744 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964503.1 protein_id gnl|my_center|LOCUS_25730 3943 3767 gene locus_tag LOCUS_25740 3943 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 4110 3949 gene locus_tag LOCUS_25750 4110 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 4922 4107 gene locus_tag LOCUS_25760 4922 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5545 5075 gene locus_tag LOCUS_25770 5545 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 5816 5553 gene locus_tag LOCUS_25780 5816 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 6472 5813 gene locus_tag LOCUS_25790 6472 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence164 132 725 gene locus_tag LOCUS_25800 132 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3085 740 gene locus_tag LOCUS_25810 3085 740 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_25810 4434 3091 gene locus_tag LOCUS_25820 4434 3091 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_25820 5674 4436 gene locus_tag LOCUS_25830 5674 4436 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_25830 <6467 5699 gene locus_tag LOCUS_25840 <6467 5699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792021.1:peptidylprolyl isomerase >Feature sequence165 269 658 gene locus_tag LOCUS_25850 269 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203265.1 protein_id gnl|my_center|LOCUS_25850 1966 719 gene locus_tag LOCUS_25860 1966 719 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_25860 2181 1987 gene locus_tag LOCUS_25870 2181 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3106 2183 gene locus_tag LOCUS_25880 3106 2183 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_25880 4283 3216 gene locus_tag LOCUS_25890 gene serC 4283 3216 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_25890 5895 4558 gene locus_tag LOCUS_25900 5895 4558 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence166 3347 3985 gene locus_tag LOCUS_25910 3347 3985 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107770.1 protein_id gnl|my_center|LOCUS_25910 4082 4888 gene locus_tag LOCUS_25920 gene nudC 4082 4888 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_25920 6041 5277 gene locus_tag LOCUS_25930 6041 5277 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence167 1576 269 gene locus_tag LOCUS_25940 1576 269 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786583.1 protein_id gnl|my_center|LOCUS_25940 2188 1607 gene locus_tag LOCUS_25950 2188 1607 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786586.1 protein_id gnl|my_center|LOCUS_25950 3785 2193 gene locus_tag LOCUS_25960 3785 2193 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_25960 4893 3862 gene locus_tag LOCUS_25970 gene mltG 4893 3862 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_25970 5016 5189 gene locus_tag LOCUS_25980 5016 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 5205 5378 gene locus_tag LOCUS_25990 5205 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 5460 5533 gene locus_tag LOCUS_t00350 5460 5533 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence168 777 115 gene locus_tag LOCUS_26000 777 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2981 984 gene locus_tag LOCUS_26010 2981 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 <6247 3003 gene locus_tag LOCUS_26020 <6247 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766148.1:TonB-dependent receptor >Feature sequence169 4582 1343 gene locus_tag LOCUS_26030 4582 1343 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_26030 <6173 4874 gene locus_tag LOCUS_26040 <6173 4874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013547257.1:transcriptional regulator >Feature sequence170 1001 228 gene locus_tag LOCUS_26050 1001 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3067 1007 gene locus_tag LOCUS_26060 3067 1007 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_26060 3165 4691 gene locus_tag LOCUS_26070 gene gltX 3165 4691 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_26070 4723 5943 gene locus_tag LOCUS_26080 4723 5943 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence171 753 199 gene locus_tag LOCUS_26090 753 199 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_26090 1126 926 gene locus_tag LOCUS_26100 1126 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1761 1345 gene locus_tag LOCUS_26110 1761 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3160 1763 gene locus_tag LOCUS_26120 3160 1763 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_26120 4333 3182 gene locus_tag LOCUS_26130 4333 3182 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_26130 5013 4940 gene locus_tag LOCUS_t00360 5013 4940 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5903 5100 gene locus_tag LOCUS_26140 5903 5100 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence172 801 415 gene locus_tag LOCUS_26150 801 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2875 956 gene locus_tag LOCUS_26160 gene dnaK 2875 956 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_26160 3315 4721 gene locus_tag LOCUS_26170 3315 4721 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_26170 4784 5350 gene locus_tag LOCUS_26180 4784 5350 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_26180 <5970 5432 gene locus_tag LOCUS_26190 <5970 5432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785793.1:META domain-containing protein >Feature sequence173 2712 1810 gene locus_tag LOCUS_26200 2712 1810 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_26200 5741 2817 gene locus_tag LOCUS_26210 5741 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence174 592 290 gene locus_tag LOCUS_26220 592 290 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308755.1 protein_id gnl|my_center|LOCUS_26220 1470 730 gene locus_tag LOCUS_26230 1470 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1940 1467 gene locus_tag LOCUS_26240 1940 1467 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291503.1 protein_id gnl|my_center|LOCUS_26240 2698 1949 gene locus_tag LOCUS_26250 2698 1949 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108210.1 protein_id gnl|my_center|LOCUS_26250 3406 3849 gene locus_tag LOCUS_26260 gene mobA 3406 3849 CDS product conjugal transfer protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007216065.1 protein_id gnl|my_center|LOCUS_26260 3834 5081 gene locus_tag LOCUS_26270 gene mobB 3834 5081 CDS product conjugal transfer protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108212.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence175 2577 514 gene locus_tag LOCUS_26280 2577 514 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_26280 2742 5309 gene locus_tag LOCUS_26290 2742 5309 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence176 487 155 gene locus_tag LOCUS_26300 487 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2382 520 gene locus_tag LOCUS_26310 2382 520 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_26310 5572 2414 gene locus_tag LOCUS_26320 5572 2414 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence177 52 1233 gene locus_tag LOCUS_26330 52 1233 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_26330 1548 2807 gene locus_tag LOCUS_26340 1548 2807 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_26340 2830 3414 gene locus_tag LOCUS_26350 2830 3414 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_26350 3416 4114 gene locus_tag LOCUS_26360 3416 4114 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_26360 4136 5689 gene locus_tag LOCUS_26370 4136 5689 CDS product DUF4836 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801225.