>Feature sequence01 1449 208 gene locus_tag LOCUS_00010 gene hydF 1449 208 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_00010 2527 1475 gene locus_tag LOCUS_00020 gene hydE 2527 1475 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_00020 4038 2653 gene locus_tag LOCUS_00030 gene hydG 4038 2653 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073668.1 protein_id gnl|my_center|LOCUS_00030 4368 4087 gene locus_tag LOCUS_00040 4368 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4880 4401 gene locus_tag LOCUS_00050 gene nuoE 4880 4401 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00050 6640 4880 gene locus_tag LOCUS_00060 6640 4880 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00060 8166 6640 gene locus_tag LOCUS_00070 gene nuoF 8166 6640 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 8516 8163 gene locus_tag LOCUS_00080 8516 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_00080 9576 8707 gene locus_tag LOCUS_00090 9576 8707 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_00090 10139 9573 gene locus_tag LOCUS_00100 10139 9573 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_00100 10499 10894 gene locus_tag LOCUS_00110 10499 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11084 25624 gene locus_tag LOCUS_00120 11084 25624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 25929 26312 gene locus_tag LOCUS_00130 25929 26312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 26536 26793 gene locus_tag LOCUS_00140 26536 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 29382 27289 gene locus_tag LOCUS_00150 gene feoB 29382 27289 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_00150 29620 29369 gene locus_tag LOCUS_00160 29620 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 30288 29818 gene locus_tag LOCUS_00170 30288 29818 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_00170 31140 30442 gene locus_tag LOCUS_00180 31140 30442 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_00180 33251 31137 gene locus_tag LOCUS_00190 33251 31137 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_00190 33515 33327 gene locus_tag LOCUS_00200 33515 33327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 34287 33505 gene locus_tag LOCUS_00210 34287 33505 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_00210 35199 34291 gene locus_tag LOCUS_00220 35199 34291 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_00220 36469 35213 gene locus_tag LOCUS_00230 36469 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 protein_id gnl|my_center|LOCUS_00230 40711 36938 gene locus_tag LOCUS_00240 40711 36938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 40931 41314 gene locus_tag LOCUS_00250 40931 41314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 42130 41489 gene locus_tag LOCUS_00260 42130 41489 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798768.1 protein_id gnl|my_center|LOCUS_00260 42278 42850 gene locus_tag LOCUS_00270 42278 42850 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881435.1 protein_id gnl|my_center|LOCUS_00270 42847 44211 gene locus_tag LOCUS_00280 42847 44211 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 protein_id gnl|my_center|LOCUS_00280 44330 45127 gene locus_tag LOCUS_00290 44330 45127 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_00290 45124 46392 gene locus_tag LOCUS_00300 45124 46392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393812.1 protein_id gnl|my_center|LOCUS_00300 46389 47537 gene locus_tag LOCUS_00310 46389 47537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_00310 47658 51164 gene locus_tag LOCUS_00320 47658 51164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 53927 51552 gene locus_tag LOCUS_00330 53927 51552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 54136 54225 gene locus_tag LOCUS_t00010 54136 54225 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 54431 54610 gene locus_tag LOCUS_00340 54431 54610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 54613 55785 gene locus_tag LOCUS_00350 54613 55785 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_00350 55811 56842 gene locus_tag LOCUS_00360 gene adhP 55811 56842 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_00360 56866 57483 gene locus_tag LOCUS_00370 56866 57483 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295290.1 protein_id gnl|my_center|LOCUS_00370 58108 57458 gene locus_tag LOCUS_00380 gene thiE 58108 57458 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674047.1 protein_id gnl|my_center|LOCUS_00380 59314 58193 gene locus_tag LOCUS_00390 gene thiH 59314 58193 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_00390 60085 59318 gene locus_tag LOCUS_00400 60085 59318 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_00400 60723 60094 gene locus_tag LOCUS_00410 gene thiF 60723 60094 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_00410 60923 60729 gene locus_tag LOCUS_00420 60923 60729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 62397 61141 gene locus_tag LOCUS_00430 62397 61141 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_00430 62566 63921 gene locus_tag LOCUS_00440 gene creD 62566 63921 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_00440 64006 65808 gene locus_tag LOCUS_00450 64006 65808 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974668.1 protein_id gnl|my_center|LOCUS_00450 66045 66133 gene locus_tag LOCUS_t00020 66045 66133 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66891 66310 gene locus_tag LOCUS_00460 66891 66310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 68098 66893 gene locus_tag LOCUS_00470 68098 66893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_00470 68442 68834 gene locus_tag LOCUS_00480 68442 68834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 68939 69253 gene locus_tag LOCUS_00490 68939 69253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 69291 69581 gene locus_tag LOCUS_00500 69291 69581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 70744 69941 gene locus_tag LOCUS_00510 70744 69941 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_00510 72685 70913 gene locus_tag LOCUS_00520 72685 70913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 72979 72734 gene locus_tag LOCUS_00530 72979 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 73427 74497 gene locus_tag LOCUS_00540 73427 74497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 74763 76250 gene locus_tag LOCUS_00550 74763 76250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 76235 76552 gene locus_tag LOCUS_00560 76235 76552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 76566 77678 gene locus_tag LOCUS_00570 76566 77678 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_00570 79732 78089 gene locus_tag LOCUS_00580 79732 78089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 80123 79707 gene locus_tag LOCUS_00590 80123 79707 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_00590 80322 80110 gene locus_tag LOCUS_00600 80322 80110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 80462 81370 gene locus_tag LOCUS_00610 80462 81370 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024414.1 protein_id gnl|my_center|LOCUS_00610 81582 81367 gene locus_tag LOCUS_00620 81582 81367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 83162 81693 gene locus_tag LOCUS_00630 gene terL 83162 81693 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_00630 83586 83164 gene locus_tag LOCUS_00640 83586 83164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 84847 83588 gene locus_tag LOCUS_00650 84847 83588 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_00650 85819 85067 gene locus_tag LOCUS_00660 85819 85067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 86390 85881 gene locus_tag LOCUS_00670 86390 85881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 86889 88124 gene locus_tag LOCUS_00680 86889 88124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 88212 89933 gene locus_tag LOCUS_00690 88212 89933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 89967 93128 gene locus_tag LOCUS_00700 89967 93128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 93161 94465 gene locus_tag LOCUS_00710 93161 94465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 95166 95408 gene locus_tag LOCUS_00720 95166 95408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 95475 95678 gene locus_tag LOCUS_00730 gene cspE 95475 95678 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 protein_id gnl|my_center|LOCUS_00730 98276 95952 gene locus_tag LOCUS_00740 98276 95952 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_00740 99322 98282 gene locus_tag LOCUS_00750 99322 98282 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_00750 99841 99689 gene locus_tag LOCUS_00760 99841 99689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 100701 99946 gene locus_tag LOCUS_00770 100701 99946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 101274 103913 gene locus_tag LOCUS_00780 101274 103913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 104978 103962 gene locus_tag LOCUS_00790 104978 103962 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_00790 106029 105148 gene locus_tag LOCUS_00800 106029 105148 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849327.1 protein_id gnl|my_center|LOCUS_00800 106864 106064 gene locus_tag LOCUS_00810 106864 106064 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_00810 107124 107498 gene locus_tag LOCUS_00820 107124 107498 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_00820 107610 108017 gene locus_tag LOCUS_00830 107610 108017 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730388.1 protein_id gnl|my_center|LOCUS_00830 108374 110890 gene locus_tag LOCUS_00840 108374 110890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 112331 110991 gene locus_tag LOCUS_00850 gene gdhA 112331 110991 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_00850 113254 112370 gene locus_tag LOCUS_00860 113254 112370 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_00860 114318 113422 gene locus_tag LOCUS_00870 114318 113422 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_00870 116547 114451 gene locus_tag LOCUS_00880 116547 114451 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_00880 116992 118821 gene locus_tag LOCUS_00890 gene glmS 116992 118821 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_00890 118984 119949 gene locus_tag LOCUS_00900 118984 119949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 120099 121583 gene locus_tag LOCUS_00910 120099 121583 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437136.1 protein_id gnl|my_center|LOCUS_00910 121863 122471 gene locus_tag LOCUS_00920 gene hisH 121863 122471 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_00920 122471 123253 gene locus_tag LOCUS_00930 gene hisF 122471 123253 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_00930 123372 123869 gene locus_tag LOCUS_00940 123372 123869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 123856 126255 gene locus_tag LOCUS_00950 gene purL 123856 126255 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 126266 127036 gene locus_tag LOCUS_00960 gene purQ 126266 127036 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_00960 131901 127135 gene locus_tag LOCUS_00970 131901 127135 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_00970 132824 132258 gene locus_tag LOCUS_00980 132824 132258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00980 133715 132825 gene locus_tag LOCUS_00990 133715 132825 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_00990 134254 134054 gene locus_tag LOCUS_01000 134254 134054 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_01000 137441 134244 gene locus_tag LOCUS_01010 137441 134244 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_01010 138782 137445 gene locus_tag LOCUS_01020 138782 137445 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_01020 139156 138788 gene locus_tag LOCUS_01030 139156 138788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 139430 139942 gene locus_tag LOCUS_01040 139430 139942 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762757.1 protein_id gnl|my_center|LOCUS_01040 140097 143513 gene locus_tag LOCUS_01050 140097 143513 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599173.1 protein_id gnl|my_center|LOCUS_01050 144128 143526 gene locus_tag LOCUS_01060 144128 143526 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_01060 144401 145978 gene locus_tag LOCUS_01070 144401 145978 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 protein_id gnl|my_center|LOCUS_01070 146166 147473 gene locus_tag LOCUS_01080 146166 147473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 147475 148044 gene locus_tag LOCUS_01090 147475 148044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 148048 151050 gene locus_tag LOCUS_01100 148048 151050 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_01100 151428 153362 gene locus_tag LOCUS_01110 151428 153362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence02 1 828 gene locus_tag LOCUS_01120 1 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1072 1398 gene locus_tag LOCUS_01130 gene rpsJ 1072 1398 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938597.1 protein_id gnl|my_center|LOCUS_01130 1509 2186 gene locus_tag LOCUS_01140 gene rplC 1509 2186 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583345.1 protein_id gnl|my_center|LOCUS_01140 2245 2865 gene locus_tag LOCUS_01150 gene rplD 2245 2865 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_01150 2900 3187 gene locus_tag LOCUS_01160 2900 3187 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_01160 3305 4141 gene locus_tag LOCUS_01170 gene rplB 3305 4141 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_01170 4296 4580 gene locus_tag LOCUS_01180 gene rpsS 4296 4580 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_01180 4598 5053 gene locus_tag LOCUS_01190 4598 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5167 5880 gene locus_tag LOCUS_01200 gene rpsC 5167 5880 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_01200 5958 6323 gene locus_tag LOCUS_01210 gene rplP 5958 6323 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_01210 6325 6522 gene locus_tag LOCUS_01220 6325 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6614 6871 gene locus_tag LOCUS_01230 gene rpsQ 6614 6871 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_01230 7023 7391 gene locus_tag LOCUS_01240 gene rplN 7023 7391 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_01240 7470 7781 gene locus_tag LOCUS_01250 gene rplX 7470 7781 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_01250 7903 8460 gene locus_tag LOCUS_01260 gene rplE 7903 8460 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_01260 8689 9084 gene locus_tag LOCUS_01270 gene rpsH 8689 9084 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01270 9198 9764 gene locus_tag LOCUS_01280 gene rplF 9198 9764 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_01280 9888 10247 gene locus_tag LOCUS_01290 gene rplR 9888 10247 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_01290 10410 10916 gene locus_tag LOCUS_01300 gene rpsE 10410 10916 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_01300 10913 11359 gene locus_tag LOCUS_01310 gene rplO 10913 11359 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638079.1 protein_id gnl|my_center|LOCUS_01310 11488 12831 gene locus_tag LOCUS_01320 gene secY 11488 12831 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_01320 13071 13700 gene locus_tag LOCUS_01330 13071 13700 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01330 13797 14570 gene locus_tag LOCUS_01340 gene map 13797 14570 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_01340 14644 14859 gene locus_tag LOCUS_01350 gene infA 14644 14859 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_01350 15117 15506 gene locus_tag LOCUS_01360 gene rpsM 15117 15506 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_01360 15654 16049 gene locus_tag LOCUS_01370 gene rpsK 15654 16049 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_01370 16167 16793 gene locus_tag LOCUS_01380 gene rpsD 16167 16793 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_01380 16834 17805 gene locus_tag LOCUS_01390 16834 17805 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_01390 17802 18155 gene locus_tag LOCUS_01400 17802 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 18289 19317 gene locus_tag LOCUS_01410 18289 19317 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_01410 19463 20302 gene locus_tag LOCUS_01420 19463 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 20299 20799 gene locus_tag LOCUS_01430 20299 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 20935 22755 gene locus_tag LOCUS_01440 gene mrdA 20935 22755 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01440 22909 24258 gene locus_tag LOCUS_01450 gene rodA 22909 24258 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_01450 24327 24602 gene locus_tag LOCUS_01460 24327 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 24640 25896 gene locus_tag LOCUS_01470 24640 25896 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894643.1 protein_id gnl|my_center|LOCUS_01470 26019 26810 gene locus_tag LOCUS_01480 26019 26810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401180.1 protein_id gnl|my_center|LOCUS_01480 26827 27438 gene locus_tag LOCUS_01490 26827 27438 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948663.1 protein_id gnl|my_center|LOCUS_01490 27496 28392 gene locus_tag LOCUS_01500 27496 28392 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_01500 28852 30783 gene locus_tag LOCUS_01510 28852 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 31863 31051 gene locus_tag LOCUS_01520 31863 31051 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_01520 33364 32045 gene locus_tag LOCUS_01530 33364 32045 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_01530 33672 34334 gene locus_tag LOCUS_01540 33672 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34483 34806 gene locus_tag LOCUS_01550 34483 34806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 34964 36691 gene locus_tag LOCUS_01560 34964 36691 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_01560 36795 37361 gene locus_tag LOCUS_01570 36795 37361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_01570 37417 38862 gene locus_tag LOCUS_01580 37417 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 38859 39194 gene locus_tag LOCUS_01590 38859 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 39258 39410 gene locus_tag LOCUS_01600 39258 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 40347 40168 gene locus_tag LOCUS_01610 40347 40168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 40328 40798 gene locus_tag LOCUS_01620 40328 40798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 41005 43503 gene locus_tag LOCUS_01630 41005 43503 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_01630 43655 45076 gene locus_tag LOCUS_01640 43655 45076 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_01640 45106 46410 gene locus_tag LOCUS_01650 gene hisS 45106 46410 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_01650 47891 46518 gene locus_tag LOCUS_01660 47891 46518 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_01660 48178 50295 gene locus_tag LOCUS_01670 48178 50295 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_01670 50701 50270 gene locus_tag LOCUS_01680 50701 50270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 52042 50864 gene locus_tag LOCUS_01690 52042 50864 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_01690 52427 52050 gene locus_tag LOCUS_01700 52427 52050 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_01700 52886 52620 gene locus_tag LOCUS_01710 52886 52620 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_01710 53613 52888 gene locus_tag LOCUS_01720 53613 52888 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_01720 53971 54044 gene locus_tag LOCUS_t00030 53971 54044 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 54148 55803 gene locus_tag LOCUS_01730 54148 55803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55897 56970 gene locus_tag LOCUS_01740 55897 56970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 56972 57568 gene locus_tag LOCUS_01750 gene recR 56972 57568 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_01750 57812 58390 gene locus_tag LOCUS_01760 57812 58390 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_01760 58543 58860 gene locus_tag LOCUS_01770 58543 58860 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250929.1 protein_id gnl|my_center|LOCUS_01770 58979 60184 gene locus_tag LOCUS_01780 58979 60184 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_01780 60319 61251 gene locus_tag LOCUS_01790 60319 61251 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_01790 61554 62048 gene locus_tag LOCUS_01800 61554 62048 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_01800 62045 64135 gene locus_tag LOCUS_01810 62045 64135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 64925 64200 gene locus_tag LOCUS_01820 64925 64200 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_01820 65078 65006 gene locus_tag LOCUS_t00040 65078 65006 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 66215 65226 gene locus_tag LOCUS_01830 66215 65226 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786940.1 protein_id gnl|my_center|LOCUS_01830 66820 66242 gene locus_tag LOCUS_01840 66820 66242 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_01840 68840 66852 gene locus_tag LOCUS_01850 68840 66852 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 protein_id gnl|my_center|LOCUS_01850 69290 72529 gene locus_tag LOCUS_01860 69290 72529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 72551 73558 gene locus_tag LOCUS_01870 72551 73558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 73562 74626 gene locus_tag LOCUS_01880 73562 74626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 74714 79060 gene locus_tag LOCUS_01890 74714 79060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 80590 81300 gene locus_tag LOCUS_01900 80590 81300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 81558 82358 gene locus_tag LOCUS_01910 81558 82358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 82355 83146 gene locus_tag LOCUS_01920 82355 83146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 83139 84257 gene locus_tag LOCUS_01930 83139 84257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 84254 85174 gene locus_tag LOCUS_01940 84254 85174 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020229.1 protein_id gnl|my_center|LOCUS_01940 85601 85380 gene locus_tag LOCUS_01950 85601 85380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 86709 86518 gene locus_tag LOCUS_01960 86709 86518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 87357 88283 gene locus_tag LOCUS_01970 87357 88283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 90458 88422 gene locus_tag LOCUS_01980 90458 88422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 90911 93097 gene locus_tag LOCUS_01990 90911 93097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 93924 93505 gene locus_tag LOCUS_02000 93924 93505 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_02000 94234 94728 gene locus_tag LOCUS_02010 94234 94728 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_02010 94725 95936 gene locus_tag LOCUS_02020 94725 95936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 95980 96369 gene locus_tag LOCUS_02030 95980 96369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 96658 96569 gene locus_tag LOCUS_t00050 96658 96569 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 96844 97407 gene locus_tag LOCUS_02040 96844 97407 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538562.1 protein_id gnl|my_center|LOCUS_02040 98839 97499 gene locus_tag LOCUS_02050 98839 97499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 98983 99909 gene locus_tag LOCUS_02060 gene argF 98983 99909 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_02060 99906 100229 gene locus_tag LOCUS_02070 gene cutA 99906 100229 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_02070 100294 101211 gene locus_tag LOCUS_02080 gene amrS 100294 101211 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_02080 101208 101789 gene locus_tag LOCUS_02090 101208 101789 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_02090 102451 101783 gene locus_tag LOCUS_02100 102451 101783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 102819 102448 gene locus_tag LOCUS_02110 102819 102448 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582466.1 protein_id gnl|my_center|LOCUS_02110 103573 102788 gene locus_tag LOCUS_02120 103573 102788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 103968 104040 gene locus_tag LOCUS_t00060 103968 104040 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 104404 105639 gene locus_tag LOCUS_02130 104404 105639 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_02130 105974 106534 gene locus_tag LOCUS_02140 105974 106534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 107001 107159 gene locus_tag LOCUS_02150 107001 107159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 107623 109062 gene locus_tag LOCUS_02160 107623 109062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 109067 110116 gene locus_tag LOCUS_02170 109067 110116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 110275 110982 gene locus_tag LOCUS_02180 110275 110982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 110985 111452 gene locus_tag LOCUS_02190 gene smpB 110985 111452 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_02190 111574 113127 gene locus_tag LOCUS_02200 111574 113127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 113128 116205 gene locus_tag LOCUS_02210 113128 116205 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546637.1 protein_id gnl|my_center|LOCUS_02210 116318 119131 gene locus_tag LOCUS_02220 116318 119131 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842727.1 protein_id gnl|my_center|LOCUS_02220 119314 119820 gene