>Feature sequence01 2542 731 gene locus_tag LOCUS_00010 2542 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2941 2564 gene locus_tag LOCUS_00020 2941 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3055 4299 gene locus_tag LOCUS_00030 3055 4299 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_00030 4466 5347 gene locus_tag LOCUS_00040 4466 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5427 6071 gene locus_tag LOCUS_00050 gene gerS 5427 6071 CDS product germination lipoprotein GerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892025.1 protein_id gnl|my_center|LOCUS_00050 6162 6506 gene locus_tag LOCUS_00060 6162 6506 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_00060 6610 6681 gene locus_tag LOCUS_t00010 6610 6681 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7745 7173 gene locus_tag LOCUS_00070 7745 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8089 11481 gene locus_tag LOCUS_00080 8089 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11478 13664 gene locus_tag LOCUS_00090 11478 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13661 15397 gene locus_tag LOCUS_00100 13661 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15455 15832 gene locus_tag LOCUS_00110 15455 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15862 16356 gene locus_tag LOCUS_00120 15862 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16556 16972 gene locus_tag LOCUS_00130 16556 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17027 17479 gene locus_tag LOCUS_00140 gene dtd 17027 17479 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_00140 18285 17494 gene locus_tag LOCUS_00150 18285 17494 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_00150 18627 18364 gene locus_tag LOCUS_00160 18627 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18937 18656 gene locus_tag LOCUS_00170 18937 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19191 18961 gene locus_tag LOCUS_00180 19191 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19696 19250 gene locus_tag LOCUS_00190 19696 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21080 19701 gene locus_tag LOCUS_00200 21080 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21770 21123 gene locus_tag LOCUS_00210 21770 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22068 21808 gene locus_tag LOCUS_00220 22068 21808 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965057.1 protein_id gnl|my_center|LOCUS_00220 22214 23149 gene locus_tag LOCUS_00230 22214 23149 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00230 23146 23439 gene locus_tag LOCUS_00240 23146 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23417 23911 gene locus_tag LOCUS_00250 23417 23911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25348 23921 gene locus_tag LOCUS_00260 25348 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25571 25966 gene locus_tag LOCUS_00270 25571 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25976 26713 gene locus_tag LOCUS_00280 25976 26713 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_00280 26715 27659 gene locus_tag LOCUS_00290 26715 27659 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_00290 27663 28655 gene locus_tag LOCUS_00300 27663 28655 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_00300 31097 28680 gene locus_tag LOCUS_00310 gene pheT 31097 28680 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_00310 32196 31159 gene locus_tag LOCUS_00320 32196 31159 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_00320 32690 32193 gene locus_tag LOCUS_00330 32690 32193 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966802.1 protein_id gnl|my_center|LOCUS_00330 32862 33611 gene locus_tag LOCUS_00340 32862 33611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33689 34273 gene locus_tag LOCUS_00350 33689 34273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36597 34345 gene locus_tag LOCUS_00360 gene clpA 36597 34345 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932415.1 protein_id gnl|my_center|LOCUS_00360 36914 36594 gene locus_tag LOCUS_00370 36914 36594 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965129.1 protein_id gnl|my_center|LOCUS_00370 37008 38630 gene locus_tag LOCUS_00380 37008 38630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38627 39181 gene locus_tag LOCUS_00390 38627 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39765 39178 gene locus_tag LOCUS_00400 39765 39178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40476 39784 gene locus_tag LOCUS_00410 40476 39784 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964733.1 protein_id gnl|my_center|LOCUS_00410 41858 40476 gene locus_tag LOCUS_00420 41858 40476 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_00420 42246 43160 gene locus_tag LOCUS_00430 gene ptb 42246 43160 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 protein_id gnl|my_center|LOCUS_00430 43163 44233 gene locus_tag LOCUS_00440 gene buk 43163 44233 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_00440 44291 45457 gene locus_tag LOCUS_00450 44291 45457 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_00450 45527 46609 gene locus_tag LOCUS_00460 gene bcd 45527 46609 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_00460 46606 47286 gene locus_tag LOCUS_00470 46606 47286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_00470 47357 47578 gene locus_tag LOCUS_00480 47357 47578 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_00480 47575 48633 gene