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence178 386 934 gene locus_tag LOCUS_26380 386 934 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_26380 952 1623 gene locus_tag LOCUS_26390 952 1623 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_26390 1611 3707 gene locus_tag LOCUS_26400 gene recG 1611 3707 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_26400 3968 4849 gene locus_tag LOCUS_26410 3968 4849 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_26410 4986 5528 gene locus_tag LOCUS_26420 4986 5528 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence179 1736 216 gene locus_tag LOCUS_26430 1736 216 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_26430 1923 2618 gene locus_tag LOCUS_26440 1923 2618 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_26440 2623 3156 gene locus_tag LOCUS_26450 2623 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3412 4542 gene locus_tag LOCUS_26460 3412 4542 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295521.1 protein_id gnl|my_center|LOCUS_26460 4605 5156 gene locus_tag LOCUS_26470 4605 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5234 5635 gene locus_tag LOCUS_26480 5234 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence180 893 693 gene locus_tag LOCUS_26490 893 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1243 1818 gene locus_tag LOCUS_26500 1243 1818 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_26500 1831 2016 gene locus_tag LOCUS_26510 gene rpmF 1831 2016 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_26510 2140 3144 gene locus_tag LOCUS_26520 2140 3144 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_26520 3230 4111 gene locus_tag LOCUS_26530 gene era 3230 4111 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_26530 4161 5474 gene locus_tag LOCUS_26540 gene der 4161 5474 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence181 2221 2979 gene locus_tag LOCUS_26550 2221 2979 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_26550 3280 2933 gene locus_tag LOCUS_26560 3280 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107461.1 protein_id gnl|my_center|LOCUS_26560 4098 3277 gene locus_tag LOCUS_26570 4098 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4832 4191 gene locus_tag LOCUS_26580 4832 4191 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_26580 5215 4835 gene locus_tag LOCUS_26590 5215 4835 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence182 3758 2625 gene locus_tag LOCUS_26600 3758 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 5349 3745 gene locus_tag LOCUS_26610 5349 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 5564 5352 gene locus_tag LOCUS_26620 5564 5352 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence183 225 2963 gene locus_tag LOCUS_26630 225 2963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_26630 2995 4542 gene locus_tag LOCUS_26640 2995 4542 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_26640 4564 5427 gene locus_tag LOCUS_26650 4564 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence184 <1 510 gene locus_tag LOCUS_26660 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164979579.1:AAA domain-containing protein 1312 767 gene locus_tag LOCUS_26670 1312 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1854 1309 gene locus_tag LOCUS_26680 1854 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2621 1884 gene locus_tag LOCUS_26690 2621 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3871 2627 gene locus_tag LOCUS_26700 3871 2627 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199160.1 protein_id gnl|my_center|LOCUS_26700 5183 3846 gene locus_tag LOCUS_26710 5183 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5385 5155 gene locus_tag LOCUS_26720 5385 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence185 930 190 gene locus_tag LOCUS_26730 930 190 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_26730 2252 1692 gene locus_tag LOCUS_26740 2252 1692 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323418.1 protein_id gnl|my_center|LOCUS_26740 3017 3238 gene locus_tag LOCUS_26750 3017 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3561 3235 gene locus_tag LOCUS_26760 3561 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4065 3718 gene locus_tag LOCUS_26770 4065 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4427 4173 gene locus_tag LOCUS_26780 4427 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence186 467 958 gene locus_tag LOCUS_26790 467 958 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308674.1 protein_id gnl|my_center|LOCUS_26790 1591 1208 gene locus_tag LOCUS_26800 1591 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2654 1593 gene locus_tag LOCUS_26810 2654 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3261 2785 gene locus_tag LOCUS_26820 3261 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 5306 3258 gene locus_tag LOCUS_26830 5306 3258 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202386.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence187 <1 627 gene locus_tag LOCUS_26840 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291471.1:sigma-54 dependent transcriptional regulator 908 1321 gene locus_tag LOCUS_26850 908 1321 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291474.1 protein_id gnl|my_center|LOCUS_26850 1533 2138 gene locus_tag LOCUS_26860 1533 2138 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304269.1 protein_id gnl|my_center|LOCUS_26860 2215 3363 gene locus_tag LOCUS_26870 2215 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 <5390 3414 gene locus_tag LOCUS_26880 <5390 3414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291482.1:conjugal transfer protein MobC >Feature sequence188 681 412 gene locus_tag LOCUS_26890 gene rpmA 681 412 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_26890 1021 704 gene locus_tag LOCUS_26900 gene rplU 1021 704 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_26900 2347 1658 gene locus_tag LOCUS_26910 2347 1658 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759985.1 protein_id gnl|my_center|LOCUS_26910 2521 4752 gene locus_tag LOCUS_26920 2521 4752 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109056.1 protein_id gnl|my_center|LOCUS_26920 4764 4949 gene locus_tag LOCUS_26930 4764 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26930 >Feature sequence189 544 326 gene locus_tag LOCUS_26940 544 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26940 856 650 gene locus_tag LOCUS_26950 856 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 916 2655 gene locus_tag LOCUS_26960 916 2655 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_26960 2660 4072 gene locus_tag LOCUS_26970 2660 4072 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788591.1 protein_id gnl|my_center|LOCUS_26970 4101 4739 gene locus_tag