locus_tag LOCUS_02230 119314 119820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 119973 120431 gene locus_tag LOCUS_02240 119973 120431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 120496 120933 gene locus_tag LOCUS_02250 120496 120933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 121156 121074 gene locus_tag LOCUS_t00070 121156 121074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence03 254 1615 gene locus_tag LOCUS_02260 254 1615 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_02260 1784 2641 gene locus_tag LOCUS_02270 1784 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2659 3099 gene locus_tag LOCUS_02280 2659 3099 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_02280 3131 3844 gene locus_tag LOCUS_02290 3131 3844 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_02290 3844 4422 gene locus_tag LOCUS_02300 gene yihA 3844 4422 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_02300 4588 5055 gene locus_tag LOCUS_02310 4588 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5069 5551 gene locus_tag LOCUS_02320 5069 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5601 6482 gene locus_tag LOCUS_02330 5601 6482 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_02330 6600 7358 gene locus_tag LOCUS_02340 gene xth 6600 7358 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_02340 7484 8917 gene locus_tag LOCUS_02350 7484 8917 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_02350 9140 9694 gene locus_tag LOCUS_02360 9140 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10088 10600 gene locus_tag LOCUS_02370 10088 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10643 19903 gene locus_tag LOCUS_02380 10643 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 20131 20397 gene locus_tag LOCUS_02390 20131 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20397 20711 gene locus_tag LOCUS_02400 20397 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20924 21721 gene locus_tag LOCUS_02410 20924 21721 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 protein_id gnl|my_center|LOCUS_02410 21721 22605 gene locus_tag LOCUS_02420 21721 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 22644 23030 gene locus_tag LOCUS_02430 22644 23030 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155664.1 protein_id gnl|my_center|LOCUS_02430 23098 26283 gene locus_tag LOCUS_02440 23098 26283 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_02440 26438 27634 gene locus_tag LOCUS_02450 26438 27634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_02450 27674 30193 gene locus_tag LOCUS_02460 27674 30193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 30183 31436 gene locus_tag LOCUS_02470 30183 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 31446 32873 gene locus_tag LOCUS_02480 gene rng 31446 32873 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_02480 32927 36751 gene locus_tag LOCUS_02490 32927 36751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 36768 37901 gene locus_tag LOCUS_02500 36768 37901 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_02500 37904 38200 gene locus_tag LOCUS_02510 37904 38200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 40393 38315 gene locus_tag LOCUS_02520 40393 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 41777 40587 gene locus_tag LOCUS_02530 41777 40587 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_02530 41910 42224 gene locus_tag LOCUS_02540 gene rplU 41910 42224 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_02540 42256 42507 gene locus_tag LOCUS_02550 gene rpmA 42256 42507 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_02550 42519 43778 gene locus_tag LOCUS_02560 gene obgE 42519 43778 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_02560 43791 44888 gene locus_tag LOCUS_02570 gene ychF 43791 44888 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_02570 44966 45505 gene locus_tag LOCUS_02580 44966 45505 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_02580 45510 46004 gene locus_tag LOCUS_02590 gene paiA 45510 46004 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_02590 46142 47047 gene locus_tag LOCUS_02600 46142 47047 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_02600 48017 47199 gene locus_tag LOCUS_02610 48017 47199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 48242 48814 gene locus_tag LOCUS_02620 48242 48814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 48801 50177 gene locus_tag LOCUS_02630 48801 50177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 50170 51519 gene locus_tag LOCUS_02640 50170 51519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 51724 52827 gene locus_tag LOCUS_02650 gene ugpC 51724 52827 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_02650 52832 53752 gene locus_tag LOCUS_02660 52832 53752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 53902 55236 gene locus_tag LOCUS_02670 53902 55236 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978229.1 protein_id gnl|my_center|LOCUS_02670 55233 56075 gene locus_tag LOCUS_02680 55233 56075 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_02680 56072 56608 gene locus_tag LOCUS_02690 56072 56608 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_02690 56760 57557 gene locus_tag LOCUS_02700 56760 57557 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_02700 57554 58306 gene locus_tag LOCUS_02710 57554 58306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 58432 59214 gene locus_tag LOCUS_02720 58432 59214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 59293 61746 gene locus_tag LOCUS_02730 59293 61746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 61887 62171 gene locus_tag LOCUS_02740 gene groES 61887 62171 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_02740 62325 63953 gene locus_tag LOCUS_02750 gene groL 62325 63953 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393619.1 protein_id gnl|my_center|LOCUS_02750 64167 64856 gene locus_tag LOCUS_02760 64167 64856 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_02760 64849 65664 gene locus_tag LOCUS_02770 gene proC 64849 65664 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 protein_id gnl|my_center|LOCUS_02770 65676 65939 gene locus_tag LOCUS_02780 65676 65939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 66103 68898 gene locus_tag LOCUS_02790 gene ileS 66103 68898 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546193.1 protein_id gnl|my_center|LOCUS_02790 68898 69377 gene locus_tag LOCUS_02800 gene lspA 68898 69377 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014705.1 protein_id gnl|my_center|LOCUS_02800 69477 70241 gene locus_tag LOCUS_02810 gene lgt 69477 70241 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_02810 70226 71116 gene locus_tag LOCUS_02820 70226 71116 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_02820 71644 71213 gene locus_tag LOCUS_02830 71644 71213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 77517 71761 gene locus_tag LOCUS_02840 77517 71761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 78126 77596 gene locus_tag LOCUS_02850 78126 77596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 78350 79387 gene locus_tag LOCUS_02860 gene hrcA 78350 79387 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02860 79389 79931 gene locus_tag LOCUS_02870 gene grpE 79389 79931 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021933.1 protein_id gnl|my_center|LOCUS_02870 79982 81847 gene locus_tag LOCUS_02880 gene dnaK 79982 81847 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_02880 81931 82455 gene locus_tag LOCUS_02890 81931 82455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 82469 82621 gene locus_tag LOCUS_02900 82469 82621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 82684 82896 gene locus_tag LOCUS_02910 82684 82896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 82841 83272 gene locus_tag LOCUS_02920 82841 83272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 83332 84099 gene locus_tag LOCUS_02930 83332 84099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 84118 84663 gene locus_tag LOCUS_02940 84118 84663 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270894.1 protein_id gnl|my_center|LOCUS_02940 84719 85150 gene locus_tag LOCUS_02950 84719 85150 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_02950 85311 85448 gene locus_tag LOCUS_02960 85311 85448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 85477 86451 gene locus_tag LOCUS_02970 gene rhuM 85477 86451 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_02970 86465 87622 gene locus_tag LOCUS_02980 gene dnaJ 86465 87622 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_02980 87623 88339 gene locus_tag LOCUS_02990 87623 88339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 88346 89035 gene locus_tag LOCUS_03000 88346 89035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_03000 89001 90773 gene locus_tag LOCUS_03010 gene phoR 89001 90773 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_03010 91046 91342 gene locus_tag LOCUS_03020 91046 91342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 93786 91564 gene locus_tag LOCUS_03030 93786 91564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 94247 95551 gene locus_tag LOCUS_03040 94247 95551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 95701 96504 gene locus_tag LOCUS_03050 95701 96504 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_03050 96957 97841 gene locus_tag LOCUS_03060 gene pstC 96957 97841 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_03060 97838 98689 gene locus_tag LOCUS_03070 gene pstA 97838 98689 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_03070 98679 99446 gene locus_tag LOCUS_03080 gene pstB 98679 99446 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_03080 99631 100287 gene locus_tag LOCUS_03090 gene phoU 99631 100287 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_03090 100852 100520 gene locus_tag LOCUS_03100 100852 100520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 100981 101613 gene locus_tag LOCUS_03110 100981 101613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 101906 101980 gene locus_tag LOCUS_t00080 101906 101980 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 102272 102688 gene locus_tag LOCUS_03120 102272 102688 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_03120 102692 103261 gene locus_tag LOCUS_03130 gene rsmD 102692 103261 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_03130 103419 104159 gene locus_tag LOCUS_03140 103419 104159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 104156 104905 gene locus_tag LOCUS_03150 gene argB 104156 104905 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_03150 105018 106190 gene locus_tag LOCUS_03160 105018 106190 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_03160 106279 107511 gene locus_tag LOCUS_03170 106279 107511 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_03170 107645 109003 gene locus_tag LOCUS_03180 gene argH 107645 109003 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_03180 109000 110178 gene locus_tag LOCUS_03190 109000 110178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 110298 111245 gene locus_tag LOCUS_03200 110298 111245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 111238 112266 gene locus_tag LOCUS_03210 111238 112266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 112431 113663 gene locus_tag LOCUS_03220 gene lysA 112431 113663 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_03220 113792 114664 gene locus_tag LOCUS_03230 gene dapA 113792 114664 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_03230 114796 115569 gene locus_tag LOCUS_03240 gene dapB 114796 115569 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence04 9512 8493 gene locus_tag LOCUS_03250 gene hemW 9512 8493 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_03250 10608 9691 gene locus_tag LOCUS_03260 10608 9691 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_03260 11173 10736 gene locus_tag LOCUS_03270 11173 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12094 11324 gene locus_tag LOCUS_03280 gene lepB 12094 11324 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_03280 13994 12204 gene locus_tag LOCUS_03290 gene lepA 13994 12204 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_03290 15879 14128 gene locus_tag LOCUS_03300 gene ptsP 15879 14128 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_03300 16153 15890 gene locus_tag LOCUS_03310 16153 15890 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_03310 16934 16155 gene locus_tag LOCUS_03320 16934 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 17720 17079 gene locus_tag LOCUS_03330 17720 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19789 17717 gene locus_tag LOCUS_03340 19789 17717 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583261.1 protein_id gnl|my_center|LOCUS_03340 20299 19805 gene locus_tag LOCUS_03350 20299 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20846 20436 gene locus_tag LOCUS_03360 20846 20436 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_03360 22055 21120 gene locus_tag LOCUS_03370 22055 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 23039 22179 gene locus_tag LOCUS_03380 gene rapZ 23039 22179 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_03380 23980 23036 gene locus_tag LOCUS_03390 gene hprK 23980 23036 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_03390 24438 23980 gene locus_tag LOCUS_03400 24438 23980 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_03400 25046 24495 gene locus_tag LOCUS_03410 gene raiA 25046 24495 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_03410 25813 25094 gene locus_tag LOCUS_03420 gene lptB 25813 25094 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_03420 26622 25810 gene locus_tag LOCUS_03430 26622 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 27079 26540 gene locus_tag LOCUS_03440 27079 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 28114 27194 gene locus_tag LOCUS_03450 28114 27194 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 protein_id gnl|my_center|LOCUS_03450 28650 28111 gene locus_tag LOCUS_03460 28650 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 28900 28637 gene locus_tag LOCUS_03470 28900 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 29727 28903 gene locus_tag LOCUS_03480 gene kdsA 29727 28903 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_03480 31327 29720 gene locus_tag LOCUS_03490 gene pyrG 31327 29720 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_03490 32049 31324 gene locus_tag LOCUS_03500 gene kdsB 32049 31324 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_03500 33029 32046 gene locus_tag LOCUS_03510 gene rfaE1 33029 32046 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_03510 34132 33170 gene locus_tag LOCUS_03520 gene rfaD 34132 33170 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_03520 34373 36199 gene locus_tag LOCUS_03530 gene typA 34373 36199 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_03530 41881 36311 gene locus_tag LOCUS_03540 41881 36311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 43018 42068 gene locus_tag LOCUS_03550 43018 42068 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_03550 43682 43005 gene locus_tag LOCUS_03560 gene gmhB 43682 43005 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966334.1 protein_id gnl|my_center|LOCUS_03560 44656 43643 gene locus_tag LOCUS_03570 gene lpxK 44656 43643 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 protein_id gnl|my_center|LOCUS_03570 45567 44806 gene locus_tag LOCUS_03580 45567 44806 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_03580 46670 45564 gene locus_tag LOCUS_03590 46670 45564 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931917.1 protein_id gnl|my_center|LOCUS_03590 47380 46667 gene locus_tag LOCUS_03600 gene bshB1 47380 46667 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228508.1 protein_id gnl|my_center|LOCUS_03600 48483 47536 gene locus_tag LOCUS_03610 48483 47536 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_03610 49583 48618 gene locus_tag LOCUS_03620 gene waaC 49583 48618 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_03620 51376 49697 gene locus_tag LOCUS_03630 51376 49697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 52718 51456 gene locus_tag LOCUS_03640 52718 51456 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_03640 53426 52851 gene locus_tag LOCUS_03650 53426 52851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 54366 53434 gene locus_tag LOCUS_03660 gene secF 54366 53434 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_03660 55808 54381 gene locus_tag LOCUS_03670 55808 54381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 56494 55808 gene locus_tag LOCUS_03680 56494 55808 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_03680 56881 56495 gene locus_tag LOCUS_03690 gene yajC 56881 56495 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_03690 58134 56989 gene locus_tag LOCUS_03700 gene tgt 58134 56989 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_03700 58799 58134 gene locus_tag LOCUS_03710 58799 58134 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_03710 59476 58880 gene locus_tag LOCUS_03720 59476 58880 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 protein_id gnl|my_center|LOCUS_03720 60701 59625 gene locus_tag LOCUS_03730 gene queA 60701 59625 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_03730 61937 60813 gene locus_tag LOCUS_03740 61937 60813 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_03740 62579 61947 gene locus_tag LOCUS_03750 62579 61947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 63102 62566 gene locus_tag LOCUS_03760 63102 62566 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_03760 64124 63099 gene locus_tag LOCUS_03770 gene ruvB 64124 63099 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_03770 64887 64270 gene locus_tag LOCUS_03780 gene ruvA 64887 64270 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947019.1 protein_id gnl|my_center|LOCUS_03780 65366 64884 gene locus_tag LOCUS_03790 gene ruvC 65366 64884 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_03790 66286 65534 gene locus_tag LOCUS_03800 66286 65534 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_03800 67337 66417 gene locus_tag LOCUS_03810 67337 66417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 67750 67334 gene locus_tag LOCUS_03820 gene atpC 67750 67334 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880401.1 protein_id gnl|my_center|LOCUS_03820 69296 67884 gene locus_tag LOCUS_03830 gene atpD 69296 67884 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_03830 70207 69359 gene locus_tag LOCUS_03840 70207 69359 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_03840 71723 70182 gene locus_tag LOCUS_03850 gene atpA 71723 70182 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_03850 72076 71720 gene locus_tag LOCUS_03860 72076 71720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 72578 72057 gene locus_tag LOCUS_03870 72578 72057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 72800 72591 gene locus_tag LOCUS_03880 72800 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 73543 72815 gene locus_tag LOCUS_03890 gene atpB 73543 72815 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019753.1 protein_id gnl|my_center|LOCUS_03890 75789 73540 gene locus_tag LOCUS_03900 75789 73540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 75886 75814 gene locus_tag LOCUS_t00090 75886 75814 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 76156 76082 gene locus_tag LOCUS_t00100 76156 76082 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 76558 76271 gene locus_tag LOCUS_03910 76558 76271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 76850 76569 gene locus_tag LOCUS_03920 76850 76569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 77644 77009 gene locus_tag LOCUS_03930 gene nth 77644 77009 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_03930 78417 77641 gene locus_tag LOCUS_03940 78417 77641 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_03940 79320 78427 gene locus_tag LOCUS_03950 79320 78427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 80409 79477 gene locus_tag LOCUS_03960 80409 79477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 80817 81548 gene locus_tag LOCUS_03970 80817 81548 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_03970 81718 82257 gene locus_tag LOCUS_03980 81718 82257 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_03980 82439 82361 gene locus_tag LOCUS_t00110 82439 82361 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 83177 82617 gene locus_tag LOCUS_03990 83177 82617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 85227 83242 gene locus_tag LOCUS_04000 85227 83242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 85990 85229 gene locus_tag LOCUS_04010 85990 85229 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973894.1 protein_id gnl|my_center|LOCUS_04010 86603 85938 gene locus_tag LOCUS_04020 86603 85938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04020 87151 86606 gene locus_tag LOCUS_04030 87151 86606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04030 87417 87151 gene locus_tag LOCUS_04040 87417 87151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 88036 87428 gene locus_tag LOCUS_04050 gene gmk 88036 87428 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_04050 88237 90009 gene locus_tag LOCUS_04060 gene mnmG 88237 90009 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880461.1 protein_id gnl|my_center|LOCUS_04060 90135 90929 gene locus_tag LOCUS_04070 90135 90929 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965945.1 protein_id gnl|my_center|LOCUS_04070 90911 91180 gene locus_tag LOCUS_04080 90911 91180 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_04080 91197 91847 gene locus_tag LOCUS_04090 91197 91847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 91955 92701 gene locus_tag LOCUS_04100 gene rsmG 91955 92701 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722161.1 protein_id gnl|my_center|LOCUS_04100 92767 93165 gene locus_tag LOCUS_04110 92767 93165 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 protein_id gnl|my_center|LOCUS_04110 94969 93239 gene locus_tag LOCUS_04120 gene rpoD 94969 93239 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_04120 96720 94966 gene locus_tag LOCUS_04130 gene dnaG 96720 94966 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583672.1 protein_id gnl|my_center|LOCUS_04130 97810 96842 gene locus_tag LOCUS_04140 97810 96842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_04140 98107 97901 gene locus_tag LOCUS_04150 gene rpsU 98107 97901 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232823.1 protein_id gnl|my_center|LOCUS_04150 98593 98246 gene locus_tag LOCUS_04160 98593 98246 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_04160 102094 98777 gene locus_tag LOCUS_04170 gene nolG 102094 98777 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970886.1 protein_id gnl|my_center|LOCUS_04170 103623 102205 gene locus_tag LOCUS_04180 103623 102205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 104499 103909 gene locus_tag LOCUS_04190 104499 103909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 105234 104815 gene locus_tag LOCUS_04200 105234 104815 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_04200 105680 105321 gene locus_tag LOCUS_04210 105680 105321 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898297.1 protein_id gnl|my_center|LOCUS_04210 105918 105688 gene locus_tag LOCUS_04220 105918 105688 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_04220 107400 106048 gene locus_tag LOCUS_04230 gene rlmD 107400 106048 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_04230 108503 107400 gene locus_tag LOCUS_04240 108503 107400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 109176 108679 gene locus_tag LOCUS_04250 109176 108679 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence05 93 848 gene locus_tag LOCUS_04260 93 848 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_04260 902 1945 gene locus_tag LOCUS_04270 902 1945 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_04270 2043 3332 gene locus_tag LOCUS_04280 2043 3332 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_04280 3329 4468 gene locus_tag LOCUS_04290 3329 4468 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679065.1 protein_id gnl|my_center|LOCUS_04290 4648 4722 gene locus_tag LOCUS_t00120 4648 4722 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4796 4871 gene locus_tag LOCUS_t00130 4796 4871 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5191 6480 gene locus_tag LOCUS_04300 5191 6480 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_04300 6471 7556 gene locus_tag LOCUS_04310 gene carA 6471 7556 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880225.1 protein_id gnl|my_center|LOCUS_04310 7549 10836 gene locus_tag LOCUS_04320 gene carB 7549 10836 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_04320 10929 11591 gene locus_tag LOCUS_04330 gene thyX 10929 11591 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_04330 12722 12519 gene locus_tag LOCUS_04340 12722 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 12802 13758 gene locus_tag LOCUS_04350 12802 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13764 15872 gene locus_tag LOCUS_04360 13764 15872 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_04360 16054 17229 gene locus_tag LOCUS_04370 16054 17229 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530104.1 protein_id gnl|my_center|LOCUS_04370 17231 17767 gene locus_tag LOCUS_04380 17231 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18291 17782 gene locus_tag LOCUS_04390 18291 17782 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870309.1 protein_id gnl|my_center|LOCUS_04390 19077 18379 gene locus_tag LOCUS_04400 19077 18379 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_04400 19286 19879 gene locus_tag LOCUS_04410 gene lexA 19286 19879 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_04410 19999 21057 gene locus_tag LOCUS_04420 