>Feature sequence001 668 456 gene locus_tag LOCUS_00010 668 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1274 2080 gene locus_tag LOCUS_00020 1274 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2111 3502 gene locus_tag LOCUS_00030 2111 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3512 4177 gene locus_tag LOCUS_00040 3512 4177 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_00040 4512 4174 gene locus_tag LOCUS_00050 4512 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5162 5848 gene locus_tag LOCUS_00060 5162 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5849 6991 gene locus_tag LOCUS_00070 gene scfB 5849 6991 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_00070 10564 7175 gene locus_tag LOCUS_00080 10564 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13219 10685 gene locus_tag LOCUS_00090 13219 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14682 13219 gene locus_tag LOCUS_00100 14682 13219 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937381.1 protein_id gnl|my_center|LOCUS_00100 15438 14692 gene locus_tag LOCUS_00110 15438 14692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_00110 16364 15441 gene locus_tag LOCUS_00120 16364 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16519 17553 gene locus_tag LOCUS_00130 16519 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17573 18283 gene locus_tag LOCUS_00140 17573 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18974 18420 gene locus_tag LOCUS_00150 18974 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19555 18983 gene locus_tag LOCUS_00160 19555 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20476 19697 gene locus_tag LOCUS_00170 20476 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21112 20642 gene locus_tag LOCUS_00180 21112 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21855 21367 gene locus_tag LOCUS_00190 21855 21367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22293 21997 gene locus_tag LOCUS_00200 22293 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22673 22290 gene locus_tag LOCUS_00210 22673 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23571 22906 gene locus_tag LOCUS_00220 23571 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25621 24098 gene locus_tag LOCUS_00230 25621 24098 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_00230 27648 25621 gene locus_tag LOCUS_00240 27648 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28162 28743 gene locus_tag LOCUS_00250 28162 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29646 28777 gene locus_tag LOCUS_00260 29646 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30668 29643 gene locus_tag LOCUS_00270 30668 29643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31988 30672 gene locus_tag LOCUS_00280 31988 30672 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_00280 32842 32168 gene locus_tag LOCUS_00290 32842 32168 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_00290 34104 32866 gene locus_tag LOCUS_00300 gene lnrN 34104 32866 CDS product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 protein_id gnl|my_center|LOCUS_00300 35234 34104 gene locus_tag LOCUS_00310 35234 34104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_00310 36174 35236 gene locus_tag LOCUS_00320 gene lnrL 36174 35236 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_00320 36268 36930 gene locus_tag LOCUS_00330 36268 36930 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_00330 39517 37523 gene locus_tag LOCUS_00340 39517 37523 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_00340 41467 39710 gene locus_tag LOCUS_00350 41467 39710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41845 41770 gene locus_tag LOCUS_t00010 41845 41770 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42072 41996 gene locus_tag LOCUS_t00020 42072 41996 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 45134 42093 gene locus_tag LOCUS_00360 45134 42093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45543 46052 gene locus_tag LOCUS_00370 45543 46052 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409242.1 protein_id gnl|my_center|LOCUS_00370 47294 46098 gene locus_tag LOCUS_00380 47294 46098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_00380 48181 47291 gene locus_tag LOCUS_00390 48181 47291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_00390 49663 48200 gene locus_tag LOCUS_00400 49663 48200 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_00400 50206 49769 gene locus_tag LOCUS_00410 50206 49769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461399.1 protein_id gnl|my_center|LOCUS_00410 51177 50473 gene locus_tag LOCUS_00420 51177 50473 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_00420 53809 51146 gene locus_tag LOCUS_00430 gene gyrA 53809 51146 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_00430 54421 53810 gene locus_tag LOCUS_00440 54421 53810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 56381 54468 gene locus_tag LOCUS_00450 gene gyrB 56381 54468 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_00450 57039 56500 gene locus_tag LOCUS_00460 57039 56500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57554 57081 gene locus_tag LOCUS_00470 57554 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 373 894 gene locus_tag LOCUS_00480 373 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 788 1189 gene locus_tag LOCUS_00490 788 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 1117 1593 gene locus_tag LOCUS_00500 1117 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1838 3130 gene locus_tag LOCUS_00510 1838 3130 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_00510 3610 4743 gene locus_tag LOCUS_00520 3610 4743 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_00520 4744 5616 gene locus_tag LOCUS_00530 4744 5616 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_00530 5609 6688 gene locus_tag LOCUS_00540 5609 6688 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_00540 6685 7455 gene locus_tag LOCUS_00550 6685 7455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_00550 7448 8206 gene locus_tag LOCUS_00560 7448 8206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_00560 8279 9502 gene locus_tag LOCUS_00570 8279 9502 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_00570 9517 10053 gene locus_tag LOCUS_00580 9517 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 10050 10514 gene locus_tag LOCUS_00590 10050 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10511 10816 gene locus_tag LOCUS_00600 10511 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10912 11763 gene locus_tag LOCUS_00610 10912 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 12387 11941 gene locus_tag LOCUS_00620 gene dut 12387 11941 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_00620 12753 12454 gene locus_tag LOCUS_00630 12753 12454 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022669.1 protein_id gnl|my_center|LOCUS_00630 13376 12930 gene locus_tag LOCUS_00640 gene nrdR 13376 12930 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_00640 13807 13574 gene locus_tag LOCUS_00650 13807 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14044 14649 gene locus_tag LOCUS_00660 gene lexA 14044 14649 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_00660 15471 14752 gene locus_tag LOCUS_00670 15471 14752 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_00670 15668 16339 gene locus_tag LOCUS_00680 15668 16339 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_00680 17795 16479 gene locus_tag LOCUS_00690 gene hflX 17795 16479 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_00690 19067 17904 gene locus_tag LOCUS_00700 19067 17904 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_00700 20243 19269 gene locus_tag LOCUS_00710 gene dapF 20243 19269 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_00710 20426 20274 gene locus_tag LOCUS_00720 20426 20274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 22737 21706 gene locus_tag LOCUS_00730 gene miaA 22737 21706 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 protein_id gnl|my_center|LOCUS_00730 23744 22710 gene locus_tag LOCUS_00740 23744 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 23727 24209 gene locus_tag LOCUS_00750 23727 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 24507 24235 gene locus_tag LOCUS_00760 24507 24235 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_00760 25728 24655 gene locus_tag LOCUS_00770 25728 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 27399 25855 gene locus_tag LOCUS_00780 gene rny 27399 25855 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_00780 29195 27795 gene locus_tag LOCUS_00790 29195 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 30487 29435 gene locus_tag LOCUS_00800 gene recA 30487 29435 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 protein_id gnl|my_center|LOCUS_00800 31310 30660 gene locus_tag LOCUS_00810 31310 30660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 32566 31310 gene locus_tag LOCUS_00820 32566 31310 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_00820 33299 32541 gene locus_tag LOCUS_00830 33299 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 34795 33296 gene locus_tag LOCUS_00840 gene rimO 34795 33296 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_00840 35320 34823 gene locus_tag LOCUS_00850 35320 34823 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257723.1 protein_id gnl|my_center|LOCUS_00850 36317 35499 gene locus_tag LOCUS_00860 36317 35499 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_00860 38673 36310 gene locus_tag LOCUS_00870 38673 36310 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_00870 39601 38693 gene locus_tag LOCUS_00880 39601 38693 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_00880 41278 39605 gene locus_tag LOCUS_00890 41278 39605 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_00890 42165 41275 gene locus_tag LOCUS_00900 gene dapA 42165 41275 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_00900 43134 42331 gene locus_tag LOCUS_00910 gene dapB 43134 42331 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_00910 44444 43194 gene locus_tag LOCUS_00920 44444 43194 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_00920 44904 44578 gene locus_tag LOCUS_00930 44904 44578 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_00930 45575 46567 gene locus_tag LOCUS_00940 45575 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 47660 46551 gene locus_tag LOCUS_00950 47660 46551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 48812 47697 gene locus_tag LOCUS_00960 48812 47697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 49056 49223 gene locus_tag LOCUS_00970 49056 49223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 49866 49330 gene locus_tag LOCUS_00980 49866 49330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083551.1 protein_id gnl|my_center|LOCUS_00980 50113 50188 gene locus_tag LOCUS_t00030 50113 50188 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 50193 50269 gene locus_tag LOCUS_t00040 50193 50269 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50693 51856 gene locus_tag LOCUS_00990 50693 51856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence003 149 337 gene locus_tag LOCUS_01000 gene rpmB 149 337 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01000 2399 456 gene locus_tag LOCUS_01010 2399 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 2473 2775 gene locus_tag LOCUS_01020 2473 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 3036 2845 gene locus_tag LOCUS_01030 3036 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3652 2954 gene locus_tag LOCUS_01040 3652 2954 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_01040 4260 3649 gene locus_tag LOCUS_01050 4260 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4993 4805 gene locus_tag LOCUS_01060 4993 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5743 5123 gene locus_tag LOCUS_01070 5743 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01070 7166 6150 gene locus_tag LOCUS_01080 7166 6150 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_01080 9226 7163 gene locus_tag LOCUS_01090 9226 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9334 9675 gene locus_tag LOCUS_01100 9334 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 10797 9862 gene locus_tag LOCUS_01110 gene glpX 10797 9862 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_01110 12316 10919 gene locus_tag LOCUS_01120 gene rsmB 12316 10919 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_01120 13449 12301 gene locus_tag LOCUS_01130 gene fmt 13449 12301 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004473.1 protein_id gnl|my_center|LOCUS_01130 13933 13436 gene locus_tag LOCUS_01140 gene def 13933 13436 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_01140 16386 14008 gene locus_tag LOCUS_01150 gene priA 16386 14008 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01150 17763 16525 gene locus_tag LOCUS_01160 gene metK 17763 16525 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_01160 20652 18301 gene locus_tag LOCUS_01170 20652 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 20963 21427 gene locus_tag LOCUS_01180 20963 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 21434 22966 gene locus_tag LOCUS_01190 gene gltX 21434 22966 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_01190 23546 23010 gene locus_tag LOCUS_01200 23546 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 23840 25027 gene locus_tag LOCUS_01210 23840 25027 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020479.1 protein_id gnl|my_center|LOCUS_01210 25117 25758 gene locus_tag LOCUS_01220 25117 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 25832 26098 gene locus_tag LOCUS_01230 25832 26098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 26220 26144 gene locus_tag LOCUS_t00050 26220 26144 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26386 26667 gene locus_tag LOCUS_01240 26386 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 26668 27009 gene locus_tag LOCUS_01250 26668 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 27373 27002 gene locus_tag LOCUS_01260 27373 27002 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_01260 28808 27354 gene locus_tag LOCUS_01270 gene coaBC 28808 27354 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_01270 30030 28813 gene locus_tag LOCUS_01280 30030 28813 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_01280 31419 30217 gene locus_tag LOCUS_01290 31419 30217 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_01290 32611 31472 gene locus_tag LOCUS_01300 32611 31472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 32976 32725 gene locus_tag LOCUS_01310 32976 32725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 33560 32967 gene locus_tag LOCUS_01320 gene gmk 33560 32967 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466863.1 protein_id gnl|my_center|LOCUS_01320 33901 33593 gene locus_tag LOCUS_01330 gene mihF 33901 33593 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_01330 35131 34124 gene locus_tag LOCUS_01340 35131 34124 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_01340 35948 35121 gene locus_tag LOCUS_01350 35948 35121 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_01350 39160 35945 gene locus_tag LOCUS_01360 gene carB 39160 35945 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_01360 40396 39161 gene locus_tag LOCUS_01370 gene carA 40396 39161 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081322.1 protein_id gnl|my_center|LOCUS_01370 41895 40393 gene locus_tag LOCUS_01380 41895 40393 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_01380 42815 41895 gene locus_tag LOCUS_01390 42815 41895 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_01390 43373 42822 gene locus_tag LOCUS_01400 gene pyrR 43373 42822 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence004 816 82 gene locus_tag LOCUS_01410 816 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2018 828 gene locus_tag LOCUS_01420 2018 828 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943706.1 protein_id gnl|my_center|LOCUS_01420 2854 2015 gene locus_tag LOCUS_01430 gene hisJ 2854 2015 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_01430 3981 2842 gene locus_tag LOCUS_01440 gene mnmA 3981 2842 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_01440 4476 3985 gene locus_tag LOCUS_01450 gene nifU 4476 3985 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_01450 5706 4525 gene locus_tag LOCUS_01460 gene nifS 5706 4525 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_01460 6250 5687 gene locus_tag LOCUS_01470 6250 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6972 6511 gene locus_tag LOCUS_01480 6972 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7523 7053 gene locus_tag LOCUS_01490 gene ribE 7523 7053 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_01490 8923 7520 gene locus_tag LOCUS_01500 8923 7520 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_01500 9619 8927 gene locus_tag LOCUS_01510 9619 8927 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_01510 10842 9580 gene locus_tag LOCUS_01520 gene ribD 10842 9580 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_01520 12450 11041 gene locus_tag LOCUS_01530 12450 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 13485 12769 gene locus_tag LOCUS_01540 gene rpe 13485 12769 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_01540 13625 13491 gene locus_tag LOCUS_01550 13625 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 14701 13688 gene locus_tag LOCUS_01560 14701 13688 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_01560 15553 14705 gene locus_tag LOCUS_01570 15553 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16874 15555 gene locus_tag LOCUS_01580 gene der 16874 15555 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_01580 17202 16981 gene locus_tag LOCUS_01590 17202 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 18706 17207 gene locus_tag LOCUS_01600 18706 17207 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_01600 19577 18744 gene locus_tag LOCUS_01610 gene ispH 19577 18744 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_01610 20280 19567 gene locus_tag LOCUS_01620 20280 19567 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233335.1 protein_id gnl|my_center|LOCUS_01620 21022 20267 gene locus_tag LOCUS_01630 gene cmk 21022 20267 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908300.1 protein_id gnl|my_center|LOCUS_01630 21985 21425 gene locus_tag LOCUS_01640 21985 21425 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_01640 22798 22007 gene locus_tag LOCUS_01650 22798 22007 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392938.1 protein_id gnl|my_center|LOCUS_01650 26436 22912 gene locus_tag LOCUS_01660 26436 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 27007 27393 gene locus_tag LOCUS_01670 27007 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 27393 27944 gene locus_tag LOCUS_01680 27393 27944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 28044 28622 gene locus_tag LOCUS_01690 28044 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 28619 29365 gene locus_tag LOCUS_01700 28619 29365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 29355 30020 gene locus_tag LOCUS_01710 29355 30020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 30017 30784 gene locus_tag LOCUS_01720 30017 30784 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804391.1 protein_id gnl|my_center|LOCUS_01720 30781 31533 gene locus_tag LOCUS_01730 gene mobB 30781 31533 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_01730 31604 32236 gene locus_tag LOCUS_01740 31604 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 33720 32293 gene locus_tag LOCUS_01750 33720 32293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 34649 33717 gene locus_tag LOCUS_01760 34649 33717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 <41306 34925 gene locus_tag LOCUS_01770 <41306 34925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein >Feature sequence005 2477 1083 gene locus_tag LOCUS_01780 gene glmM 2477 1083 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_01780 2966 2568 gene locus_tag LOCUS_01790 gene rpsI 2966 2568 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_01790 3404 2970 gene locus_tag LOCUS_01800 gene rplM 3404 2970 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_01800 4360 3542 gene locus_tag LOCUS_01810 4360 3542 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379226.1 protein_id gnl|my_center|LOCUS_01810 5430 4375 gene locus_tag LOCUS_01820 5430 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 6233 5421 gene locus_tag LOCUS_01830 6233 5421 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393906.1 protein_id gnl|my_center|LOCUS_01830 6698 6348 gene locus_tag LOCUS_01840 gene rplQ 6698 6348 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975188.1 protein_id gnl|my_center|LOCUS_01840 7672 6734 gene locus_tag LOCUS_01850 7672 6734 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_01850 8345 7719 gene locus_tag LOCUS_01860 gene rpsD 8345 7719 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_01860 8785 8384 gene locus_tag LOCUS_01870 gene rpsK 8785 8384 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_01870 9163 8789 gene locus_tag LOCUS_01880 gene rpsM 9163 8789 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_01880 9694 9473 gene locus_tag LOCUS_01890 gene infA 9694 9473 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_01890 10563 9814 gene locus_tag LOCUS_01900 gene map 10563 9814 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01900 11201 10560 gene locus_tag LOCUS_01910 11201 10560 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01910 12594 11317 gene locus_tag LOCUS_01920 gene secY 12594 11317 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_01920 13037 12588 gene locus_tag LOCUS_01930 gene rplO 13037 12588 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_01930 13289 13092 gene locus_tag LOCUS_01940 gene rpmD 13289 13092 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_01940 13802 13293 gene locus_tag LOCUS_01950 gene rpsE 13802 13293 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_01950 14189 13821 gene locus_tag LOCUS_01960 gene rplR 14189 13821 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_01960 14778 14242 gene locus_tag LOCUS_01970 gene rplF 14778 14242 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_01970 15212 14814 gene locus_tag LOCUS_01980 gene rpsH 15212 14814 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_01980 15496 15311 gene locus_tag LOCUS_01990 15496 15311 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_01990 16095 15553 gene locus_tag LOCUS_02000 gene rplE 16095 15553 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 protein_id gnl|my_center|LOCUS_02000 16529 16209 gene locus_tag LOCUS_02010 gene rplX 16529 16209 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_02010 16908 16540 gene locus_tag LOCUS_02020 gene rplN 16908 16540 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_02020 