locus_tag LOCUS_00490 47575 48633 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_00490 48633 49376 gene locus_tag LOCUS_00500 48633 49376 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_00500 49373 49918 gene locus_tag LOCUS_00510 49373 49918 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_00510 49905 50576 gene locus_tag LOCUS_00520 49905 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50684 52051 gene locus_tag LOCUS_00530 50684 52051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52302 53030 gene locus_tag LOCUS_00540 52302 53030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53080 54252 gene locus_tag LOCUS_00550 gene ftsZ 53080 54252 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_00550 54290 54433 gene locus_tag LOCUS_00560 54290 54433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 54484 58086 gene locus_tag LOCUS_00570 gene nifJ 54484 58086 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458899.1 protein_id gnl|my_center|LOCUS_00570 58146 58730 gene locus_tag LOCUS_00580 58146 58730 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_00580 59374 58841 gene locus_tag LOCUS_00590 59374 58841 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_00590 60590 59403 gene locus_tag LOCUS_00600 60590 59403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 61458 60634 gene locus_tag LOCUS_00610 61458 60634 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016729594.1 protein_id gnl|my_center|LOCUS_00610 61548 62543 gene locus_tag LOCUS_00620 61548 62543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62716 63564 gene locus_tag LOCUS_00630 62716 63564 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731865.1 protein_id gnl|my_center|LOCUS_00630 63666 64298 gene locus_tag LOCUS_00640 63666 64298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 64370 64936 gene locus_tag LOCUS_00650 64370 64936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64968 65537 gene locus_tag LOCUS_00660 64968 65537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65973 65593 gene locus_tag LOCUS_00670 65973 65593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 66164 66033 gene locus_tag LOCUS_00680 66164 66033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 67283 66195 gene locus_tag LOCUS_00690 67283 66195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69129 67927 gene locus_tag LOCUS_00700 69129 67927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_00700 70712 69819 gene locus_tag LOCUS_00710 70712 69819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 72202 71558 gene locus_tag LOCUS_00720 72202 71558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 72647 72192 gene locus_tag LOCUS_00730 72647 72192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74599 72644 gene locus_tag LOCUS_00740 74599 72644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 74863 74633 gene locus_tag LOCUS_00750 74863 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75981 74860 gene locus_tag LOCUS_00760 75981 74860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 77199 75991 gene locus_tag LOCUS_00770 77199 75991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 77599 77751 gene locus_tag LOCUS_00780 77599 77751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 78231 78031 gene locus_tag LOCUS_00790 78231 78031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 78856 78245 gene locus_tag LOCUS_00800 78856 78245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 79267 78866 gene locus_tag LOCUS_00810 79267 78866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79652 79260 gene locus_tag LOCUS_00820 79652 79260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 80153 79704 gene locus_tag LOCUS_00830 80153 79704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 80982 80188 gene locus_tag LOCUS_00840 80982 80188 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989953.1 protein_id gnl|my_center|LOCUS_00840 81790 81176 gene locus_tag LOCUS_00850 81790 81176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 82940 81771 gene locus_tag LOCUS_00860 82940 81771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 84319 83132 gene locus_tag LOCUS_00870 84319 83132 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_00870 84764 84306 gene locus_tag LOCUS_00880 84764 84306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 85271 84843 gene locus_tag LOCUS_00890 85271 84843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 86259 85306 gene locus_tag LOCUS_00900 86259 85306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 86468 86259 gene locus_tag LOCUS_00910 86468 86259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 86641 87249 gene locus_tag LOCUS_00920 86641 87249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 87449 87285 gene locus_tag LOCUS_00930 87449 87285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 91938 87559 gene locus_tag LOCUS_00940 91938 87559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 92255 92830 gene locus_tag LOCUS_00950 92255 92830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 93073 94260 gene locus_tag LOCUS_00960 93073 94260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459067.1 protein_id gnl|my_center|LOCUS_00960 94512 95813 gene locus_tag LOCUS_00970 94512 95813 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_00970 97297 95840 gene locus_tag LOCUS_00980 97297 95840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 97573 97406 gene locus_tag LOCUS_00990 