19999 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 21322 22221 gene locus_tag LOCUS_04430 21322 22221 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_04430 22648 23163 gene locus_tag LOCUS_04440 gene cobO 22648 23163 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_04440 23285 24127 gene locus_tag LOCUS_04450 23285 24127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_04450 24308 25306 gene locus_tag LOCUS_04460 24308 25306 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582661.1 protein_id gnl|my_center|LOCUS_04460 25303 26088 gene locus_tag LOCUS_04470 25303 26088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 protein_id gnl|my_center|LOCUS_04470 26409 28265 gene locus_tag LOCUS_04480 26409 28265 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_04480 30472 28349 gene locus_tag LOCUS_04490 30472 28349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 31176 30472 gene locus_tag LOCUS_04500 31176 30472 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_04500 32324 31188 gene locus_tag LOCUS_04510 gene waaC 32324 31188 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_04510 32519 32594 gene locus_tag LOCUS_t00140 32519 32594 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 32676 33128 gene locus_tag LOCUS_04520 32676 33128 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_04520 33128 34621 gene locus_tag LOCUS_04530 33128 34621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 34621 35187 gene locus_tag LOCUS_04540 34621 35187 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147337.1 protein_id gnl|my_center|LOCUS_04540 35294 36526 gene locus_tag LOCUS_04550 35294 36526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_04550 36970 37470 gene locus_tag LOCUS_04560 36970 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 37536 40205 gene locus_tag LOCUS_04570 37536 40205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 40352 40879 gene locus_tag LOCUS_04580 40352 40879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 41034 42026 gene locus_tag LOCUS_04590 41034 42026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 42217 43731 gene locus_tag LOCUS_04600 42217 43731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 44830 43844 gene locus_tag LOCUS_04610 44830 43844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 45517 51237 gene locus_tag LOCUS_04620 45517 51237 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947392.1 protein_id gnl|my_center|LOCUS_04620 51240 53576 gene locus_tag LOCUS_04630 gene pbpC 51240 53576 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444434.1 protein_id gnl|my_center|LOCUS_04630 53904 55130 gene locus_tag LOCUS_04640 gene hisD 53904 55130 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_04640 55206 55412 gene locus_tag LOCUS_04650 55206 55412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 55432 56016 gene locus_tag LOCUS_04660 gene hisB 55432 56016 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263176.1 protein_id gnl|my_center|LOCUS_04660 56143 56886 gene locus_tag LOCUS_04670 gene hisA 56143 56886 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_04670 56888 57640 gene locus_tag LOCUS_04680 gene hisF 56888 57640 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_04680 57783 58172 gene locus_tag LOCUS_04690 gene hisI 57783 58172 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_04690 58297 58926 gene locus_tag LOCUS_04700 58297 58926 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_04700 59069 60031 gene locus_tag LOCUS_04710 59069 60031 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_04710 60133 60939 gene locus_tag LOCUS_04720 gene accD 60133 60939 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_04720 61063 62322 gene locus_tag LOCUS_04730 61063 62322 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_04730 62327 63271 gene locus_tag LOCUS_04740 62327 63271 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_04740 63258 65357 gene locus_tag LOCUS_04750 63258 65357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 65502 66497 gene locus_tag LOCUS_04760 gene rfbB 65502 66497 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_04760 66659 66868 gene locus_tag LOCUS_04770 66659 66868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 66898 67752 gene locus_tag LOCUS_04780 66898 67752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 67899 69899 gene locus_tag LOCUS_04790 67899 69899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 69896 70717 gene locus_tag LOCUS_04800 69896 70717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 70717 71601 gene locus_tag LOCUS_04810 70717 71601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 71776 71952 gene locus_tag LOCUS_04820 71776 71952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 72135 72791 gene locus_tag LOCUS_04830 72135 72791 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_04830 72905 73555 gene locus_tag LOCUS_04840 72905 73555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 73641 74135 gene locus_tag LOCUS_04850 73641 74135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 74233 75681 gene locus_tag LOCUS_04860 74233 75681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 75732 77912 gene locus_tag LOCUS_04870 75732 77912 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_04870 78052 78339 gene locus_tag LOCUS_04880 78052 78339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 80325 78469 gene locus_tag LOCUS_04890 80325 78469 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_04890 80593 81693 gene locus_tag LOCUS_04900 gene nspC 80593 81693 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 protein_id gnl|my_center|LOCUS_04900 81905 83164 gene locus_tag LOCUS_04910 81905 83164 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969784.1 protein_id gnl|my_center|LOCUS_04910 83770 83198 gene locus_tag LOCUS_04920 83770 83198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 83652 83879 gene locus_tag LOCUS_04930 83652 83879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 83914 84129 gene locus_tag LOCUS_04940 83914 84129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 84718 84164 gene locus_tag LOCUS_04950 84718 84164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 85239 84718 gene locus_tag LOCUS_04960 85239 84718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 85487 87328 gene locus_tag LOCUS_04970 85487 87328 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_04970 87488 87898 gene locus_tag LOCUS_04980 gene nusB 87488 87898 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_04980 87978 90008 gene locus_tag LOCUS_04990 gene ligA 87978 90008 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04990 90086 90463 gene locus_tag LOCUS_05000 90086 90463 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965543.1 protein_id gnl|my_center|LOCUS_05000 90587 91297 gene locus_tag LOCUS_05010 90587 91297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 91331 91915 gene locus_tag LOCUS_05020 91331 91915 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020496.1 protein_id gnl|my_center|LOCUS_05020 94904 91971 gene locus_tag LOCUS_05030 94904 91971 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_05030 95089 96132 gene locus_tag LOCUS_05040 95089 96132 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_05040 96162 96377 gene locus_tag LOCUS_05050 96162 96377 CDS product superinfection immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858641.1 protein_id gnl|my_center|LOCUS_05050 96391 97011 gene locus_tag LOCUS_05060 96391 97011 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_05060 97074 98156 gene locus_tag LOCUS_05070 97074 98156 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_05070 98176 98586 gene locus_tag LOCUS_05080 98176 98586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 98702 99559 gene locus_tag LOCUS_05090 98702 99559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 99605 100168 gene locus_tag LOCUS_05100 99605 100168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 100209 101765 gene locus_tag LOCUS_05110 gene purH 100209 101765 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545749.1 protein_id gnl|my_center|LOCUS_05110 101880 102755 gene locus_tag LOCUS_05120 101880 102755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 102899 104098 gene locus_tag LOCUS_05130 102899 104098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 105312 104233 gene locus_tag LOCUS_05140 gene lptG 105312 104233 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_05140 106452 105397 gene locus_tag LOCUS_05150 gene lptF 106452 105397 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence06 2159 357 gene locus_tag LOCUS_05160 2159 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3497 2202 gene locus_tag LOCUS_05170 3497 2202 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_05170 4949 3498 gene locus_tag LOCUS_05180 4949 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5058 5831 gene locus_tag LOCUS_05190 5058 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7991 5841 gene locus_tag LOCUS_05200 gene ppk1 7991 5841 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_05200 17477 8025 gene locus_tag LOCUS_05210 17477 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 17404 17568 gene locus_tag LOCUS_05220 17404 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 18446 17580 gene locus_tag LOCUS_05230 18446 17580 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_05230 19747 18443 gene locus_tag LOCUS_05240 19747 18443 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_05240 30914 20007 gene locus_tag LOCUS_05250 30914 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 33197 31134 gene locus_tag LOCUS_05260 gene uvrB 33197 31134 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441046.1 protein_id gnl|my_center|LOCUS_05260 34043 33309 gene locus_tag LOCUS_05270 gene surE 34043 33309 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880503.1 protein_id gnl|my_center|LOCUS_05270 35116 34043 gene locus_tag LOCUS_05280 gene murG 35116 34043 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_05280 36216 35113 gene locus_tag LOCUS_05290 gene spoVE 36216 35113 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_05290 37669 36335 gene locus_tag LOCUS_05300 gene murD 37669 36335 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_05300 38758 37673 gene locus_tag LOCUS_05310 gene mraY 38758 37673 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_05310 40161 38758 gene locus_tag LOCUS_05320 gene murF 40161 38758 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_05320 41687 40161 gene locus_tag LOCUS_05330 41687 40161 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_05330 43571 41859 gene locus_tag LOCUS_05340 43571 41859 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_05340 43824 43573 gene locus_tag LOCUS_05350 43824 43573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 44692 43817 gene locus_tag LOCUS_05360 gene rsmH 44692 43817 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_05360 45047 44694 gene locus_tag LOCUS_05370 45047 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 46381 45665 gene locus_tag LOCUS_05380 46381 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 46584 46513 gene locus_tag LOCUS_t00150 46584 46513 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46838 46765 gene locus_tag LOCUS_t00160 46838 46765 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47540 46941 gene locus_tag LOCUS_05390 47540 46941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 48492 47602 gene locus_tag LOCUS_05400 gene rfbA 48492 47602 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_05400 49822 48518 gene locus_tag LOCUS_05410 49822 48518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 50589 49825 gene locus_tag LOCUS_05420 50589 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 50720 50586 gene locus_tag LOCUS_05430 50720 50586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51626 50901 gene locus_tag LOCUS_05440 51626 50901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 52687 51623 gene locus_tag LOCUS_05450 gene gcvT 52687 51623 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_05450 54032 52689 gene locus_tag LOCUS_05460 gene lpdA 54032 52689 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083198.1 protein_id gnl|my_center|LOCUS_05460 55750 54041 gene locus_tag LOCUS_05470 55750 54041 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_05470 56346 55882 gene locus_tag LOCUS_05480 gene greA 56346 55882 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_05480 57441 56365 gene locus_tag LOCUS_05490 gene ispG 57441 56365 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_05490 58559 57507 gene locus_tag LOCUS_05500 gene rseP 58559 57507 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_05500 58725 58498 gene locus_tag LOCUS_05510 58725 58498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 59840 58677 gene locus_tag LOCUS_05520 59840 58677 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_05520 60912 60109 gene locus_tag LOCUS_05530 60912 60109 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_05530 61630 60923 gene locus_tag LOCUS_05540 61630 60923 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_05540 61817 61644 gene locus_tag LOCUS_05550 61817 61644 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_05550 62465 61905 gene locus_tag LOCUS_05560 gene frr 62465 61905 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_05560 63260 62568 gene locus_tag LOCUS_05570 gene pyrH 63260 62568 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_05570 63856 63260 gene locus_tag LOCUS_05580 gene tsf 63856 63260 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_05580 64634 63846 gene locus_tag LOCUS_05590 gene rpsB 64634 63846 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_05590 66130 64871 gene locus_tag LOCUS_05600 66130 64871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 66899 66525 gene locus_tag LOCUS_05610 66899 66525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 66991 68571 gene locus_tag LOCUS_05620 66991 68571 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_05620 70161 68563 gene locus_tag LOCUS_05630 70161 68563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 71414 70158 gene locus_tag LOCUS_05640 gene murA 71414 70158 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_05640 72273 71425 gene locus_tag LOCUS_05650 gene prmC 72273 71425 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546726.1 protein_id gnl|my_center|LOCUS_05650 73502 72444 gene locus_tag LOCUS_05660 gene prfA 73502 72444 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_05660 73920 73582 gene locus_tag LOCUS_05670 73920 73582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 75410 74124 gene locus_tag LOCUS_05680 gene rho 75410 74124 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_05680 76177 75584 gene locus_tag LOCUS_05690 gene coaE 76177 75584 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_05690 79002 76315 gene locus_tag LOCUS_05700 gene polA 79002 76315 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_05700 79935 79024 gene locus_tag LOCUS_05710 gene trxB 79935 79024 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_05710 80547 80068 gene locus_tag LOCUS_05720 80547 80068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 80857 80537 gene locus_tag LOCUS_05730 gene trxA 80857 80537 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_05730 81857 80913 gene locus_tag LOCUS_05740 gene fmt 81857 80913 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_05740 82360 81851 gene locus_tag LOCUS_05750 gene def 82360 81851 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_05750 82554 82484 gene locus_tag LOCUS_t00170 82554 82484 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 84069 82612 gene locus_tag LOCUS_05760 84069 82612 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583871.1 protein_id gnl|my_center|LOCUS_05760 84844 84095 gene locus_tag LOCUS_05770 84844 84095 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015722.1 protein_id gnl|my_center|LOCUS_05770 85632 84856 gene locus_tag LOCUS_05780 85632 84856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 86429 85632 gene locus_tag LOCUS_05790 86429 85632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_05790 87581 86610 gene locus_tag LOCUS_05800 87581 86610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_05800 89237 87594 gene locus_tag LOCUS_05810 89237 87594 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_05810 89663 89376 gene locus_tag LOCUS_05820 89663 89376 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_05820 91006 89771 gene locus_tag LOCUS_05830 91006 89771 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_05830 92288 91071 gene locus_tag LOCUS_05840 92288 91071 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_05840 93003 92365 gene locus_tag LOCUS_05850 93003 92365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 93373 93026 gene locus_tag LOCUS_05860 93373 93026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 93766 93392 gene locus_tag LOCUS_05870 93766 93392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 94621 93830 gene locus_tag LOCUS_05880 gene amrB 94621 93830 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_05880 95508 94618 gene locus_tag LOCUS_05890 95508 94618 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_05890 96038 95508 gene locus_tag LOCUS_05900 96038 95508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 96482 96048 gene locus_tag LOCUS_05910 gene dtd 96482 96048 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_05910 97523 96528 gene locus_tag LOCUS_05920 97523 96528 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_05920 98825 97932 gene locus_tag LOCUS_05930 98825 97932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 99349 98921 gene locus_tag LOCUS_05940 99349 98921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 99788 99714 gene locus_tag LOCUS_t00180 99788 99714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 100470 99976 gene locus_tag LOCUS_05950 gene def 100470 99976 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_05950 101028 100483 gene locus_tag LOCUS_05960 101028 100483 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_05960 103686 101041 gene locus_tag LOCUS_05970 gene alaS 103686 101041 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545089.1 protein_id gnl|my_center|LOCUS_05970 104724 103822 gene locus_tag LOCUS_05980 104724 103822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 105326 104739 gene locus_tag LOCUS_05990 105326 104739 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence07 466 1425 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttagggttgccccccgagtttgaacttggtaaaat 2811 1915 gene locus_tag LOCUS_06000 gene cas1 2811 1915 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06000 6376 2813 gene locus_tag LOCUS_06010 gene cas9 6376 2813 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_06010 7460 6447 gene locus_tag LOCUS_06020 7460 6447 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297790.1 protein_id gnl|my_center|LOCUS_06020 7645 7463 gene locus_tag LOCUS_06030 7645 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7839 7657 gene locus_tag LOCUS_06040 7839 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8410 7820 gene locus_tag LOCUS_06050 8410 7820 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_06050 10988 8472 gene locus_tag LOCUS_06060 gene gyrA 10988 8472 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_06060 11638 11225 gene locus_tag LOCUS_06070 11638 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12341 11754 gene locus_tag LOCUS_06080 12341 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 15004 12467 gene locus_tag LOCUS_06090 gene gyrB 15004 12467 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263617.1 protein_id gnl|my_center|LOCUS_06090 15230 15087 gene locus_tag LOCUS_06100 15230 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 15994 15227 gene locus_tag LOCUS_06110 15994 15227 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_06110 16354 16022 gene locus_tag LOCUS_06120 16354 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 17575 16451 gene locus_tag LOCUS_06130 gene dnaN 17575 16451 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_06130 18608 17907 gene locus_tag LOCUS_06140 18608 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 19987 18629 gene locus_tag LOCUS_06150 gene dnaA 19987 18629 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_06150 20926 20072 gene locus_tag LOCUS_06160 gene rsmA 20926 20072 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_06160 21104 21493 gene locus_tag LOCUS_06170 21104 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 22871 21495 gene locus_tag LOCUS_06180 gene mnmE 22871 21495 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_06180 23621 22950 gene locus_tag LOCUS_06190 23621 22950 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_06190 25282 23708 gene locus_tag LOCUS_06200 gene yidC 25282 23708 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_06200 26084 25722 gene locus_tag LOCUS_06210 gene rnpA 26084 25722 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_06210 26314 26180 gene locus_tag LOCUS_06220 gene rpmH 26314 26180 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262507.1 protein_id gnl|my_center|LOCUS_06220 26711 28123 gene locus_tag LOCUS_06230 26711 28123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_06230 28253 29530 gene locus_tag LOCUS_06240 28253 29530 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544916.1 protein_id gnl|my_center|LOCUS_06240 29558 30034 gene locus_tag LOCUS_06250 29558 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 30225 30539 gene locus_tag LOCUS_06260 30225 30539 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_06260 30600 30947 gene locus_tag LOCUS_06270 30600 30947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 31199 32917 gene locus_tag LOCUS_06280 gene iorA 31199 32917 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_06280 32994 33482 gene locus_tag LOCUS_06290 32994 33482 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_06290 33502 34407 gene locus_tag LOCUS_06300 33502 34407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 34421 35722 gene locus_tag LOCUS_06310 34421 35722 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_06310 35882 36640 gene locus_tag LOCUS_06320 35882 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 36768 37514 gene locus_tag LOCUS_06330 36768 37514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 37537 39198 gene locus_tag LOCUS_06340 37537 39198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 39315 39746 gene locus_tag LOCUS_06350 39315 39746 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_06350 39837 41096 gene locus_tag LOCUS_06360 39837 41096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 41170 41562 gene locus_tag LOCUS_06370 41170 41562 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_06370 41685 42383 gene locus_tag LOCUS_06380 41685 42383 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_06380 42383 43063 gene locus_tag LOCUS_06390 42383 43063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 43159 44151 gene locus_tag LOCUS_06400 43159 44151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 44391 45818 gene locus_tag LOCUS_06410 44391 45818 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080708.1 protein_id gnl|my_center|LOCUS_06410 45951 46715 gene locus_tag LOCUS_06420 gene soj 45951 46715 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_06420 46860 47729 gene locus_tag LOCUS_06430 46860 47729 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_06430 48247 48732 gene locus_tag LOCUS_06440 48247 48732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 49066 55581 gene locus_tag LOCUS_06450 49066 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 55811 57079 gene locus_tag LOCUS_06460 55811 57079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 57464 66559 gene locus_tag LOCUS_06470 57464 66559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 66706 67350 gene locus_tag LOCUS_06480 gene bioD 66706 67350 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_06480 67794 67393 gene locus_tag LOCUS_06490 67794 67393 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_06490 68836 67796 gene locus_tag LOCUS_06500 gene arsB 68836 67796 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_06500 69691 68849 gene locus_tag LOCUS_06510 69691 68849 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_06510 70094 69750 gene locus_tag LOCUS_06520 70094 69750 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_06520 70184 71599 gene locus_tag LOCUS_06530 gene bioA 70184 71599 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_06530 71627 72508 gene locus_tag LOCUS_06540 71627 72508 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_06540 72724 74028 gene locus_tag LOCUS_06550 72724 74028 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_06550 75008 74127 gene locus_tag LOCUS_06560 75008 74127 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_06560 76630 75005 gene locus_tag LOCUS_06570 76630 75005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 78675 76711 gene locus_tag LOCUS_06580 78675 76711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_06580 79060 78761 gene locus_tag LOCUS_06590 79060 78761 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_06590 79582 79169 gene locus_tag LOCUS_06600 79582 79169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 80559 79633 gene locus_tag LOCUS_06610 80559 79633 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932069.1 protein_id gnl|my_center|LOCUS_06610 81937 80684 gene locus_tag LOCUS_06620 81937 80684 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926846.1 protein_id gnl|my_center|LOCUS_06620 82194 82730 gene locus_tag LOCUS_06630 82194 82730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 83020 83358 gene locus_tag LOCUS_06640 83020 83358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 83578 85719 gene locus_tag LOCUS_06650 83578 