17252 16992 gene locus_tag LOCUS_02030 gene rpsQ 17252 16992 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_02030 17487 17272 gene locus_tag LOCUS_02040 gene rpmC 17487 17272 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_02040 17964 17488 gene locus_tag LOCUS_02050 gene rplP 17964 17488 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_02050 18625 17918 gene locus_tag LOCUS_02060 gene rpsC 18625 17918 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_02060 18973 18632 gene locus_tag LOCUS_02070 gene rplV 18973 18632 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_02070 19255 18977 gene locus_tag LOCUS_02080 gene rpsS 19255 18977 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_02080 20105 19275 gene locus_tag LOCUS_02090 gene rplB 20105 19275 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_02090 20539 20252 gene locus_tag LOCUS_02100 gene rplW 20539 20252 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_02100 21163 20540 gene locus_tag LOCUS_02110 gene rplD 21163 20540 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829775.1 protein_id gnl|my_center|LOCUS_02110 21797 21210 gene locus_tag LOCUS_02120 gene rplC 21797 21210 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_02120 22285 21977 gene locus_tag LOCUS_02130 gene rpsJ 22285 21977 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_02130 24449 22362 gene locus_tag LOCUS_02140 gene fusA 24449 22362 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_02140 25127 24657 gene locus_tag LOCUS_02150 gene rpsG 25127 24657 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_02150 25616 25245 gene locus_tag LOCUS_02160 gene rpsL 25616 25245 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_02160 26276 25890 gene locus_tag LOCUS_02170 26276 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 26413 26276 gene locus_tag LOCUS_02180 26413 26276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27305 26469 gene locus_tag LOCUS_02190 27305 26469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 31728 27457 gene locus_tag LOCUS_02200 31728 27457 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_02200 35246 31731 gene locus_tag LOCUS_02210 gene rpoB 35246 31731 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_02210 35954 35574 gene locus_tag LOCUS_02220 gene rplL 35954 35574 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_02220 36542 36024 gene locus_tag LOCUS_02230 gene rplJ 36542 36024 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_02230 36672 36815 gene locus_tag LOCUS_02240 36672 36815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 37837 37121 gene locus_tag LOCUS_02250 gene rplA 37837 37121 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence006 167 1138 gene locus_tag LOCUS_02260 167 1138 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_02260 1131 2156 gene locus_tag LOCUS_02270 1131 2156 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_02270 5326 2186 gene locus_tag LOCUS_02280 5326 2186 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_02280 5562 8102 gene locus_tag LOCUS_02290 5562 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8294 8962 gene locus_tag LOCUS_02300 gene sdaAB 8294 8962 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 protein_id gnl|my_center|LOCUS_02300 11043 9145 gene locus_tag LOCUS_02310 gene feoB 11043 9145 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541602.1 protein_id gnl|my_center|LOCUS_02310 11392 11099 gene locus_tag LOCUS_02320 11392 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 11780 12670 gene locus_tag LOCUS_02330 gene sdaAA 11780 12670 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_02330 12758 13315 gene locus_tag LOCUS_02340 12758 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13680 13420 gene locus_tag LOCUS_02350 13680 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 13966 13664 gene locus_tag LOCUS_02360 13966 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 15207 14221 gene locus_tag LOCUS_02370 15207 14221 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_02370 15670 18459 gene locus_tag LOCUS_02380 15670 18459 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_02380 19365 18424 gene locus_tag LOCUS_02390 19365 18424 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_02390 20141 19410 gene locus_tag LOCUS_02400 20141 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20473 21603 gene locus_tag LOCUS_02410 gene rlmN 20473 21603 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450546.1 protein_id gnl|my_center|LOCUS_02410 25265 21522 gene locus_tag LOCUS_02420 25265 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 28384 25268 gene locus_tag LOCUS_02430 28384 25268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 28723 28430 gene locus_tag LOCUS_02440 28723 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 29595 28720 gene locus_tag LOCUS_02450 29595 28720 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_02450 30373 29588 gene locus_tag LOCUS_02460 30373 29588 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_02460 31163 30438 gene locus_tag LOCUS_02470 gene rsmG 31163 30438 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_02470 32099 31335 gene locus_tag LOCUS_02480 32099 31335 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_02480 32952 32161 gene locus_tag LOCUS_02490 32952 32161 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869456.1 protein_id gnl|my_center|LOCUS_02490 34636 36003 gene locus_tag LOCUS_02500 gene dnaA 34636 36003 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_02500 36303 37403 gene locus_tag LOCUS_02510 gene dnaN 36303 37403 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence007 2690 120 gene locus_tag LOCUS_02520 2690 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5486 2904 gene locus_tag LOCUS_02530 gene clpB 5486 2904 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_02530 5878 5483 gene locus_tag LOCUS_02540 5878 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7133 6000 gene locus_tag LOCUS_02550 gene dnaJ 7133 6000 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_02550 7850 7137 gene locus_tag LOCUS_02560 7850 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 9766 7847 gene locus_tag LOCUS_02570 gene dnaK 9766 7847 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_02570 10174 10362 gene locus_tag LOCUS_02580 10174 10362 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064240.1 protein_id gnl|my_center|LOCUS_02580 11034 10366 gene locus_tag LOCUS_02590 11034 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11981 11034 gene locus_tag LOCUS_02600 11981 11034 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_02600 12713 12015 gene locus_tag LOCUS_02610 12713 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 13043 13657 gene locus_tag LOCUS_02620 13043 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 16142 13797 gene locus_tag LOCUS_02630 gene lon 16142 13797 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_02630 16559 16362 gene locus_tag LOCUS_02640 16559 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 16537 18537 gene locus_tag LOCUS_02650 16537 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18537 18944 gene locus_tag LOCUS_02660 18537 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18944 20194 gene locus_tag LOCUS_02670 18944 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 20184 21131 gene locus_tag LOCUS_02680 gene trxB 20184 21131 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_02680 21204 21527 gene locus_tag LOCUS_02690 gene trxA 21204 21527 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_02690 21657 21908 gene locus_tag LOCUS_02700 21657 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 23020 21905 gene locus_tag LOCUS_02710 23020 21905 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_02710 24711 23353 gene locus_tag LOCUS_02720 24711 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 25438 24806 gene locus_tag LOCUS_02730 25438 24806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 25904 26422 gene locus_tag LOCUS_02740 gene nikR 25904 26422 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_02740 26427 27248 gene locus_tag LOCUS_02750 gene cbiQ 26427 27248 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_02750 27245 28036 gene locus_tag LOCUS_02760 27245 28036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_02760 28023 30740 gene locus_tag LOCUS_02770 gene hypF 28023 30740 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933457.1 protein_id gnl|my_center|LOCUS_02770 30761 31006 gene locus_tag LOCUS_02780 30761 31006 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810715.1 protein_id gnl|my_center|LOCUS_02780 31012 32124 gene locus_tag LOCUS_02790 gene hypD 31012 32124 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_02790 32114 33124 gene locus_tag LOCUS_02800 gene hypE 32114 33124 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_02800 33456 35318 gene locus_tag LOCUS_02810 33456 35318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 35913 35311 gene locus_tag LOCUS_02820 35913 35311 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_02820 <36563 35926 gene locus_tag LOCUS_02830 <36563 35926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053094988.1:LytTR family DNA-binding domain-containing protein >Feature sequence008 2303 1095 gene locus_tag LOCUS_02840 gene tyrS 2303 1095 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_02840 2798 5329 gene locus_tag LOCUS_02850 2798 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5968 6888 gene locus_tag LOCUS_02860 5968 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6885 11126 gene locus_tag LOCUS_02870 6885 11126 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_02870 13945 11357 gene locus_tag LOCUS_02880 13945 11357 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 protein_id gnl|my_center|LOCUS_02880 14265 16373 gene locus_tag LOCUS_02890 14265 16373 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_02890 17278 16481 gene locus_tag LOCUS_02900 17278 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 18210 17539 gene locus_tag LOCUS_02910 18210 17539 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_02910 19637 18207 gene locus_tag LOCUS_02920 gene argH 19637 18207 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_02920 20867 19641 gene locus_tag LOCUS_02930 gene argG 20867 19641 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358518.1 protein_id gnl|my_center|LOCUS_02930 21328 21005 gene locus_tag LOCUS_02940 gene argR 21328 21005 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_02940 22435 21491 gene locus_tag LOCUS_02950 gene argF 22435 21491 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227834.1 protein_id gnl|my_center|LOCUS_02950 23652 22432 gene locus_tag LOCUS_02960 23652 22432 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_02960 24530 23649 gene locus_tag LOCUS_02970 gene argB 24530 23649 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_02970 25910 24675 gene locus_tag LOCUS_02980 gene argJ 25910 24675 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_02980 27044 26007 gene locus_tag LOCUS_02990 gene argC 27044 26007 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_02990 29699 27198 gene locus_tag LOCUS_03000 gene pheT 29699 27198 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_03000 30854 29793 gene locus_tag LOCUS_03010 gene pheS 30854 29793 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_03010 31612 31211 gene locus_tag LOCUS_03020 31612 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 32118 31630 gene locus_tag LOCUS_03030 32118 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 32619 32263 gene locus_tag LOCUS_03040 gene rplT 32619 32263 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_03040 32890 32693 gene locus_tag LOCUS_03050 gene rpmI 32890 32693 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_03050 33563 32883 gene locus_tag LOCUS_03060 gene infC 33563 32883 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_03060 34817 34110 gene locus_tag LOCUS_03070 34817 34110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 35397 35215 gene locus_tag LOCUS_03080 35397 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35416 35847 gene locus_tag LOCUS_03090 35416 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence009 1595 510 gene locus_tag LOCUS_03100 gene cheB 1595 510 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_03100 3946 1607 gene locus_tag LOCUS_03110 3946 1607 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_03110 5200 3971 gene locus_tag LOCUS_03120 5200 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5793 5212 gene locus_tag LOCUS_03130 gene cheW 5793 5212 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367343.1 protein_id gnl|my_center|LOCUS_03130 6287 5772 gene locus_tag LOCUS_03140 6287 5772 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072185.1 protein_id gnl|my_center|LOCUS_03140 8359 6284 gene locus_tag LOCUS_03150 8359 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 8754 8374 gene locus_tag LOCUS_03160 8754 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10281 8812 gene locus_tag LOCUS_03170 10281 8812 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_03170 9781 9690 gene locus_tag LOCUS_t00060 9781 9690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11068 10298 gene locus_tag LOCUS_03180 11068 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 12071 11211 gene locus_tag LOCUS_03190 12071 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12426 12058 gene locus_tag LOCUS_03200 12426 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12812 12459 gene locus_tag LOCUS_tm00010 12812 12459 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13486 13010 gene locus_tag LOCUS_03210 gene smpB 13486 13010 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_03210 14559 13495 gene locus_tag LOCUS_03220 14559 13495 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_03220 16747 14687 gene locus_tag LOCUS_03230 gene rnr 16747 14687 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_03230 17054 17479 gene locus_tag LOCUS_03240 17054 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 18169 17489 gene locus_tag LOCUS_03250 18169 17489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_03250 19505 18300 gene locus_tag LOCUS_03260 19505 18300 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_03260 20527 19613 gene locus_tag LOCUS_03270 gene ftsX 20527 19613 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_03270 21203 20517 gene locus_tag LOCUS_03280 gene ftsE 21203 20517 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_03280 22346 21420 gene locus_tag LOCUS_03290 22346 21420 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_03290 23239 22343 gene locus_tag LOCUS_03300 23239 22343 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03300 24084 23311 gene locus_tag LOCUS_03310 24084 23311 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393968.1 protein_id gnl|my_center|LOCUS_03310 25318 24089 gene locus_tag LOCUS_03320 gene prfB 25318 24089 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_03320 28106 25326 gene locus_tag LOCUS_03330 gene secA 28106 25326 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_03330 28624 28103 gene locus_tag LOCUS_03340 28624 28103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 30200 28626 gene locus_tag LOCUS_03350 30200 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 32344 32069 gene locus_tag LOCUS_03360 32344 32069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 33078 32581 gene locus_tag LOCUS_03370 33078 32581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 33161 33565 gene locus_tag LOCUS_03380 33161 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 34991 33678 gene locus_tag LOCUS_03390 34991 33678 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence010 1287 1715 gene locus_tag LOCUS_03400 1287 1715 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_03400 2194 1712 gene locus_tag LOCUS_03410 2194 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4431 2191 gene locus_tag LOCUS_03420 4431 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4949 4518 gene locus_tag LOCUS_03430 gene arr 4949 4518 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_03430 5292 5216 gene locus_tag LOCUS_t00070 5292 5216 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5612 6841 gene locus_tag LOCUS_03440 5612 6841 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_03440 6881 8323 gene locus_tag LOCUS_03450 6881 8323 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_03450 8323 9663 gene locus_tag LOCUS_03460 8323 9663 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_03460 9672 10565 gene locus_tag LOCUS_03470 9672 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10854 10549 gene locus_tag LOCUS_03480 10854 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11530 10880 gene locus_tag LOCUS_03490 11530 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 12905 11523 gene locus_tag LOCUS_03500 gene gltA 12905 11523 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_03500 13843 13004 gene locus_tag LOCUS_03510 13843 13004 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_03510 14057 15259 gene locus_tag LOCUS_03520 14057 15259 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_03520 15980 15354 gene locus_tag LOCUS_03530 gene pth 15980 15354 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_03530 16700 16065 gene locus_tag LOCUS_03540 16700 16065 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 protein_id gnl|my_center|LOCUS_03540 17779 16820 gene locus_tag LOCUS_03550 17779 16820 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_03550 19243 17864 gene locus_tag LOCUS_03560 gene glmU 19243 17864 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_03560 19365 19292 gene locus_tag LOCUS_t00080 19365 19292 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19853 19548 gene locus_tag LOCUS_03570 gene spoVG 19853 19548 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722725.1 protein_id gnl|my_center|LOCUS_03570 20684 19914 gene locus_tag LOCUS_03580 20684 19914 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227758.1 protein_id gnl|my_center|LOCUS_03580 21475 20681 gene locus_tag LOCUS_03590 21475 20681 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 protein_id gnl|my_center|LOCUS_03590 21940 21659 gene locus_tag LOCUS_03600 21940 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 23025 21997 gene locus_tag LOCUS_03610 gene rsmA 23025 21997 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468995.1 protein_id gnl|my_center|LOCUS_03610 24071 22986 gene locus_tag LOCUS_03620 24071 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 25279 24410 gene locus_tag LOCUS_03630 25279 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 30506 25290 gene locus_tag LOCUS_03640 30506 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 31734 31093 gene locus_tag LOCUS_03650 31734 31093 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_03650 32678 31731 gene locus_tag LOCUS_03660 32678 31731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 34252 32675 gene locus_tag LOCUS_03670 gene metG 34252 32675 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence011 1443 523 gene locus_tag LOCUS_03680 1443 523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_03680 1848 1447 gene locus_tag LOCUS_03690 1848 1447 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_03690 2614 2147 gene locus_tag LOCUS_03700 2614 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3345 2611 gene locus_tag LOCUS_03710 3345 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3578 3327 gene locus_tag LOCUS_03720 3578 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4917 3952 gene locus_tag LOCUS_03730 4917 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 5583 7964 gene locus_tag LOCUS_03740 5583 7964 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_03740 8051 8629 gene locus_tag LOCUS_03750 gene dcd 8051 8629 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_03750 9533 8697 gene locus_tag LOCUS_03760 9533 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10764 9733 gene locus_tag LOCUS_03770 10764 9733 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945122.1 protein_id gnl|my_center|LOCUS_03770 11013 11264 gene locus_tag LOCUS_03780 11013 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 12824 11436 gene locus_tag LOCUS_03790 12824 11436 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_03790 13386 13832 gene locus_tag LOCUS_03800 13386 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14053 14625 gene locus_tag LOCUS_03810 14053 14625 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_03810 14641 15585 gene locus_tag LOCUS_03820 gene lgt 14641 15585 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_03820 15664 16701 gene locus_tag LOCUS_03830 15664 16701 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_03830 16758 17654 gene locus_tag LOCUS_03840 gene pdxS 16758 17654 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_03840 17667 18260 gene locus_tag LOCUS_03850 gene pdxT 17667 18260 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_03850 18273 19028 gene locus_tag LOCUS_03860 18273 19028 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 protein_id gnl|my_center|LOCUS_03860 19038 19541 gene locus_tag LOCUS_03870 gene ruvC 19038 19541 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_03870 19534 20202 gene locus_tag LOCUS_03880 gene ruvA 19534 20202 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_03880 20199 21278 gene locus_tag LOCUS_03890 gene ruvB 20199 21278 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_03890 21580 21783 gene locus_tag LOCUS_03900 gene cspC 21580 21783 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 protein_id gnl|my_center|LOCUS_03900 22213 22569 gene locus_tag LOCUS_03910 22213 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 22966 22616 gene locus_tag LOCUS_03920 22966 22616 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_03920 23097 23939 gene locus_tag LOCUS_03930 gene folD 23097 23939 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03930 24026 24607 gene locus_tag LOCUS_03940 24026 24607 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_03940 24634 25716 gene locus_tag LOCUS_03950 gene queA 24634 25716 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_03950 26873 25710 gene locus_tag LOCUS_03960 26873 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 27436 26870 gene locus_tag LOCUS_03970 gene rpoE 27436 26870 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_03970 27694 28740 gene locus_tag LOCUS_03980 gene tgt 27694 28740 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_03980 28960 29715 gene locus_tag LOCUS_03990 28960 29715 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_03990 29959 30318 gene locus_tag LOCUS_04000 29959 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 30420 31736 gene locus_tag LOCUS_04010 gene secD 30420 31736 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869961.1 protein_id gnl|my_center|LOCUS_04010 31729 