LOCUS_26980 4101 4739 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence190 2545 518 gene locus_tag LOCUS_26990 gene rho 2545 518 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_26990 2822 3670 gene locus_tag LOCUS_27000 2822 3670 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694770.1 protein_id gnl|my_center|LOCUS_27000 4942 3674 gene locus_tag LOCUS_27010 gene tilS 4942 3674 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence191 212 673 gene locus_tag LOCUS_27020 212 673 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_27020 792 1568 gene locus_tag LOCUS_27030 792 1568 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_27030 1556 2467 gene locus_tag LOCUS_27040 1556 2467 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_27040 3238 2561 gene locus_tag LOCUS_27050 gene trmD 3238 2561 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence192 807 445 gene locus_tag LOCUS_27060 807 445 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_27060 1610 894 gene locus_tag LOCUS_27070 1610 894 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_27070 2323 1610 gene locus_tag LOCUS_27080 2323 1610 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_27080 2427 3296 gene locus_tag LOCUS_27090 2427 3296 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_27090 3578 4981 gene locus_tag LOCUS_27100 3578 4981 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence193 2862 811 gene locus_tag LOCUS_27110 2862 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3633 5144 gene locus_tag LOCUS_27120 gene accC 3633 5144 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence194 1417 92 gene locus_tag LOCUS_27130 1417 92 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_27130 3306 1552 gene locus_tag LOCUS_27140 3306 1552 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_27140 4165 3326 gene locus_tag LOCUS_27150 4165 3326 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_27150 4772 4182 gene locus_tag LOCUS_27160 4772 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence195 1497 13 gene locus_tag LOCUS_27170 1497 13 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_27170 2980 1634 gene locus_tag LOCUS_27180 gene purB 2980 1634 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_27180 3212 3137 gene locus_tag LOCUS_t00370 3212 3137 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <5226 3535 gene locus_tag LOCUS_27190 <5226 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799108.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit >Feature sequence196 886 596 gene locus_tag LOCUS_27200 886 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2310 886 gene locus_tag LOCUS_27210 2310 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3756 2326 gene locus_tag LOCUS_27220 3756 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4135 3743 gene locus_tag LOCUS_27230 4135 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4557 4318 gene locus_tag LOCUS_27240 4557 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 5195 4590 gene locus_tag LOCUS_27250 5195 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence197 524 1660 gene locus_tag LOCUS_27260 524 1660 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_27260 2251 1721 gene locus_tag LOCUS_27270 2251 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2616 2272 gene locus_tag LOCUS_27280 2616 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3080 3670 gene locus_tag LOCUS_27290 3080 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4781 3831 gene locus_tag LOCUS_27300 4781 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence198 1750 113 gene locus_tag LOCUS_27310 gene groL 1750 113 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_27310 2065 1793 gene locus_tag LOCUS_27320 2065 1793 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_27320 3073 2312 gene locus_tag LOCUS_27330 3073 2312 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_27330 3280 3122 gene locus_tag LOCUS_27340 3280 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4789 3428 gene locus_tag LOCUS_27350 gene hisS 4789 3428 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence199 163 1182 gene locus_tag LOCUS_27360 163 1182 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_27360 1190 4540 gene locus_tag LOCUS_27370 1190 4540 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence200 588 920 gene locus_tag LOCUS_27380 588 920 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_27380 1205 1789 gene locus_tag LOCUS_27390 1205 1789 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_27390 1794 2660 gene locus_tag LOCUS_27400 1794 2660 CDS product DUF5712 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_27400 2882 4147 gene locus_tag LOCUS_27410 2882 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence201 2503 4878 gene locus_tag LOCUS_27420 2503 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence202 <1 805 gene locus_tag LOCUS_27430 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase 1801 818 gene locus_tag LOCUS_27440 1801 818 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_27440 1898 3184 gene locus_tag LOCUS_27450 1898 3184 CDS product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453709.1 protein_id gnl|my_center|LOCUS_27450 3278 3814 gene locus_tag LOCUS_27460 3278 3814 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_27460 3817 4152 gene locus_tag LOCUS_27470 3817 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789521.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence203 36 425 gene locus_tag LOCUS_27480 gene rpsK 36 425 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_27480 542 1147 gene locus_tag LOCUS_27490 gene rpsD 542 1147 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_27490 1159 1293 gene locus_tag LOCUS_27500 1159 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27500 1274 2170 gene locus_tag LOCUS_27510 1274 2170 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_27510 1278 1287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2174 2677 gene locus_tag LOCUS_27520 2174 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3340 3669 gene locus_tag LOCUS_27530 3340 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3791 4207 gene locus_tag LOCUS_27540 3791 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27540 4318 4737 gene locus_tag LOCUS_27550 4318 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770214.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence204 4677 1501 gene locus_tag LOCUS_27560 4677 1501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783448.