97573 97406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 98085 97570 gene locus_tag LOCUS_01000 98085 97570 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836563.1 protein_id gnl|my_center|LOCUS_01000 99155 98127 gene locus_tag LOCUS_01010 99155 98127 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 protein_id gnl|my_center|LOCUS_01010 100152 99325 gene locus_tag LOCUS_01020 100152 99325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 101159 100164 gene locus_tag LOCUS_01030 101159 100164 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01030 101735 101244 gene locus_tag LOCUS_01040 101735 101244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103079 101832 gene locus_tag LOCUS_01050 gene gluD 103079 101832 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358881.1 protein_id gnl|my_center|LOCUS_01050 103297 103163 gene locus_tag LOCUS_01060 103297 103163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 103835 103284 gene locus_tag LOCUS_01070 103835 103284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812934.1 protein_id gnl|my_center|LOCUS_01070 105597 103861 gene locus_tag LOCUS_01080 gene pyk 105597 103861 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_01080 106427 107899 gene locus_tag LOCUS_01090 106427 107899 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_01090 107991 109775 gene locus_tag LOCUS_01100 gene fucI 107991 109775 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_01100 109923 110759 gene locus_tag LOCUS_01110 109923 110759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 112031 110970 gene locus_tag LOCUS_01120 112031 110970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 112977 111943 gene locus_tag LOCUS_01130 112977 111943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113357 112974 gene locus_tag LOCUS_01140 113357 112974 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461150.1 protein_id gnl|my_center|LOCUS_01140 113527 114399 gene locus_tag LOCUS_01150 113527 114399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 114424 116022 gene locus_tag LOCUS_01160 114424 116022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118000 116045 gene locus_tag LOCUS_01170 118000 116045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 118680 117997 gene locus_tag LOCUS_01180 118680 117997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_01180 119611 118769 gene locus_tag LOCUS_01190 119611 118769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 120221 119601 gene locus_tag LOCUS_01200 120221 119601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963845.1 protein_id gnl|my_center|LOCUS_01200 120689 122245 gene locus_tag LOCUS_01210 120689 122245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 123042 122269 gene locus_tag LOCUS_01220 123042 122269 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_01220 123175 123702 gene locus_tag LOCUS_01230 123175 123702 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_01230 123692 124030 gene locus_tag LOCUS_01240 123692 124030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 124011 124322 gene locus_tag LOCUS_01250 124011 124322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 124345 124983 gene locus_tag LOCUS_01260 124345 124983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 128100 125083 gene locus_tag LOCUS_01270 128100 125083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 128864 128103 gene locus_tag LOCUS_01280 128864 128103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 132330 128887 gene locus_tag LOCUS_01290 132330 128887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 133248 132337 gene locus_tag LOCUS_01300 133248 132337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 138470 133263 gene locus_tag LOCUS_01310 138470 133263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 139515 138490 gene locus_tag LOCUS_01320 139515 138490 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_01320 139693 140361 gene locus_tag LOCUS_01330 139693 140361 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_01330 140437 141384 gene locus_tag LOCUS_01340 140437 141384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141387 142142 gene locus_tag LOCUS_01350 gene lieB 141387 142142 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_01350 142519 142301 gene locus_tag LOCUS_01360 142519 142301 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence02 303 88 gene locus_tag LOCUS_01370 303 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 740 432 gene locus_tag LOCUS_01380 740 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2377 737 gene locus_tag LOCUS_01390 2377 737 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_01390 2598 2395 gene locus_tag LOCUS_01400 2598 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 2802 4328 gene locus_tag LOCUS_01410 2802 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 4321 5643 gene locus_tag LOCUS_01420 4321 5643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_01420 5640 6017 gene locus_tag LOCUS_01430 5640 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6059 8296 gene locus_tag LOCUS_01440 6059 8296 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_01440 8821 8333 gene locus_tag LOCUS_01450 8821 8333 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102671.1 protein_id gnl|my_center|LOCUS_01450 9847 8975 gene locus_tag LOCUS_01460 9847 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10691 9966 gene locus_tag LOCUS_01470 10691 