85719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 85875 88595 gene locus_tag LOCUS_06660 85875 88595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence08 820 1563 gene locus_tag LOCUS_06670 820 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1681 2871 gene locus_tag LOCUS_06680 1681 2871 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269286.1 protein_id gnl|my_center|LOCUS_06680 3014 4348 gene locus_tag LOCUS_06690 3014 4348 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_06690 4338 5009 gene locus_tag LOCUS_06700 4338 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5006 6031 gene locus_tag LOCUS_06710 gene tsaD 5006 6031 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_06710 6183 7184 gene locus_tag LOCUS_06720 gene dusB 6183 7184 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_06720 8947 7187 gene locus_tag LOCUS_06730 8947 7187 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_06730 9114 9872 gene locus_tag LOCUS_06740 9114 9872 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_06740 9953 12565 gene locus_tag LOCUS_06750 9953 12565 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_06750 12708 13349 gene locus_tag LOCUS_06760 12708 13349 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_06760 13462 21234 gene locus_tag LOCUS_06770 13462 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21393 28412 gene locus_tag LOCUS_06780 21393 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 28479 28967 gene locus_tag LOCUS_06790 28479 28967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 29072 30967 gene locus_tag LOCUS_06800 29072 30967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 31286 31795 gene locus_tag LOCUS_06810 gene nrdR 31286 31795 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06810 31869 34196 gene locus_tag LOCUS_06820 31869 34196 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_06820 34304 34873 gene locus_tag LOCUS_06830 gene dcd 34304 34873 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_06830 35012 36265 gene locus_tag LOCUS_06840 35012 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 36369 37247 gene locus_tag LOCUS_06850 36369 37247 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_06850 37244 38110 gene locus_tag LOCUS_06860 gene pstC 37244 38110 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_06860 38241 39095 gene locus_tag LOCUS_06870 gene pstA 38241 39095 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_06870 39136 39885 gene locus_tag LOCUS_06880 gene pstB 39136 39885 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_06880 40029 40784 gene locus_tag LOCUS_06890 gene pstB 40029 40784 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538553.1 protein_id gnl|my_center|LOCUS_06890 40899 41564 gene locus_tag LOCUS_06900 gene phoU 40899 41564 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_06900 41801 44188 gene locus_tag LOCUS_06910 gene purL 41801 44188 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_06910 44513 44824 gene locus_tag LOCUS_06920 44513 44824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 44836 46308 gene locus_tag LOCUS_06930 gene purD 44836 46308 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_06930 46377 46910 gene locus_tag LOCUS_06940 gene purE 46377 46910 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124346.1 protein_id gnl|my_center|LOCUS_06940 46910 47443 gene locus_tag LOCUS_06950 gene pyrR 46910 47443 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_06950 47462 48430 gene locus_tag LOCUS_06960 47462 48430 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_06960 48453 49745 gene locus_tag LOCUS_06970 48453 49745 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_06970 49709 50485 gene locus_tag LOCUS_06980 49709 50485 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_06980 50495 51265 gene locus_tag LOCUS_06990 50495 51265 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_06990 51252 52181 gene locus_tag LOCUS_07000 51252 52181 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_07000 52174 52818 gene locus_tag LOCUS_07010 gene pyrF 52174 52818 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545803.1 protein_id gnl|my_center|LOCUS_07010 52820 53395 gene locus_tag LOCUS_07020 gene pyrE 52820 53395 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_07020 53466 54428 gene locus_tag LOCUS_07030 gene purM 53466 54428 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 protein_id gnl|my_center|LOCUS_07030 54441 55442 gene locus_tag LOCUS_07040 54441 55442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 55546 56139 gene locus_tag LOCUS_07050 gene purN 55546 56139 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_07050 56275 57570 gene locus_tag LOCUS_07060 gene purB 56275 57570 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_07060 57573 58394 gene locus_tag LOCUS_07070 57573 58394 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_07070 58434 61646 gene locus_tag LOCUS_07080 58434 61646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 protein_id gnl|my_center|LOCUS_07080 61658 63643 gene locus_tag LOCUS_07090 61658 63643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 63828 63903 gene locus_tag LOCUS_t00190 63828 63903 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63946 66006 gene locus_tag LOCUS_07100 63946 66006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 66003 67265 gene locus_tag LOCUS_07110 66003 67265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 67450 70275 gene locus_tag LOCUS_07120 67450 70275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 70292 70900 gene locus_tag LOCUS_07130 70292 70900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 70953 71630 gene locus_tag LOCUS_07140 70953 71630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 71627 72286 gene locus_tag LOCUS_07150 71627 72286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 72421 73377 gene locus_tag LOCUS_07160 72421 73377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 73553 74458 gene locus_tag LOCUS_07170 73553 74458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 74600 75343 gene locus_tag LOCUS_07180 74600 75343 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_07180 75461 76234 gene locus_tag LOCUS_07190 75461 76234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 76402 77868 gene locus_tag LOCUS_07200 76402 77868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 78453 79364 gene locus_tag LOCUS_07210 78453 79364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 79430 80260 gene locus_tag LOCUS_07220 79430 80260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence09 703 125 gene locus_tag LOCUS_07230 703 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2422 1010 gene locus_tag LOCUS_07240 2422 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2947 4398 gene locus_tag LOCUS_07250 2947 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4594 4460 gene locus_tag LOCUS_07260 4594 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5015 4939 gene locus_tag LOCUS_t00200 5015 4939 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5429 5061 gene locus_tag LOCUS_07270 5429 5061 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_07270 5548 5473 gene locus_tag LOCUS_t00210 5548 5473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8778 5749 gene locus_tag LOCUS_07280 8778 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9172 14934 gene locus_tag LOCUS_07290 9172 14934 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947392.1 protein_id gnl|my_center|LOCUS_07290 14966 17323 gene locus_tag LOCUS_07300 gene pbpC 14966 17323 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444434.1 protein_id gnl|my_center|LOCUS_07300 17400 18137 gene locus_tag LOCUS_07310 17400 18137 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_07310 18253 18633 gene locus_tag LOCUS_07320 18253 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 18742 19569 gene locus_tag LOCUS_07330 18742 19569 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_07330 20665 19961 gene locus_tag LOCUS_07340 20665 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 21648 20743 gene locus_tag LOCUS_07350 21648 20743 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_07350 22351 21638 gene locus_tag LOCUS_07360 gene truB 22351 21638 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810552.1 protein_id gnl|my_center|LOCUS_07360 23336 22341 gene locus_tag LOCUS_07370 23336 22341 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_07370 23748 23401 gene locus_tag LOCUS_07380 gene rbfA 23748 23401 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_07380 26068 23828 gene locus_tag LOCUS_07390 26068 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 27362 26109 gene locus_tag LOCUS_07400 gene nusA 27362 26109 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07400 27853 27395 gene locus_tag LOCUS_07410 27853 27395 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_07410 28943 27948 gene locus_tag LOCUS_07420 28943 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31355 29007 gene locus_tag LOCUS_07430 31355 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 32932 31319 gene locus_tag LOCUS_07440 32932 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 33704 32952 gene locus_tag LOCUS_07450 33704 32952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 34490 33804 gene locus_tag LOCUS_07460 34490 33804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 35769 34600 gene locus_tag LOCUS_07470 35769 34600 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_07470 36687 36004 gene locus_tag LOCUS_07480 36687 36004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 36976 37803 gene locus_tag LOCUS_07490 36976 37803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 37811 38509 gene locus_tag LOCUS_07500 37811 38509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 38516 39979 gene locus_tag LOCUS_07510 38516 39979 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229056.1 protein_id gnl|my_center|LOCUS_07510 39969 40229 gene locus_tag LOCUS_07520 39969 40229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 40239 40964 gene locus_tag LOCUS_07530 gene fabG 40239 40964 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_07530 41107 42405 gene locus_tag LOCUS_07540 41107 42405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 42420 43025 gene locus_tag LOCUS_07550 42420 43025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 43076 44776 gene locus_tag LOCUS_07560 gene metG 43076 44776 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383822.1 protein_id gnl|my_center|LOCUS_07560 44781 46592 gene locus_tag LOCUS_07570 44781 46592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 46577 47293 gene locus_tag LOCUS_07580 46577 47293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 47367 47699 gene locus_tag LOCUS_07590 47367 47699 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_07590 47706 49679 gene locus_tag LOCUS_07600 47706 49679 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_07600 51286 49754 gene locus_tag LOCUS_07610 51286 49754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 52625 51276 gene locus_tag LOCUS_07620 52625 51276 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_07620 53782 52742 gene locus_tag LOCUS_07630 53782 52742 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_07630 54512 53787 gene locus_tag LOCUS_07640 54512 53787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 55720 54527 gene locus_tag LOCUS_07650 55720 54527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 58335 55777 gene locus_tag LOCUS_07660 58335 55777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 59777 58338 gene locus_tag LOCUS_07670 59777 58338 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107843.1 protein_id gnl|my_center|LOCUS_07670 60618 59764 gene locus_tag LOCUS_07680 60618 59764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 62408 60636 gene locus_tag LOCUS_07690 62408 60636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_07690 62547 62918 gene locus_tag LOCUS_07700 62547 62918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 63728 63051 gene locus_tag LOCUS_07710 gene rplA 63728 63051 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_07710 64432 63998 gene locus_tag LOCUS_07720 gene rplK 64432 63998 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946069.1 protein_id gnl|my_center|LOCUS_07720 65101 64571 gene locus_tag LOCUS_07730 gene nusG 65101 64571 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_07730 65304 65116 gene locus_tag LOCUS_07740 65304 65116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 65515 65444 gene locus_tag LOCUS_t00220 65515 65444 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 65725 65573 gene locus_tag LOCUS_07750 gene rpmG 65725 65573 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908609.1 protein_id gnl|my_center|LOCUS_07750 66648 65821 gene locus_tag LOCUS_07760 66648 65821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence10 1590 148 gene locus_tag LOCUS_07770 1590 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2486 1587 gene locus_tag LOCUS_07780 2486 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3728 2736 gene locus_tag LOCUS_07790 3728 2736 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_07790 4606 3725 gene locus_tag LOCUS_07800 4606 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5488 4607 gene locus_tag LOCUS_07810 5488 4607 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_07810 6661 5639 gene locus_tag LOCUS_07820 gene argC 6661 5639 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_07820 7448 6759 gene locus_tag LOCUS_07830 gene rsmI 7448 6759 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_07830 8823 7582 gene locus_tag LOCUS_07840 8823 7582 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583578.1 protein_id gnl|my_center|LOCUS_07840 10462 8879 gene locus_tag LOCUS_07850 10462 8879 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_07850 11510 10632 gene locus_tag LOCUS_07860 11510 10632 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124243.1 protein_id gnl|my_center|LOCUS_07860 11759 12865 gene locus_tag LOCUS_07870 gene dprA 11759 12865 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_07870 12990 15236 gene locus_tag LOCUS_07880 gene topA 12990 15236 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259747.1 protein_id gnl|my_center|LOCUS_07880 15128 16093 gene locus_tag LOCUS_07890 gene xerC 15128 16093 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_07890 16248 17144 gene locus_tag LOCUS_07900 16248 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 17820 17350 gene locus_tag LOCUS_07910 17820 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 18983 17946 gene locus_tag LOCUS_07920 18983 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 19751 19128 gene locus_tag LOCUS_07930 19751 19128 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_07930 20163 19687 gene locus_tag LOCUS_07940 20163 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 21753 20230 gene locus_tag LOCUS_07950 21753 20230 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_07950 21957 22535 gene locus_tag LOCUS_07960 21957 22535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 24447 22588 gene locus_tag LOCUS_07970 24447 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 25380 24460 gene locus_tag LOCUS_07980 25380 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 26180 25497 gene locus_tag LOCUS_07990 26180 25497 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_07990 27160 26258 gene locus_tag LOCUS_08000 27160 26258 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670643.1 protein_id gnl|my_center|LOCUS_08000 28071 27214 gene locus_tag LOCUS_08010 28071 27214 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_08010 28820 28203 gene locus_tag LOCUS_08020 28820 28203 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_08020 29470 28907 gene locus_tag LOCUS_08030 gene pth 29470 28907 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_08030 30265 29561 gene locus_tag LOCUS_08040 30265 29561 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_08040 31286 30354 gene locus_tag LOCUS_08050 31286 30354 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_08050 32689 31325 gene locus_tag LOCUS_08060 gene glmU 32689 31325 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_08060 33012 33863 gene locus_tag LOCUS_08070 33012 33863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 34852 34160 gene locus_tag LOCUS_08080 34852 34160 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808268.1 protein_id gnl|my_center|LOCUS_08080 35622 34888 gene locus_tag LOCUS_08090 35622 34888 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 protein_id gnl|my_center|LOCUS_08090 36263 35646 gene locus_tag LOCUS_08100 36263 35646 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675038.1 protein_id gnl|my_center|LOCUS_08100 36982 36287 gene locus_tag LOCUS_08110 36982 36287 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762363.1 protein_id gnl|my_center|LOCUS_08110 37197 37685 gene locus_tag LOCUS_08120 37197 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 37703 38419 gene locus_tag LOCUS_08130 37703 38419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 38515 38444 gene locus_tag LOCUS_t00230 38515 38444 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 38853 38581 gene locus_tag LOCUS_08140 gene spoVG 38853 38581 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421453.1 protein_id gnl|my_center|LOCUS_08140 39729 38878 gene locus_tag LOCUS_08150 gene ispE 39729 38878 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_08150 41910 39745 gene locus_tag LOCUS_08160 41910 39745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 42374 41907 gene locus_tag LOCUS_08170 gene rimI 42374 41907 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546589.1 protein_id gnl|my_center|LOCUS_08170 43480 42455 gene locus_tag LOCUS_08180 gene pdxA 43480 42455 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_08180 44544 43486 gene locus_tag LOCUS_08190 44544 43486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 45470 44568 gene locus_tag LOCUS_08200 45470 44568 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_08200 48773 45603 gene locus_tag LOCUS_08210 48773 45603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 49292 48921 gene locus_tag LOCUS_08220 49292 48921 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_08220 50778 49270 gene locus_tag LOCUS_08230 50778 49270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 51809 50775 gene locus_tag LOCUS_08240 51809 50775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 52875 52018 gene locus_tag LOCUS_08250 52875 52018 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876176.1 protein_id gnl|my_center|LOCUS_08250 54737 53034 gene locus_tag LOCUS_08260 54737 53034 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_08260 55606 54869 gene locus_tag LOCUS_08270 55606 54869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 56333 55755 gene locus_tag LOCUS_08280 56333 55755 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_08280 56806 56354 gene locus_tag LOCUS_08290 56806 56354 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146718.1 protein_id gnl|my_center|LOCUS_08290 56992 56834 gene locus_tag LOCUS_08300 56992 56834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 58322 57123 gene locus_tag LOCUS_08310 58322 57123 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_08310 58844 58341 gene locus_tag LOCUS_08320 58844 58341 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_08320 59179 58997 gene locus_tag LOCUS_08330 59179 58997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 59632 59246 gene locus_tag LOCUS_08340 gene nifU 59632 59246 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_08340 60962 59712 gene locus_tag LOCUS_08350 gene nifS 60962 59712 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_08350 61244 61086 gene locus_tag LOCUS_08360 61244 61086 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_08360 61693 61283 gene locus_tag LOCUS_08370 61693 61283 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_08370 61943 63406 gene locus_tag LOCUS_08380 gene guaB 61943 63406 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_08380 63519 64451 gene locus_tag LOCUS_08390 63519 64451 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545151.1 protein_id gnl|my_center|LOCUS_08390 <66146 64587 gene locus_tag LOCUS_08400 <66146 64587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002970704.1:OmpA family protein >Feature sequence11 5896 3200 gene locus_tag LOCUS_08410 5896 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7653 5926 gene locus_tag LOCUS_08420 7653 5926 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104447.1 protein_id gnl|my_center|LOCUS_08420 8086 7661 gene locus_tag LOCUS_08430 8086 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8845 8258 gene locus_tag LOCUS_08440 8845 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9189 8959 gene locus_tag LOCUS_08450 9189 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10008 9223 gene locus_tag LOCUS_08460 10008 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10165 9998 gene locus_tag LOCUS_08470 10165 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 10712 10251 gene locus_tag LOCUS_08480 10712 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 11224 10769 gene locus_tag LOCUS_08490 11224 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 12031 11264 gene locus_tag LOCUS_08500 12031 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 12518 12120 gene locus_tag LOCUS_08510 12518 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 28478 12585 gene locus_tag LOCUS_08520 28478 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 30162 28522 gene locus_tag LOCUS_08530 30162 28522 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_08530 30638 30159 gene locus_tag LOCUS_08540 30638 30159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 31595 30870 gene locus_tag LOCUS_08550 31595 30870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 34440 31741 gene locus_tag LOCUS_08560 gene mgtA 34440 31741 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905854.1 protein_id gnl|my_center|LOCUS_08560 35469 34645 gene locus_tag LOCUS_08570 gene lipA 35469 34645 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880870.1 protein_id gnl|my_center|LOCUS_08570 40866 35530 gene locus_tag LOCUS_08580 40866 35530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 46405 41039 gene locus_tag LOCUS_08590 46405 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 62065 46550 gene locus_tag LOCUS_08600 62065 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 63883 62201 gene locus_tag LOCUS_08610 63883 62201 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_08610 64707 64075 gene locus_tag LOCUS_08620 64707 64075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence12 9131 7791 gene locus_tag LOCUS_08630 9131 7791 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_08630 12390 9262 gene locus_tag LOCUS_08640 12390 9262 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_08640 13862 12540 gene locus_tag LOCUS_08650 13862 12540 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_08650 15561 14071 gene locus_tag LOCUS_08660 15561 14071 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_08660 16657 15656 gene locus_tag LOCUS_08670 16657 15656 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_08670 17384 16641 gene locus_tag LOCUS_08680 17384 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 17578 17381 gene locus_tag LOCUS_08690 17578 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 18419 17700 gene locus_tag LOCUS_08700 18419 17700 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_08700 19729 18560 gene locus_tag LOCUS_08710 19729 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 23161 19745 gene locus_tag LOCUS_08720 23161 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 23728 23360 gene locus_tag LOCUS_08730 23728 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 24279 23920 gene locus_tag LOCUS_08740 24279 23920 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_08740 25003 24350 gene locus_tag LOCUS_08750 25003 24350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 25517 25116 gene locus_tag LOCUS_08760 gene rplS 25517 25116 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_08760 26360 25656 gene locus_tag LOCUS_08770 gene trmD 26360 25656 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_08770 26691 26350 gene locus_tag LOCUS_08780 26691 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 26959 26729 gene locus_tag LOCUS_08790 26959 26729 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_08790 27234 26983 gene locus_tag LOCUS_08800 gene rpsP 27234 26983 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_08800 27641 28009 gene locus_tag LOCUS_08810 27641 28009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 28281 29585 gene locus_tag LOCUS_08820 gene eno 28281 29585 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_08820 29716 30030 gene locus_tag LOCUS_08830 29716 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 30011 30358 gene locus_tag LOCUS_08840 30011 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 30367 30771 gene locus_tag LOCUS_08850 gene nikR 30367 30771 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_08850 30785 31852 gene locus_tag LOCUS_08860 30785 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 32429 31854 gene locus_tag LOCUS_08870 32429 31854 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_08870 33256 32456 gene locus_tag LOCUS_08880 33256 32456 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_08880 34102 33395 gene locus_tag LOCUS_08890 34102 33395 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_08890 37427 34242 gene locus_tag LOCUS_08900 37427 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 40939 37661 gene locus_tag LOCUS_08910 40939 37661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 41894 41061 gene locus_tag LOCUS_08920 41894 41061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 