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence205 564 82 gene locus_tag LOCUS_27570 gene ybaK 564 82 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_27570 3415 548 gene locus_tag LOCUS_27580 gene uvrA 3415 548 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence206 1314 475 gene locus_tag LOCUS_27590 1314 475 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_27590 1442 2050 gene locus_tag LOCUS_27600 1442 2050 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_27600 2043 2687 gene locus_tag LOCUS_27610 2043 2687 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_27610 2696 3568 gene locus_tag LOCUS_27620 2696 3568 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 protein_id gnl|my_center|LOCUS_27620 4693 3953 gene locus_tag LOCUS_27630 4693 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence207 1041 358 gene locus_tag LOCUS_27640 gene pseF 1041 358 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_27640 2201 1038 gene locus_tag LOCUS_27650 gene pseC 2201 1038 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_27650 3220 2198 gene locus_tag LOCUS_27660 gene pseB 3220 2198 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_27660 3723 3235 gene locus_tag LOCUS_27670 3723 3235 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202140.1 protein_id gnl|my_center|LOCUS_27670 4295 3759 gene locus_tag LOCUS_27680 gene upgY 4295 3759 CDS product capsular polysaccharide transcription antiterminator UpgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784914.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence208 <4665 40 gene locus_tag LOCUS_27690 <4665 40 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291462.1:N-6 DNA methylase >Feature sequence209 <1 2399 gene locus_tag LOCUS_27700 <1 2399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202662.1:ATP-dependent Clp protease ATP-binding subunit 2408 2824 gene locus_tag LOCUS_27710 2408 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2835 3398 gene locus_tag LOCUS_27720 2835 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3386 3853 gene locus_tag LOCUS_27730 3386 3853 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202658.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence210 96 677 gene locus_tag LOCUS_27740 96 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 758 1909 gene locus_tag LOCUS_27750 758 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1985 2527 gene locus_tag LOCUS_27760 1985 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2594 3076 gene locus_tag LOCUS_27770 2594 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194199.1 protein_id gnl|my_center|LOCUS_27770 3108 3734 gene locus_tag LOCUS_27780 3108 3734 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989391.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence211 2743 3459 gene locus_tag LOCUS_27790 2743 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence212 1230 922 gene locus_tag LOCUS_27800 1230 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2448 1369 gene locus_tag LOCUS_27810 2448 1369 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_27810 3904 2528 gene locus_tag LOCUS_27820 3904 2528 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_27820 4281 3916 gene locus_tag LOCUS_27830 4281 3916 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202325.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence213 1942 722 gene locus_tag LOCUS_27840 1942 722 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_27840 <4506 1994 gene locus_tag LOCUS_27850 <4506 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787886.1:DNA gyrase subunit A >Feature sequence214 1797 1249 gene locus_tag LOCUS_27860 gene rfbC 1797 1249 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761514.1 protein_id gnl|my_center|LOCUS_27860 3166 1802 gene locus_tag LOCUS_27870 3166 1802 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_27870 3452 4378 gene locus_tag LOCUS_27880 3452 4378 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence215 <1 591 gene locus_tag LOCUS_27890 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759897.1:Fic family protein 591 1979 gene locus_tag LOCUS_27900 gene rhuM 591 1979 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303134.1 protein_id gnl|my_center|LOCUS_27900 2143 2820 gene locus_tag LOCUS_27910 2143 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3875 3024 gene locus_tag LOCUS_27920 3875 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 <4415 3887 gene locus_tag LOCUS_27930 <4415 3887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203140.1:ATP-binding protein >Feature sequence216 <1 634 gene locus_tag LOCUS_27940 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007485401.1:DUF4141 domain-containing protein 640 1710 gene locus_tag LOCUS_27950 gene traJ 640 1710 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_27950 1765 2388 gene locus_tag LOCUS_27960 gene traK 1765 2388 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776802.1 protein_id gnl|my_center|LOCUS_27960 2393 2677 gene locus_tag LOCUS_27970 2393 2677 CDS product TraL conjugative transposon family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202374.1 protein_id gnl|my_center|LOCUS_27970 2684 4081 gene locus_tag LOCUS_27980 gene traM 2684 4081 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108206.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence217 801 121 gene locus_tag LOCUS_27990 801 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 2488 1145 gene locus_tag LOCUS_28000 2488 1145 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_28000 2662 3384 gene locus_tag LOCUS_28010 2662 3384 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784721.1 protein_id gnl|my_center|LOCUS_28010 3670 3425 gene locus_tag LOCUS_28020 3670 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28020 3696 4130 gene locus_tag LOCUS_28030 3696 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence218 525 13 gene locus_tag LOCUS_28040 525 13 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_28040 2326 530 gene locus_tag LOCUS_28050 2326 530 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_28050 3031 3222 gene locus_tag LOCUS_28060 gene rpsU 3031 3222 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_28060 3295 4179 gene locus_tag LOCUS_28070 gene xerC 3295 4179 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence219 70 282 gene locus_tag LOCUS_28080 gene xseB 70 282 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791731.1 protein_id gnl|my_center|LOCUS_28080 336 1355 gene locus_tag LOCUS_28090 336 1355 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_28090 1432 2190 gene locus_tag LOCUS_28100 gene trmB 1432 2190 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_28100 2265 3365 gene locus_tag LOCUS_28110 2265 3365 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_28110 <4294 3458 gene locus_tag LOCUS_28120 <4294 3458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109009.1:M56 family metallopeptidase >Feature sequence220 354 1151 gene locus_tag LOCUS_28130 354 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766610.1 protein_id gnl|my_center|LOCUS_28130 1376 2212 gene locus_tag LOCUS_28140 1376 2212 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_28140 2250 2822 gene locus_tag LOCUS_28150 2250 2822 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_28150 2870 3235 gene locus_tag LOCUS_28160 2870 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109213.1 protein_id gnl|my_center|LOCUS_28160 3261 3734 gene locus_tag LOCUS_28170 3261 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence221 1439 663 gene locus_tag LOCUS_28180 1439 663 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_28180 1676 1954 gene locus_tag LOCUS_28190 1676 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2884 1994 gene locus_tag LOCUS_28200 gene bla 2884 1994 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_28200 3210 2941 gene locus_tag LOCUS_28210 3210 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 4159 3365 gene locus_tag LOCUS_28220 4159 3365 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761029.