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11076 10831 gene locus_tag LOCUS_01480 11076 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11240 12577 gene locus_tag LOCUS_01490 11240 12577 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_01490 13111 12623 gene locus_tag LOCUS_01500 13111 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13229 15163 gene locus_tag LOCUS_01510 13229 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 15183 15620 gene locus_tag LOCUS_01520 15183 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 15688 16101 gene locus_tag LOCUS_01530 15688 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 16394 19036 gene locus_tag LOCUS_01540 16394 19036 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01540 19083 20465 gene locus_tag LOCUS_01550 19083 20465 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01550 20462 20641 gene locus_tag LOCUS_01560 20462 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 20628 21962 gene locus_tag LOCUS_01570 20628 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 21976 22143 gene locus_tag LOCUS_01580 21976 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 22159 22599 gene locus_tag LOCUS_01590 22159 22599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 22651 22986 gene locus_tag LOCUS_01600 22651 22986 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_01600 23780 23082 gene locus_tag LOCUS_01610 23780 23082 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_01610 23988 24383 gene locus_tag LOCUS_01620 23988 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 24553 25824 gene locus_tag LOCUS_01630 24553 25824 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_01630 25903 26922 gene locus_tag LOCUS_01640 25903 26922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 27519 27283 gene locus_tag LOCUS_01650 27519 27283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27449 28594 gene locus_tag LOCUS_01660 27449 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28639 29400 gene locus_tag LOCUS_01670 28639 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 32616 29725 gene locus_tag LOCUS_01680 32616 29725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 32750 33370 gene locus_tag LOCUS_01690 gene pcp 32750 33370 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 protein_id gnl|my_center|LOCUS_01690 33419 36526 gene locus_tag LOCUS_01700 33419 36526 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_01700 36539 37615 gene locus_tag LOCUS_01710 36539 37615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 37578 37808 gene locus_tag LOCUS_01720 37578 37808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 39279 38047 gene locus_tag LOCUS_01730 39279 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 39351 40394 gene locus_tag LOCUS_01740 39351 40394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 41269 40415 gene locus_tag LOCUS_01750 41269 40415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 41403 42305 gene locus_tag LOCUS_01760 gene rbsK 41403 42305 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641604.1 protein_id gnl|my_center|LOCUS_01760 42302 43222 gene locus_tag LOCUS_01770 42302 43222 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_01770 43226 46189 gene locus_tag LOCUS_01780 43226 46189 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_01780 46870 47922 gene locus_tag LOCUS_01790 46870 47922 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_01790 48023 48685 gene locus_tag LOCUS_01800 48023 48685 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_01800 48711 48947 gene locus_tag LOCUS_01810 48711 48947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 48911 49126 gene locus_tag LOCUS_01820 48911 49126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 50122 49631 gene locus_tag LOCUS_01830 50122 49631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 50418 50762 gene locus_tag LOCUS_01840 50418 50762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 50978 51286 gene locus_tag LOCUS_01850 50978 51286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 52977 52219 gene locus_tag LOCUS_01860 52977 52219 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_01860 53197 52970 gene locus_tag LOCUS_01870 53197 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 53491 53757 gene locus_tag LOCUS_01880 53491 53757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 53881 54099 gene locus_tag LOCUS_01890 53881 54099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 54092 54280 gene locus_tag LOCUS_01900 54092 54280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 54366 54920 gene locus_tag LOCUS_01910 54366 54920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 54913 55167 gene locus_tag LOCUS_01920 54913 55167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 55655 55242 gene locus_tag LOCUS_01930 55655 55242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 57240 55732 gene locus_tag LOCUS_01940 57240 55732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01940 59292 57289 gene locus_tag LOCUS_01950 59292 57289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 59829 59320 gene locus_tag LOCUS_01960 59829 59320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 60237 60073 gene locus_tag LOCUS_01970 60237 60073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 60863 60252 gene locus_tag LOCUS_01980 60863 60252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 61621 60875 gene locus_tag LOCUS_01990 