32637 gene locus_tag LOCUS_04020 gene secF 31729 32637 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence012 1235 495 gene locus_tag LOCUS_04030 1235 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3037 1271 gene locus_tag LOCUS_04040 3037 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3876 3034 gene locus_tag LOCUS_04050 gene cobI 3876 3034 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461549.1 protein_id gnl|my_center|LOCUS_04050 4679 3873 gene locus_tag LOCUS_04060 gene cbiT 4679 3873 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_04060 6832 4676 gene locus_tag LOCUS_04070 6832 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 7922 6837 gene locus_tag LOCUS_04080 7922 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9435 7912 gene locus_tag LOCUS_04090 9435 7912 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_04090 10362 9868 gene locus_tag LOCUS_04100 10362 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 11161 10352 gene locus_tag LOCUS_04110 11161 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 11368 11293 gene locus_tag LOCUS_t00090 11368 11293 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11671 12267 gene locus_tag LOCUS_04120 gene pyrE 11671 12267 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_04120 12971 12264 gene locus_tag LOCUS_04130 12971 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 13483 13408 gene locus_tag LOCUS_t00100 13483 13408 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14579 13722 gene locus_tag LOCUS_04140 14579 13722 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_04140 14982 14566 gene locus_tag LOCUS_04150 14982 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 14887 15078 gene locus_tag LOCUS_04160 14887 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15318 15139 gene locus_tag LOCUS_04170 15318 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 15263 15472 gene locus_tag LOCUS_04180 15263 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 15469 15882 gene locus_tag LOCUS_04190 15469 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 17552 15927 gene locus_tag LOCUS_04200 gene purH 17552 15927 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817232.1 protein_id gnl|my_center|LOCUS_04200 19002 17833 gene locus_tag LOCUS_04210 19002 17833 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 protein_id gnl|my_center|LOCUS_04210 19858 19208 gene locus_tag LOCUS_04220 gene purN 19858 19208 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_04220 20952 19855 gene locus_tag LOCUS_04230 gene purM 20952 19855 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_04230 26084 21390 gene locus_tag LOCUS_04240 26084 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 26366 26803 gene locus_tag LOCUS_04250 26366 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 28506 27073 gene locus_tag LOCUS_04260 gene purF 28506 27073 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_04260 30896 28506 gene locus_tag LOCUS_04270 gene purL 30896 28506 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_04270 31606 30911 gene locus_tag LOCUS_04280 gene purQ 31606 30911 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733240.1 protein_id gnl|my_center|LOCUS_04280 31846 31619 gene locus_tag LOCUS_04290 gene purS 31846 31619 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 protein_id gnl|my_center|LOCUS_04290 32255 31851 gene locus_tag LOCUS_04300 32255 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 33148 32258 gene locus_tag LOCUS_04310 33148 32258 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence013 <1 1313 gene locus_tag LOCUS_04320 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272539.1:cell wall-binding repeat-containing protein 2825 1449 gene locus_tag LOCUS_04330 2825 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2940 3128 gene locus_tag LOCUS_04340 2940 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3349 4029 gene locus_tag LOCUS_04350 3349 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4057 4131 gene locus_tag LOCUS_t00110 4057 4131 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4243 5043 gene locus_tag LOCUS_04360 4243 5043 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987086.1 protein_id gnl|my_center|LOCUS_04360 5941 5072 gene locus_tag LOCUS_04370 5941 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6063 6677 gene locus_tag LOCUS_04380 6063 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6888 6964 gene locus_tag LOCUS_t00120 6888 6964 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7059 7214 gene locus_tag LOCUS_04390 7059 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7447 8022 gene locus_tag LOCUS_04400 7447 8022 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_04400 8123 9784 gene locus_tag LOCUS_04410 8123 9784 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_04410 10100 10600 gene locus_tag LOCUS_04420 10100 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10588 10830 gene locus_tag LOCUS_04430 10588 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 11806 10988 gene locus_tag LOCUS_04440 11806 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 11978 13384 gene locus_tag LOCUS_04450 11978 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13445 13520 gene locus_tag LOCUS_t00130 13445 13520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14280 15050 gene locus_tag LOCUS_04460 14280 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15172 16035 gene locus_tag LOCUS_04470 15172 16035 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_04470 16218 20507 gene locus_tag LOCUS_04480 16218 20507 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_04480 20608 21729 gene locus_tag LOCUS_04490 20608 21729 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_04490 21726 23030 gene locus_tag LOCUS_04500 21726 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 24642 23128 gene locus_tag LOCUS_04510 24642 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 26587 24635 gene locus_tag LOCUS_04520 26587 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 27103 28032 gene locus_tag LOCUS_04530 27103 28032 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_04530 28164 29360 gene locus_tag LOCUS_04540 28164 29360 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_04540 29467 30501 gene locus_tag LOCUS_04550 29467 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 30568 31677 gene locus_tag LOCUS_04560 30568 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence014 2102 924 gene locus_tag LOCUS_04570 gene murG 2102 924 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_04570 3285 2017 gene locus_tag LOCUS_04580 gene ftsW 3285 2017 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04580 4973 3282 gene locus_tag LOCUS_04590 gene murD 4973 3282 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_04590 6043 4982 gene locus_tag LOCUS_04600 gene mraY 6043 4982 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_04600 7559 6033 gene locus_tag LOCUS_04610 7559 6033 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272489.1 protein_id gnl|my_center|LOCUS_04610 9010 7553 gene locus_tag LOCUS_04620 9010 7553 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04620 10722 9010 gene locus_tag LOCUS_04630 10722 9010 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_04630 11434 10787 gene locus_tag LOCUS_04640 11434 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12557 11580 gene locus_tag LOCUS_04650 gene rsmH 12557 11580 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_04650 13035 12595 gene locus_tag LOCUS_04660 gene mraZ 13035 12595 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_04660 13723 14781 gene locus_tag LOCUS_04670 13723 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15278 15015 gene locus_tag LOCUS_04680 15278 15015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 15649 15401 gene locus_tag LOCUS_04690 15649 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 16594 15674 gene locus_tag LOCUS_04700 gene xerD 16594 15674 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_04700 17709 16591 gene locus_tag LOCUS_04710 gene ald 17709 16591 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_04710 18936 17800 gene locus_tag LOCUS_04720 18936 17800 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_04720 20075 18933 gene locus_tag LOCUS_04730 20075 18933 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_04730 21769 20075 gene locus_tag LOCUS_04740 21769 20075 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_04740 22740 21778 gene locus_tag LOCUS_04750 22740 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 25181 22737 gene locus_tag LOCUS_04760 25181 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860624.1 protein_id gnl|my_center|LOCUS_04760 26624 25326 gene locus_tag LOCUS_04770 26624 25326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_04770 27015 28577 gene locus_tag LOCUS_04780 gene murJ 27015 28577 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_04780 28580 29257 gene locus_tag LOCUS_04790 28580 29257 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_04790 30361 29312 gene locus_tag LOCUS_04800 30361 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 30654 30427 gene locus_tag LOCUS_04810 30654 30427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 30541 30906 gene locus_tag LOCUS_04820 30541 30906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 32058 31174 gene locus_tag LOCUS_04830 32058 31174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence015 <1 752 gene locus_tag LOCUS_04840 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272539.1:cell wall-binding repeat-containing protein 1075 2076 gene locus_tag LOCUS_04850 gene glyQ 1075 2076 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_04850 2073 4268 gene locus_tag LOCUS_04860 gene glyS 2073 4268 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_04860 4270 5091 gene locus_tag LOCUS_04870 4270 5091 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_04870 5151 7883 gene locus_tag LOCUS_04880 gene ppdK 5151 7883 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_04880 7870 8916 gene locus_tag LOCUS_04890 7870 8916 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_04890 9142 11331 gene locus_tag LOCUS_04900 9142 11331 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_04900 11461 13383 gene locus_tag LOCUS_04910 gene dnaG 11461 13383 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_04910 13373 14821 gene locus_tag LOCUS_04920 gene rpoD 13373 14821 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_04920 14838 15950 gene locus_tag LOCUS_04930 14838 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 16243 18918 gene locus_tag LOCUS_04940 gene mgtA 16243 18918 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_04940 19113 19038 gene locus_tag LOCUS_t00140 19113 19038 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 19410 19484 gene locus_tag LOCUS_t00150 19410 19484 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19639 20472 gene locus_tag LOCUS_04950 19639 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 20511 22538 gene locus_tag LOCUS_04960 20511 22538 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_04960 22872 23240 gene locus_tag LOCUS_04970 22872 23240 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_04970 23228 23872 gene locus_tag LOCUS_04980 23228 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 23869 24336 gene locus_tag LOCUS_04990 23869 24336 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 protein_id gnl|my_center|LOCUS_04990 24336 25445 gene locus_tag LOCUS_05000 24336 25445 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392495.1 protein_id gnl|my_center|LOCUS_05000 25442 26389 gene locus_tag LOCUS_05010 gene nuoH 25442 26389 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_05010 26386 28485 gene locus_tag LOCUS_05020 26386 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 28478 28984 gene locus_tag LOCUS_05030 28478 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 28981 29361 gene locus_tag LOCUS_05040 28981 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 29358 31364 gene locus_tag LOCUS_05050 29358 31364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence016 537 133 gene locus_tag LOCUS_05060 537 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1085 1390 gene locus_tag LOCUS_05070 1085 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1411 2550 gene locus_tag LOCUS_05080 1411 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2615 2929 gene locus_tag LOCUS_05090 2615 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3626 2940 gene locus_tag LOCUS_05100 3626 2940 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813521.1 protein_id gnl|my_center|LOCUS_05100 4333 3623 gene locus_tag LOCUS_05110 4333 3623 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461724.1 protein_id gnl|my_center|LOCUS_05110 5213 4371 gene locus_tag LOCUS_05120 5213 4371 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461725.1 protein_id gnl|my_center|LOCUS_05120 6146 5421 gene locus_tag LOCUS_05130 6146 5421 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943166.1 protein_id gnl|my_center|LOCUS_05130 7350 6481 gene locus_tag LOCUS_05140 7350 6481 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_05140 8167 7499 gene locus_tag LOCUS_05150 8167 7499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_05150 8906 8160 gene locus_tag LOCUS_05160 8906 8160 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115441.1 protein_id gnl|my_center|LOCUS_05160 9030 10079 gene locus_tag LOCUS_05170 9030 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11031 10147 gene locus_tag LOCUS_05180 11031 10147 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460249.1 protein_id gnl|my_center|LOCUS_05180 11574 11122 gene locus_tag LOCUS_05190 11574 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 11922 11662 gene locus_tag LOCUS_05200 11922 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 12153 13400 gene locus_tag LOCUS_05210 12153 13400 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_05210 14591 13554 gene locus_tag LOCUS_05220 14591 13554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_05220 14791 15267 gene locus_tag LOCUS_05230 14791 15267 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_05230 16376 15264 gene locus_tag LOCUS_05240 16376 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 16835 16443 gene locus_tag LOCUS_05250 16835 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 17927 16851 gene locus_tag LOCUS_05260 17927 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132415.1 protein_id gnl|my_center|LOCUS_05260 19283 17955 gene locus_tag LOCUS_05270 19283 17955 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_05270 19962 19459 gene locus_tag LOCUS_05280 19962 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 21275 19959 gene locus_tag LOCUS_05290 21275 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 21532 21771 gene locus_tag LOCUS_05300 21532 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 21935 22093 gene locus_tag LOCUS_05310 21935 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 23244 22192 gene locus_tag LOCUS_05320 gene pgoN 23244 22192 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_05320 24025 23267 gene locus_tag LOCUS_05330 24025 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 25145 24273 gene locus_tag LOCUS_05340 gene hisG 25145 24273 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_05340 25674 25294 gene locus_tag LOCUS_05350 25674 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 26154 26738 gene locus_tag LOCUS_05360 26154 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 27080 28021 gene locus_tag LOCUS_05370 27080 28021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_05370 29764 29420 gene locus_tag LOCUS_05380 29764 29420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130296.1 protein_id gnl|my_center|LOCUS_05380 29968 30204 gene locus_tag LOCUS_05390 29968 30204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence017 2276 1608 gene locus_tag LOCUS_05400 2276 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 3317 2379 gene locus_tag LOCUS_05410 3317 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 4458 3331 gene locus_tag LOCUS_05420 gene steA 4458 3331 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_05420 6297 4459 gene locus_tag LOCUS_05430 gene recN 6297 4459 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_05430 7167 6301 gene locus_tag LOCUS_05440 7167 6301 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_05440 7951 7157 gene locus_tag LOCUS_05450 7951 7157 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_05450 9950 7959 gene locus_tag LOCUS_05460 gene dxs 9950 7959 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_05460 10320 9940 gene locus_tag LOCUS_05470 10320 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 10671 10327 gene locus_tag LOCUS_05480 10671 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 11093 10743 gene locus_tag LOCUS_05490 11093 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 12490 11123 gene locus_tag LOCUS_05500 gene accC 12490 11123 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_05500 14352 12487 gene locus_tag LOCUS_05510 gene accB 14352 12487 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272421.1 protein_id gnl|my_center|LOCUS_05510 15176 14616 gene locus_tag LOCUS_05520 gene efp 15176 14616 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_05520 16435 15206 gene locus_tag LOCUS_05530 16435 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 16887 16432 gene locus_tag LOCUS_05540 gene aroQ 16887 16432 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 protein_id gnl|my_center|LOCUS_05540 18086 16884 gene locus_tag LOCUS_05550 gene aroB 18086 16884 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_05550 18670 18083 gene locus_tag LOCUS_05560 gene aroK 18670 18083 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266378.1 protein_id gnl|my_center|LOCUS_05560 19838 18684 gene locus_tag LOCUS_05570 gene aroC 19838 18684 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_05570 20953 20192 gene locus_tag LOCUS_05580 20953 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21626 20961 gene locus_tag LOCUS_05590 21626 20961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 22306 21641 gene locus_tag LOCUS_05600 22306 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 23445 22309 gene locus_tag LOCUS_05610 gene pilM 23445 22309 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_05610 24819 23560 gene locus_tag LOCUS_05620 24819 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 25468 24812 gene locus_tag LOCUS_05630 25468 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 27069 25462 gene locus_tag LOCUS_05640 27069 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 27884 27309 gene locus_tag LOCUS_05650 27884 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 28731 28324 gene locus_tag LOCUS_05660 28731 28324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 30101 28893 gene locus_tag LOCUS_05670 30101 28893 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05670 <31719 30143 gene locus_tag LOCUS_05680 <31719 30143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942137.1:type IV-A pilus assembly ATPase PilB >Feature sequence018 531 1415 gene locus_tag LOCUS_05690 gene galU 531 1415 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_05690 1420 3021 gene locus_tag LOCUS_05700 1420 3021 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189311.1 protein_id gnl|my_center|LOCUS_05700 3018 4208 gene locus_tag LOCUS_05710 gene wecB 3018 4208 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_05710 4205 6211 gene locus_tag LOCUS_05720 4205 6211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_05720 6208 7383 gene locus_tag LOCUS_05730 6208 7383 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258119.1 protein_id gnl|my_center|LOCUS_05730 7517 8656 gene locus_tag LOCUS_05740 gene wecB 7517 8656 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_05740 9613 8660 gene locus_tag LOCUS_05750 9613 8660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_05750 9987 12296 gene locus_tag LOCUS_05760 9987 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 12575 14077 gene locus_tag LOCUS_05770 12575 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 14390 14208 gene locus_tag LOCUS_05780 14390 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14311 15786 gene locus_tag LOCUS_05790 14311 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16048 17400 gene locus_tag LOCUS_05800 16048 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 18776 17577 gene locus_tag LOCUS_05810 18776 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 18960 20441 gene locus_tag LOCUS_05820 18960 20441 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_05820 20580 21722 gene locus_tag LOCUS_05830 20580 21722 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_05830 22064 29539 gene locus_tag LOCUS_05840 22064 29539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 30141 30479 gene locus_tag LOCUS_05850 30141 30479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 30577 31050 gene locus_tag LOCUS_05860 30577 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05860 >Feature sequence019 133 1665 gene locus_tag LOCUS_05870 gene istA 133 1665 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_05870 1777 2397 gene locus_tag LOCUS_05880 gene istB 1777 2397 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 2980 2477 gene locus_tag LOCUS_05890 2980 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2979 3209 gene locus_tag LOCUS_05900 2979 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3119 5047 gene locus_tag LOCUS_05910 3119 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6162 5803 gene locus_tag LOCUS_05920 6162 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7323 6304 gene locus_tag LOCUS_05930 7323 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7439 7741 gene locus_tag LOCUS_05940 7439 7741 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_05940 7827 8018 gene locus_tag LOCUS_05950 7827 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 8884 11628 gene locus_tag LOCUS_05960 gene polA 8884 11628 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805099.1 protein_id gnl|my_center|LOCUS_05960 11746 12429 gene locus_tag LOCUS_05970 11746 12429 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_05970 12620 14047 gene locus_tag LOCUS_05980 12620 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 14328 16175 gene locus_tag LOCUS_05990 14328 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16486 17154 gene locus_tag LOCUS_06000 16486 17154 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_06000 17215 17964 gene locus_tag LOCUS_06010 17215 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17967 18704 gene locus_tag LOCUS_06020 17967 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 18697 20769 gene locus_tag LOCUS_06030 gene uvrB 18697 20769 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_06030 21098 25504 