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence222 1143 223 gene locus_tag LOCUS_28230 1143 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2632 1625 gene locus_tag LOCUS_28240 2632 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3837 2740 gene locus_tag LOCUS_28250 3837 2740 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789041.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence223 774 241 gene locus_tag LOCUS_28260 774 241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_28260 2028 799 gene locus_tag LOCUS_28270 2028 799 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_28270 2316 2789 gene locus_tag LOCUS_28280 2316 2789 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_28280 3280 2792 gene locus_tag LOCUS_28290 3280 2792 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_28290 4018 3323 gene locus_tag LOCUS_28300 4018 3323 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence224 512 1012 gene locus_tag LOCUS_28310 512 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788879.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence225 2 199 gene locus_tag LOCUS_28320 2 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence226 <1 512 gene locus_tag LOCUS_28330 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202518.1:tetratricopeptide repeat protein 592 2532 gene locus_tag LOCUS_28340 gene thrS 592 2532 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_28340 2654 3253 gene locus_tag LOCUS_28350 gene infC 2654 3253 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_28350 3670 3969 gene locus_tag LOCUS_28360 gene rplT 3670 3969 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence227 >Feature sequence228 192 803 gene locus_tag LOCUS_28370 192 803 CDS product DUF4141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304283.1 protein_id gnl|my_center|LOCUS_28370 807 1811 gene locus_tag LOCUS_28380 gene traJ 807 1811 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291518.1 protein_id gnl|my_center|LOCUS_28380 1844 2467 gene locus_tag LOCUS_28390 gene traK 1844 2467 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291519.1 protein_id gnl|my_center|LOCUS_28390 2507 2794 gene locus_tag LOCUS_28400 2507 2794 CDS product TraL conjugative transposon family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291520.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence229 3801 1450 gene locus_tag LOCUS_28410 3801 1450 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence230 1069 29 gene locus_tag LOCUS_28420 1069 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3709 1181 gene locus_tag LOCUS_28430 3709 1181 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence231 2 268 gene locus_tag LOCUS_28440 2 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 301 1308 gene locus_tag LOCUS_28450 301 1308 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_28450 1418 2701 gene locus_tag LOCUS_28460 1418 2701 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence232 518 1708 gene locus_tag LOCUS_28470 518 1708 CDS product Tsr0667 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784676.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence233 <1 840 gene locus_tag LOCUS_28480 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107514.1:VWA domain-containing protein 907 1935 gene locus_tag LOCUS_28490 907 1935 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_28490 1932 2642 gene locus_tag LOCUS_28500 1932 2642 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence234 304 546 gene locus_tag LOCUS_28510 304 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 543 1034 gene locus_tag LOCUS_28520 543 1034 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_28520 1015 1248 gene locus_tag LOCUS_28530 1015 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3717 2038 gene locus_tag LOCUS_28540 3717 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence235 183 109 gene locus_tag LOCUS_t00380 183 109 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 579 259 gene locus_tag LOCUS_28550 579 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28550 2493 610 gene locus_tag LOCUS_28560 2493 610 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768894.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28560 <3836 2739 gene locus_tag LOCUS_28570 <3836 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202859.1:molecular chaperone HtpG >Feature sequence236 <1 1539 gene locus_tag LOCUS_28580 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108230.1:bifunctional DNA primase/helicase 1536 1934 gene locus_tag LOCUS_28590 1536 1934 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643639.1 protein_id gnl|my_center|LOCUS_28590 2360 2923 gene locus_tag LOCUS_28600 2360 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 2920 3708 gene locus_tag LOCUS_28610 2920 3708 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence237 375 1187 gene locus_tag LOCUS_28620 375 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1840 3708 gene locus_tag LOCUS_28630 1840 3708 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence238 171 1394 gene locus_tag LOCUS_28640 171 1394 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551117.1 protein_id gnl|my_center|LOCUS_28640 2041 1484 gene locus_tag LOCUS_28650 gene nadD 2041 1484 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_28650 2300 2064 gene locus_tag LOCUS_28660 2300 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2860 2297 gene locus_tag LOCUS_28670 gene gmk 2860 2297 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_28670 3789 2905 gene locus_tag LOCUS_28680 3789 2905 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence239 454 1572 gene locus_tag LOCUS_28690 454 1572 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102408502.1 protein_id gnl|my_center|LOCUS_28690 2089 1856 gene locus_tag LOCUS_28700 2089 1856 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202095.1 protein_id gnl|my_center|LOCUS_28700 2523 2230 gene locus_tag LOCUS_28710 2523 2230 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478799.1 protein_id gnl|my_center|LOCUS_28710 3112 3324 gene locus_tag LOCUS_28720 3112 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 3296 3305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 <1 971 gene locus_tag LOCUS_28730 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107338.1:S9 family peptidase 1846 1349 gene locus_tag LOCUS_28740 1846 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3154 1904 gene locus_tag LOCUS_28750 3154 1904 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence241 103 882 gene locus_tag LOCUS_28760 103 882 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817413.1 protein_id gnl|my_center|LOCUS_28760 1045 1133 gene locus_tag LOCUS_t00390 1045 1133 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1210 2004 gene locus_tag LOCUS_28770 1210 2004 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_28770 2010 2483 gene locus_tag LOCUS_28780 2010 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761056.1 protein_id gnl|my_center|LOCUS_28780 2535 3125 gene locus_tag LOCUS_28790 2535 3125 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_28790 3125 3589 gene locus_tag LOCUS_28800 3125 3589 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence242 2069 747 gene locus_tag LOCUS_28810 2069 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 <3726 2091 gene locus_tag LOCUS_28820 <3726 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203741.1:TonB-dependent receptor >Feature sequence243 1367 219 gene locus_tag LOCUS_28830 gene wecB 1367 219 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_28830 2588 1383 gene locus_tag LOCUS_28840 gene wecC 2588 1383 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_28840 3121 2639 gene locus_tag LOCUS_28850 3121 2639 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817126.