61621 60875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 61878 61618 gene locus_tag LOCUS_02000 61878 61618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 62092 61904 gene locus_tag LOCUS_02010 62092 61904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 62509 62312 gene locus_tag LOCUS_02020 62509 62312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 62903 62538 gene locus_tag LOCUS_02030 62903 62538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 63371 62991 gene locus_tag LOCUS_02040 63371 62991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 64188 63388 gene locus_tag LOCUS_02050 64188 63388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 64555 64358 gene locus_tag LOCUS_02060 64555 64358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 64724 64536 gene locus_tag LOCUS_02070 64724 64536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 64900 65661 gene locus_tag LOCUS_02080 64900 65661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 65642 67105 gene locus_tag LOCUS_02090 65642 67105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 67117 67554 gene locus_tag LOCUS_02100 67117 67554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 69007 67775 gene locus_tag LOCUS_02110 69007 67775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 69100 69681 gene locus_tag LOCUS_02120 69100 69681 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_02120 71452 69671 gene locus_tag LOCUS_02130 71452 69671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 72275 71547 gene locus_tag LOCUS_02140 gene sigF 72275 71547 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_02140 72745 72299 gene locus_tag LOCUS_02150 gene spoIIAB 72745 72299 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_02150 73095 72751 gene locus_tag LOCUS_02160 gene spoIIAA 73095 72751 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_02160 74557 73229 gene locus_tag LOCUS_02170 74557 73229 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_02170 79904 74610 gene locus_tag LOCUS_02180 79904 74610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 81008 79941 gene locus_tag LOCUS_02190 81008 79941 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_02190 81877 81149 gene locus_tag LOCUS_02200 81877 81149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 82710 81892 gene locus_tag LOCUS_02210 gene mutM 82710 81892 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 protein_id gnl|my_center|LOCUS_02210 83662 82703 gene locus_tag LOCUS_02220 83662 82703 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458931.1 protein_id gnl|my_center|LOCUS_02220 84304 83882 gene locus_tag LOCUS_02230 84304 83882 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 protein_id gnl|my_center|LOCUS_02230 85058 84306 gene locus_tag LOCUS_02240 85058 84306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 86054 85098 gene locus_tag LOCUS_02250 86054 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 86377 86078 gene locus_tag LOCUS_02260 86377 86078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 89040 86476 gene locus_tag LOCUS_02270 89040 86476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 89995 89042 gene locus_tag LOCUS_02280 89995 89042 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_02280 90850 90026 gene locus_tag LOCUS_02290 90850 90026 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_02290 91090 91917 gene locus_tag LOCUS_02300 91090 91917 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_02300 91950 92864 gene locus_tag LOCUS_02310 91950 92864 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_02310 92885 94861 gene locus_tag LOCUS_02320 92885 94861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 94932 95675 gene locus_tag LOCUS_02330 94932 95675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 96929 95739 gene locus_tag LOCUS_02340 96929 95739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02340 97957 96944 gene locus_tag LOCUS_02350 97957 96944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 98929 97967 gene locus_tag LOCUS_02360 98929 97967 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_02360 100913 99036 gene locus_tag LOCUS_02370 100913 99036 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence03 <1 669 gene locus_tag LOCUS_02380 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048139859.1:4Fe-4S double cluster binding domain-containing protein 1748 666 gene locus_tag LOCUS_02390 1748 666 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964643.1 protein_id gnl|my_center|LOCUS_02390 4183 1820 gene locus_tag LOCUS_02400 4183 1820 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_02400 4472 4275 gene locus_tag LOCUS_02410 4472 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4571 6169 gene locus_tag LOCUS_02420 4571 6169 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_02420 6934 6053 gene locus_tag LOCUS_02430 6934 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 8110 7037 gene locus_tag LOCUS_02440 8110 7037 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_02440 10387 8174 gene locus_tag LOCUS_02450 10387 8174 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459555.1 protein_id gnl|my_center|LOCUS_02450 10754 10485 gene locus_tag LOCUS_02460 10754 10485 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_02460 10950 11531 gene locus_tag LOCUS_02470 10950 11531 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_02470 11528 12061 gene locus_tag LOCUS_02480 11528 12061 