43716 41911 gene locus_tag LOCUS_08930 43716 41911 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_08930 44479 43823 gene locus_tag LOCUS_08940 gene rpe 44479 43823 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_08940 45786 44836 gene locus_tag LOCUS_08950 45786 44836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 46949 45948 gene locus_tag LOCUS_08960 gene ilvC 46949 45948 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_08960 47468 46995 gene locus_tag LOCUS_08970 47468 46995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 48031 47552 gene locus_tag LOCUS_08980 gene ilvN 48031 47552 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_08980 49912 48179 gene locus_tag LOCUS_08990 gene ilvB 49912 48179 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_08990 51350 50073 gene locus_tag LOCUS_09000 51350 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 53122 51473 gene locus_tag LOCUS_09010 gene ilvD 53122 51473 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_09010 54705 53119 gene locus_tag LOCUS_09020 gene cimA 54705 53119 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_09020 55154 54720 gene locus_tag LOCUS_09030 55154 54720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 56380 55151 gene locus_tag LOCUS_09040 56380 55151 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_09040 57480 56563 gene locus_tag LOCUS_09050 gene thrB 57480 56563 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_09050 <63345 57959 gene locus_tag LOCUS_09060 <63345 57959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496538.1:intein-containing phosphoenolpyruvate synthase >Feature sequence13 473 2035 gene locus_tag LOCUS_09070 473 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2032 2754 gene locus_tag LOCUS_09080 2032 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2775 4370 gene locus_tag LOCUS_09090 2775 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4367 5956 gene locus_tag LOCUS_09100 4367 5956 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_09100 5981 6535 gene locus_tag LOCUS_09110 5981 6535 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_09110 6560 7333 gene locus_tag LOCUS_09120 6560 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7564 8616 gene locus_tag LOCUS_09130 7564 8616 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_09130 8665 9102 gene locus_tag LOCUS_09140 gene ndk 8665 9102 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_09140 9236 10444 gene locus_tag LOCUS_09150 9236 10444 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_09150 10572 11027 gene locus_tag LOCUS_09160 10572 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 11172 11399 gene locus_tag LOCUS_09170 11172 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 11399 12430 gene locus_tag LOCUS_09180 gene plsX 11399 12430 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_09180 12434 13423 gene locus_tag LOCUS_09190 12434 13423 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_09190 13567 14496 gene locus_tag LOCUS_09200 gene fabD 13567 14496 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_09200 14493 15236 gene locus_tag LOCUS_09210 gene fabG 14493 15236 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_09210 15396 15638 gene locus_tag LOCUS_09220 gene acpP 15396 15638 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_09220 15668 16909 gene locus_tag LOCUS_09230 gene fabF 15668 16909 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_09230 16899 17588 gene locus_tag LOCUS_09240 gene rnc 16899 17588 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_09240 17721 18887 gene locus_tag LOCUS_09250 17721 18887 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_09250 19004 19789 gene locus_tag LOCUS_09260 19004 19789 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_09260 19830 21062 gene locus_tag LOCUS_09270 19830 21062 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_09270 21303 21653 gene locus_tag LOCUS_09280 21303 21653 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846935.1 protein_id gnl|my_center|LOCUS_09280 21770 24004 gene locus_tag LOCUS_09290 gene hypF 21770 24004 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_09290 24076 25254 gene locus_tag LOCUS_09300 24076 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 25256 25474 gene locus_tag LOCUS_09310 25256 25474 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_09310 25476 26063 gene locus_tag LOCUS_09320 25476 26063 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 protein_id gnl|my_center|LOCUS_09320 26078 27217 gene locus_tag LOCUS_09330 gene hypD 26078 27217 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_09330 27356 28354 gene locus_tag LOCUS_09340 gene hypE 27356 28354 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_09340 28485 29465 gene locus_tag LOCUS_09350 28485 29465 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_09350 29490 30674 gene locus_tag LOCUS_09360 29490 30674 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_09360 30820 31932 gene locus_tag LOCUS_09370 30820 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_09370 32003 32473 gene locus_tag LOCUS_09380 32003 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 32467 32655 gene locus_tag LOCUS_09390 32467 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 32803 36276 gene locus_tag LOCUS_09400 gene smc 32803 36276 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_09400 36403 37527 gene locus_tag LOCUS_09410 36403 37527 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_09410 37685 38599 gene locus_tag LOCUS_09420 37685 38599 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_09420 39062 38637 gene locus_tag LOCUS_09430 39062 38637 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 protein_id gnl|my_center|LOCUS_09430 39576 39067 gene locus_tag LOCUS_09440 39576 39067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 40070 39636 gene locus_tag LOCUS_09450 40070 39636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 40474 41550 gene locus_tag LOCUS_09460 gene ribD 40474 41550 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_09460 41634 42254 gene locus_tag LOCUS_09470 41634 42254 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_09470 42256 43476 gene locus_tag LOCUS_09480 42256 43476 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_09480 43615 44082 gene locus_tag LOCUS_09490 gene ribE 43615 44082 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_09490 44247 44621 gene locus_tag LOCUS_09500 gene gcvH 44247 44621 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_09500 44741 46072 gene locus_tag LOCUS_09510 44741 46072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 46208 47641 gene locus_tag LOCUS_09520 gene gcvPB 46208 47641 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082890.1 protein_id gnl|my_center|LOCUS_09520 47790 48848 gene locus_tag LOCUS_09530 47790 48848 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_09530 49287 50585 gene locus_tag LOCUS_09540 49287 50585 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_09540 50582 51472 gene locus_tag LOCUS_09550 50582 51472 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_09550 51596 52444 gene locus_tag LOCUS_09560 51596 52444 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_09560 52581 53186 gene locus_tag LOCUS_09570 52581 53186 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_09570 53186 53602 gene locus_tag LOCUS_09580 53186 53602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 53641 55173 gene locus_tag LOCUS_09590 53641 55173 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_09590 55160 55852 gene locus_tag LOCUS_09600 gene radC 55160 55852 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_09600 55999 57408 gene locus_tag LOCUS_09610 55999 57408 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_09610 57471 57752 gene locus_tag LOCUS_09620 57471 57752 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_09620 58291 60465 gene locus_tag LOCUS_09630 58291 60465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence14 1189 119 gene locus_tag LOCUS_09640 1189 119 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883648.1 protein_id gnl|my_center|LOCUS_09640 1912 1199 gene locus_tag LOCUS_09650 1912 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2620 2066 gene locus_tag LOCUS_09660 2620 2066 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_09660 3895 2738 gene locus_tag LOCUS_09670 gene aroC 3895 2738 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545839.1 protein_id gnl|my_center|LOCUS_09670 4432 3989 gene locus_tag LOCUS_09680 4432 3989 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_09680 4756 4454 gene locus_tag LOCUS_09690 4756 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6875 4803 gene locus_tag LOCUS_09700 6875 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8423 7050 gene locus_tag LOCUS_09710 gene radA 8423 7050 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_09710 9830 8475 gene locus_tag LOCUS_09720 9830 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 10597 9833 gene locus_tag LOCUS_09730 10597 9833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_09730 11518 10694 gene locus_tag LOCUS_09740 11518 10694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_09740 12814 11651 gene locus_tag LOCUS_09750 gene alr 12814 11651 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09750 14184 12811 gene locus_tag LOCUS_09760 gene dnaB 14184 12811 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_09760 14752 14303 gene locus_tag LOCUS_09770 gene rplI 14752 14303 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_09770 15277 14984 gene locus_tag LOCUS_09780 15277 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15854 15393 gene locus_tag LOCUS_09790 gene ssb 15854 15393 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_09790 16203 15820 gene locus_tag LOCUS_09800 16203 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 16853 16446 gene locus_tag LOCUS_09810 16853 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17282 16953 gene locus_tag LOCUS_09820 17282 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 17827 17432 gene locus_tag LOCUS_09830 17827 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18375 18025 gene locus_tag LOCUS_09840 18375 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 20144 18762 gene locus_tag LOCUS_09850 gene gltA 20144 18762 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_09850 20992 20147 gene locus_tag LOCUS_09860 20992 20147 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_09860 22045 21086 gene locus_tag LOCUS_09870 22045 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 23460 22042 gene locus_tag LOCUS_09880 23460 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_09880 24087 23485 gene locus_tag LOCUS_09890 24087 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 25266 24100 gene locus_tag LOCUS_09900 gene tyrS 25266 24100 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_09900 25613 25314 gene locus_tag LOCUS_09910 25613 25314 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_09910 26656 25694 gene locus_tag LOCUS_09920 gene pfkA 26656 25694 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_09920 28842 26851 gene locus_tag LOCUS_09930 28842 26851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 29169 29807 gene locus_tag LOCUS_09940 29169 29807 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_09940 29800 30699 gene locus_tag LOCUS_09950 29800 30699 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_09950 30895 31479 gene locus_tag LOCUS_09960 30895 31479 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_09960 31476 32303 gene locus_tag LOCUS_09970 31476 32303 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_09970 32752 36546 gene locus_tag LOCUS_09980 32752 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 38027 36831 gene locus_tag LOCUS_09990 38027 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 38546 39292 gene locus_tag LOCUS_10000 gene gpmA 38546 39292 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_10000 40442 39423 gene locus_tag LOCUS_10010 gene coxFIC1 40442 39423 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_10010 40949 40614 gene locus_tag LOCUS_10020 40949 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 41263 40946 gene locus_tag LOCUS_10030 41263 40946 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_10030 41471 41383 gene locus_tag LOCUS_t00240 41471 41383 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41688 42533 gene locus_tag LOCUS_10040 41688 42533 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_10040 <59736 42625 gene locus_tag LOCUS_10050 <59736 42625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence15 28844 28263 gene locus_tag LOCUS_10060 28844 28263 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_10060 29194 30441 gene locus_tag LOCUS_10070 29194 30441 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_10070 30443 31714 gene locus_tag LOCUS_10080 30443 31714 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943352.1 protein_id gnl|my_center|LOCUS_10080 31890 32129 gene locus_tag LOCUS_10090 gene tatA 31890 32129 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933182.1 protein_id gnl|my_center|LOCUS_10090 32330 33070 gene locus_tag LOCUS_10100 gene tatC 32330 33070 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073887.1 protein_id gnl|my_center|LOCUS_10100 33621 33127 gene locus_tag LOCUS_10110 33621 33127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 34029 33646 gene locus_tag LOCUS_10120 34029 33646 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_10120 34457 34044 gene locus_tag LOCUS_10130 34457 34044 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225588.1 protein_id gnl|my_center|LOCUS_10130 36121 34466 gene locus_tag LOCUS_10140 36121 34466 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_10140 36454 36125 gene locus_tag LOCUS_10150 36454 36125 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_10150 36580 37278 gene locus_tag LOCUS_10160 36580 37278 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808268.1 protein_id gnl|my_center|LOCUS_10160 37299 37829 gene locus_tag LOCUS_10170 37299 37829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 38609 37848 gene locus_tag LOCUS_10180 38609 37848 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022370.1 protein_id gnl|my_center|LOCUS_10180 40823 38772 gene locus_tag LOCUS_10190 40823 38772 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_10190 41302 40901 gene locus_tag LOCUS_10200 41302 40901 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 protein_id gnl|my_center|LOCUS_10200 42259 41378 gene locus_tag LOCUS_10210 gene mtnP 42259 41378 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_10210 44395 42347 gene locus_tag LOCUS_10220 gene recJ 44395 42347 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889718.1 protein_id gnl|my_center|LOCUS_10220 45702 44395 gene locus_tag LOCUS_10230 45702 44395 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_10230 46532 45699 gene locus_tag LOCUS_10240 46532 45699 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_10240 47762 46545 gene locus_tag LOCUS_10250 47762 46545 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_10250 48754 47804 gene locus_tag LOCUS_10260 48754 47804 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_10260 49617 48784 gene locus_tag LOCUS_10270 49617 48784 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_10270 52015 49769 gene locus_tag LOCUS_10280 52015 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 52685 52047 gene locus_tag LOCUS_10290 gene deoC 52685 52047 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_10290 54028 52679 gene locus_tag LOCUS_10300 54028 52679 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_10300 54763 54185 gene locus_tag LOCUS_10310 54763 54185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 55181 54756 gene locus_tag LOCUS_10320 55181 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 55780 55307 gene locus_tag LOCUS_10330 gene rpiB 55780 55307 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_10330 56355 55777 gene locus_tag LOCUS_10340 56355 55777 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_10340 57175 56423 gene locus_tag LOCUS_10350 gene tpiA 57175 56423 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence16 149 358 gene locus_tag LOCUS_10360 149 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 375 1481 gene locus_tag LOCUS_10370 375 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1441 1653 gene locus_tag LOCUS_10380 1441 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2022 2642 gene locus_tag LOCUS_10390 2022 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2771 4045 gene locus_tag LOCUS_10400 2771 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4085 4246 gene locus_tag LOCUS_10410 4085 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4234 5262 gene locus_tag LOCUS_10420 4234 5262 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_10420 5273 6412 gene locus_tag LOCUS_10430 5273 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6750 8285 gene locus_tag LOCUS_10440 gene hcp 6750 8285 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_10440 8621 9238 gene locus_tag LOCUS_10450 8621 9238 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_10450 9376 10164 gene locus_tag LOCUS_10460 gene pssA 9376 10164 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_10460 10292 11863 gene locus_tag LOCUS_10470 10292 11863 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_10470 11975 13744 gene locus_tag LOCUS_10480 11975 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 13750 15012 gene locus_tag LOCUS_10490 gene leuC 13750 15012 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_10490 15164 15658 gene locus_tag LOCUS_10500 15164 15658 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393736.1 protein_id gnl|my_center|LOCUS_10500 15754 16815 gene locus_tag LOCUS_10510 15754 16815 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_10510 16894 17298 gene locus_tag LOCUS_10520 16894 17298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 17355 18374 gene locus_tag LOCUS_10530 gene asd 17355 18374 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_10530 18520 19218 gene locus_tag LOCUS_10540 gene chbG 18520 19218 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861727.1 protein_id gnl|my_center|LOCUS_10540 19362 19619 gene locus_tag LOCUS_10550 19362 19619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 19616 20353 gene locus_tag LOCUS_10560 gene truA 19616 20353 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_10560 20475 21380 gene locus_tag LOCUS_10570 20475 21380 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_10570 21448 21843 gene locus_tag LOCUS_10580 21448 21843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 21840 22505 gene locus_tag LOCUS_10590 21840 22505 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009127818.1 protein_id gnl|my_center|LOCUS_10590 22515 23111 gene locus_tag LOCUS_10600 22515 23111 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_10600 23108 23551 gene locus_tag LOCUS_10610 23108 23551 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966759.1 protein_id gnl|my_center|LOCUS_10610 23571 24404 gene locus_tag LOCUS_10620 23571 24404 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_10620 24516 26519 gene locus_tag LOCUS_10630 24516 26519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 26606 27904 gene locus_tag LOCUS_10640 gene miaB 26606 27904 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_10640 27885 28475 gene locus_tag LOCUS_10650 27885 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 28484 31018 gene locus_tag LOCUS_10660 gene mutS 28484 31018 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545203.1 protein_id gnl|my_center|LOCUS_10660 31115 31534 gene locus_tag LOCUS_10670 31115 31534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 31649 33466 gene locus_tag LOCUS_10680 gene mutL 31649 33466 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_10680 33531 34421 gene locus_tag LOCUS_10690 gene miaA 33531 34421 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_10690 35566 34454 gene locus_tag LOCUS_10700 35566 34454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_10700 36737 35601 gene locus_tag LOCUS_10710 36737 35601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_10710 37566 36841 gene locus_tag LOCUS_10720 37566 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 38282 37563 gene locus_tag LOCUS_10730 38282 37563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 39057 38338 gene locus_tag LOCUS_10740 39057 38338 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_10740 40358 39054 gene locus_tag LOCUS_10750 40358 39054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 40511 42082 gene locus_tag LOCUS_10760 gene murJ 40511 42082 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_10760 42201 42812 gene locus_tag LOCUS_10770 42201 42812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 43147 45162 gene locus_tag LOCUS_10780 43147 45162 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787412.1 protein_id gnl|my_center|LOCUS_10780 45364 45858 gene locus_tag LOCUS_10790 45364 45858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 45868 47160 gene locus_tag LOCUS_10800 45868 47160 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_10800 47157 49310 gene locus_tag LOCUS_10810 47157 49310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 49310 49765 gene locus_tag LOCUS_10820 49310 49765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458819.1 protein_id gnl|my_center|LOCUS_10820 49773 50135 gene locus_tag LOCUS_10830 49773 50135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 50137 50787 gene locus_tag LOCUS_10840 50137 50787 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514081.1 protein_id gnl|my_center|LOCUS_10840 50799 51890 gene locus_tag LOCUS_10850 50799 51890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 52041 53072 gene locus_tag LOCUS_10860 gene rlmN 52041 53072 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082231.1 protein_id gnl|my_center|LOCUS_10860 53523 53125 gene locus_tag LOCUS_10870 53523 53125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 54463 54388 gene locus_tag LOCUS_t00250 54463 54388 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55016 54486 gene locus_tag LOCUS_10880 55016 54486 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_10880 55954 55016 gene locus_tag LOCUS_10890 55954 55016 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942172.1 protein_id gnl|my_center|LOCUS_10890 56053 55978 gene locus_tag LOCUS_t00260 56053 55978 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 683 2164 gene locus_tag LOCUS_10900 gene trpE 683 2164 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_10900 2220 2786 gene locus_tag LOCUS_10910 2220 2786 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_10910 2852 3862 gene locus_tag LOCUS_10920 gene trpD 2852 3862 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_10920 4008 4808 gene locus_tag LOCUS_10930 gene trpC 4008 4808 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_10930 4808 5410 gene locus_tag LOCUS_10940 4808 5410 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_10940 5578 6822 gene locus_tag LOCUS_10950 gene trpB 5578 6822 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_10950 6812 7588 gene locus_tag LOCUS_10960 gene trpA 6812 7588 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_10960 7897 21402 gene locus_tag LOCUS_10970 7897 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 21561 23237 gene locus_tag LOCUS_10980 21561 23237 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956991.1 protein_id gnl|my_center|LOCUS_10980 23306 24757 gene locus_tag LOCUS_10990 23306 24757 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225959.1 protein_id gnl|my_center|LOCUS_10990 26661 24892 gene locus_tag LOCUS_11000 26661 24892 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_11000 27196 26684 gene locus_tag LOCUS_11010 gene ndk 27196 26684 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_11010 27698 28063 gene locus_tag LOCUS_11020 27698 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 28319 28843 gene locus_tag LOCUS_11030 gene nudF 28319 28843 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_11030 28985 30751 gene locus_tag LOCUS_11040 gene aspS 28985 30751 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_11040 30879 31814 gene locus_tag LOCUS_11050 30879 31814 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721973.1 protein_id gnl|my_center|LOCUS_11050 31792 33291 gene locus_tag LOCUS_11060 31792 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 33404 33808 gene locus_tag LOCUS_11070 gene ybeY 33404 33808 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565667.1 protein_id gnl|my_center|LOCUS_11070 33796 34797 gene locus_tag LOCUS_11080 33796 34797 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_11080 34794 36071 gene locus_tag LOCUS_11090 34794 36071 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_11090 36184 36834 gene locus_tag LOCUS_11100 36184 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 36972 37838 gene locus_tag LOCUS_11110 gene glyQ 36972 37838 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_11110 37828 39942 gene locus_tag LOCUS_11120 gene glyS 37828 39942 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544914.1 protein_id gnl|my_center|LOCUS_11120 40115 41311 gene locus_tag LOCUS_11130 40115 41311 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_11130 41298 42386 gene locus_tag LOCUS_11140 41298 42386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 42441 42860 gene locus_tag LOCUS_11150 42441 42860 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_11150 42929 43948 gene locus_tag LOCUS_11160 42929 43948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 44713 43931 gene locus_tag LOCUS_11170 44713 43931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 45456 44821 gene locus_tag LOCUS_11180 45456 44821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 