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence244 <1 1100 gene locus_tag LOCUS_28860 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256729.1:helicase-related protein >Feature sequence245 332 607 gene locus_tag LOCUS_28870 332 607 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_28870 612 770 gene locus_tag LOCUS_28880 612 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 748 987 gene locus_tag LOCUS_28890 748 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2741 1536 gene locus_tag LOCUS_28900 2741 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_28900 3505 2861 gene locus_tag LOCUS_28910 3505 2861 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence246 66 416 gene locus_tag LOCUS_28920 66 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202663.1 protein_id gnl|my_center|LOCUS_28920 445 1830 gene locus_tag LOCUS_28930 445 1830 CDS product DUF5458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787102.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence247 295 1194 gene locus_tag LOCUS_28940 295 1194 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202651.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence248 2407 47 gene locus_tag LOCUS_28950 2407 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3222 2602 gene locus_tag LOCUS_28960 3222 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2608 2617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 507 2033 gene locus_tag LOCUS_28970 507 2033 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence250 311 985 gene locus_tag LOCUS_28980 311 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1053 2138 gene locus_tag LOCUS_28990 1053 2138 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_28990 3339 2152 gene locus_tag LOCUS_29000 3339 2152 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389902.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence251 499 20 gene locus_tag LOCUS_29010 499 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 737 1966 gene locus_tag LOCUS_29020 737 1966 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_29020 1972 2475 gene locus_tag LOCUS_29030 1972 2475 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_29030 <3464 2554 gene locus_tag LOCUS_29040 <3464 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109034.1:phosphoglucosamine mutase >Feature sequence252 18 1658 gene locus_tag LOCUS_29050 18 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2062 2652 gene locus_tag LOCUS_29060 2062 2652 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_29060 2639 2830 gene locus_tag LOCUS_29070 2639 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence253 963 91 gene locus_tag LOCUS_29080 963 91 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_29080 999 1358 gene locus_tag LOCUS_29090 999 1358 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_29090 1941 1363 gene locus_tag LOCUS_29100 1941 1363 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764610.1 protein_id gnl|my_center|LOCUS_29100 2297 2007 gene locus_tag LOCUS_29110 2297 2007 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_29110 3081 2299 gene locus_tag LOCUS_29120 3081 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3386 3078 gene locus_tag LOCUS_29130 3386 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence254 <1 860 gene locus_tag LOCUS_29140 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349776.1:ATP-binding protein 930 2696 gene locus_tag LOCUS_29150 930 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence255 1739 249 gene locus_tag LOCUS_29160 gene xylE 1739 249 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_29160 3168 1852 gene locus_tag LOCUS_29170 gene xylA 3168 1852 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence256 2998 1301 gene locus_tag LOCUS_29180 gene ettA 2998 1301 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_29180 3138 3211 gene locus_tag LOCUS_t00400 3138 3211 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence257 373 301 gene locus_tag LOCUS_t00410 373 301 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3128 657 gene locus_tag LOCUS_29190 gene feoB 3128 657 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence258 <1 1553 gene locus_tag LOCUS_29200 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107104.1:TraG family conjugative transposon ATPase 1561 1920 gene locus_tag LOCUS_29210 1561 1920 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291516.1 protein_id gnl|my_center|LOCUS_29210 1934 2302 gene locus_tag LOCUS_29220 1934 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2343 3257 gene locus_tag LOCUS_29230 2343 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence259 411 1385 gene locus_tag LOCUS_29240 411 1385 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_29240 1612 2985 gene locus_tag LOCUS_29250 1612 2985 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence260 17 874 gene locus_tag LOCUS_29260 17 874 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_29260 898 1830 gene locus_tag LOCUS_29270 gene cas1 898 1830 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_29270 1830 2162 gene locus_tag LOCUS_29280 gene cas2 1830 2162 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence261 222 2546 gene locus_tag LOCUS_29290 222 2546 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_29290 2686 3168 gene locus_tag LOCUS_29300 2686 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence262 <1 1366 gene locus_tag LOCUS_29310 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763133.1:glutamate synthase subunit beta 1477 3147 gene locus_tag LOCUS_29320 gene asnB 1477 3147 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence263 693 61 gene locus_tag LOCUS_29330 693 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1904 690 gene locus_tag LOCUS_29340 1904 690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_29340 3151 2051 gene locus_tag LOCUS_29350 3151 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence264 36 482 gene locus_tag LOCUS_29360 36 482 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_29360 513 2522 gene locus_tag LOCUS_29370 513 2522 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_29370 2661 2987 gene locus_tag LOCUS_29380 2661 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29380 >Feature sequence265 <1 711 gene locus_tag LOCUS_29390 