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_02480 12563 12635 gene locus_tag LOCUS_t00020 12563 12635 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12886 13272 gene locus_tag LOCUS_02490 12886 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13620 13342 gene locus_tag LOCUS_02500 13620 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 13788 14819 gene locus_tag LOCUS_02510 13788 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 14810 16867 gene locus_tag LOCUS_02520 14810 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18013 17120 gene locus_tag LOCUS_02530 18013 17120 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_02530 18265 19362 gene locus_tag LOCUS_02540 18265 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 19686 19892 gene locus_tag LOCUS_02550 19686 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 20921 20073 gene locus_tag LOCUS_02560 20921 20073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_02560 21711 20908 gene locus_tag LOCUS_02570 21711 20908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_02570 23473 21791 gene locus_tag LOCUS_02580 23473 21791 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_02580 23613 25523 gene locus_tag LOCUS_02590 23613 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 25619 26191 gene locus_tag LOCUS_02600 25619 26191 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_02600 26195 26578 gene locus_tag LOCUS_02610 26195 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 28656 26575 gene locus_tag LOCUS_02620 28656 26575 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_02620 29660 28653 gene locus_tag LOCUS_02630 gene asnA 29660 28653 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427105.1 protein_id gnl|my_center|LOCUS_02630 30428 29673 gene locus_tag LOCUS_02640 30428 29673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_02640 31322 30432 gene locus_tag LOCUS_02650 31322 30432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_02650 32121 31417 gene locus_tag LOCUS_02660 32121 31417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_02660 32960 32118 gene locus_tag LOCUS_02670 32960 32118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_02670 34014 32947 gene locus_tag LOCUS_02680 34014 32947 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_02680 34911 34030 gene locus_tag LOCUS_02690 34911 34030 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_02690 36108 34948 gene locus_tag LOCUS_02700 36108 34948 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_02700 37131 36139 gene locus_tag LOCUS_02710 37131 36139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_02710 40412 37917 gene locus_tag LOCUS_02720 40412 37917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 40625 40777 gene locus_tag LOCUS_02730 40625 40777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 40845 41492 gene locus_tag LOCUS_02740 40845 41492 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_02740 41508 42566 gene locus_tag LOCUS_02750 41508 42566 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_02750 42659 43807 gene locus_tag LOCUS_02760 42659 43807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 43828 47499 gene locus_tag LOCUS_02770 43828 47499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 47521 48636 gene locus_tag LOCUS_02780 47521 48636 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_02780 48657 51743 gene locus_tag LOCUS_02790 48657 51743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 51763 53511 gene locus_tag LOCUS_02800 51763 53511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_02800 53522 54349 gene locus_tag LOCUS_02810 53522 54349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 54330 55940 gene locus_tag LOCUS_02820 54330 55940 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504021.1 protein_id gnl|my_center|LOCUS_02820 57360 55930 gene locus_tag LOCUS_02830 57360 55930 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_02830 58808 57348 gene locus_tag LOCUS_02840 58808 57348 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 protein_id gnl|my_center|LOCUS_02840 59893 58805 gene locus_tag LOCUS_02850 59893 58805 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_02850 60680 59904 gene locus_tag LOCUS_02860 60680 59904 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_02860 61523 60681 gene locus_tag LOCUS_02870 gene kduI 61523 60681 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_02870 62451 61612 gene locus_tag LOCUS_02880 62451 61612 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288161.1 protein_id gnl|my_center|LOCUS_02880 67405 62711 gene locus_tag LOCUS_02890 67405 62711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 73253 67422 gene locus_tag LOCUS_02900 73253 67422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 73371 74003 gene locus_tag LOCUS_02910 73371 74003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 74073 75773 gene locus_tag LOCUS_02920 74073 75773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 75897 75778 gene locus_tag LOCUS_02930 75897 75778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 76015 76281 gene locus_tag LOCUS_02940 76015 76281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 77625 76285 gene locus_tag LOCUS_02950 gene hflX 77625 76285 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_02950 77699 78928 gene locus_tag LOCUS_02960 77699 78928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 78953 79195 gene locus_tag LOCUS_02970 