gene locus_tag LOCUS_06040 21098 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 28031 25647 gene locus_tag LOCUS_06050 28031 25647 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_06050 29154 28036 gene locus_tag LOCUS_06060 29154 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 30645 29392 gene locus_tag LOCUS_06070 30645 29392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence020 1400 615 gene locus_tag LOCUS_06080 1400 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2299 1778 gene locus_tag LOCUS_06090 2299 1778 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 protein_id gnl|my_center|LOCUS_06090 2835 2296 gene locus_tag LOCUS_06100 2835 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2818 3114 gene locus_tag LOCUS_06110 2818 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4604 3123 gene locus_tag LOCUS_06120 gene cysS 4604 3123 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_06120 5413 4694 gene locus_tag LOCUS_06130 gene cysE 5413 4694 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_06130 5918 5427 gene locus_tag LOCUS_06140 gene ispF 5918 5427 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_06140 6634 5915 gene locus_tag LOCUS_06150 gene ispD 6634 5915 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_06150 7714 6644 gene locus_tag LOCUS_06160 7714 6644 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143079.1 protein_id gnl|my_center|LOCUS_06160 9059 7971 gene locus_tag LOCUS_06170 gene disA 9059 7971 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_06170 10375 9059 gene locus_tag LOCUS_06180 gene radA 10375 9059 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085219.1 protein_id gnl|my_center|LOCUS_06180 13072 10478 gene locus_tag LOCUS_06190 13072 10478 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284160.1 protein_id gnl|my_center|LOCUS_06190 14738 13281 gene locus_tag LOCUS_06200 gene lysS 14738 13281 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_06200 15271 14795 gene locus_tag LOCUS_06210 gene greA 15271 14795 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_06210 15811 15551 gene locus_tag LOCUS_06220 15811 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16277 16017 gene locus_tag LOCUS_06230 16277 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 17271 16474 gene locus_tag LOCUS_06240 17271 16474 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_06240 18446 17427 gene locus_tag LOCUS_06250 18446 17427 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_06250 18725 19279 gene locus_tag LOCUS_06260 18725 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 20125 19424 gene locus_tag LOCUS_06270 20125 19424 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258017.1 protein_id gnl|my_center|LOCUS_06270 20264 20188 gene locus_tag LOCUS_t00160 20264 20188 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21450 20437 gene locus_tag LOCUS_06280 21450 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 24124 21605 gene locus_tag LOCUS_06290 24124 21605 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839674.1 protein_id gnl|my_center|LOCUS_06290 24450 24238 gene locus_tag LOCUS_06300 24450 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 25325 24477 gene locus_tag LOCUS_06310 25325 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 25539 25387 gene locus_tag LOCUS_06320 25539 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 26681 25911 gene locus_tag LOCUS_06330 26681 25911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 27575 26835 gene locus_tag LOCUS_06340 27575 26835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 28176 27925 gene locus_tag LOCUS_06350 28176 27925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 29202 28960 gene locus_tag LOCUS_06360 29202 28960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 29338 30021 gene locus_tag LOCUS_06370 29338 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 30273 30079 gene locus_tag LOCUS_06380 30273 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence021 1054 269 gene locus_tag LOCUS_06390 1054 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1404 1054 gene locus_tag LOCUS_06400 1404 1054 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_06400 2446 1613 gene locus_tag LOCUS_06410 2446 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3279 2443 gene locus_tag LOCUS_06420 3279 2443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860754.1 protein_id gnl|my_center|LOCUS_06420 4168 3281 gene locus_tag LOCUS_06430 4168 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4497 4105 gene locus_tag LOCUS_06440 4497 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5268 4705 gene locus_tag LOCUS_06450 5268 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5551 7218 gene locus_tag LOCUS_06460 5551 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8312 7224 gene locus_tag LOCUS_06470 8312 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 9307 8315 gene locus_tag LOCUS_06480 9307 8315 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_06480 9665 9300 gene locus_tag LOCUS_06490 9665 9300 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_06490 10327 11523 gene locus_tag LOCUS_06500 10327 11523 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_06500 11532 12461 gene locus_tag LOCUS_06510 gene cysK 11532 12461 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_06510 12960 12550 gene locus_tag LOCUS_06520 12960 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 25193 13350 gene locus_tag LOCUS_06530 25193 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 25570 26013 gene locus_tag LOCUS_06540 25570 26013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 27794 25980 gene locus_tag LOCUS_06550 gene typA 27794 25980 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_06550 <28531 27806 gene locus_tag LOCUS_06560 <28531 27806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729048.1:DMT family transporter >Feature sequence022 1415 363 gene locus_tag LOCUS_06570 1415 363 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_06570 2425 1415 gene locus_tag LOCUS_06580 2425 1415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_06580 3380 2427 gene locus_tag LOCUS_06590 3380 2427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_06590 4398 3388 gene locus_tag LOCUS_06600 4398 3388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583497.1 protein_id gnl|my_center|LOCUS_06600 6102 4402 gene locus_tag LOCUS_06610 6102 4402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_06610 6637 6392 gene locus_tag LOCUS_06620 6637 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 8366 6768 gene locus_tag LOCUS_06630 gene gpmI 8366 6768 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_06630 9139 8363 gene locus_tag LOCUS_06640 gene tpiA 9139 8363 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_06640 10336 9143 gene locus_tag LOCUS_06650 10336 9143 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_06650 11350 10346 gene locus_tag LOCUS_06660 gene gap 11350 10346 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_06660 12412 11477 gene locus_tag LOCUS_06670 gene whiA 12412 11477 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_06670 13539 12412 gene locus_tag LOCUS_06680 13539 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 14453 13542 gene locus_tag LOCUS_06690 gene rapZ 14453 13542 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138459.1 protein_id gnl|my_center|LOCUS_06690 15090 14578 gene locus_tag LOCUS_06700 15090 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 17005 15092 gene locus_tag LOCUS_06710 gene uvrC 17005 15092 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_06710 20033 17085 gene locus_tag LOCUS_06720 gene uvrA 20033 17085 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_06720 20452 20264 gene locus_tag LOCUS_06730 20452 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 20606 21484 gene locus_tag LOCUS_06740 gene larE 20606 21484 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_06740 22482 21502 gene locus_tag LOCUS_06750 22482 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 23096 22605 gene locus_tag LOCUS_06760 23096 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 23836 23189 gene locus_tag LOCUS_06770 23836 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 <28179 23983 gene locus_tag LOCUS_06780 <28179 23983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158208138.1:DNRLRE domain-containing protein >Feature sequence023 347 703 gene locus_tag LOCUS_06790 347 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 895 2667 gene locus_tag LOCUS_06800 895 2667 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_06800 2664 2990 gene locus_tag LOCUS_06810 2664 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3047 3625 gene locus_tag LOCUS_06820 3047 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3622 4719 gene locus_tag LOCUS_06830 3622 4719 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 protein_id gnl|my_center|LOCUS_06830 4712 5044 gene locus_tag LOCUS_06840 4712 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5045 6805 gene locus_tag LOCUS_06850 5045 6805 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228560.1 protein_id gnl|my_center|LOCUS_06850 6810 8252 gene locus_tag LOCUS_06860 6810 8252 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_06860 8265 8912 gene locus_tag LOCUS_06870 8265 8912 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 protein_id gnl|my_center|LOCUS_06870 8912 9853 gene locus_tag LOCUS_06880 8912 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10307 9936 gene locus_tag LOCUS_06890 10307 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10522 11037 gene locus_tag LOCUS_06900 10522 11037 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_06900 11311 12126 gene locus_tag LOCUS_06910 11311 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 12126 12758 gene locus_tag LOCUS_06920 12126 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 12755 15355 gene locus_tag LOCUS_06930 12755 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15646 15957 gene locus_tag LOCUS_06940 15646 15957 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918611.1 protein_id gnl|my_center|LOCUS_06940 15986 16486 gene locus_tag LOCUS_06950 15986 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16604 18964 gene locus_tag LOCUS_06960 16604 18964 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_06960 18977 19714 gene locus_tag LOCUS_06970 gene cas5c 18977 19714 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_06970 19716 21749 gene locus_tag LOCUS_06980 19716 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 21730 22581 gene locus_tag LOCUS_06990 gene cas7c 21730 22581 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_06990 23908 24285 gene locus_tag LOCUS_07000 23908 24285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24290 24580 gene locus_tag LOCUS_07010 gene cas2 24290 24580 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_07010 24751 27475 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccgcgtggggagcgtggattgaaat >Feature sequence024 1122 1037 gene locus_tag LOCUS_t00170 1122 1037 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2429 1275 gene locus_tag LOCUS_07020 2429 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4973 2649 gene locus_tag LOCUS_07030 4973 2649 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_07030 5293 7143 gene locus_tag LOCUS_07040 5293 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7167 8063 gene locus_tag LOCUS_07050 7167 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 8060 8476 gene locus_tag LOCUS_07060 8060 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8473 9780 gene locus_tag LOCUS_07070 8473 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9781 12531 gene locus_tag LOCUS_07080 9781 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 12615 14477 gene locus_tag LOCUS_07090 gene pknB 12615 14477 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_07090 16072 14498 gene locus_tag LOCUS_07100 16072 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 17892 16141 gene locus_tag LOCUS_07110 17892 16141 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_07110 18499 17900 gene locus_tag LOCUS_07120 18499 17900 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_07120 18698 19450 gene locus_tag LOCUS_07130 18698 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_07130 19555 19770 gene locus_tag LOCUS_07140 19555 19770 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_07140 19777 20982 gene locus_tag LOCUS_07150 19777 20982 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_07150 20979 21824 gene locus_tag LOCUS_07160 20979 21824 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_07160 21817 22353 gene locus_tag LOCUS_07170 21817 22353 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_07170 22354 23349 gene locus_tag LOCUS_07180 22354 23349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 23404 23952 gene locus_tag LOCUS_07190 23404 23952 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_07190 24046 25719 gene locus_tag LOCUS_07200 24046 25719 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_07200 <27457 25735 gene locus_tag LOCUS_07210 <27457 25735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694526.1:type I restriction endonuclease subunit R >Feature sequence025 693 310 gene locus_tag LOCUS_07220 693 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2277 1747 gene locus_tag LOCUS_07230 2277 1747 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_07230 4546 2294 gene locus_tag LOCUS_07240 4546 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6504 4801 gene locus_tag LOCUS_07250 6504 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 7547 6567 gene locus_tag LOCUS_07260 gene aroE 7547 6567 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_07260 8038 7544 gene locus_tag LOCUS_07270 8038 7544 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_07270 8743 8039 gene locus_tag LOCUS_07280 8743 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9486 8740 gene locus_tag LOCUS_07290 9486 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10508 9483 gene locus_tag LOCUS_07300 10508 9483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_07300 11521 10508 gene locus_tag LOCUS_07310 gene mltG 11521 10508 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_07310 12174 11665 gene locus_tag LOCUS_07320 gene ruvX 12174 11665 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07320 14881 12260 gene locus_tag LOCUS_07330 gene alaS 14881 12260 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869780.1 protein_id gnl|my_center|LOCUS_07330 16182 14878 gene locus_tag LOCUS_07340 16182 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 17725 16370 gene locus_tag LOCUS_07350 17725 16370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_07350 18435 17743 gene locus_tag LOCUS_07360 18435 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 20471 18702 gene locus_tag LOCUS_07370 gene aspS 20471 18702 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_07370 21916 20639 gene locus_tag LOCUS_07380 gene hisS 21916 20639 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_07380 22716 22009 gene locus_tag LOCUS_07390 22716 22009 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_07390 24935 22716 gene locus_tag LOCUS_07400 24935 22716 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_07400 27008 25032 gene locus_tag LOCUS_07410 27008 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence026 465 1163 gene locus_tag LOCUS_07420 465 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1217 3529 gene locus_tag LOCUS_07430 1217 3529 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_07430 3718 3814 gene locus_tag LOCUS_t00180 3718 3814 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3904 4413 gene locus_tag LOCUS_07440 3904 4413 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_07440 4654 5661 gene locus_tag LOCUS_07450 gene idsA 4654 5661 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_07450 7372 5756 gene locus_tag LOCUS_07460 7372 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8162 7482 gene locus_tag LOCUS_07470 gene cbiM 8162 7482 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339128.1 protein_id gnl|my_center|LOCUS_07470 8272 9213 gene locus_tag LOCUS_07480 8272 9213 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_07480 9265 9756 gene locus_tag LOCUS_07490 9265 9756 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817323.1 protein_id gnl|my_center|LOCUS_07490 9749 10933 gene locus_tag LOCUS_07500 9749 10933 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_07500 11115 12074 gene locus_tag LOCUS_07510 gene moaA 11115 12074 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_07510 12078 12740 gene locus_tag LOCUS_07520 gene moaC 12078 12740 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 protein_id gnl|my_center|LOCUS_07520 12740 14200 gene locus_tag LOCUS_07530 12740 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15500 14277 gene locus_tag LOCUS_07540 15500 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 16184 17011 gene locus_tag LOCUS_07550 16184 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 17260 18258 gene locus_tag LOCUS_07560 17260 18258 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_07560 18524 18874 gene locus_tag LOCUS_07570 18524 18874 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_07570 18867 19430 gene locus_tag LOCUS_07580 18867 19430 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_07580 19822 20925 gene locus_tag LOCUS_07590 19822 20925 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_07590 21138 22082 gene locus_tag LOCUS_07600 21138 22082 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_07600 22090 22407 gene locus_tag LOCUS_07610 22090 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 22863 22498 gene locus_tag LOCUS_07620 22863 22498 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460590.1 protein_id gnl|my_center|LOCUS_07620 23155 22853 gene locus_tag LOCUS_07630 23155 22853 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944888.1 protein_id gnl|my_center|LOCUS_07630 23124 23381 gene locus_tag LOCUS_07640 23124 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 23572 23342 gene locus_tag LOCUS_07650 23572 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 23721 24368 gene locus_tag LOCUS_07660 23721 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence027 <1 1845 gene locus_tag LOCUS_07670 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2069 1884 gene locus_tag LOCUS_07680 2069 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3017 2190 gene locus_tag LOCUS_07690 3017 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3614 3105 gene locus_tag LOCUS_07700 3614 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3736 4302 gene locus_tag LOCUS_07710 gene leuD 3736 4302 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_07710 4299 5483 gene locus_tag LOCUS_07720 gene leuB 4299 5483 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_07720 5548 5820 gene locus_tag LOCUS_07730 5548 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5817 6161 gene locus_tag LOCUS_07740 5817 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6237 6515 gene locus_tag LOCUS_07750 6237 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6481 7383 gene locus_tag LOCUS_07760 gene ilvE 6481 7383 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_07760 7501 9228 gene locus_tag LOCUS_07770 gene cimA 7501 9228 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_07770 9266 10027 gene locus_tag LOCUS_07780 9266 10027 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 protein_id gnl|my_center|LOCUS_07780 10275 12572 gene locus_tag LOCUS_07790 10275 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12635 12961 gene locus_tag LOCUS_07800 12635 12961 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_07800 13012 16485 gene locus_tag LOCUS_07810 13012 16485 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_07810 16825 18099 gene locus_tag LOCUS_07820 gene hisZ 16825 18099 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_07820 18101 18745 gene locus_tag LOCUS_07830 gene hisG 18101 18745 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393532.1 protein_id gnl|my_center|LOCUS_07830 18965 20368 gene locus_tag LOCUS_07840 gene hisD 18965 20368 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406995.1 protein_id gnl|my_center|LOCUS_07840 20372 21496 gene locus_tag LOCUS_07850 20372 21496 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_07850 21605 22171 gene locus_tag LOCUS_07860 gene hisB 21605 22171 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_07860 22168 22788 gene locus_tag LOCUS_07870 gene hisH 22168 22788 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_07870 22785 23519 gene locus_tag LOCUS_07880 gene hisA 22785 23519 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_07880 23525 24292 gene locus_tag LOCUS_07890 gene hisF 23525 24292 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_07890 24328 24762 gene locus_tag LOCUS_07900 24328 24762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 24749 25084 gene locus_tag LOCUS_07910 24749 25084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence028 <1 625 gene locus_tag LOCUS_07920 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029870.1:DNA helicase PcrA 638 2278 gene locus_tag LOCUS_07930 638 2278 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_07930 2564 4690 gene locus_tag LOCUS_07940 2564 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6017 4737 gene locus_tag LOCUS_07950 6017 4737 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_07950 6757 6014 gene locus_tag LOCUS_07960 6757 6014 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 protein_id gnl|my_center|LOCUS_07960 7023 7898 gene locus_tag LOCUS_07970 7023 7898 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_07970 7882 8793 gene locus_tag LOCUS_07980 gene pstC 7882 8793 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_07980 8790 9668 gene locus_tag LOCUS_07990 gene pstA 8790 9668 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_07990 9662 10648 gene locus_tag LOCUS_08000 gene pstB 9662 10648 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_08000 10683 11831 gene locus_tag LOCUS_08010 10683 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 13422 11908 gene locus_tag LOCUS_08020 13422 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 14996 13419 gene locus_tag LOCUS_08030 gene thrC 14996 13419 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101905.1 protein_id gnl|my_center|LOCUS_08030 15337 16563 gene locus_tag LOCUS_08040 15337 16563 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_08040 16959 17438 gene locus_tag LOCUS_08050 16959 17438 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_08050 17429 17875 gene locus_tag LOCUS_08060 17429 17875 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_08060 17944 20538 gene locus_tag LOCUS_08070 17944 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 20559 21299 gene locus_tag