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794868.1:creatininase family protein 2241 1657 gene locus_tag LOCUS_29400 2241 1657 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_29400 2732 2385 gene locus_tag LOCUS_29410 2732 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2960 3049 gene locus_tag LOCUS_t00420 2960 3049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3053 3126 gene locus_tag LOCUS_t00430 3053 3126 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence266 2064 568 gene locus_tag LOCUS_29420 2064 568 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_29420 <3114 2097 gene locus_tag LOCUS_29430 <3114 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104967.1:ATP-binding protein >Feature sequence267 105 1382 gene locus_tag LOCUS_29440 105 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence268 170 1063 gene locus_tag LOCUS_29450 170 1063 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765278.1 protein_id gnl|my_center|LOCUS_29450 1080 1901 gene locus_tag LOCUS_29460 1080 1901 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_29460 2024 2920 gene locus_tag LOCUS_29470 2024 2920 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202474.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence269 529 1722 gene locus_tag LOCUS_29480 529 1722 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_29480 1754 2200 gene locus_tag LOCUS_29490 gene bcp 1754 2200 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence270 <1 752 gene locus_tag LOCUS_29500 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796397.1:mechanosensitive ion channel 2783 1017 gene locus_tag LOCUS_29510 2783 1017 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107898.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence271 <3048 349 gene locus_tag LOCUS_29520 <3048 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257798.1:DEAD/DEAH box helicase >Feature sequence272 774 1679 gene locus_tag LOCUS_29530 774 1679 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202726.1 protein_id gnl|my_center|LOCUS_29530 1692 2507 gene locus_tag LOCUS_29540 1692 2507 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_29540 2748 2951 gene locus_tag LOCUS_29550 2748 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence273 3 680 gene locus_tag LOCUS_29560 3 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 809 2095 gene locus_tag LOCUS_29570 809 2095 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_29570 2907 2107 gene locus_tag LOCUS_29580 2907 2107 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence274 635 462 gene locus_tag LOCUS_29590 635 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1269 646 gene locus_tag LOCUS_29600 1269 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2228 1266 gene locus_tag LOCUS_29610 2228 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 <2998 2252 gene locus_tag LOCUS_29620 <2998 2252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203118.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence275 1825 998 gene locus_tag LOCUS_29630 1825 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29630 2587 1853 gene locus_tag LOCUS_29640 2587 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29640 >Feature sequence276 <2955 340 gene locus_tag LOCUS_29650 <2955 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930803.1:IGHMBP2 family helicase >Feature sequence277 556 927 gene locus_tag LOCUS_29660 556 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 <2912 1187 gene locus_tag LOCUS_29670 <2912 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203068.1:DEAD/DEAH box helicase family protein >Feature sequence278 696 1655 gene locus_tag LOCUS_29680 696 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence279 1886 2716 gene locus_tag LOCUS_29690 1886 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence280 1005 382 gene locus_tag LOCUS_29700 1005 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 1990 1130 gene locus_tag LOCUS_29710 1990 1130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797785.1 protein_id gnl|my_center|LOCUS_29710 2583 1996 gene locus_tag LOCUS_29720 2583 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence281 1691 171 gene locus_tag LOCUS_29730 1691 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2423 1707 gene locus_tag LOCUS_29740 2423 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence282 1033 2298 gene locus_tag LOCUS_29750 1033 2298 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence283 223 1260 gene locus_tag LOCUS_29760 223 1260 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_29760 <2686 1322 gene locus_tag LOCUS_29770 <2686 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202382.1:conjugal transfer protein MobC >Feature sequence284 2027 1242 gene locus_tag LOCUS_29780 2027 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2110 2658 gene locus_tag LOCUS_29790 2110 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence285 927 1544 gene locus_tag LOCUS_29800 927 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1594 2055 gene locus_tag LOCUS_29810 1594 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29810 2062 2259 gene locus_tag LOCUS_29820 2062 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29820 >Feature sequence286 179 409 gene locus_tag LOCUS_29830 179 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 402 977 gene locus_tag LOCUS_29840 402 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1452 2162 gene locus_tag LOCUS_29850 1452 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612809.1 protein_id gnl|my_center|LOCUS_29850 2186 2596 gene locus_tag LOCUS_29860 2186 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence287 1333 1680 gene locus_tag LOCUS_29870 1333 1680 CDS product SH3 beta-barrel fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203522.1 protein_id gnl|my_center|LOCUS_29870 1715 2539 gene locus_tag LOCUS_29880 1715 2539 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202608.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence288 1634 156 gene locus_tag LOCUS_29890 1634 156 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_29890 2411 1680 gene locus_tag LOCUS_29900 2411 1680 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence289 626 1798 gene locus_tag LOCUS_29910 626 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896664.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence290 896 654 gene locus_tag LOCUS_29920 896 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence291 977 2353 gene locus_tag LOCUS_29930 977 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence292 620 2482 gene locus_tag LOCUS_29940 gene dxs 620 2482 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence293 44 895 gene locus_tag LOCUS_29950 gene cas7c 44 895 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_29950 906 1571 gene locus_tag LOCUS_29960 gene cas4 906 1571 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence294 2269 1163 gene locus_tag LOCUS_29970 2269 1163 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763519.