78953 79195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 79275 80438 gene locus_tag LOCUS_02980 79275 80438 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817351.1 protein_id gnl|my_center|LOCUS_02980 80448 81074 gene locus_tag LOCUS_02990 gene upp 80448 81074 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 protein_id gnl|my_center|LOCUS_02990 81144 81656 gene locus_tag LOCUS_03000 81144 81656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 84407 81702 gene locus_tag LOCUS_03010 84407 81702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 84618 85202 gene locus_tag LOCUS_03020 84618 85202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 86525 85209 gene locus_tag LOCUS_03030 86525 85209 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_03030 86665 87261 gene locus_tag LOCUS_03040 86665 87261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 87278 87856 gene locus_tag LOCUS_03050 87278 87856 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_03050 87853 88890 gene locus_tag LOCUS_03060 87853 88890 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_03060 88926 91427 gene locus_tag LOCUS_03070 gene clpC 88926 91427 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_03070 94074 91420 gene locus_tag LOCUS_03080 94074 91420 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073717.1 protein_id gnl|my_center|LOCUS_03080 94638 94210 gene locus_tag LOCUS_03090 94638 94210 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_03090 95751 94702 gene locus_tag LOCUS_03100 95751 94702 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_03100 96761 95790 gene locus_tag LOCUS_03110 96761 95790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_03110 97202 96939 gene locus_tag LOCUS_03120 97202 96939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 98745 97240 gene locus_tag LOCUS_03130 gene gguA 98745 97240 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence04 280 567 gene locus_tag LOCUS_03140 280 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 581 1345 gene locus_tag LOCUS_03150 581 1345 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_03150 1440 3491 gene locus_tag LOCUS_03160 1440 3491 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03160 3651 3866 gene locus_tag LOCUS_03170 3651 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3913 6315 gene locus_tag LOCUS_03180 3913 6315 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_03180 7307 6354 gene locus_tag LOCUS_03190 7307 6354 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_03190 8236 7319 gene locus_tag LOCUS_03200 8236 7319 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_03200 10016 8325 gene locus_tag LOCUS_03210 10016 8325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_03210 10193 11875 gene locus_tag LOCUS_03220 10193 11875 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_03220 12142 11945 gene locus_tag LOCUS_03230 12142 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 12864 12169 gene locus_tag LOCUS_03240 12864 12169 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_03240 12965 14170 gene locus_tag LOCUS_03250 12965 14170 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_03250 14268 15143 gene locus_tag LOCUS_03260 14268 15143 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_03260 15167 16216 gene locus_tag LOCUS_03270 15167 16216 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_03270 16207 17250 gene locus_tag LOCUS_03280 16207 17250 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_03280 17305 18300 gene locus_tag LOCUS_03290 17305 18300 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_03290 18770 18369 gene locus_tag LOCUS_03300 18770 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 18791 18967 gene locus_tag LOCUS_03310 18791 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 20354 19311 gene locus_tag LOCUS_03320 gene mnmA 20354 19311 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_03320 20920 20351 gene locus_tag LOCUS_03330 20920 20351 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_03330 21021 21093 gene locus_tag LOCUS_t00030 21021 21093 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21131 21203 gene locus_tag LOCUS_t00040 21131 21203 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21238 21309 gene locus_tag LOCUS_t00050 21238 21309 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21482 21961 gene locus_tag LOCUS_03340 21482 21961 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_03340 22510 21983 gene locus_tag LOCUS_03350 22510 21983 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_03350 22974 22507 gene locus_tag LOCUS_03360 22974 22507 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_03360 27799 23189 gene locus_tag LOCUS_03370 27799 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 28327 28088 gene locus_tag LOCUS_03380 28327 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28574 30022 gene locus_tag LOCUS_03390 28574 30022 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_03390 30010 30966 gene locus_tag LOCUS_03400 30010 30966 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_03400 30959 31297 gene locus_tag LOCUS_03410 30959 31297 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_03410 32803 31301 gene locus_tag LOCUS_03420 gene glpK 32803 31301 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_03420 34274 32868 gene locus_tag LOCUS_03430 34274 32868 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_03430 34567 34274 gene