LOCUS_08080 20559 21299 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_08080 21296 22168 gene locus_tag LOCUS_08090 21296 22168 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence029 3443 273 gene locus_tag LOCUS_08100 3443 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3694 3984 gene locus_tag LOCUS_08110 3694 3984 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642340.1 protein_id gnl|my_center|LOCUS_08110 4186 4111 gene locus_tag LOCUS_t00190 4186 4111 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5136 4288 gene locus_tag LOCUS_08120 5136 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 6148 5138 gene locus_tag LOCUS_08130 gene hemC 6148 5138 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_08130 7602 6226 gene locus_tag LOCUS_08140 gene hemA 7602 6226 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_08140 8911 8051 gene locus_tag LOCUS_08150 8911 8051 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_08150 9708 8908 gene locus_tag LOCUS_08160 9708 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10548 9712 gene locus_tag LOCUS_08170 10548 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10744 10565 gene locus_tag LOCUS_08180 10744 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11576 10806 gene locus_tag LOCUS_08190 gene ccsA 11576 10806 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_08190 12406 11690 gene locus_tag LOCUS_08200 12406 11690 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_08200 13141 12410 gene locus_tag LOCUS_08210 13141 12410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_08210 15457 13157 gene locus_tag LOCUS_08220 15457 13157 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_08220 16159 15482 gene locus_tag LOCUS_08230 16159 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 17334 16414 gene locus_tag LOCUS_08240 17334 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_08240 17930 17304 gene locus_tag LOCUS_08250 17930 17304 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 protein_id gnl|my_center|LOCUS_08250 19006 18083 gene locus_tag LOCUS_08260 gene truA 19006 18083 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_08260 19794 19030 gene locus_tag LOCUS_08270 19794 19030 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_08270 20134 20874 gene locus_tag LOCUS_08280 20134 20874 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_08280 20885 21958 gene locus_tag LOCUS_08290 20885 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 22598 21927 gene locus_tag LOCUS_08300 22598 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 23027 23296 gene locus_tag LOCUS_08310 23027 23296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 23293 23523 gene locus_tag LOCUS_08320 23293 23523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 24602 23520 gene locus_tag LOCUS_08330 24602 23520 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence030 2563 896 gene locus_tag LOCUS_08340 2563 896 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 protein_id gnl|my_center|LOCUS_08340 3303 2560 gene locus_tag LOCUS_08350 3303 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4378 3296 gene locus_tag LOCUS_08360 4378 3296 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_08360 6565 4571 gene locus_tag LOCUS_08370 6565 4571 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868842.1 protein_id gnl|my_center|LOCUS_08370 6871 7713 gene locus_tag LOCUS_08380 6871 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 7926 8906 gene locus_tag LOCUS_08390 7926 8906 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668780.1 protein_id gnl|my_center|LOCUS_08390 9276 8920 gene locus_tag LOCUS_08400 9276 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08400 9686 9213 gene locus_tag LOCUS_08410 9686 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08410 9754 10044 gene locus_tag LOCUS_08420 9754 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 11465 10056 gene locus_tag LOCUS_08430 11465 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 12178 11462 gene locus_tag LOCUS_08440 12178 11462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_08440 12531 12887 gene locus_tag LOCUS_08450 12531 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 13132 13590 gene locus_tag LOCUS_08460 13132 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 13562 14494 gene locus_tag LOCUS_08470 13562 14494 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860910.1 protein_id gnl|my_center|LOCUS_08470 15738 14617 gene locus_tag LOCUS_08480 15738 14617 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_08480 16436 15735 gene locus_tag LOCUS_08490 16436 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 17712 16465 gene locus_tag LOCUS_08500 gene glyA 17712 16465 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_08500 18159 17719 gene locus_tag LOCUS_08510 gene rpiB 18159 17719 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_08510 18825 18181 gene locus_tag LOCUS_08520 18825 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 19782 18865 gene locus_tag LOCUS_08530 gene prmC 19782 18865 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_08530 20867 19791 gene locus_tag LOCUS_08540 gene prfA 20867 19791 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_08540 21417 21235 gene locus_tag LOCUS_08550 21417 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 22201 21407 gene locus_tag LOCUS_08560 22201 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 23305 22208 gene locus_tag LOCUS_08570 23305 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 24173 23310 gene locus_tag LOCUS_08580 24173 23310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence031 3258 193 gene locus_tag LOCUS_08590 3258 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3971 3600 gene locus_tag LOCUS_08600 3971 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5055 3949 gene locus_tag LOCUS_08610 5055 3949 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262003.1 protein_id gnl|my_center|LOCUS_08610 5771 5052 gene locus_tag LOCUS_08620 5771 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8646 5758 gene locus_tag LOCUS_08630 gene ileS 8646 5758 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_08630 8921 9202 gene locus_tag LOCUS_08640 8921 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9272 9877 gene locus_tag LOCUS_08650 9272 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 10054 10560 gene locus_tag LOCUS_08660 10054 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10589 11074 gene locus_tag LOCUS_08670 10589 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 11449 12210 gene locus_tag LOCUS_08680 11449 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 12243 13613 gene locus_tag LOCUS_08690 12243 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13914 13705 gene locus_tag LOCUS_08700 13914 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14336 14040 gene locus_tag LOCUS_08710 14336 14040 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173685.1 protein_id gnl|my_center|LOCUS_08710 14443 14368 gene locus_tag LOCUS_t00200 14443 14368 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15518 14610 gene locus_tag LOCUS_08720 15518 14610 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367249.1 protein_id gnl|my_center|LOCUS_08720 15913 15515 gene locus_tag LOCUS_08730 gene rsfS 15913 15515 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_08730 16961 15897 gene locus_tag LOCUS_08740 16961 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 17622 17011 gene locus_tag LOCUS_08750 17622 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 18305 17619 gene locus_tag LOCUS_08760 gene nadD 18305 17619 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_08760 19612 18362 gene locus_tag LOCUS_08770 19612 18362 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08770 20802 19699 gene locus_tag LOCUS_08780 gene proB 20802 19699 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_08780 22109 20799 gene locus_tag LOCUS_08790 gene obgE 22109 20799 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_08790 22602 22348 gene locus_tag LOCUS_08800 gene rpmA 22602 22348 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_08800 23193 22681 gene locus_tag LOCUS_08810 23193 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 <23994 23451 gene locus_tag LOCUS_08820 <23994 23451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812911.1:cell wall-binding repeat-containing protein >Feature sequence032 249 1028 gene locus_tag LOCUS_08830 249 1028 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_08830 1025 1882 gene locus_tag LOCUS_08840 1025 1882 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_08840 1972 3123 gene locus_tag LOCUS_08850 1972 3123 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_08850 3202 4461 gene locus_tag LOCUS_08860 3202 4461 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263520.1 protein_id gnl|my_center|LOCUS_08860 4476 5606 gene locus_tag LOCUS_08870 gene ispG 4476 5606 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_08870 5815 7623 gene locus_tag LOCUS_08880 5815 7623 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_08880 5989 6087 gene locus_tag LOCUS_t00210 5989 6087 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7749 8240 gene locus_tag LOCUS_08890 gene rimP 7749 8240 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_08890 8237 9391 gene locus_tag LOCUS_08900 gene nusA 8237 9391 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_08900 9425 9688 gene locus_tag LOCUS_08910 9425 9688 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_08910 9718 12321 gene locus_tag LOCUS_08920 9718 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12343 12762 gene locus_tag LOCUS_08930 12343 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 12769 13845 gene locus_tag LOCUS_08940 12769 13845 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_08940 13896 14900 gene locus_tag LOCUS_08950 gene truB 13896 14900 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_08950 14897 16471 gene locus_tag LOCUS_08960 14897 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 16523 17875 gene locus_tag LOCUS_08970 16523 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 17815 18282 gene locus_tag LOCUS_08980 17815 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 18545 18820 gene locus_tag LOCUS_08990 gene rpsO 18545 18820 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_08990 18927 21104 gene locus_tag LOCUS_09000 gene pnp 18927 21104 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_09000 21104 21796 gene locus_tag LOCUS_09010 21104 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence033 2297 951 gene locus_tag LOCUS_09020 2297 951 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_09020 3698 2361 gene locus_tag LOCUS_09030 3698 2361 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_09030 6815 3996 gene locus_tag LOCUS_09040 6815 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8068 6806 gene locus_tag LOCUS_09050 gene murA 8068 6806 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_09050 8238 8600 gene locus_tag LOCUS_09060 8238 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 15454 8783 gene locus_tag LOCUS_09070 15454 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 16873 16145 gene locus_tag LOCUS_09080 gene pyrF 16873 16145 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_09080 19891 17153 gene locus_tag LOCUS_09090 19891 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 20396 21322 gene locus_tag LOCUS_09100 20396 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 21585 21379 gene locus_tag LOCUS_09110 21585 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 21771 21589 gene locus_tag LOCUS_09120 21771 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 21967 21764 gene locus_tag LOCUS_09130 21967 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 22245 21964 gene locus_tag LOCUS_09140 22245 21964 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence034 1368 880 gene locus_tag LOCUS_09150 1368 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1832 1365 gene locus_tag LOCUS_09160 1832 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3730 2150 gene locus_tag LOCUS_09170 gene serA 3730 2150 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_09170 4888 3737 gene locus_tag LOCUS_09180 4888 3737 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_09180 5946 4954 gene locus_tag LOCUS_09190 gene ilvC 5946 4954 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_09190 6461 5970 gene locus_tag LOCUS_09200 gene ilvN 6461 5970 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_09200 8339 6462 gene locus_tag LOCUS_09210 gene ilvB 8339 6462 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_09210 10024 8378 gene locus_tag LOCUS_09220 gene ilvD 10024 8378 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_09220 10128 10451 gene locus_tag LOCUS_09230 10128 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 11211 10591 gene locus_tag LOCUS_09240 11211 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11729 11436 gene locus_tag LOCUS_09250 11729 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12802 12041 gene locus_tag LOCUS_09260 12802 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13394 12897 gene locus_tag LOCUS_09270 13394 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 14095 13586 gene locus_tag LOCUS_09280 14095 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 14325 14131 gene locus_tag LOCUS_09290 14325 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14540 14322 gene locus_tag LOCUS_09300 14540 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 14862 14608 gene locus_tag LOCUS_09310 14862 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 15089 14895 gene locus_tag LOCUS_09320 15089 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 15598 15086 gene locus_tag LOCUS_09330 15598 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 <22251 15634 gene locus_tag LOCUS_09340 <22251 15634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence035 795 1313 gene locus_tag LOCUS_09350 795 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1628 2122 gene locus_tag LOCUS_09360 1628 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2190 3245 gene locus_tag LOCUS_09370 2190 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3423 4874 gene locus_tag LOCUS_09380 3423 4874 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_09380 4890 7262 gene locus_tag LOCUS_09390 4890 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7325 9805 gene locus_tag LOCUS_09400 7325 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9847 11211 gene locus_tag LOCUS_09410 9847 11211 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_09410 11208 11648 gene locus_tag LOCUS_09420 11208 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11663 12334 gene locus_tag LOCUS_09430 11663 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12719 12366 gene locus_tag LOCUS_09440 12719 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 13089 13349 gene locus_tag LOCUS_09450 13089 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 13556 14026 gene locus_tag LOCUS_09460 13556 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14033 15007 gene locus_tag LOCUS_09470 gene tatC 14033 15007 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811176.1 protein_id gnl|my_center|LOCUS_09470 15039 15383 gene locus_tag LOCUS_09480 15039 15383 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_09480 15386 16072 gene locus_tag LOCUS_09490 gene hypB 15386 16072 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_09490 16074 18602 gene locus_tag LOCUS_09500 16074 18602 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_09500 18709 19644 gene locus_tag LOCUS_09510 gene mdh 18709 19644 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_09510 19622 20659 gene locus_tag LOCUS_09520 19622 20659 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence036 2927 1584 gene locus_tag LOCUS_09530 gene purB 2927 1584 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384999.1 protein_id gnl|my_center|LOCUS_09530 3907 3203 gene locus_tag LOCUS_09540 3907 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5000 4131 gene locus_tag LOCUS_09550 5000 4131 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_09550 5231 6961 gene locus_tag LOCUS_09560 5231 6961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_09560 6958 9015 gene locus_tag LOCUS_09570 6958 9015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_09570 10222 9017 gene locus_tag LOCUS_09580 10222 9017 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966774.1 protein_id gnl|my_center|LOCUS_09580 10346 11263 gene locus_tag LOCUS_09590 gene ilvE 10346 11263 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_09590 13605 11197 gene locus_tag LOCUS_09600 13605 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 19662 14050 gene locus_tag LOCUS_09610 19662 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 21085 19985 gene locus_tag LOCUS_09620 21085 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence037 296 895 gene locus_tag LOCUS_09630 296 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2339 945 gene locus_tag LOCUS_09640 gene selA 2339 945 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_09640 3681 2710 gene locus_tag LOCUS_09650 gene selD 3681 2710 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_09650 4108 4602 gene locus_tag LOCUS_09660 4108 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4909 4825 gene locus_tag LOCUS_t00220 4909 4825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5856 4933 gene locus_tag LOCUS_09670 5856 4933 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_09670 6637 6113 gene locus_tag LOCUS_09680 6637 6113 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 protein_id gnl|my_center|LOCUS_09680 7260 6634 gene locus_tag LOCUS_09690 7260 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7615 7349 gene locus_tag LOCUS_09700 7615 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9105 7810 gene locus_tag LOCUS_09710 gene eno 9105 7810 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_09710 9305 9102 gene locus_tag LOCUS_09720 9305 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9947 9327 gene locus_tag LOCUS_09730 9947 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 10972 9953 gene locus_tag LOCUS_09740 10972 9953 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_09740 14535 10969 gene locus_tag LOCUS_09750 14535 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 15169 14894 gene locus_tag LOCUS_09760 15169 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 15054 15368 gene locus_tag LOCUS_09770 15054 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 15369 15593 gene locus_tag LOCUS_09780 15369 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15793 15990 gene locus_tag LOCUS_09790 15793 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 16421 17002 gene locus_tag LOCUS_09800 gene nth 16421 17002 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_09800 17396 17055 gene locus_tag LOCUS_09810 17396 17055 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437817.1 protein_id gnl|my_center|LOCUS_09810 17628 17383 gene locus_tag LOCUS_09820 17628 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18089 17913 gene locus_tag LOCUS_09830 18089 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18547 18236 gene locus_tag LOCUS_09840 18547 18236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 18798 18547 gene locus_tag LOCUS_09850 18798 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 19448 19038 gene locus_tag LOCUS_09860 19448 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 20170 19499 gene locus_tag LOCUS_09870 20170 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 20933 20163 gene locus_tag LOCUS_09880 20933 20163 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941418.