46748 45801 gene locus_tag LOCUS_11190 46748 45801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 47628 46708 gene locus_tag LOCUS_11200 47628 46708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 48793 47663 gene locus_tag LOCUS_11210 48793 47663 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_11210 49684 48797 gene locus_tag LOCUS_11220 49684 48797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 50517 49681 gene locus_tag LOCUS_11230 50517 49681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 51862 50573 gene locus_tag LOCUS_11240 51862 50573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 51756 51953 gene locus_tag LOCUS_11250 51756 51953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 52886 51972 gene locus_tag LOCUS_11260 52886 51972 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_11260 53427 52873 gene locus_tag LOCUS_11270 gene rfbC 53427 52873 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence18 275 18085 gene locus_tag LOCUS_11280 275 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 18225 19433 gene locus_tag LOCUS_11290 18225 19433 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11290 19888 21141 gene locus_tag LOCUS_11300 19888 21141 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11300 21288 21360 gene locus_tag LOCUS_t00270 21288 21360 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21430 21513 gene locus_tag LOCUS_t00280 21430 21513 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21726 23051 gene locus_tag LOCUS_11310 gene tig 21726 23051 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_11310 23180 23782 gene locus_tag LOCUS_11320 gene clpP 23180 23782 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_11320 23841 25085 gene locus_tag LOCUS_11330 gene clpX 23841 25085 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_11330 25082 27472 gene locus_tag LOCUS_11340 gene lon 25082 27472 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_11340 27649 28782 gene locus_tag LOCUS_11350 27649 28782 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_11350 28927 30507 gene locus_tag LOCUS_11360 gene serA 28927 30507 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_11360 30654 31307 gene locus_tag LOCUS_11370 30654 31307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 31475 32113 gene locus_tag LOCUS_11380 31475 32113 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_11380 32254 33228 gene locus_tag LOCUS_11390 gene trpS 32254 33228 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_11390 33353 34210 gene locus_tag LOCUS_11400 33353 34210 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_11400 34197 34790 gene locus_tag LOCUS_11410 gene scpB 34197 34790 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_11410 34947 38018 gene locus_tag LOCUS_11420 34947 38018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 38085 39734 gene locus_tag LOCUS_11430 38085 39734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015840.1 protein_id gnl|my_center|LOCUS_11430 39731 40906 gene locus_tag LOCUS_11440 39731 40906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 40908 41945 gene locus_tag LOCUS_11450 40908 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 41954 43003 gene locus_tag LOCUS_11460 41954 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 43155 45368 gene locus_tag LOCUS_11470 43155 45368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 45365 46792 gene locus_tag LOCUS_11480 45365 46792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 46797 47165 gene locus_tag LOCUS_11490 46797 47165 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_11490 47162 49330 gene locus_tag LOCUS_11500 47162 49330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 49330 50328 gene locus_tag LOCUS_11510 gene galT 49330 50328 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_11510 50522 51994 gene locus_tag LOCUS_11520 gene glgA 50522 51994 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence19 482 135 gene locus_tag LOCUS_11530 gene panD 482 135 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_11530 1041 691 gene locus_tag LOCUS_11540 1041 691 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_11540 2481 1063 gene locus_tag LOCUS_11550 2481 1063 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_11550 4288 2768 gene locus_tag LOCUS_11560 gene guaA 4288 2768 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_11560 5877 4285 gene locus_tag LOCUS_11570 5877 4285 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_11570 7240 5870 gene locus_tag LOCUS_11580 gene purF 7240 5870 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_11580 10513 7256 gene locus_tag LOCUS_11590 gene carB 10513 7256 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_11590 11660 10524 gene locus_tag LOCUS_11600 gene carA 11660 10524 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_11600 12253 11657 gene locus_tag LOCUS_11610 12253 11657 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_11610 13598 12270 gene locus_tag LOCUS_11620 gene glnA 13598 12270 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_11620 14489 13752 gene locus_tag LOCUS_11630 14489 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582453.1 protein_id gnl|my_center|LOCUS_11630 15724 14486 gene locus_tag LOCUS_11640 15724 14486 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_11640 16179 15721 gene locus_tag LOCUS_11650 16179 15721 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_11650 17684 16176 gene locus_tag LOCUS_11660 17684 16176 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_11660 18790 17678 gene locus_tag LOCUS_11670 18790 17678 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_11670 20132 18954 gene locus_tag LOCUS_11680 20132 18954 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_11680 21071 20229 gene locus_tag LOCUS_11690 gene dapF 21071 20229 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_11690 21441 21097 gene locus_tag LOCUS_11700 21441 21097 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_11700 22698 21469 gene locus_tag LOCUS_11710 22698 21469 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_11710 23242 22718 gene locus_tag LOCUS_11720 23242 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 24316 24243 gene locus_tag LOCUS_t00290 24316 24243 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24527 24456 gene locus_tag LOCUS_t00300 24527 24456 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 25183 24680 gene locus_tag LOCUS_11730 25183 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 26015 25173 gene locus_tag LOCUS_11740 gene rfbD 26015 25173 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_11740 26631 26083 gene locus_tag LOCUS_11750 gene rfbC 26631 26083 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_11750 28494 26758 gene locus_tag LOCUS_11760 gene msbA 28494 26758 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_11760 30227 28491 gene locus_tag LOCUS_11770 30227 28491 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_11770 31326 30238 gene locus_tag LOCUS_11780 gene lpxB 31326 30238 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_11780 32432 31488 gene locus_tag LOCUS_11790 32432 31488 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_11790 33567 32470 gene locus_tag LOCUS_11800 33567 32470 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_11800 34546 33746 gene locus_tag LOCUS_11810 gene lpxI 34546 33746 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_11810 35325 34546 gene locus_tag LOCUS_11820 gene lpxA 35325 34546 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_11820 36151 35390 gene locus_tag LOCUS_11830 gene lpxA 36151 35390 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_11830 37500 36148 gene locus_tag LOCUS_11840 37500 36148 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_11840 38533 37502 gene locus_tag LOCUS_11850 gene lpxD 38533 37502 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_11850 39161 38646 gene locus_tag LOCUS_11860 39161 38646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 41556 39301 gene locus_tag LOCUS_11870 gene bamA 41556 39301 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_11870 42212 41751 gene locus_tag LOCUS_11880 gene mscL 42212 41751 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_11880 46888 42209 gene locus_tag LOCUS_11890 46888 42209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 47971 47096 gene locus_tag LOCUS_11900 gene ilvE 47971 47096 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816735.1 protein_id gnl|my_center|LOCUS_11900 48741 48070 gene locus_tag LOCUS_11910 48741 48070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_11910 50102 48870 gene locus_tag LOCUS_11920 50102 48870 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_11920 51664 50177 gene locus_tag LOCUS_11930 gene lysS 51664 50177 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence20 <1 2922 gene locus_tag LOCUS_11940 <1 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 3696 3040 gene locus_tag LOCUS_11950 3696 3040 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797963.1 protein_id gnl|my_center|LOCUS_11950 4428 3766 gene locus_tag LOCUS_11960 gene queC 4428 3766 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088969.1 protein_id gnl|my_center|LOCUS_11960 4823 4455 gene locus_tag LOCUS_11970 gene queD 4823 4455 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_11970 5876 5049 gene locus_tag LOCUS_11980 gene murI 5876 5049 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_11980 7563 5839 gene locus_tag LOCUS_11990 7563 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8143 7583 gene locus_tag LOCUS_12000 8143 7583 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 protein_id gnl|my_center|LOCUS_12000 9359 8136 gene locus_tag LOCUS_12010 9359 8136 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022044.1 protein_id gnl|my_center|LOCUS_12010 11197 9434 gene locus_tag LOCUS_12020 11197 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 12379 11225 gene locus_tag LOCUS_12030 12379 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 13104 12427 gene locus_tag LOCUS_12040 13104 12427 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_12040 13239 14420 gene locus_tag LOCUS_12050 13239 14420 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_12050 14509 17643 gene locus_tag LOCUS_12060 14509 17643 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_12060 17640 18989 gene locus_tag LOCUS_12070 17640 18989 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_12070 18982 19455 gene locus_tag LOCUS_12080 18982 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20793 20314 gene locus_tag LOCUS_12090 gene tadA 20793 20314 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771930.1 protein_id gnl|my_center|LOCUS_12090 21210 20803 gene locus_tag LOCUS_12100 21210 20803 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_12100 21469 22938 gene locus_tag LOCUS_12110 21469 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 22977 24212 gene locus_tag LOCUS_12120 gene czcB 22977 24212 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_12120 24364 27534 gene locus_tag LOCUS_12130 24364 27534 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 protein_id gnl|my_center|LOCUS_12130 27606 30818 gene locus_tag LOCUS_12140 27606 30818 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_12140 30894 31319 gene locus_tag LOCUS_12150 gene ruvX 30894 31319 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 protein_id gnl|my_center|LOCUS_12150 31441 31938 gene locus_tag LOCUS_12160 31441 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 31911 32885 gene locus_tag LOCUS_12170 gene mltG 31911 32885 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931071.1 protein_id gnl|my_center|LOCUS_12170 33005 33415 gene locus_tag LOCUS_12180 33005 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 33405 33608 gene locus_tag LOCUS_12190 33405 33608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 33736 34926 gene locus_tag LOCUS_12200 gene nifS 33736 34926 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_12200 35048 36058 gene locus_tag LOCUS_12210 gene mnmA 35048 36058 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_12210 36238 36384 gene locus_tag LOCUS_12220 36238 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence21 240 1922 gene locus_tag LOCUS_12230 240 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1980 2717 gene locus_tag LOCUS_12240 1980 2717 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_12240 2710 3288 gene locus_tag LOCUS_12250 gene nadD 2710 3288 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687035.1 protein_id gnl|my_center|LOCUS_12250 3285 3863 gene locus_tag LOCUS_12260 gene yqeK 3285 3863 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_12260 3847 4932 gene locus_tag LOCUS_12270 3847 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4953 5669 gene locus_tag LOCUS_12280 4953 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7117 5936 gene locus_tag LOCUS_12290 7117 5936 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_12290 9399 7720 gene locus_tag LOCUS_12300 9399 7720 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_12300 10083 9421 gene locus_tag LOCUS_12310 10083 9421 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_12310 10387 11166 gene locus_tag LOCUS_12320 10387 11166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_12320 11213 11713 gene locus_tag LOCUS_12330 11213 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11871 15101 gene locus_tag LOCUS_12340 11871 15101 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927582.1 protein_id gnl|my_center|LOCUS_12340 15886 15206 gene locus_tag LOCUS_12350 15886 15206 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_12350 17268 15979 gene locus_tag LOCUS_12360 17268 15979 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_12360 18146 17559 gene locus_tag LOCUS_12370 18146 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 20791 18155 gene locus_tag LOCUS_12380 20791 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 21572 20769 gene locus_tag LOCUS_12390 21572 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 22743 21676 gene locus_tag LOCUS_12400 22743 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 23651 23025 gene locus_tag LOCUS_12410 23651 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 26487 23821 gene locus_tag LOCUS_12420 26487 23821 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989583.1 protein_id gnl|my_center|LOCUS_12420 29380 26723 gene locus_tag LOCUS_12430 29380 26723 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989583.1 protein_id gnl|my_center|LOCUS_12430 29581 31803 gene locus_tag LOCUS_12440 29581 31803 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_12440 31884 32549 gene locus_tag LOCUS_12450 31884 32549 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_12450 32695 39450 gene locus_tag LOCUS_12460 32695 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 39452 41023 gene locus_tag LOCUS_12470 39452 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 41308 46653 gene locus_tag LOCUS_12480 41308 46653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 46655 48268 gene locus_tag LOCUS_12490 46655 48268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence22 <1 21318 gene locus_tag LOCUS_12500 <1 21318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147373219.1:chromosome segregation protein SMC 21454 21771 gene locus_tag LOCUS_12510 21454 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 21758 22153 gene locus_tag LOCUS_12520 21758 22153 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_12520 22601 22927 gene locus_tag LOCUS_12530 22601 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 22917 24176 gene locus_tag LOCUS_12540 22917 24176 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_12540 24308 25354 gene locus_tag LOCUS_12550 24308 25354 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_12550 25810 25460 gene locus_tag LOCUS_12560 25810 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 25929 28604 gene locus_tag LOCUS_12570 25929 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 28761 29285 gene locus_tag LOCUS_12580 28761 29285 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207795.1 protein_id gnl|my_center|LOCUS_12580 29449 30075 gene locus_tag LOCUS_12590 29449 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 30184 31629 gene locus_tag LOCUS_12600 30184 31629 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930806.1 protein_id gnl|my_center|LOCUS_12600 31809 32240 gene locus_tag LOCUS_12610 31809 32240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 32240 32905 gene locus_tag LOCUS_12620 32240 32905 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391936.1 protein_id gnl|my_center|LOCUS_12620 32997 33881 gene locus_tag LOCUS_12630 32997 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 34112 37039 gene locus_tag LOCUS_12640 34112 37039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 37087 38259 gene locus_tag LOCUS_12650 37087 38259 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_12650 39001 38360 gene locus_tag LOCUS_12660 39001 38360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 39776 39036 gene locus_tag LOCUS_12670 39776 39036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 39983 40951 gene locus_tag LOCUS_12680 39983 40951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 41126 41677 gene locus_tag LOCUS_12690 41126 41677 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_12690 41798 43456 gene locus_tag LOCUS_12700 41798 43456 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_12700 43586 44590 gene locus_tag LOCUS_12710 gene pta 43586 44590 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_12710 44673 45479 gene locus_tag LOCUS_12720 44673 45479 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_12720 45727 46752 gene locus_tag LOCUS_12730 45727 46752 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_12730 46764 47828 gene locus_tag LOCUS_12740 gene thrC 46764 47828 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_12740 47846 48145 gene locus_tag LOCUS_12750 47846 48145 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence23 1386 766 gene locus_tag LOCUS_12760 1386 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4376 1518 gene locus_tag LOCUS_12770 4376 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4455 5069 gene locus_tag LOCUS_12780 4455 5069 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_12780 5240 7651 gene locus_tag LOCUS_12790 5240 7651 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_12790 7758 8474 gene locus_tag LOCUS_12800 7758 8474 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_12800 8634 9992 gene locus_tag LOCUS_12810 gene mdtD 8634 9992 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084717.1 protein_id gnl|my_center|LOCUS_12810 10324 12222 gene locus_tag LOCUS_12820 10324 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 14098 12341 gene locus_tag LOCUS_12830 14098 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15278 14091 gene locus_tag LOCUS_12840 gene fabF 15278 14091 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287619.1 protein_id gnl|my_center|LOCUS_12840 15655 15398 gene locus_tag LOCUS_12850 15655 15398 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_12850 17191 16016 gene locus_tag LOCUS_12860 17191 16016 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_12860 17749 17276 gene locus_tag LOCUS_12870 17749 17276 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_12870 18189 17845 gene locus_tag LOCUS_12880 18189 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 18382 18230 gene locus_tag LOCUS_12890 18382 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 18852 18364 gene locus_tag LOCUS_12900 18852 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 19353 18928 gene locus_tag LOCUS_12910 19353 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 20093 19350 gene locus_tag LOCUS_12920 20093 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 20341 20096 gene locus_tag LOCUS_12930 20341 20096 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 protein_id gnl|my_center|LOCUS_12930 21705 20470 gene locus_tag LOCUS_12940 21705 20470 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_12940 23655 21967 gene locus_tag LOCUS_12950 23655 21967 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_12950 24318 23767 gene locus_tag LOCUS_12960 24318 23767 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_12960 25160 24435 gene locus_tag LOCUS_12970 gene fabG 25160 24435 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_12970 25947 25309 gene locus_tag LOCUS_12980 25947 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 26188 26595 gene locus_tag LOCUS_12990 26188 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 27906 26746 gene locus_tag LOCUS_13000 27906 26746 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680038.1 protein_id gnl|my_center|LOCUS_13000 28735 27896 gene locus_tag LOCUS_13010 28735 27896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 29953 28787 gene locus_tag LOCUS_13020 gene fabF 29953 28787 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_13020 31359 30049 gene locus_tag LOCUS_13030 31359 30049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 32438 31383 gene locus_tag LOCUS_13040 32438 31383 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_13040 33227 32532 gene locus_tag LOCUS_13050 gene fabG 33227 32532 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_13050 33415 33224 gene locus_tag LOCUS_13060 33415 33224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 34396 33440 gene locus_tag LOCUS_13070 gene bioB 34396 33440 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_13070 35019 34552 gene locus_tag LOCUS_13080 35019 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13080 35361 35182 gene locus_tag LOCUS_13090 35361 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 35771 35493 gene locus_tag LOCUS_13100 35771 35493 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221177.1 protein_id gnl|my_center|LOCUS_13100 35862 37010 gene locus_tag LOCUS_13110 35862 37010 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_13110 37058 37297 gene locus_tag LOCUS_13120 37058 37297 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_13120 38758 37349 gene locus_tag LOCUS_13130 38758 37349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 40556 38772 gene locus_tag LOCUS_13140 40556 38772 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_13140 42020 40728 gene locus_tag LOCUS_13150 42020 40728 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_13150 45430 42113 gene locus_tag LOCUS_13160 45430 42113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 47528 45588 gene locus_tag LOCUS_13170 47528 45588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence24 3053 2790 gene locus_tag LOCUS_13180 3053 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4602 3211 gene locus_tag LOCUS_13190 4602 3211 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_13190 16197 4717 gene locus_tag LOCUS_13200 16197 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 16723 16247 gene locus_tag LOCUS_13210 16723 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18054 16804 gene locus_tag LOCUS_13220 18054 16804 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_13220 18381 18172 gene locus_tag LOCUS_13230 18381 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 20181 18529 gene locus_tag LOCUS_13240 gene pgi 20181 18529 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261112.1 protein_id gnl|my_center|LOCUS_13240 20871 20311 gene locus_tag LOCUS_13250 20871 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21104 21901 gene locus_tag LOCUS_13260 21104 21901 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_13260 22014 22577 gene locus_tag LOCUS_13270 gene sigW 22014 22577 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_13270 22588 23040 gene locus_tag LOCUS_13280 22588 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 23050 23436 gene locus_tag LOCUS_13290 23050 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 23541 24158 gene locus_tag LOCUS_13300 23541 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 24437 25219 gene locus_tag LOCUS_13310 24437 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 25369 25731 gene locus_tag LOCUS_13320 25369 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 27528 26083 gene locus_tag LOCUS_13330 27528 26083 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_13330 27936 28235 gene locus_tag LOCUS_13340 27936 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 28248 28595 gene locus_tag LOCUS_13350 28248 28595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 28606 28749 gene locus_tag LOCUS_13360 28606 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 28929 29255 gene locus_tag LOCUS_13370 28929 29255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 29404 29568 gene locus_tag LOCUS_13380 29404 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 29979 32183 gene locus_tag LOCUS_13390 29979 32183 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787412.1 protein_id gnl|my_center|LOCUS_13390 32427 33272 gene locus_tag LOCUS_13400 32427 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_13400 33567 34427 gene locus_tag LOCUS_13410 33567 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 34669 35991 gene locus_tag LOCUS_13420 34669 35991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 35981 36418 gene locus_tag LOCUS_13430 35981 36418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 36441 37451 gene locus_tag LOCUS_13440 36441 37451 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_13440 37659 37584 gene locus_tag LOCUS_t00310 37659 37584 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38376 37777 gene locus_tag LOCUS_13450 38376 37777 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 protein_id gnl|my_center|LOCUS_13450 39068 38373 gene locus_tag LOCUS_13460 gene rph 39068 38373 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583693.1 protein_id gnl|my_center|LOCUS_13460 