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence295 1275 271 gene locus_tag LOCUS_29980 1275 271 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_29980 <2515 1564 gene locus_tag LOCUS_29990 <2515 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor >Feature sequence296 1391 555 gene locus_tag LOCUS_30000 1391 555 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_30000 1489 1995 gene locus_tag LOCUS_30010 1489 1995 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_30010 2004 2474 gene locus_tag LOCUS_30020 2004 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence297 397 113 gene locus_tag LOCUS_30030 397 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1234 1461 gene locus_tag LOCUS_30040 1234 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776813.1 protein_id gnl|my_center|LOCUS_30040 1473 1730 gene locus_tag LOCUS_30050 1473 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485421.1 protein_id gnl|my_center|LOCUS_30050 1768 2343 gene locus_tag LOCUS_30060 1768 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776811.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence298 897 142 gene locus_tag LOCUS_30070 897 142 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_30070 2372 1035 gene locus_tag LOCUS_30080 2372 1035 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence299 835 98 gene locus_tag LOCUS_30090 835 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1123 1695 gene locus_tag LOCUS_30100 1123 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1707 1985 gene locus_tag LOCUS_30110 1707 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2258 2443 gene locus_tag LOCUS_30120 2258 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence300 968 1123 gene locus_tag LOCUS_30130 968 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1120 2187 gene locus_tag LOCUS_30140 1120 2187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence301 620 2449 gene locus_tag LOCUS_30150 620 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence302 1 1773 gene locus_tag LOCUS_30160 1 1773 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680466.1 protein_id gnl|my_center|LOCUS_30160 2017 2367 gene locus_tag LOCUS_30170 2017 2367 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107103.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence303 1790 1641 gene locus_tag LOCUS_30180 1790 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2296 2021 gene locus_tag LOCUS_30190 2296 2021 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence304 >Feature sequence305 >Feature sequence306 1574 744 gene locus_tag LOCUS_30200 1574 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2020 1667 gene locus_tag LOCUS_30210 2020 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence307 <1 1121 gene locus_tag LOCUS_30220 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767823.1:glycosyltransferase family 4 protein 1160 1990 gene locus_tag LOCUS_30230 1160 1990 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence308 398 27 gene locus_tag LOCUS_30240 398 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1548 580 gene locus_tag LOCUS_30250 1548 580 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence309 334 1695 gene locus_tag LOCUS_30260 334 1695 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence310 2161 1415 gene locus_tag LOCUS_30270 2161 1415 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence311 298 104 gene locus_tag LOCUS_30280 298 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 455 652 gene locus_tag LOCUS_30290 455 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1723 1019 gene locus_tag LOCUS_30300 1723 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence312 1048 548 gene locus_tag LOCUS_30310 gene tpx 1048 548 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538561.1 protein_id gnl|my_center|LOCUS_30310 1749 1156 gene locus_tag LOCUS_30320 gene mpi 1749 1156 CDS product serine-type multi-promoter DNA invertase Mpi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788600.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence313 1558 233 gene locus_tag LOCUS_30330 1558 233 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_30330 <2258 1639 gene locus_tag LOCUS_30340 <2258 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203231.1:SusF/SusE family outer membrane protein >Feature sequence314 1821 319 gene locus_tag LOCUS_30350 1821 319 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840466.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence315 2159 2233 gene locus_tag LOCUS_t00440 2159 2233 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence316 189 632 gene locus_tag LOCUS_30360 189 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765432.1 protein_id gnl|my_center|LOCUS_30360 <2233 673 gene locus_tag LOCUS_30370 <2233 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765433.1:MutS family DNA mismatch repair protein >Feature sequence317 794 303 gene locus_tag LOCUS_30380 794 303 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence318 <1 1379 gene locus_tag LOCUS_30390 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068386.1:AAA family ATPase 1406 2137 gene locus_tag LOCUS_30400 1406 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence319 1848 1081 gene locus_tag LOCUS_30410 1848 1081 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764105.1 protein_id gnl|my_center|LOCUS_30410 2105 1857 gene locus_tag LOCUS_30420 2105 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence320 347 970 gene locus_tag LOCUS_30430 347 970 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_30430 976 1560 gene locus_tag LOCUS_30440 976 1560 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129407.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence321 <2130 1378 gene locus_tag LOCUS_30450 <2130 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963675.1:ATP-dependent endonuclease >Feature sequence322 443 153 gene locus_tag LOCUS_30460 443 153 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760084.1 protein_id gnl|my_center|LOCUS_30460 772 458 gene locus_tag LOCUS_30470 772 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_30470 1299 1673 gene locus_tag LOCUS_30480 1299 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence323 53 496 gene locus_tag LOCUS_30490 53 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 527 727 gene locus_tag LOCUS_30500 527 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 724 984 gene locus_tag LOCUS_30510 724 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1391 1149 gene locus_tag LOCUS_30520 1391 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence324 1656 559 gene locus_tag LOCUS_30530 1656 559 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074435184.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence325 367 2 gene locus_tag LOCUS_30540 gene rplN 367 2 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_30540 639 370 gene locus_tag LOCUS_30550 gene rpsQ 639 370 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_30550 833 636 gene locus_tag LOCUS_30560 gene rpmC 833 636 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_30560 1273 839 gene locus_tag LOCUS_30570 gene rplP 1273 839 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_30570 2026 1295 gene locus_tag LOCUS_30580 gene rpsC 2026 1295 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_30580