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence038 1 1947 gene locus_tag LOCUS_09890 1 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1953 3533 gene locus_tag LOCUS_09900 1953 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5226 3916 gene locus_tag LOCUS_09910 5226 3916 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388520.1 protein_id gnl|my_center|LOCUS_09910 5892 6668 gene locus_tag LOCUS_09920 5892 6668 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 protein_id gnl|my_center|LOCUS_09920 6716 8917 gene locus_tag LOCUS_09930 6716 8917 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181307.1 protein_id gnl|my_center|LOCUS_09930 9037 10173 gene locus_tag LOCUS_09940 9037 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10515 11441 gene locus_tag LOCUS_09950 10515 11441 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_09950 11525 12232 gene locus_tag LOCUS_09960 11525 12232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_09960 12229 13335 gene locus_tag LOCUS_09970 12229 13335 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_09970 13408 14682 gene locus_tag LOCUS_09980 13408 14682 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_09980 14679 14897 gene locus_tag LOCUS_09990 14679 14897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14897 15433 gene locus_tag LOCUS_10000 gene mobB 14897 15433 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_10000 15572 16198 gene locus_tag LOCUS_10010 gene sigH 15572 16198 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966429.1 protein_id gnl|my_center|LOCUS_10010 16341 16415 gene locus_tag LOCUS_t00230 16341 16415 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16714 16798 gene locus_tag LOCUS_t00240 16714 16798 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16819 16894 gene locus_tag LOCUS_t00250 16819 16894 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16953 17029 gene locus_tag LOCUS_t00260 16953 17029 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17062 17247 gene locus_tag LOCUS_10020 17062 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17319 18506 gene locus_tag LOCUS_10030 gene tuf 17319 18506 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_10030 18798 18874 gene locus_tag LOCUS_t00270 18798 18874 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 19017 19328 gene locus_tag LOCUS_10040 19017 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 19332 19862 gene locus_tag LOCUS_10050 gene nusG 19332 19862 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence039 445 209 gene locus_tag LOCUS_10060 445 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 335 640 gene locus_tag LOCUS_10070 gene gatC 335 640 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_10070 637 2130 gene locus_tag LOCUS_10080 gene gatA 637 2130 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_10080 2369 3535 gene locus_tag LOCUS_10090 2369 3535 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_10090 3528 4277 gene locus_tag LOCUS_10100 3528 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4277 5284 gene locus_tag LOCUS_10110 4277 5284 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_10110 5292 5957 gene locus_tag LOCUS_10120 5292 5957 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868796.1 protein_id gnl|my_center|LOCUS_10120 5999 6997 gene locus_tag LOCUS_10130 5999 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7036 7719 gene locus_tag LOCUS_10140 7036 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7722 7871 gene locus_tag LOCUS_10150 7722 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7887 9386 gene locus_tag LOCUS_10160 7887 9386 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257366.1 protein_id gnl|my_center|LOCUS_10160 9370 10887 gene locus_tag LOCUS_10170 9370 10887 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_10170 10887 12140 gene locus_tag LOCUS_10180 10887 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13301 12117 gene locus_tag LOCUS_10190 13301 12117 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 protein_id gnl|my_center|LOCUS_10190 13587 14621 gene locus_tag LOCUS_10200 gene yedE 13587 14621 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_10200 14618 14851 gene locus_tag LOCUS_10210 14618 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16071 14854 gene locus_tag LOCUS_10220 16071 14854 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_10220 16318 17238 gene locus_tag LOCUS_10230 16318 17238 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_10230 17294 18877 gene locus_tag LOCUS_10240 17294 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 19618 18983 gene locus_tag LOCUS_10250 19618 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence040 338 423 gene locus_tag LOCUS_t00280 338 423 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 530 1321 gene locus_tag LOCUS_10260 530 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1318 2595 gene locus_tag LOCUS_10270 1318 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2905 3654 gene locus_tag LOCUS_10280 2905 3654 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_10280 4946 3720 gene locus_tag LOCUS_10290 4946 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5223 6233 gene locus_tag LOCUS_10300 5223 6233 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_10300 6366 7775 gene locus_tag LOCUS_10310 gene rpoN 6366 7775 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_10310 7772 9316 gene locus_tag LOCUS_10320 7772 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9329 10693 gene locus_tag LOCUS_10330 9329 10693 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_10330 10844 13351 gene locus_tag LOCUS_10340 10844 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 13360 14145 gene locus_tag LOCUS_10350 13360 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14142 14960 gene locus_tag LOCUS_10360 14142 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 16251 15001 gene locus_tag LOCUS_10370 16251 15001 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583970.1 protein_id gnl|my_center|LOCUS_10370 16352 16903 gene locus_tag LOCUS_10380 16352 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 17054 17203 gene locus_tag LOCUS_10390 17054 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 17967 17329 gene locus_tag LOCUS_10400 17967 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 18706 18927 gene locus_tag LOCUS_10410 18706 18927 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_10410 19176 19103 gene locus_tag LOCUS_t00290 19176 19103 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19367 19292 gene locus_tag LOCUS_t00300 19367 19292 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 195 1640 gene locus_tag LOCUS_10420 gene glnA 195 1640 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_10420 1793 3199 gene locus_tag LOCUS_10430 gene tig 1793 3199 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_10430 3196 3819 gene locus_tag LOCUS_10440 gene clpP 3196 3819 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_10440 3828 5090 gene locus_tag LOCUS_10450 gene clpX 3828 5090 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_10450 5130 7784 gene locus_tag LOCUS_10460 5130 7784 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_10460 7849 9210 gene locus_tag LOCUS_10470 7849 9210 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_10470 9360 9797 gene locus_tag LOCUS_10480 9360 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 9794 11713 gene locus_tag LOCUS_10490 gene thrS 9794 11713 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_10490 12006 15215 gene locus_tag LOCUS_10500 gene fdnG 12006 15215 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:12609..12611,aa:Sec) note codon on position 202 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10500 15212 16132 gene locus_tag LOCUS_10510 gene fdxH 15212 16132 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 protein_id gnl|my_center|LOCUS_10510 16133 16807 gene locus_tag LOCUS_10520 16133 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 17003 17905 gene locus_tag LOCUS_10530 17003 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 19448 18042 gene locus_tag LOCUS_10540 19448 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence042 3275 2163 gene locus_tag LOCUS_10550 3275 2163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047958.1 protein_id gnl|my_center|LOCUS_10550 4099 3272 gene locus_tag LOCUS_10560 4099 3272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066010.1 protein_id gnl|my_center|LOCUS_10560 5124 4099 gene locus_tag LOCUS_10570 5124 4099 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_10570 5996 5121 gene locus_tag LOCUS_10580 5996 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6186 6938 gene locus_tag LOCUS_10590 6186 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 8645 7299 gene locus_tag LOCUS_10600 8645 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9838 8645 gene locus_tag LOCUS_10610 9838 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11145 9964 gene locus_tag LOCUS_10620 11145 9964 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_10620 13136 11331 gene locus_tag LOCUS_10630 13136 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 14793 13408 gene locus_tag LOCUS_10640 14793 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 18656 14796 gene locus_tag LOCUS_10650 18656 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence043 340 639 gene locus_tag LOCUS_10660 340 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1437 1156 gene locus_tag LOCUS_10670 1437 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1781 1707 gene locus_tag LOCUS_t00310 1781 1707 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2725 1907 gene locus_tag LOCUS_10680 2725 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_10680 4249 2738 gene locus_tag LOCUS_10690 4249 2738 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_10690 5459 4254 gene locus_tag LOCUS_10700 5459 4254 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_10700 6782 5460 gene locus_tag LOCUS_10710 6782 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7813 7019 gene locus_tag LOCUS_10720 7813 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 9537 7936 gene locus_tag LOCUS_10730 9537 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10372 9809 gene locus_tag LOCUS_10740 10372 9809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_10740 11919 10372 gene locus_tag LOCUS_10750 11919 10372 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_10750 12149 12233 gene locus_tag LOCUS_t00320 12149 12233 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12474 12277 gene locus_tag LOCUS_10760 12474 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15577 12695 gene locus_tag LOCUS_10770 15577 12695 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_10770 16598 15570 gene locus_tag LOCUS_10780 16598 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 16833 16609 gene locus_tag LOCUS_10790 16833 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 17606 17070 gene locus_tag LOCUS_10800 17606 17070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence044 1611 946 gene locus_tag LOCUS_10810 gene cybH 1611 946 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932460.1 protein_id gnl|my_center|LOCUS_10810 3270 1693 gene locus_tag LOCUS_10820 3270 1693 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_10820 4496 3270 gene locus_tag LOCUS_10830 4496 3270 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811615.1 protein_id gnl|my_center|LOCUS_10830 5634 5083 gene locus_tag LOCUS_10840 5634 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5620 5841 gene locus_tag LOCUS_10850 5620 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5939 6649 gene locus_tag LOCUS_10860 5939 6649 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_10860 8140 6731 gene locus_tag LOCUS_10870 gene rlmD 8140 6731 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_10870 8431 10224 gene locus_tag LOCUS_10880 8431 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10356 11063 gene locus_tag LOCUS_10890 10356 11063 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_10890 11053 11784 gene locus_tag LOCUS_10900 gene bshB1 11053 11784 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_10900 11849 13621 gene locus_tag LOCUS_10910 11849 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_10910 14306 13593 gene locus_tag LOCUS_10920 gene plsY 14306 13593 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_10920 15211 14306 gene locus_tag LOCUS_10930 15211 14306 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_10930 15427 17352 gene locus_tag LOCUS_10940 15427 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 17478 17553 gene locus_tag LOCUS_t00330 17478 17553 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 1635 625 gene locus_tag LOCUS_10950 1635 625 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_10950 2715 1837 gene locus_tag LOCUS_10960 2715 1837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_10960 3840 3043 gene locus_tag LOCUS_10970 3840 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 10840 3857 gene locus_tag LOCUS_10980 10840 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 10904 11257 gene locus_tag LOCUS_10990 10904 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13090 11531 gene locus_tag LOCUS_11000 13090 11531 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173655.1 protein_id gnl|my_center|LOCUS_11000 13912 13091 gene locus_tag LOCUS_11010 13912 13091 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_11010 15131 13944 gene locus_tag LOCUS_11020 gene dnaJ 15131 13944 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_11020 16248 15232 gene locus_tag LOCUS_11030 gene hrcA 16248 15232 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_11030 17419 16286 gene locus_tag LOCUS_11040 gene hemW 17419 16286 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence046 300 1031 gene locus_tag LOCUS_11050 300 1031 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_11050 2588 1251 gene locus_tag LOCUS_11060 2588 1251 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_11060 2819 2622 gene locus_tag LOCUS_11070 2819 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2984 4372 gene locus_tag LOCUS_11080 2984 4372 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_11080 4443 5819 gene locus_tag LOCUS_11090 4443 5819 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_11090 5819 6442 gene locus_tag LOCUS_11100 gene metW 5819 6442 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_11100 6595 7581 gene locus_tag LOCUS_11110 6595 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7628 7933 gene locus_tag LOCUS_11120 7628 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8345 9499 gene locus_tag LOCUS_11130 gene rsgA 8345 9499 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_11130 10828 9557 gene locus_tag LOCUS_11140 10828 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 11666 10812 gene locus_tag LOCUS_11150 11666 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11979 12839 gene locus_tag LOCUS_11160 11979 12839 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_11160 12836 13708 gene locus_tag LOCUS_11170 12836 13708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_11170 13709 16111 gene locus_tag LOCUS_11180 13709 16111 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence047 191 400 gene locus_tag LOCUS_11190 191 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11190 578 970 gene locus_tag LOCUS_11200 578 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11200 1066 2124 gene locus_tag LOCUS_11210 1066 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2342 4336 gene locus_tag LOCUS_11220 2342 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4329 5024 gene locus_tag LOCUS_11230 4329 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5200 5322 gene locus_tag LOCUS_11240 5200 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5397 5471 gene locus_tag LOCUS_t00340 5397 5471 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5706 5533 gene locus_tag LOCUS_11250 5706 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5906 5676 gene locus_tag LOCUS_11260 5906 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6074 6421 gene locus_tag LOCUS_11270 6074 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6418 7158 gene locus_tag LOCUS_11280 6418 7158 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_11280 7242 8363 gene locus_tag LOCUS_11290 7242 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8407 8700 gene locus_tag LOCUS_11300 gene rpsF 8407 8700 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_11300 8775 9191 gene locus_tag LOCUS_11310 8775 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 9272 9532 gene locus_tag LOCUS_11320 gene rpsR 9272 9532 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_11320 9558 10262 gene locus_tag LOCUS_11330 9558 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 10633 12024 gene locus_tag LOCUS_11340 gene dnaB 10633 12024 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_11340 12248 12913 gene locus_tag LOCUS_11350 12248 12913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_11350 13050 14405 gene locus_tag LOCUS_11360 13050 14405 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_11360 14598 14807 gene locus_tag LOCUS_11370 14598 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 14843 15577 gene locus_tag LOCUS_11380 14843 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16641 15703 gene locus_tag LOCUS_11390 gene cysK 16641 15703 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence048 258 1082 gene locus_tag LOCUS_11400 258 1082 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_11400 1141 1851 gene locus_tag LOCUS_11410 gene srtC2 1141 1851 CDS product class C sortase SrtC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746885.1 protein_id gnl|my_center|LOCUS_11410 3209 1830 gene locus_tag LOCUS_11420 3209 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5486 3228 gene locus_tag LOCUS_11430 5486 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7152 5569 gene locus_tag LOCUS_11440 7152 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 9161 7419 gene locus_tag LOCUS_11450 9161 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9352 10656 gene locus_tag LOCUS_11460 9352 10656 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_11460 10662 11903 gene locus_tag LOCUS_11470 10662 11903 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_11470 12057 13307 gene locus_tag LOCUS_11480 12057 13307 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_11480 14072 13386 gene locus_tag LOCUS_11490 gene srtC1 14072 13386 CDS product FCT-2 pilus polymerization class B sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921812.1 protein_id gnl|my_center|LOCUS_11490 15042 14116 gene locus_tag LOCUS_11500 15042 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 16726 15257 gene locus_tag LOCUS_11510 16726 15257 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence049 301 555 gene locus_tag LOCUS_11520 301 555 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_11520 619 1563 gene locus_tag LOCUS_11530 619 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1584 1877 gene locus_tag LOCUS_11540 1584 1877 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992358.1 protein_id gnl|my_center|LOCUS_11540 1858 4377 gene locus_tag LOCUS_11550 gene leuS 1858 4377 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_11550 4417 4779 gene locus_tag LOCUS_11560 4417 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5889 4798 gene locus_tag LOCUS_11570 5889 4798 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_11570 7679 5937 gene locus_tag LOCUS_11580 7679 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 8847 7699 gene locus_tag LOCUS_11590 8847 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 9242 10054 gene locus_tag LOCUS_11600 9242 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10089 12785 gene locus_tag LOCUS_11610 10089 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 12736 13443 gene locus_tag LOCUS_11620 12736 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13827 13564 gene locus_tag LOCUS_11630 gene rpsT 13827 13564 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_11630 14090 15913 gene locus_tag LOCUS_11640 gene lepA 14090 15913 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence050 678 511 gene locus_tag LOCUS_11650 678 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1406 1753 gene locus_tag LOCUS_11660 1406 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4537 1742 gene locus_tag LOCUS_11670 4537 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5036 5449 gene locus_tag LOCUS_11680 5036 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5430 6923 gene locus_tag LOCUS_11690 5430 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6923 7609 gene locus_tag LOCUS_11700 6923 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 7639 8484 gene locus_tag LOCUS_11710 7639 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8493 10103 gene locus_tag LOCUS_11720 8493 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10078 11142 gene locus_tag LOCUS_11730 10078 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 11139 12194 gene locus_tag LOCUS_11740 11139 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12393 12974 gene locus_tag LOCUS_11750 12393 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13259 13477 gene locus_tag LOCUS_11760 13259 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 13480 13959 gene locus_tag LOCUS_11770 13480 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 14014 14295 gene locus_tag LOCUS_11780 14014 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11780 14295 15083 gene locus_tag LOCUS_11790 14295 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence051 698 546 gene locus_tag LOCUS_11800 698 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 982 755 gene locus_tag LOCUS_11810 982 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1238 2119 gene locus_tag LOCUS_11820 1238 2119 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_11820 2104 2265 gene locus_tag LOCUS_11830 2104 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2626 3279 gene locus_tag LOCUS_11840 2626 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4355 3594 gene locus_tag LOCUS_11850 gene larB 4355 3594 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_11850 5419 4529 gene locus_tag LOCUS_11860 5419 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6084 6284 gene locus_tag LOCUS_11870 6084 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6415 7701 gene locus_tag LOCUS_11880 gene serS 6415 7701 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_11880 8130 8786 gene locus_tag LOCUS_11890 8130 8786 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861425.1 protein_id gnl|my_center|LOCUS_11890 8805 9746 gene locus_tag LOCUS_11900 8805 9746 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809360.1 protein_id gnl|my_center|LOCUS_11900 9743 10561 gene locus_tag LOCUS_11910 9743 10561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809359.1 protein_id gnl|my_center|LOCUS_11910 11551 10790 gene locus_tag LOCUS_11920 11551 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11920 11963 11712 gene locus_tag LOCUS_11930 11963 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 12174 12743 gene locus_tag LOCUS_11940 12174 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 12933 12857 gene locus_tag LOCUS_t00350 12933 12857 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13282 13127 gene locus_tag LOCUS_11950 13282 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 13959 13246 gene locus_tag LOCUS_11960 13959 13246 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114629.1 protein_id gnl|my_center|LOCUS_11960 14107 14013 gene locus_tag LOCUS_t00360 14107 14013 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <16082 14227 gene locus_tag LOCUS_11970 <16082 14227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964550.1:T9SS type A sorting domain-containing protein >Feature sequence052 353 568 gene locus_tag LOCUS_11980 gene rpmF 353 568 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_11980 657 1700 gene locus_tag LOCUS_11990 gene plsX 657 1700 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 protein_id gnl|my_center|LOCUS_11990 1715 1951 gene locus_tag LOCUS_12000 1715 1951 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830184.1 protein_id gnl|my_center|LOCUS_12000 1998 2699 gene locus_tag LOCUS_12010 gene rnc 1998 2699 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 protein_id gnl|my_center|LOCUS_12010 2709 6272 gene locus_tag LOCUS_12020 gene smc 2709 6272 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950799.1 protein_id gnl|my_center|LOCUS_12020 6253 7251 gene locus_tag LOCUS_12030 gene ftsY 6253 7251 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888888.1 protein_id gnl|my_center|LOCUS_12030 7347 7949 gene locus_tag LOCUS_12040 gene sipZ 7347 7949 CDS product type I signal peptidase SipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723889.1 protein_id gnl|my_center|LOCUS_12040 7953 9299 gene locus_tag LOCUS_12050 gene ffh 7953 9299 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_12050 9514 9852 gene locus_tag LOCUS_12060 9514 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9855 10109 gene locus_tag LOCUS_12070 9855 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 10115 10750 gene locus_tag LOCUS_12080 gene rimM 10115 10750 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_12080 10747 11448 gene locus_tag LOCUS_12090 gene trmD 10747 11448 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_12090 11552 12106 gene locus_tag LOCUS_12100 gene lepB 11552 12106 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_12100 12240 12584 gene locus_tag LOCUS_12110 gene rplS 12240 12584 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_12110 12960 12565 gene locus_tag LOCUS_12120 12960 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13188 12982 gene locus_tag LOCUS_12130 13188 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 13295 13546 gene locus_tag LOCUS_12140 13295 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 15226 13622 gene locus_tag