42572 39090 gene locus_tag LOCUS_13470 42572 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 45307 42608 gene locus_tag LOCUS_13480 45307 42608 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence25 78 2714 gene locus_tag LOCUS_13490 78 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2810 3340 gene locus_tag LOCUS_13500 gene folK 2810 3340 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_13500 3337 4134 gene locus_tag LOCUS_13510 gene panB 3337 4134 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_13510 4131 4970 gene locus_tag LOCUS_13520 gene panC 4131 4970 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_13520 5105 5638 gene locus_tag LOCUS_13530 5105 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5641 7212 gene locus_tag LOCUS_13540 gene nadB 5641 7212 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_13540 7939 8415 gene locus_tag LOCUS_13550 7939 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 8722 10062 gene locus_tag LOCUS_13560 8722 10062 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_13560 10104 10397 gene locus_tag LOCUS_13570 10104 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 10637 11227 gene locus_tag LOCUS_13580 10637 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 11199 11651 gene locus_tag LOCUS_13590 11199 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 11944 14769 gene locus_tag LOCUS_13600 gene uvrA 11944 14769 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_13600 14897 15400 gene locus_tag LOCUS_13610 gene pal 14897 15400 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_13610 15403 16089 gene locus_tag LOCUS_13620 15403 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 16073 16813 gene locus_tag LOCUS_13630 16073 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16837 18150 gene locus_tag LOCUS_13640 gene tolB 16837 18150 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_13640 18253 18897 gene locus_tag LOCUS_13650 18253 18897 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141141.1 protein_id gnl|my_center|LOCUS_13650 18917 19294 gene locus_tag LOCUS_13660 gene tolR 18917 19294 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_13660 19307 20644 gene locus_tag LOCUS_13670 19307 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 20625 22079 gene locus_tag LOCUS_13680 20625 22079 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880464.1 protein_id gnl|my_center|LOCUS_13680 22076 23386 gene locus_tag LOCUS_13690 22076 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 23477 24514 gene locus_tag LOCUS_13700 23477 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 24519 25031 gene locus_tag LOCUS_13710 24519 25031 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_13710 25012 26058 gene locus_tag LOCUS_13720 25012 26058 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_13720 26070 27989 gene locus_tag LOCUS_13730 gene glgB 26070 27989 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_13730 28136 29377 gene locus_tag LOCUS_13740 28136 29377 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_13740 29374 30513 gene locus_tag LOCUS_13750 29374 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 30529 31584 gene locus_tag LOCUS_13760 30529 31584 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870059.1 protein_id gnl|my_center|LOCUS_13760 32004 32825 gene locus_tag LOCUS_13770 32004 32825 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_13770 32972 33256 gene locus_tag LOCUS_13780 32972 33256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 33269 33604 gene locus_tag LOCUS_13790 33269 33604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 33797 40321 gene locus_tag LOCUS_13800 33797 40321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 40570 40719 gene locus_tag LOCUS_13810 40570 40719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 40931 43096 gene locus_tag LOCUS_13820 40931 43096 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_13820 43261 44982 gene locus_tag LOCUS_13830 gene msbA 43261 44982 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence26 1786 104 gene locus_tag LOCUS_13840 gene asnB 1786 104 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13840 2775 1783 gene locus_tag LOCUS_13850 2775 1783 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_13850 4472 2919 gene locus_tag LOCUS_13860 4472 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5318 4476 gene locus_tag LOCUS_13870 5318 4476 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13870 5765 5322 gene locus_tag LOCUS_13880 5765 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6848 5781 gene locus_tag LOCUS_13890 6848 5781 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_13890 7349 6861 gene locus_tag LOCUS_13900 gene coaD 7349 6861 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_13900 8405 7521 gene locus_tag LOCUS_13910 gene xerD 8405 7521 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_13910 9148 8516 gene locus_tag LOCUS_13920 9148 8516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_13920 9594 9145 gene locus_tag LOCUS_13930 9594 9145 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_13930 10210 9587 gene locus_tag LOCUS_13940 gene pgsA 10210 9587 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_13940 11571 10264 gene locus_tag LOCUS_13950 gene rimO 11571 10264 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13950 12507 11575 gene locus_tag LOCUS_13960 12507 11575 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137484.1 protein_id gnl|my_center|LOCUS_13960 13177 12518 gene locus_tag LOCUS_13970 13177 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13667 13179 gene locus_tag LOCUS_13980 13667 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 15844 13688 gene locus_tag LOCUS_13990 15844 13688 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_13990 16100 15894 gene locus_tag LOCUS_14000 16100 15894 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871133.1 protein_id gnl|my_center|LOCUS_14000 16637 16179 gene locus_tag LOCUS_14010 gene accB 16637 16179 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_14010 18791 16713 gene locus_tag LOCUS_14020 gene pnp 18791 16713 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_14020 19258 18998 gene locus_tag LOCUS_14030 gene rpsO 19258 18998 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_14030 19520 20821 gene locus_tag LOCUS_14040 19520 20821 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920237.1 protein_id gnl|my_center|LOCUS_14040 21890 20856 gene locus_tag LOCUS_14050 21890 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890729.1 protein_id gnl|my_center|LOCUS_14050 22986 21892 gene locus_tag LOCUS_14060 gene glf 22986 21892 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_14060 24035 23049 gene locus_tag LOCUS_14070 24035 23049 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837191.1 protein_id gnl|my_center|LOCUS_14070 25319 24042 gene locus_tag LOCUS_14080 25319 24042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 26340 25327 gene locus_tag LOCUS_14090 26340 25327 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_14090 27327 26404 gene locus_tag LOCUS_14100 27327 26404 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_14100 28642 27386 gene locus_tag LOCUS_14110 gene ahcY 28642 27386 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_14110 29875 28706 gene locus_tag LOCUS_14120 gene metK 29875 28706 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_14120 31003 29987 gene locus_tag LOCUS_14130 31003 29987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 32047 31118 gene locus_tag LOCUS_14140 32047 31118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_14140 33132 32056 gene locus_tag LOCUS_14150 gene recA 33132 32056 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_14150 34634 33333 gene locus_tag LOCUS_14160 34634 33333 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_14160 35678 34713 gene locus_tag LOCUS_14170 35678 34713 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_14170 36710 35958 gene locus_tag LOCUS_14180 36710 35958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 37503 36829 gene locus_tag LOCUS_14190 37503 36829 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_14190 38318 37854 gene locus_tag LOCUS_14200 38318 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence27 1167 148 gene locus_tag LOCUS_14210 gene aroF 1167 148 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_14210 2401 1274 gene locus_tag LOCUS_14220 gene hisC 2401 1274 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_14220 3619 2549 gene locus_tag LOCUS_14230 gene pheA 3619 2549 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_14230 17633 3798 gene locus_tag LOCUS_14240 17633 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 18179 17688 gene locus_tag LOCUS_14250 18179 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18441 19295 gene locus_tag LOCUS_14260 18441 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 20048 19392 gene locus_tag LOCUS_14270 gene pgeF 20048 19392 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518935.1 protein_id gnl|my_center|LOCUS_14270 21246 20158 gene locus_tag LOCUS_14280 gene ftsZ 21246 20158 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_14280 22489 21248 gene locus_tag LOCUS_14290 gene ftsA 22489 21248 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_14290 23434 22616 gene locus_tag LOCUS_14300 23434 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 24352 23438 gene locus_tag LOCUS_14310 24352 23438 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_14310 25293 24361 gene locus_tag LOCUS_14320 gene murB 25293 24361 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_14320 26726 25374 gene locus_tag LOCUS_14330 gene murC 26726 25374 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_14330 27116 26727 gene locus_tag LOCUS_14340 gene queF 27116 26727 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_14340 27355 28632 gene locus_tag LOCUS_14350 27355 28632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 29896 28721 gene locus_tag LOCUS_14360 29896 28721 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14360 31347 30097 gene locus_tag LOCUS_14370 31347 30097 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_14370 33109 31475 gene locus_tag LOCUS_14380 33109 31475 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116957511.1 protein_id gnl|my_center|LOCUS_14380 33876 33262 gene locus_tag LOCUS_14390 33876 33262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 35178 33952 gene locus_tag LOCUS_14400 gene argJ 35178 33952 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_14400 35996 35325 gene locus_tag LOCUS_14410 35996 35325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 37002 36010 gene locus_tag LOCUS_14420 37002 36010 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_14420 38383 37118 gene locus_tag LOCUS_14430 38383 37118 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence28 1641 232 gene locus_tag LOCUS_14440 1641 232 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_14440 1937 3145 gene locus_tag LOCUS_14450 1937 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3665 3216 gene locus_tag LOCUS_14460 3665 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3799 4650 gene locus_tag LOCUS_14470 3799 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4726 6303 gene locus_tag LOCUS_14480 4726 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6498 7373 gene locus_tag LOCUS_14490 6498 7373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089704.1 protein_id gnl|my_center|LOCUS_14490 7610 8395 gene locus_tag LOCUS_14500 7610 8395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_14500 8410 10980 gene locus_tag LOCUS_14510 gene mprF 8410 10980 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_14510 10977 11957 gene locus_tag LOCUS_14520 10977 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11947 12501 gene locus_tag LOCUS_14530 gene hpt 11947 12501 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454045.1 protein_id gnl|my_center|LOCUS_14530 12538 14463 gene locus_tag LOCUS_14540 gene ftsH 12538 14463 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_14540 14447 15028 gene locus_tag LOCUS_14550 gene folE 14447 15028 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_14550 15232 16410 gene locus_tag LOCUS_14560 gene folP 15232 16410 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_14560 16410 17183 gene locus_tag LOCUS_14570 gene cdaA 16410 17183 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_14570 17292 18671 gene locus_tag LOCUS_14580 gene glmM 17292 18671 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_14580 18672 19418 gene locus_tag LOCUS_14590 gene pdxJ 18672 19418 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 protein_id gnl|my_center|LOCUS_14590 19478 20209 gene locus_tag LOCUS_14600 gene nagB 19478 20209 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_14600 20300 20635 gene locus_tag LOCUS_14610 20300 20635 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_14610 20739 21599 gene locus_tag LOCUS_14620 20739 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21600 22751 gene locus_tag LOCUS_14630 21600 22751 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989507.1 protein_id gnl|my_center|LOCUS_14630 23684 22857 gene locus_tag LOCUS_14640 23684 22857 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_14640 23913 24887 gene locus_tag LOCUS_14650 gene thiL 23913 24887 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881388.1 protein_id gnl|my_center|LOCUS_14650 24841 25305 gene locus_tag LOCUS_14660 gene tsaE 24841 25305 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_14660 25302 25973 gene locus_tag LOCUS_14670 gene tsaB 25302 25973 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 protein_id gnl|my_center|LOCUS_14670 25960 26571 gene locus_tag LOCUS_14680 25960 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 27533 26697 gene locus_tag LOCUS_14690 27533 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 28119 27517 gene locus_tag LOCUS_14700 28119 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 28885 28121 gene locus_tag LOCUS_14710 28885 28121 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_14710 30573 29032 gene locus_tag LOCUS_14720 gene metG 30573 29032 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_14720 31379 30570 gene locus_tag LOCUS_14730 31379 30570 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_14730 32484 31513 gene locus_tag LOCUS_14740 gene holB 32484 31513 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_14740 33265 32624 gene locus_tag LOCUS_14750 gene tmk 33265 32624 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_14750 33497 35887 gene locus_tag LOCUS_14760 33497 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence29 2035 110 gene locus_tag LOCUS_14770 2035 110 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_14770 2701 2171 gene locus_tag LOCUS_14780 2701 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5395 2783 gene locus_tag LOCUS_14790 gene clpB 5395 2783 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_14790 6168 5506 gene locus_tag LOCUS_14800 6168 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6759 6409 gene locus_tag LOCUS_14810 6759 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7042 6788 gene locus_tag LOCUS_14820 7042 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8860 7223 gene locus_tag LOCUS_14830 8860 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9422 8823 gene locus_tag LOCUS_14840 9422 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 9750 9424 gene locus_tag LOCUS_14850 9750 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10749 9754 gene locus_tag LOCUS_14860 10749 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 12395 10851 gene locus_tag LOCUS_14870 12395 10851 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869657.1 protein_id gnl|my_center|LOCUS_14870 14190 12541 gene locus_tag LOCUS_14880 gene argS 14190 12541 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583838.1 protein_id gnl|my_center|LOCUS_14880 14746 14249 gene locus_tag LOCUS_14890 14746 14249 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_14890 16084 14885 gene locus_tag LOCUS_14900 16084 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 16199 18445 gene locus_tag LOCUS_14910 gene pcrA 16199 18445 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_14910 18844 18545 gene locus_tag LOCUS_14920 18844 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 19007 19687 gene locus_tag LOCUS_14930 19007 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 19677 20999 gene locus_tag LOCUS_14940 19677 20999 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_14940 22468 21110 gene locus_tag LOCUS_14950 22468 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 23553 22465 gene locus_tag LOCUS_14960 gene proB 23553 22465 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_14960 30005 23643 gene locus_tag LOCUS_14970 30005 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 35464 30116 gene locus_tag LOCUS_14980 35464 30116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence30 361 290 gene locus_tag LOCUS_t00320 361 290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 584 514 gene locus_tag LOCUS_t00330 584 514 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 858 775 gene locus_tag LOCUS_t00340 858 775 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1629 1057 gene locus_tag LOCUS_14990 1629 1057 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_14990 1942 2685 gene locus_tag LOCUS_15000 1942 2685 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_15000 2682 3848 gene locus_tag LOCUS_15010 gene mtaB 2682 3848 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_15010 3852 5648 gene locus_tag LOCUS_15020 3852 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6338 5685 gene locus_tag LOCUS_15030 6338 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 6515 7336 gene locus_tag LOCUS_15040 6515 7336 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_15040 7476 9140 gene locus_tag LOCUS_15050 gene recN 7476 9140 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_15050 9600 9130 gene locus_tag LOCUS_15060 9600 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 10090 9677 gene locus_tag LOCUS_15070 10090 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 10244 10720 gene locus_tag LOCUS_15080 gene guaD 10244 10720 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_15080 11126 10881 gene locus_tag LOCUS_15090 11126 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_15090 11928 11248 gene locus_tag LOCUS_15100 11928 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13547 11925 gene locus_tag LOCUS_15110 13547 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 14314 13547 gene locus_tag LOCUS_15120 14314 13547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_15120 14895 14302 gene locus_tag LOCUS_15130 14895 14302 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023081.1 protein_id gnl|my_center|LOCUS_15130 15601 14915 gene locus_tag LOCUS_15140 15601 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 15891 18299 gene locus_tag LOCUS_15150 15891 18299 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_15150 21637 18470 gene locus_tag LOCUS_15160 21637 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 22302 21808 gene locus_tag LOCUS_15170 gene hycI 22302 21808 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_15170 22924 22412 gene locus_tag LOCUS_15180 22924 22412 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251043.1 protein_id gnl|my_center|LOCUS_15180 23859 22921 gene locus_tag LOCUS_15190 gene nuoH 23859 22921 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573426.1 protein_id gnl|my_center|LOCUS_15190 25239 24019 gene locus_tag LOCUS_15200 25239 24019 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_15200 25733 25236 gene locus_tag LOCUS_15210 25733 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15210 26205 25723 gene locus_tag LOCUS_15220 26205 25723 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_15220 26554 26198 gene locus_tag LOCUS_15230 26554 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 26877 26557 gene locus_tag LOCUS_15240 gene nuoK 26877 26557 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861496.1 protein_id gnl|my_center|LOCUS_15240 27377 26874 gene locus_tag LOCUS_15250 27377 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 28920 27502 gene locus_tag LOCUS_15260 28920 27502 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_15260 30691 28928 gene locus_tag LOCUS_15270 30691 28928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 32142 30688 gene locus_tag LOCUS_15280 32142 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 33776 32373 gene locus_tag LOCUS_15290 33776 32373 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947343.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence31 5790 2497 gene locus_tag LOCUS_15300 5790 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6942 6025 gene locus_tag LOCUS_15310 gene nadA 6942 6025 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_15310 7763 6930 gene locus_tag LOCUS_15320 gene thiM 7763 6930 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_15320 8399 7803 gene locus_tag LOCUS_15330 gene metW 8399 7803 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_15330 9522 8392 gene locus_tag LOCUS_15340 9522 8392 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005981.1 protein_id gnl|my_center|LOCUS_15340 10921 9668 gene locus_tag LOCUS_15350 10921 9668 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_15350 11705 11070 gene locus_tag LOCUS_15360 11705 11070 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_15360 13068 11698 gene locus_tag LOCUS_15370 13068 11698 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_15370 14109 13180 gene locus_tag LOCUS_15380 gene cysK 14109 13180 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_15380 14564 14127 gene locus_tag LOCUS_15390 14564 14127 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_15390 15970 14687 gene locus_tag LOCUS_15400 15970 14687 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_15400 16518 16309 gene locus_tag LOCUS_15410 16518 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 17495 16539 gene locus_tag LOCUS_15420 17495 16539 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_15420 18570 17620 gene locus_tag LOCUS_15430 18570 17620 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662706.1 protein_id gnl|my_center|LOCUS_15430 20043 18706 gene locus_tag LOCUS_15440 gene gdhA 20043 18706 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_15440 20291 23806 gene locus_tag LOCUS_15450 20291 23806 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_15450 23968 24207 gene locus_tag LOCUS_15460 23968 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 24338 24832 gene locus_tag LOCUS_15470 24338 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 24944 25126 gene locus_tag LOCUS_15480 24944 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 26302 25226 gene locus_tag LOCUS_15490 gene rsgA 26302 25226 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_15490 26545 29574 gene locus_tag LOCUS_15500 26545 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 29715 30659 gene locus_tag LOCUS_15510 29715 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 31336 30683 gene locus_tag LOCUS_15520 31336 30683 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_15520 32853 31471 gene locus_tag LOCUS_15530 32853 31471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence32 4794 2365 gene locus_tag LOCUS_15540 4794 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7387 4892 gene locus_tag LOCUS_15550 7387 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 8737 7976 gene locus_tag LOCUS_15560 gene rlmB 8737 7976 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_15560 10259 8868 gene locus_tag LOCUS_15570 gene cysS 10259 8868 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_15570 10871 10377 gene locus_tag LOCUS_15580 gene ispF 10871 10377 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_15580 11534 10872 gene locus_tag LOCUS_15590 gene ispD 11534 10872 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_15590 12562 11531 gene locus_tag LOCUS_15600 12562 11531 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966462.1 protein_id gnl|my_center|LOCUS_15600 13500 12664 gene locus_tag LOCUS_15610 13500 12664 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880549.1 protein_id gnl|my_center|LOCUS_15610 13774 13487 gene locus_tag LOCUS_15620 13774 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 15411 14074 gene locus_tag LOCUS_15630 15411 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 15664 17196 gene locus_tag LOCUS_15640 15664 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17203 18375 gene locus_tag LOCUS_15650 17203 18375 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_15650 19697 18570 gene locus_tag LOCUS_15660 19697 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 19961 21178 gene locus_tag LOCUS_15670 19961 21178 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_15670 21304 21786 gene locus_tag LOCUS_15680 21304 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 21922 22794 gene locus_tag LOCUS_15690 gene hisG 21922 22794 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_15690 22967 24457 gene locus_tag LOCUS_15700 gene gltX 22967 24457 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_15700 24505 24846 gene locus_tag LOCUS_15710 24505 24846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 24861 25403 gene locus_tag LOCUS_15720 24861 25403 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 protein_id gnl|my_center|LOCUS_15720 25511 25585 gene locus_tag LOCUS_t00350 25511 25585 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 28936 25883 gene locus_tag LOCUS_15730 28936 25883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29768 28926 gene locus_tag LOCUS_15740 29768 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 30149 29973 gene locus_tag LOCUS_15750 30149 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 30724 30311 gene locus_tag LOCUS_15760 30724 30311 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229702.1 protein_id gnl|my_center|LOCUS_15760 31343 30840 gene locus_tag LOCUS_15770 gene lirB 31343 30840 CDS product type IV secretion system effector LirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947678.