LOCUS_12150 15226 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence053 506 1081 gene locus_tag LOCUS_12160 506 1081 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_12160 1699 1274 gene locus_tag LOCUS_12170 1699 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1841 1749 gene locus_tag LOCUS_t00370 1841 1749 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4182 2020 gene locus_tag LOCUS_12180 4182 2020 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_12180 4660 4388 gene locus_tag LOCUS_12190 4660 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4902 6317 gene locus_tag LOCUS_12200 4902 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6757 6410 gene locus_tag LOCUS_12210 6757 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272171.1 protein_id gnl|my_center|LOCUS_12210 6989 8239 gene locus_tag LOCUS_12220 6989 8239 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12220 8335 8243 gene locus_tag LOCUS_t00380 8335 8243 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9815 8481 gene locus_tag LOCUS_12230 9815 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 11782 9923 gene locus_tag LOCUS_12240 11782 9923 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_12240 11993 11694 gene locus_tag LOCUS_12250 11993 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 12456 11968 gene locus_tag LOCUS_12260 gene tadA 12456 11968 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_12260 12783 12870 gene locus_tag LOCUS_t00390 12783 12870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12969 13673 gene locus_tag LOCUS_12270 12969 13673 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_12270 13705 14316 gene locus_tag LOCUS_12280 13705 14316 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_12280 14318 15157 gene locus_tag LOCUS_12290 14318 15157 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence054 1410 244 gene locus_tag LOCUS_12300 1410 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2524 1433 gene locus_tag LOCUS_12310 2524 1433 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_12310 3249 2614 gene locus_tag LOCUS_12320 3249 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3767 3255 gene locus_tag LOCUS_12330 3767 3255 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_12330 5114 3852 gene locus_tag LOCUS_12340 5114 3852 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_12340 6411 5233 gene locus_tag LOCUS_12350 gene nifV 6411 5233 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_12350 6879 8048 gene locus_tag LOCUS_12360 6879 8048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_12360 9038 8139 gene locus_tag LOCUS_12370 9038 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11479 9089 gene locus_tag LOCUS_12380 gene rlmKL 11479 9089 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 protein_id gnl|my_center|LOCUS_12380 12275 11499 gene locus_tag LOCUS_12390 12275 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12715 12350 gene locus_tag LOCUS_12400 12715 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 13498 12920 gene locus_tag LOCUS_12410 13498 12920 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_12410 13838 14377 gene locus_tag LOCUS_12420 13838 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 14995 14363 gene locus_tag LOCUS_12430 gene pncA 14995 14363 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_12430 <15622 14999 gene locus_tag LOCUS_12440 <15622 14999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000284436.1:nicotinate phosphoribosyltransferase >Feature sequence055 2344 983 gene locus_tag LOCUS_12450 gene lysA 2344 983 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_12450 4228 2363 gene locus_tag LOCUS_12460 4228 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2670 2841 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcggcggcggcatcaatgg 5806 4331 gene locus_tag LOCUS_12470 5806 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6102 5803 gene locus_tag LOCUS_12480 6102 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6974 6690 gene locus_tag LOCUS_12490 6974 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 7112 8137 gene locus_tag LOCUS_12500 7112 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8134 8598 gene locus_tag LOCUS_12510 gene rlmH 8134 8598 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 protein_id gnl|my_center|LOCUS_12510 8745 9140 gene locus_tag LOCUS_12520 8745 9140 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807790.1 protein_id gnl|my_center|LOCUS_12520 9467 9210 gene locus_tag LOCUS_12530 9467 9210 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976577.1 protein_id gnl|my_center|LOCUS_12530 10070 9891 gene locus_tag LOCUS_12540 10070 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 10303 10067 gene locus_tag LOCUS_12550 10303 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10690 10391 gene locus_tag LOCUS_12560 10690 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11002 10927 gene locus_tag LOCUS_t00400 11002 10927 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12628 11219 gene locus_tag LOCUS_12570 12628 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 13737 12616 gene locus_tag LOCUS_12580 gene holB 13737 12616 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_12580 14519 13782 gene locus_tag LOCUS_12590 gene tmk 14519 13782 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_12590 15340 14516 gene locus_tag LOCUS_12600 15340 14516 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence056 921 31 gene locus_tag LOCUS_12610 921 31 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 protein_id gnl|my_center|LOCUS_12610 2123 930 gene locus_tag LOCUS_12620 2123 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4068 2332 gene locus_tag LOCUS_12630 4068 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4697 4137 gene locus_tag LOCUS_12640 4697 4137 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869013.1 protein_id gnl|my_center|LOCUS_12640 6551 4719 gene locus_tag LOCUS_12650 6551 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7998 6976 gene locus_tag LOCUS_12660 7998 6976 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_12660 9350 7998 gene locus_tag LOCUS_12670 9350 7998 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_12670 10538 9612 gene locus_tag LOCUS_12680 10538 9612 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_12680 11740 10553 gene locus_tag LOCUS_12690 11740 10553 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_12690 12137 11742 gene locus_tag LOCUS_12700 12137 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 12709 12134 gene locus_tag LOCUS_12710 12709 12134 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_12710 13696 13100 gene locus_tag LOCUS_12720 gene recR 13696 13100 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_12720 14231 13791 gene locus_tag LOCUS_12730 14231 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence057 1032 109 gene locus_tag LOCUS_12740 1032 109 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_12740 1258 2547 gene locus_tag LOCUS_12750 gene rnd 1258 2547 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_12750 2561 3241 gene locus_tag LOCUS_12760 2561 3241 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_12760 3245 4564 gene locus_tag LOCUS_12770 gene xseA 3245 4564 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_12770 4564 4827 gene locus_tag LOCUS_12780 gene xseB 4564 4827 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351725.1 protein_id gnl|my_center|LOCUS_12780 4827 6905 gene locus_tag LOCUS_12790 4827 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7063 8148 gene locus_tag LOCUS_12800 gene hemE 7063 8148 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_12800 8240 9292 gene locus_tag LOCUS_12810 gene hemH 8240 9292 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_12810 9311 10825 gene locus_tag LOCUS_12820 gene hemY 9311 10825 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740655.1 protein_id gnl|my_center|LOCUS_12820 10894 12414 gene locus_tag LOCUS_12830 gene hemG 10894 12414 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_12830 13045 12485 gene locus_tag LOCUS_12840 13045 12485 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_12840 <13620 13060 gene locus_tag LOCUS_12850 <13620 13060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074137.1:coproporphyrinogen III oxidase family protein >Feature sequence058 1583 720 gene locus_tag LOCUS_12860 gene panC 1583 720 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242940.1 protein_id gnl|my_center|LOCUS_12860 2542 1583 gene locus_tag LOCUS_12870 gene panB 2542 1583 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_12870 2721 2539 gene locus_tag LOCUS_12880 2721 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3211 2675 gene locus_tag LOCUS_12890 3211 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4065 3208 gene locus_tag LOCUS_12900 gene folP 4065 3208 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_12900 4046 4198 gene locus_tag LOCUS_12910 4046 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4745 4182 gene locus_tag LOCUS_12920 gene folE 4745 4182 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_12920 5467 4826 gene locus_tag LOCUS_12930 5467 4826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_12930 6555 5464 gene locus_tag LOCUS_12940 6555 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8788 6890 gene locus_tag LOCUS_12950 gene ftsH 8788 6890 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_12950 9472 8834 gene locus_tag LOCUS_12960 gene hpt 9472 8834 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_12960 10953 9490 gene locus_tag LOCUS_12970 gene tilS 10953 9490 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_12970 11554 11060 gene locus_tag LOCUS_12980 11554 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 12289 11582 gene locus_tag LOCUS_12990 12289 11582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_12990 13169 12294 gene locus_tag LOCUS_13000 13169 12294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence059 1863 1018 gene locus_tag LOCUS_13010 1863 1018 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836657.1 protein_id gnl|my_center|LOCUS_13010 2430 1957 gene locus_tag LOCUS_13020 2430 1957 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_13020 3376 2516 gene locus_tag LOCUS_13030 3376 2516 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_13030 4233 3373 gene locus_tag LOCUS_13040 4233 3373 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814610.1 protein_id gnl|my_center|LOCUS_13040 4413 6692 gene locus_tag LOCUS_13050 4413 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6867 7229 gene locus_tag LOCUS_13060 6867 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7220 7798 gene locus_tag LOCUS_13070 7220 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7798 9513 gene locus_tag LOCUS_13080 7798 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9510 10673 gene locus_tag LOCUS_13090 gene nuoH 9510 10673 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_13090 10670 11146 gene locus_tag LOCUS_13100 10670 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 11143 11787 gene locus_tag LOCUS_13110 11143 11787 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813221.1 protein_id gnl|my_center|LOCUS_13110 11784 12092 gene locus_tag LOCUS_13120 gene nuoK 11784 12092 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence060 784 2130 gene locus_tag LOCUS_13130 784 2130 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_13130 2868 3626 gene locus_tag LOCUS_13140 2868 3626 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_13140 3630 4010 gene locus_tag LOCUS_13150 3630 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4007 4909 gene locus_tag LOCUS_13160 gene cbiQ 4007 4909 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_13160 4920 5807 gene locus_tag LOCUS_13170 4920 5807 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_13170 5844 7634 gene locus_tag LOCUS_13180 5844 7634 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_13180 7739 8197 gene locus_tag LOCUS_13190 7739 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 8260 9201 gene locus_tag LOCUS_13200 8260 9201 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_13200 9338 9910 gene locus_tag LOCUS_13210 9338 9910 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_13210 9990 10604 gene locus_tag LOCUS_13220 9990 10604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905802.1 protein_id gnl|my_center|LOCUS_13220 10660 11310 gene locus_tag LOCUS_13230 10660 11310 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817429.1 protein_id gnl|my_center|LOCUS_13230 11321 12151 gene locus_tag LOCUS_13240 11321 12151 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_13240 13214 12966 gene locus_tag LOCUS_13250 13214 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence061 1005 2291 gene locus_tag LOCUS_13260 1005 2291 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_13260 2909 3685 gene locus_tag LOCUS_13270 2909 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4181 4843 gene locus_tag LOCUS_13280 gene fsa 4181 4843 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_13280 4840 6186 gene locus_tag LOCUS_13290 4840 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6264 6815 gene locus_tag LOCUS_13300 6264 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6990 7271 gene locus_tag LOCUS_13310 6990 7271 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_13310 7287 7598 gene locus_tag LOCUS_13320 7287 7598 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_13320 7692 7967 gene locus_tag LOCUS_13330 7692 7967 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_13330 7967 8239 gene locus_tag LOCUS_13340 7967 8239 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_13340 8569 9348 gene locus_tag LOCUS_13350 8569 9348 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_13350 9506 9964 gene locus_tag LOCUS_13360 9506 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 10109 10798 gene locus_tag LOCUS_13370 gene thyX 10109 10798 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_13370 10795 12075 gene locus_tag LOCUS_13380 10795 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 12486 12635 gene locus_tag LOCUS_13390 12486 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence062 346 179 gene locus_tag LOCUS_13400 346 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1984 350 gene locus_tag LOCUS_13410 1984 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2488 1985 gene locus_tag LOCUS_13420 2488 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3472 2861 gene locus_tag LOCUS_13430 3472 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8707 3605 gene locus_tag LOCUS_13440 8707 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9996 8707 gene locus_tag LOCUS_13450 9996 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10388 9996 gene locus_tag LOCUS_13460 10388 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 11672 10623 gene locus_tag LOCUS_13470 11672 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 <13273 11782 gene locus_tag LOCUS_13480 <13273 11782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256150.1:NAD-dependent DNA ligase LigA >Feature sequence063 455 195 gene locus_tag LOCUS_13490 455 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 445 5607 gene locus_tag LOCUS_13500 445 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5773 6495 gene locus_tag LOCUS_13510 5773 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6786 7268 gene locus_tag LOCUS_13520 6786 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7417 7755 gene locus_tag LOCUS_13530 7417 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7686 8051 gene locus_tag LOCUS_13540 7686 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8268 9704 gene locus_tag LOCUS_13550 gene lpdA 8268 9704 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_13550 9708 10631 gene locus_tag LOCUS_13560 gene lipA 9708 10631 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_13560 11632 10622 gene locus_tag LOCUS_13570 11632 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 11962 12264 gene locus_tag LOCUS_13580 11962 12264 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence064 1014 100 gene locus_tag LOCUS_13590 1014 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1247 1041 gene locus_tag LOCUS_13600 1247 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1671 1237 gene locus_tag LOCUS_13610 1671 1237 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_13610 2797 1829 gene locus_tag LOCUS_13620 2797 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3585 2797 gene locus_tag LOCUS_13630 3585 2797 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_13630 4012 4476 gene locus_tag LOCUS_13640 4012 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6589 4484 gene locus_tag LOCUS_13650 6589 4484 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_13650 7896 6682 gene locus_tag LOCUS_13660 7896 6682 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_13660 8103 8783 gene locus_tag LOCUS_13670 8103 8783 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 protein_id gnl|my_center|LOCUS_13670 10108 8807 gene locus_tag LOCUS_13680 10108 8807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_13680 10748 12619 gene locus_tag LOCUS_13690 gene dnaX 10748 12619 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence065 2267 945 gene locus_tag LOCUS_13700 gene ahbD 2267 945 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_13700 3229 2237 gene locus_tag LOCUS_13710 gene hemB 3229 2237 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_13710 3625 3263 gene locus_tag LOCUS_13720 3625 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3980 5053 gene locus_tag LOCUS_13730 3980 5053 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_13730 5143 6144 gene locus_tag LOCUS_13740 5143 6144 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006189.1 protein_id gnl|my_center|LOCUS_13740 6147 7829 gene locus_tag LOCUS_13750 6147 7829 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425530.1 protein_id gnl|my_center|LOCUS_13750 7826 8638 gene locus_tag LOCUS_13760 7826 8638 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_13760 8694 9821 gene locus_tag LOCUS_13770 gene phnW 8694 9821 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786490.1 protein_id gnl|my_center|LOCUS_13770 11078 9879 gene locus_tag LOCUS_13780 11078 9879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_13780 11785 11075 gene locus_tag LOCUS_13790 11785 11075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_13790 <12764 11812 gene locus_tag LOCUS_13800 <12764 11812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583203.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence066 540 259 gene locus_tag LOCUS_13810 540 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 469 846 gene locus_tag LOCUS_13820 469 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 976 2016 gene locus_tag LOCUS_13830 976 2016 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_13830 2032 2895 gene locus_tag LOCUS_13840 gene mreC 2032 2895 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_13840 2895 3407 gene locus_tag LOCUS_13850 2895 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3537 5390 gene locus_tag LOCUS_13860 gene mrdA 3537 5390 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_13860 5395 6543 gene locus_tag LOCUS_13870 gene rodA 5395 6543 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_13870 6573 7604 gene locus_tag LOCUS_13880 6573 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7614 9674 gene locus_tag LOCUS_13890 7614 9674 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_13890 9671 10489 gene locus_tag LOCUS_13900 9671 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 10537 12180 gene locus_tag LOCUS_13910 gene rng 10537 12180 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence067 1133 171 gene locus_tag LOCUS_13920 1133 171 CDS product HindVP family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038499775.1 protein_id gnl|my_center|LOCUS_13920 1331 2539 gene locus_tag LOCUS_13930 1331 2539 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_13930 2788 4407 gene locus_tag LOCUS_13940 2788 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4482 6035 gene locus_tag LOCUS_13950 gene gatB 4482 6035 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_13950 7598 6123 gene locus_tag LOCUS_13960 7598 6123 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_13960 9219 7600 gene locus_tag LOCUS_13970 9219 7600 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_13970 10715 9219 gene locus_tag LOCUS_13980 10715 9219 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence068 2422 980 gene locus_tag LOCUS_13990 gene aroA 2422 980 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_13990 3609 2434 gene locus_tag LOCUS_14000 gene hisC 3609 2434 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_14000 4368 3718 gene locus_tag LOCUS_14010 4368 3718 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_14010 5153 4365 gene locus_tag LOCUS_14020 gene cobS 5153 4365 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_14020 6259 5156 gene locus_tag LOCUS_14030 gene cobT 6259 5156 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_14030 7039 6377 gene locus_tag LOCUS_14040 7039 6377 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899876.1 protein_id gnl|my_center|LOCUS_14040 7871 7041 gene locus_tag LOCUS_14050 7871 7041 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_14050 8571 7873 gene locus_tag LOCUS_14060 gene scpB 8571 7873 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389686.1 protein_id gnl|my_center|LOCUS_14060 10378 9077 gene locus_tag LOCUS_14070 10378 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence069 253 1647 gene locus_tag LOCUS_14080 253 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1644 3137 gene locus_tag LOCUS_14090 gene gcvPB 1644 3137 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_14090 3134 3997 gene locus_tag LOCUS_14100 3134 3997 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_14100 4095 4406 gene locus_tag LOCUS_14110 4095 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4480 4932 gene locus_tag LOCUS_14120 4480 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4929 5636 gene locus_tag LOCUS_14130 4929 5636 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_14130 5649 6167 gene locus_tag LOCUS_14140 5649 6167 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_14140 6330 7517 gene locus_tag LOCUS_14150 6330 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 8061 7630 gene locus_tag LOCUS_14160 8061 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8310 9848 gene locus_tag LOCUS_14170 8310 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 9877 10632 gene locus_tag LOCUS_14180 gene istB 9877 10632 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence070 2456 1857 gene locus_tag LOCUS_14190 2456 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2767 2456 gene locus_tag LOCUS_14200 2767 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3328 2792 gene locus_tag LOCUS_14210 3328 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3779 3342 gene locus_tag LOCUS_14220 3779 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4125 3766 gene locus_tag LOCUS_14230 4125 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4487 4128 gene locus_tag LOCUS_14240 4487 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4831 4484 gene locus_tag LOCUS_14250 4831 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5825 4950 gene locus_tag LOCUS_14260 5825 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6355 5837 gene locus_tag LOCUS_14270 6355 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6827 6534 gene locus_tag LOCUS_14280 6827 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7084 6926 gene locus_tag LOCUS_14290 7084 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8619 7081 gene locus_tag LOCUS_14300 8619 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10286 8619 gene locus_tag LOCUS_14310 10286 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence071 1657 179 gene locus_tag LOCUS_14320 1657 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3086 1647 gene locus_tag LOCUS_14330 3086 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4864 3194 gene locus_tag LOCUS_14340 4864 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5696 5436 gene locus_tag LOCUS_14350 5696 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5652 6560 gene locus_tag LOCUS_14360 5652 6560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_14360 6563 8230 gene locus_tag LOCUS_14370 6563 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 8868 10355 gene locus_tag LOCUS_14380 8868 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence072 453 1208 gene locus_tag LOCUS_14390 gene rph 453 1208 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_14390 1198 1854 gene locus_tag LOCUS_14400 gene rdgB 1198 1854 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403926.1 protein_id gnl|my_center|LOCUS_14400 2091 2167 gene locus_tag LOCUS_t00410 2091 2167 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2475 2254 gene locus_tag LOCUS_14410 2475 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3143 2568 gene locus_tag LOCUS_14420 3143 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755884.1 protein_id gnl|my_center|LOCUS_14420 3429 3504 gene locus_tag LOCUS_t00420 3429 3504 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3583 3659 gene locus_tag LOCUS_t00430 3583 3659 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3910 3719 gene locus_tag LOCUS_14430 3910 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4527 3979 gene locus_tag LOCUS_14440 4527 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4685 4936 gene locus_tag LOCUS_14450 4685 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5184 5260 gene locus_tag LOCUS_t00440 5184 5260 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5362 5437 gene locus_tag LOCUS_t00450 5362 5437 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5733 6884 gene locus_tag LOCUS_14460 5733 6884 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877011.1 protein_id gnl|my_center|LOCUS_14460 7133 8350 gene locus_tag LOCUS_14470 7133 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8380 10203 gene locus_tag LOCUS_14480 8380 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence073 1137 253 gene locus_tag LOCUS_14490 gene pstC 1137 253 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_14490 1979 1134 gene locus_tag LOCUS_14500 1979 1134 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_14500 2818 1952 gene locus_tag LOCUS_14510 gene pgeF 2818 1952 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_14510 3019 3705 gene locus_tag LOCUS_14520 3019 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3817 3611 gene locus_tag LOCUS_14530 3817 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4217 5494 gene locus_tag LOCUS_14540 4217 5494 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986390.1 protein_id gnl|my_center|LOCUS_14540 5699 5481 gene locus_tag LOCUS_14550 5699 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6018 6392 gene locus_tag LOCUS_14560 6018 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 7550 6471 gene locus_tag LOCUS_14570 gene ftsZ 7550 6471 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_14570 8614 7823 gene locus_tag LOCUS_14580 8614 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9755 8820 gene locus_tag LOCUS_14590 gene murB 9755 8820 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_14590 10254 9796 gene locus_tag LOCUS_14600 10254 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence074 <1 2884 gene locus_tag LOCUS_14610 <1 2884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890485.1:class I SAM-dependent DNA methyltransferase 2897 3844 gene locus_tag LOCUS_14620 2897 3844 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_14620 3841 4035 gene locus_tag LOCUS_14630 3841 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4020 6371 gene locus_tag LOCUS_14640 4020 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6259 7539 gene locus_tag LOCUS_14650 6259 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7539 8675 gene locus_tag LOCUS_14660 7539 8675 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877011.1 protein_id gnl|my_center|LOCUS_14660 8791 9075 gene locus_tag LOCUS_14670 8791 9075 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_14670 9062 9349 gene locus_tag LOCUS_14680 9062 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9939 9346 gene locus_tag LOCUS_14690 9939 9346 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073408.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence075 <1 927 gene locus_tag LOCUS_14700 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251080.1:cob(I)yrinic acid a,c-diamide adenosyltransferase 929 2692 gene locus_tag LOCUS_14710 929 2692 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812308.1 protein_id gnl|my_center|LOCUS_14710 2790 4112 gene locus_tag LOCUS_14720 gene cobD 2790 4112 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_14720 4147 5274 gene locus_tag LOCUS_14730 gene cbiB 4147 5274 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932620.1 protein_id gnl|my_center|LOCUS_14730 5537 5983 gene locus_tag LOCUS_14740 5537 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5944 6282 gene locus_tag LOCUS_14750 5944 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6469 6726 gene locus_tag LOCUS_14760 6469 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6728 7126 gene locus_tag LOCUS_14770 6728 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7349 8626 gene locus_tag LOCUS_14780 7349 8626 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence076 1904 918 gene locus_tag LOCUS_14790 1904 918 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_14790 3368 2145 gene locus_tag LOCUS_14800 3368 2145 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_14800 3681 4130 gene locus_tag LOCUS_14810 3681 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4206 5183 gene locus_tag LOCUS_14820 4206 5183 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_14820 5301 6560 gene locus_tag LOCUS_14830 gene dcm 5301 6560 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_14830 6565 7353 gene locus_tag LOCUS_14840 6565 7353 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_14840 7361 7825 gene locus_tag LOCUS_14850 7361 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 8178 7933 gene locus_tag LOCUS_14860 8178 7933 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_14860 8546 8370 gene locus_tag LOCUS_14870 8546 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence077 1873 137 gene locus_tag LOCUS_14880 gene guaA 1873 137 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_14880 3051 1876 gene locus_tag LOCUS_14890 3051 1876 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141602.1 protein_id gnl|my_center|LOCUS_14890 4594 3455 gene locus_tag LOCUS_14900 gene ychF 4594 3455 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_14900 4536 4721 gene locus_tag LOCUS_14910 4536 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4762 6087 gene locus_tag LOCUS_14920 4762 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7835 6201 gene locus_tag LOCUS_14930 gene groL 7835 6201 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_14930 8256 7939 gene locus_tag LOCUS_14940 gene groES 8256 7939 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence078 179 736 gene locus_tag LOCUS_14950 179 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1130 852 gene locus_tag LOCUS_14960 1130 852 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813972.1 protein_id gnl|my_center|LOCUS_14960 2600 1263 gene locus_tag LOCUS_14970 2600 1263 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_14970 2909 4195 gene locus_tag LOCUS_14980 2909 4195 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_14980 4586 5254 gene locus_tag LOCUS_14990 4586 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5467 6498 gene locus_tag LOCUS_15000 5467 6498 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_15000 6501 7304 gene locus_tag LOCUS_15010 6501 7304 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461041.1 protein_id gnl|my_center|LOCUS_15010 7354 8472 gene locus_tag LOCUS_15020 7354 8472 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence079 <1 1365 gene locus_tag LOCUS_15030 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814549.1:N-acetylmuramoyl-L-alanine amidase 1552 3384 gene locus_tag LOCUS_15040 gene glmS 1552 3384 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_15040 3392 3910 gene locus_tag LOCUS_15050 3392 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3895 5637 gene locus_tag LOCUS_15060 3895 5637 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_15060 5582 6700 gene locus_tag LOCUS_15070 gene alr 5582 6700 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_15070 6952 8253 gene locus_tag LOCUS_15080 6952 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence080 217 570 gene locus_tag LOCUS_15090 217 570 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_15090 567 2264 gene locus_tag LOCUS_15100 567 2264 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_15100 2268 4391 gene locus_tag LOCUS_15110 gene recG 2268 4391 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_15110 4456 5031 gene locus_tag LOCUS_15120 gene rsmD 4456 5031 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 protein_id gnl|my_center|LOCUS_15120 5028 5519 gene locus_tag LOCUS_15130 gene coaD 5028 5519 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_15130 5532 5990 gene locus_tag LOCUS_15140 5532 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6024 6569 gene locus_tag LOCUS_15150 6024 6569 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227921.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence081 1270 341 gene locus_tag LOCUS_15160 gene xerD 1270 341 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287472.1 protein_id gnl|my_center|LOCUS_15160 2720 1263 gene locus_tag LOCUS_15170 gene trmFO 2720 1263 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_15170 3657 2764 gene locus_tag LOCUS_15180 gene dprA 3657 2764 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082954.1 protein_id gnl|my_center|LOCUS_15180 5144 3654 gene locus_tag LOCUS_15190 5144 3654 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_15190 5584 5144 gene locus_tag LOCUS_15200 5584 5144 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_15200 5951 5763 gene locus_tag LOCUS_15210 5951 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 6008 6469 gene locus_tag LOCUS_15220 6008 6469 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818394.1 protein_id gnl|my_center|LOCUS_15220 6511 7143 gene locus_tag LOCUS_15230 6511 7143 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15230 7616 7377 gene locus_tag LOCUS_15240 7616 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence082 1992 490 gene locus_tag LOCUS_15250 1992 490 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_15250 3078 2080 gene locus_tag LOCUS_15260 3078 2080 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_15260 3326 3538 gene locus_tag LOCUS_15270 3326 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3666 3944 gene locus_tag LOCUS_15280 3666 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4071 4146 gene locus_tag LOCUS_t00460 4071 4146 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4274 5287 gene locus_tag LOCUS_15290 4274 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6290 5349 gene locus_tag LOCUS_15300 6290 5349 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_15300 6795 6292 gene locus_tag LOCUS_15310 6795 6292 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_15310 <7709 6932 gene locus_tag LOCUS_15320 <7709 6932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence083 622 1053 gene locus_tag LOCUS_15330 622 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 1101 1976 gene locus_tag LOCUS_15340 1101 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 2058 3278 gene locus_tag LOCUS_15350 gene mtnA 2058 3278 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_15350 3402 4313 gene locus_tag LOCUS_15360 3402 4313 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_15360 4455 5129 gene locus_tag LOCUS_15370 4455 5129 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257716.1 protein_id gnl|my_center|LOCUS_15370 5512 6456 gene locus_tag LOCUS_15380 5512 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 6639 7484 gene locus_tag LOCUS_15390 6639 7484 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence084 <1 5776 gene locus_tag LOCUS_15400 <1 5776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 6124 6681 gene locus_tag LOCUS_15410 6124 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6877 7203 gene locus_tag LOCUS_15420 6877 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence085 <1 630 gene locus_tag LOCUS_15430 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263290.1:6-carboxytetrahydropterin synthase QueD 693 1379 gene locus_tag LOCUS_15440 693 1379 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_15440 2762 1383 gene locus_tag LOCUS_15450 gene dinB 2762 1383 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_15450 2956 3816 gene locus_tag LOCUS_15460 2956 3816 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_15460 3974 5593 gene locus_tag LOCUS_15470 3974 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 <7154 6128 gene locus_tag LOCUS_15480 <7154 6128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087605.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence086 2 757 gene locus_tag LOCUS_15490 2 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1654 866 gene locus_tag LOCUS_15500 1654 866 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_15500 1875 1702 gene locus_tag LOCUS_15510 1875 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1961 2095 gene locus_tag LOCUS_15520 1961 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3019 2216 gene locus_tag LOCUS_15530 3019 2216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_15530 4076 3102 gene locus_tag LOCUS_15540 4076 3102 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681592.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence087 387 830 gene locus_tag LOCUS_15550 387 830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948662.1 protein_id gnl|my_center|LOCUS_15550 2055 919 gene locus_tag LOCUS_15560 2055 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4224 2155 gene locus_tag LOCUS_15570 gene fusA 4224 2155 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869860.1 protein_id gnl|my_center|LOCUS_15570 4461 5027 gene locus_tag LOCUS_15580 4461 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5036 6457 gene locus_tag LOCUS_15590 5036 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence088 1505 201 gene locus_tag LOCUS_15600 gene purD 1505 201 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_15600 1809 1988 gene locus_tag LOCUS_15610 1809 1988 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_15610 3137 2145 gene locus_tag LOCUS_15620 3137 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4022 3366 gene locus_tag LOCUS_15630 4022 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5516 4194 gene locus_tag LOCUS_15640 5516 4194 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_15640 5751 6776 gene locus_tag LOCUS_15650 5751 6776 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence089 1323 214 gene locus_tag LOCUS_15660 gene gcvT 1323 214 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_15660 2696 1494 gene locus_tag LOCUS_15670 2696 1494 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_15670 3126 3938 gene locus_tag LOCUS_15680 3126 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4351 3914 gene locus_tag LOCUS_15690 4351 3914 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_15690 5664 4348 gene locus_tag LOCUS_15700 5664 4348 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_15700 <6258 5736 gene locus_tag LOCUS_15710 <6258 5736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896350.1:VanW family protein >Feature sequence090 2285 5566 gene locus_tag LOCUS_15720 2285 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence091 1025 300 gene locus_tag LOCUS_15730 gene pyrH 1025 300 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_15730 2061 1174 gene locus_tag LOCUS_15740 gene tsf 2061 1174 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_15740 3055 2135 gene locus_tag LOCUS_15750 3055 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4780 3272 gene locus_tag LOCUS_15760 4780 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence092 235 516 gene locus_tag LOCUS_15770 235 516 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615953.1 protein_id gnl|my_center|LOCUS_15770 661 1920 gene locus_tag LOCUS_15780 661 1920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_15780 1996 2454 gene locus_tag LOCUS_15790 1996 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2491 2874 gene locus_tag LOCUS_15800 gene mscL 2491 2874 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_15800 3039 3761 gene locus_tag LOCUS_15810 3039 3761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459370.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence093 <1 900 gene locus_tag LOCUS_15820 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066795.1:type II CAAX endopeptidase family protein 1083 850 gene locus_tag LOCUS_15830 1083 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1561 1172 gene locus_tag LOCUS_15840 1561 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1863 1576 gene locus_tag LOCUS_15850 1863 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3013 1865 gene locus_tag LOCUS_15860 3013 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3320 4504 gene locus_tag LOCUS_15870 3320 4504 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence094 <1 2770 gene locus_tag LOCUS_15880 <1 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922088.1:tape measure protein 2775 3647 gene locus_tag LOCUS_15890 2775 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence095 397 1614 gene locus_tag LOCUS_15900 397 1614 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_15900 1660 2349 gene locus_tag LOCUS_15910 1660 2349 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_15910 2418 3434 gene locus_tag LOCUS_15920 gene trpS 2418 3434 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_15920 3444 4208 gene locus_tag LOCUS_15930 3444 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence096 685 281 gene locus_tag LOCUS_15940 685 281 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_15940 873 673 gene locus_tag LOCUS_15950 873 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1247 3031 gene locus_tag LOCUS_15960 gene iorA 1247 3031 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_15960 3028 3618 gene locus_tag LOCUS_15970 3028 3618 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_15970 3615 4031 gene locus_tag LOCUS_15980 3615 4031 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence097 <1 1328 gene locus_tag LOCUS_15990 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891852.1:coproporphyrinogen III oxidase family protein 1342 1839 gene locus_tag LOCUS_16000 gene purE 1342 1839 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_16000 1949 3715 gene locus_tag LOCUS_16010 1949 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence098 2694 1537 gene locus_tag LOCUS_16020 2694 1537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_16020 3560 3177 gene locus_tag LOCUS_16030 3560 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence099 1887 634 gene locus_tag LOCUS_16040 gene leuC 1887 634 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_16040 2347 2096 gene locus_tag LOCUS_16050 2347 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 <3560 2493 gene locus_tag LOCUS_16060 <3560 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142287.1:2-isopropylmalate synthase >Feature sequence100 686 12 gene locus_tag LOCUS_16070 686 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_16070 1456 896 gene locus_tag LOCUS_16080 gene raiA 1456 896 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815573.1 protein_id gnl|my_center|LOCUS_16080 2522 1623 gene locus_tag LOCUS_16090 2522 1623 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_16090 <3421 2569 gene locus_tag LOCUS_16100 <3421 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583415.1:amino acid ABC transporter permease >Feature sequence101 490 161 gene locus_tag LOCUS_16110 490 161 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814591.1 protein_id gnl|my_center|LOCUS_16110 2762 495 gene locus_tag LOCUS_16120 2762 495 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462063.1 protein_id gnl|my_center|LOCUS_16120 3103 2807 gene locus_tag LOCUS_16130 3103 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence102 560 336 gene locus_tag LOCUS_16140 560 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2382 850 gene locus_tag LOCUS_16150 gene nuoN 2382 850 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037647.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence103 1278 502 gene locus_tag LOCUS_16160 1278 502 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_16160 <2841 1275 gene locus_tag LOCUS_16170 <2841 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975694.1:histidine kinase >Feature sequence104 <1 1181 gene locus_tag LOCUS_16180 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393219.1:NADH-dependent [FeFe] hydrogenase, group A6 <2586 1570 gene locus_tag LOCUS_16190 <2586 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073033580.1:leucine-rich repeat protein >Feature sequence105 1142 576 gene locus_tag LOCUS_16200 1142 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1852 1166 gene locus_tag LOCUS_16210 1852 1166 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_16210 2542 1865 gene locus_tag LOCUS_16220 gene phoU 2542 1865 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_16220