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence33 192 473 gene locus_tag LOCUS_15780 gene rpsT 192 473 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_15780 1458 544 gene locus_tag LOCUS_15790 1458 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2559 1540 gene locus_tag LOCUS_15800 gene holA 2559 1540 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_15800 3255 2695 gene locus_tag LOCUS_15810 3255 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 5850 3412 gene locus_tag LOCUS_15820 gene leuS 5850 3412 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_15820 6562 5909 gene locus_tag LOCUS_15830 6562 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 7508 6771 gene locus_tag LOCUS_15840 7508 6771 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_15840 9383 7539 gene locus_tag LOCUS_15850 gene dxs 9383 7539 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_15850 10397 9516 gene locus_tag LOCUS_15860 10397 9516 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_15860 10675 10415 gene locus_tag LOCUS_15870 10675 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 11916 10672 gene locus_tag LOCUS_15880 gene xseA 11916 10672 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099131.1 protein_id gnl|my_center|LOCUS_15880 13635 12079 gene locus_tag LOCUS_15890 gene rny 13635 12079 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_15890 14247 13654 gene locus_tag LOCUS_15900 14247 13654 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_15900 15523 14204 gene locus_tag LOCUS_15910 15523 14204 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_15910 16114 15824 gene locus_tag LOCUS_15920 16114 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 16347 16117 gene locus_tag LOCUS_15930 16347 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 17924 16443 gene locus_tag LOCUS_15940 17924 16443 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_15940 19447 17921 gene locus_tag LOCUS_15950 19447 17921 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139558.1 protein_id gnl|my_center|LOCUS_15950 21964 19601 gene locus_tag LOCUS_15960 gene pheT 21964 19601 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_15960 23050 22031 gene locus_tag LOCUS_15970 gene pheS 23050 22031 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021092.1 protein_id gnl|my_center|LOCUS_15970 23333 23043 gene locus_tag LOCUS_15980 23333 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 24027 23335 gene locus_tag LOCUS_15990 24027 23335 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_15990 25359 24046 gene locus_tag LOCUS_16000 25359 24046 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_16000 25721 25374 gene locus_tag LOCUS_16010 gene rplT 25721 25374 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166423.1 protein_id gnl|my_center|LOCUS_16010 26016 25816 gene locus_tag LOCUS_16020 gene rpmI 26016 25816 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_16020 26588 26172 gene locus_tag LOCUS_16030 gene infC 26588 26172 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881156.1 protein_id gnl|my_center|LOCUS_16030 27460 27020 gene locus_tag LOCUS_16040 27460 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 29283 27544 gene locus_tag LOCUS_16050 gene thrS 29283 27544 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_16050 30326 29511 gene locus_tag LOCUS_16060 30326 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 31299 30472 gene locus_tag LOCUS_16070 31299 30472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence34 153 1148 gene locus_tag LOCUS_16080 gene fba 153 1148 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_16080 1417 1704 gene locus_tag LOCUS_16090 1417 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1796 3217 gene locus_tag LOCUS_16100 1796 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3227 4150 gene locus_tag LOCUS_16110 3227 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4159 4860 gene locus_tag LOCUS_16120 4159 4860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272621.1 protein_id gnl|my_center|LOCUS_16120 4862 5596 gene locus_tag LOCUS_16130 4862 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5589 7742 gene locus_tag LOCUS_16140 5589 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 7839 8201 gene locus_tag LOCUS_16150 7839 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8353 10641 gene locus_tag LOCUS_16160 8353 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 10818 11213 gene locus_tag LOCUS_16170 10818 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 11331 12680 gene locus_tag LOCUS_16180 11331 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 12926 14614 gene locus_tag LOCUS_16190 gene ftsH 12926 14614 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_16190 14619 15392 gene locus_tag LOCUS_16200 14619 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 15482 17293 gene locus_tag LOCUS_16210 15482 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 17395 27690 gene locus_tag LOCUS_16220 17395 27690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 27796 29823 gene locus_tag LOCUS_16230 27796 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence35 296 221 gene locus_tag LOCUS_t00360 296 221 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 721 347 gene locus_tag LOCUS_16240 721 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1135 872 gene locus_tag LOCUS_16250 1135 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2120 1128 gene locus_tag LOCUS_16260 2120 1128 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_16260 2862 2260 gene locus_tag LOCUS_16270 gene plsY 2862 2260 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_16270 4291 2969 gene locus_tag LOCUS_16280 gene der 4291 2969 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_16280 5549 4284 gene locus_tag LOCUS_16290 gene hflX 5549 4284 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_16290 5703 5629 gene locus_tag LOCUS_t00370 5703 5629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5951 5867 gene locus_tag LOCUS_t00380 5951 5867 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6316 5963 gene locus_tag LOCUS_16300 6316 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7685 6435 gene locus_tag LOCUS_16310 7685 6435 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_16310 8879 7863 gene locus_tag LOCUS_16320 gene gap 8879 7863 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_16320 9139 9846 gene locus_tag LOCUS_16330 9139 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 10836 9892 gene locus_tag LOCUS_16340 gene prfB 10836 9892 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881199.1 protein_id gnl|my_center|LOCUS_16340 12633 11122 gene locus_tag LOCUS_16350 gene lnt 12633 11122 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_16350 14160 12637 gene locus_tag LOCUS_16360 gene lnt 14160 12637 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_16360 15604 14138 gene locus_tag LOCUS_16370 gene lnt 15604 14138 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_16370 17310 15775 gene locus_tag LOCUS_16380 gene lnt 17310 15775 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_16380 20052 17416 gene locus_tag LOCUS_16390 gene secA 20052 17416 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_16390 <22617 20286 gene locus_tag LOCUS_16400 <22617 20286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002970704.1:OmpA family protein >Feature sequence36 2174 909 gene locus_tag LOCUS_16410 gene thiC 2174 909 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_16410 2497 4938 gene locus_tag LOCUS_16420 2497 4938 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_16420 4956 5729 gene locus_tag LOCUS_16430 4956 5729 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438774.1 protein_id gnl|my_center|LOCUS_16430 6260 5790 gene locus_tag LOCUS_16440 6260 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6726 6247 gene locus_tag LOCUS_16450 6726 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7302 6727 gene locus_tag LOCUS_16460 7302 6727 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_16460 8802 7453 gene locus_tag LOCUS_16470 gene accC 8802 7453 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_16470 9283 8858 gene locus_tag LOCUS_16480 gene accB 9283 8858 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988620.1 protein_id gnl|my_center|LOCUS_16480 9979 9422 gene locus_tag LOCUS_16490 gene efp 9979 9422 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_16490 11152 10103 gene locus_tag LOCUS_16500 11152 10103 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 protein_id gnl|my_center|LOCUS_16500 11321 11524 gene locus_tag LOCUS_16510 gene cspE 11321 11524 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 protein_id gnl|my_center|LOCUS_16510 14177 11919 gene locus_tag LOCUS_16520 14177 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 16669 14336 gene locus_tag LOCUS_16530 16669 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 17663 17214 gene locus_tag LOCUS_16540 gene aroQ 17663 17214 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_16540 18868 17759 gene locus_tag LOCUS_16550 gene aroB 18868 17759 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence37 3218 1899 gene locus_tag LOCUS_16560 gene alaC 3218 1899 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_16560 3505 3233 gene locus_tag LOCUS_16570 3505 3233 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_16570 3840 5213 gene locus_tag LOCUS_16580 3840 5213 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_16580 5274 6305 gene locus_tag LOCUS_16590 5274 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6411 7013 gene locus_tag LOCUS_16600 6411 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7050 7769 gene locus_tag LOCUS_16610 7050 7769 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_16610 7907 9226 gene locus_tag LOCUS_16620 7907 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9867 9340 gene locus_tag LOCUS_16630 9867 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10772 9942 gene locus_tag LOCUS_16640 10772 9942 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_16640 11856 10786 gene locus_tag LOCUS_16650 11856 10786 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964934.1 protein_id gnl|my_center|LOCUS_16650 12589 11918 gene locus_tag LOCUS_16660 12589 11918 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_16660 12969 12721 gene locus_tag LOCUS_16670 12969 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 13309 13767 gene locus_tag LOCUS_16680 13309 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14154 14858 gene locus_tag LOCUS_16690 14154 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 15043 15747 gene locus_tag LOCUS_16700 15043 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 15963 16535 gene locus_tag LOCUS_16710 15963 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 16918 18522 gene locus_tag LOCUS_16720 16918 18522 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110774.1 protein_id gnl|my_center|LOCUS_16720 18844 21012 gene locus_tag LOCUS_16730 18844 21012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence38 170 520 gene locus_tag LOCUS_16740 170 520 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_16740 554 1423 gene locus_tag LOCUS_16750 554 1423 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583629.1 protein_id gnl|my_center|LOCUS_16750 1425 2141 gene locus_tag LOCUS_16760 1425 2141 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_16760 2275 2700 gene locus_tag LOCUS_16770 2275 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2730 20264 gene locus_tag LOCUS_16780 2730 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence39 1292 1387 gene locus_tag LOCUS_r00010 1292 1387 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1606 3219 gene locus_tag LOCUS_16790 1606 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5267 3282 gene locus_tag LOCUS_16800 5267 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5622 6137 gene locus_tag LOCUS_16810 gene rplJ 5622 6137 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_16810 6268 6657 gene locus_tag LOCUS_16820 gene rplL 6268 6657 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_16820 6812 10591 gene locus_tag LOCUS_16830 gene rpoB 6812 10591 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019908.1 protein_id gnl|my_center|LOCUS_16830 10588 15330 gene locus_tag LOCUS_16840 gene rpoC 10588 15330 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_16840 15358 15744 gene locus_tag LOCUS_16850 gene rpsL 15358 15744 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_16850 15840 16319 gene locus_tag LOCUS_16860 gene rpsG 15840 16319 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_16860 16415 16678 gene locus_tag LOCUS_16870 16415 16678 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_16870 17063 16746 gene locus_tag LOCUS_16880 17063 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 17396 17082 gene locus_tag LOCUS_16890 17396 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 17510 19591 gene locus_tag LOCUS_16900 gene fusA 17510 19591 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence40 227 2713 gene locus_tag LOCUS_16910 227 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3074 4735 gene locus_tag LOCUS_16920 3074 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4901 6661 gene locus_tag LOCUS_16930 4901 6661 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_16930 7087 7162 gene locus_tag LOCUS_t00390 7087 7162 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8739 7135 gene locus_tag LOCUS_16940 8739 7135 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861375.1 protein_id gnl|my_center|LOCUS_16940 9004 8741 gene locus_tag LOCUS_16950 9004 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 10019 8982 gene locus_tag LOCUS_16960 10019 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 10333 10016 gene locus_tag LOCUS_16970 10333 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 11257 10412 gene locus_tag LOCUS_16980 11257 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 11944 11372 gene locus_tag LOCUS_16990 11944 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 13025 11988 gene locus_tag LOCUS_17000 13025 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13335 13075 gene locus_tag LOCUS_17010 13335 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 13901 13716 gene locus_tag LOCUS_17020 13901 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 14530 14021 gene locus_tag LOCUS_17030 14530 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 15089 14532 gene locus_tag LOCUS_17040 15089 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16142 15339 gene locus_tag LOCUS_17050 16142 15339 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262186.1 protein_id gnl|my_center|LOCUS_17050 16326 17213 gene locus_tag LOCUS_17060 16326 17213 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_17060 17223 17411 gene locus_tag LOCUS_17070 17223 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 18181 18720 gene locus_tag LOCUS_17080 18181 18720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 19220 18777 gene locus_tag LOCUS_17090 19220 18777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966715.1 protein_id gnl|my_center|LOCUS_17090 19472 19398 gene locus_tag LOCUS_t00400 19472 19398 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence41 1860 1312 gene locus_tag LOCUS_17100 1860 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3513 2059 gene locus_tag LOCUS_17110 gene gatB 3513 2059 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_17110 5098 3641 gene locus_tag LOCUS_17120 gene gatA 5098 3641 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_17120 6116 5124 gene locus_tag LOCUS_17130 gene corA 6116 5124 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_17130 6414 6121 gene locus_tag LOCUS_17140 gene gatC 6414 6121 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583526.1 protein_id gnl|my_center|LOCUS_17140 6634 8085 gene locus_tag LOCUS_17150 6634 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10471 8228 gene locus_tag LOCUS_17160 10471 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12567 10468 gene locus_tag LOCUS_17170 12567 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 14252 13134 gene locus_tag LOCUS_17180 14252 13134 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_17180 14996 14574 gene locus_tag LOCUS_17190 14996 14574 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_17190 16192 15065 gene locus_tag LOCUS_17200 16192 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 17307 16189 gene locus_tag LOCUS_17210 17307 16189 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_17210 17936 17400 gene locus_tag LOCUS_17220 17936 17400 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_17220 18508 18095 gene locus_tag LOCUS_17230 18508 18095 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence42 1497 169 gene locus_tag LOCUS_17240 gene rfbH 1497 169 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_17240 2570 1494 gene locus_tag LOCUS_17250 gene rfbG 2570 1494 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_17250 3058 2591 gene locus_tag LOCUS_17260 3058 2591 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930707.1 protein_id gnl|my_center|LOCUS_17260 3814 3179 gene locus_tag LOCUS_17270 3814 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4550 3804 gene locus_tag LOCUS_17280 4550 3804 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_17280 5596 4550 gene locus_tag LOCUS_17290 5596 4550 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_17290 6555 6052 gene locus_tag LOCUS_17300 6555 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7001 6591 gene locus_tag LOCUS_17310 7001 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7572 6985 gene locus_tag LOCUS_17320 7572 6985 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_17320 8139 7636 gene locus_tag LOCUS_17330 8139 7636 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_17330 8331 8738 gene locus_tag LOCUS_17340 8331 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 8905 18021 gene locus_tag LOCUS_17350 8905 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 18249 18336 gene locus_tag LOCUS_t00410 18249 18336 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence43 640 449 gene locus_tag LOCUS_17360 gene rpmB 640 449 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193812.1 protein_id gnl|my_center|LOCUS_17360 1824 817 gene locus_tag LOCUS_17370 1824 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1868 2143 gene locus_tag LOCUS_17380 1868 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2140 2472 gene locus_tag LOCUS_17390 2140 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2603 4705 gene locus_tag LOCUS_17400 gene recG 2603 4705 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_17400 4839 5684 gene locus_tag LOCUS_17410 gene nadC 4839 5684 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_17410 5687 6628 gene locus_tag LOCUS_17420 5687 6628 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_17420 6629 7285 gene locus_tag LOCUS_17430 6629 7285 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105288.1 protein_id gnl|my_center|LOCUS_17430 7296 7763 gene locus_tag LOCUS_17440 7296 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 7788 9185 gene locus_tag LOCUS_17450 7788 9185 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_17450 9259 9465 gene locus_tag LOCUS_17460 9259 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 9455 9670 gene locus_tag LOCUS_17470 9455 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 9639 9842 gene locus_tag LOCUS_17480 9639 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 9996 10292 gene locus_tag LOCUS_17490 9996 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 10455 11186 gene locus_tag LOCUS_17500 10455 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 11233 11976 gene locus_tag LOCUS_17510 11233 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11977 13359 gene locus_tag LOCUS_17520 11977 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence44 85 954 gene locus_tag LOCUS_17530 85 954 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_17530 1024 1434 gene locus_tag LOCUS_17540 1024 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1442 2752 gene locus_tag LOCUS_17550 gene aroA 1442 2752 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_17550 2743 3342 gene locus_tag LOCUS_17560 2743 3342 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_17560 3495 4388 gene locus_tag LOCUS_17570 gene ispH 3495 4388 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_17570 4441 6123 gene locus_tag LOCUS_17580 4441 6123 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_17580 6457 7200 gene locus_tag LOCUS_17590 6457 7200 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431907.1 protein_id gnl|my_center|LOCUS_17590 7265 8539 gene locus_tag LOCUS_17600 7265 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 8743 9174 gene locus_tag LOCUS_17610 gene rplM 8743 9174 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_17610 9264 9659 gene locus_tag LOCUS_17620 gene rpsI 9264 9659 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_17620 10108 10323 gene locus_tag LOCUS_17630 10108 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17630 10374 13922 gene locus_tag LOCUS_17640 10374 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 14032 14205 gene locus_tag LOCUS_17650 14032 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence45 364 657 gene locus_tag LOCUS_17660 364 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 665 1531 gene locus_tag LOCUS_17670 665 1531 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137498.1 protein_id gnl|my_center|LOCUS_17670 1528 2082 gene locus_tag LOCUS_17680 1528 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2079 2873 gene locus_tag LOCUS_17690 2079 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3280 3402 gene locus_tag LOCUS_17700 3280 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5018 3744 gene locus_tag LOCUS_17710 gene serS 5018 3744 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_17710 5261 5857 gene locus_tag LOCUS_17720 5261 5857 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_17720 5885 6553 gene locus_tag LOCUS_17730 5885 6553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_17730 7434 6592 gene locus_tag LOCUS_17740 7434 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7727 9004 gene locus_tag LOCUS_17750 7727 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9337 10785 gene locus_tag LOCUS_17760 9337 10785 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_17760 10858 11154 gene locus_tag LOCUS_17770 10858 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 11444 11674 gene locus_tag LOCUS_17780 11444 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence46 181 1881 gene locus_tag LOCUS_17790 gene pilB 181 1881 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_17790 2056 3309 gene locus_tag LOCUS_17800 2056 3309 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_17800 3326 4186 gene locus_tag LOCUS_17810 3326 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4383 4796 gene locus_tag LOCUS_17820 4383 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4938 6848 gene locus_tag LOCUS_17830 4938 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence47 788 102 gene locus_tag LOCUS_17840 788 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1242 2018 gene locus_tag LOCUS_17850 1242 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2002 2376 gene locus_tag LOCUS_17860 2002 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2399 2713 gene locus_tag LOCUS_17870 2399 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3337 2843 gene locus_tag LOCUS_17880 3337 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3557 4099 gene locus_tag LOCUS_17890 3557 4099 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_17890 4519 5442 gene locus_tag LOCUS_17900 4519 5442 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_17900 5444 5818 gene locus_tag LOCUS_17910 gene crcB 5444 5818 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence48 99 1112 gene locus_tag LOCUS_17920 99 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1105 1689 gene locus_tag LOCUS_17930 1105 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1690 2613 gene locus_tag LOCUS_17940 1690 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2616 3935 gene locus_tag LOCUS_17950 2616 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4176 4736 gene locus_tag LOCUS_17960 4176 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4977 5783 gene locus_tag LOCUS_17970 4977 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence49 2543 1938 gene locus_tag LOCUS_17980 2543 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence50 4371 115 gene locus_tag LOCUS_17990 4371 115 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence51 >Feature sequence52 185 2296 gene locus_tag LOCUS_18000 185 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence53 244 173 gene locus_tag LOCUS_t00420 244 173 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 514 1152 gene locus_tag LOCUS_18010 514 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2076 1285 gene locus_tag LOCUS_18020 2076 1285 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_18020 2726 2088 gene locus_tag LOCUS_18030 2726 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3645 2908 gene locus_tag LOCUS_18040 3645 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence54 2055 142 gene locus_tag LOCUS_18050 gene recQ 2055 142 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_18050 2924 2085 gene locus_tag LOCUS_18060 gene dinD 2924 2085 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_18060