locus_tag LOCUS_03440 34567 34274 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404931.1 protein_id gnl|my_center|LOCUS_03440 35724 34585 gene locus_tag LOCUS_03450 35724 34585 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_03450 36722 35730 gene locus_tag LOCUS_03460 36722 35730 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_03460 37907 36747 gene locus_tag LOCUS_03470 37907 36747 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_03470 38203 39402 gene locus_tag LOCUS_03480 38203 39402 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_03480 39399 40991 gene locus_tag LOCUS_03490 39399 40991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 40991 41560 gene locus_tag LOCUS_03500 40991 41560 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_03500 41560 41937 gene locus_tag LOCUS_03510 41560 41937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 41970 42704 gene locus_tag LOCUS_03520 41970 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 42986 43420 gene locus_tag LOCUS_03530 42986 43420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 43540 44796 gene locus_tag LOCUS_03540 gene fliD 43540 44796 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_03540 44823 45653 gene locus_tag LOCUS_03550 44823 45653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 46377 45619 gene locus_tag LOCUS_03560 46377 45619 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_03560 47200 46463 gene locus_tag LOCUS_03570 47200 46463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 49973 47340 gene locus_tag LOCUS_03580 49973 47340 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_03580 50572 49988 gene locus_tag LOCUS_03590 50572 49988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 52117 50597 gene locus_tag LOCUS_03600 gene cls 52117 50597 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_03600 52782 52114 gene locus_tag LOCUS_03610 52782 52114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 53099 54481 gene locus_tag LOCUS_03620 53099 54481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 55197 54484 gene locus_tag LOCUS_03630 55197 54484 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_03630 56387 55209 gene locus_tag LOCUS_03640 56387 55209 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_03640 56978 56436 gene locus_tag LOCUS_03650 gene scpB 56978 56436 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_03650 57727 56975 gene locus_tag LOCUS_03660 gene scpA 57727 56975 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_03660 58359 57727 gene locus_tag LOCUS_03670 58359 57727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 59462 58356 gene locus_tag LOCUS_03680 gene mltG 59462 58356 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964992.1 protein_id gnl|my_center|LOCUS_03680 59816 59478 gene locus_tag LOCUS_03690 59816 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 61493 59820 gene locus_tag LOCUS_03700 61493 59820 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_03700 62290 61544 gene locus_tag LOCUS_03710 62290 61544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 62583 62287 gene locus_tag LOCUS_03720 62583 62287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 63973 62663 gene locus_tag LOCUS_03730 gene mtaB 63973 62663 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_03730 65231 63966 gene locus_tag LOCUS_03740 65231 63966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 66235 65210 gene locus_tag LOCUS_03750 66235 65210 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_03750 66806 66300 gene locus_tag LOCUS_03760 gene rimM 66806 66300 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_03760 67039 66803 gene locus_tag LOCUS_03770 67039 66803 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_03770 67294 67049 gene locus_tag LOCUS_03780 gene rpsP 67294 67049 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_03780 68705 67365 gene locus_tag LOCUS_03790 gene ffh 68705 67365 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_03790 69686 69096 gene locus_tag LOCUS_03800 69686 69096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 69809 71620 gene locus_tag LOCUS_03810 gene lepA 69809 71620 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_03810 71625 72233 gene locus_tag LOCUS_03820 71625 72233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 72230 72700 gene locus_tag LOCUS_03830 72230 72700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 72702 73259 gene locus_tag LOCUS_03840 72702 73259 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902829.1 protein_id gnl|my_center|LOCUS_03840 73356 74615 gene locus_tag LOCUS_03850 73356 74615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 75127 74654 gene locus_tag LOCUS_03860 75127 74654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 75869 75174 gene locus_tag LOCUS_03870 75869 75174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 78502 75866 gene locus_tag LOCUS_03880 78502 75866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 79651 78734 gene locus_tag LOCUS_03890 gene pyrB 79651 78734 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_03890 80665 79727 gene locus_tag LOCUS_03900 80665 79727 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_03900 83803 80681 gene locus_tag LOCUS_03910 83803 80681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 84655 83858 gene locus_tag LOCUS_03920 84655 83858 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence05 3162 1072 gene locus_tag LOCUS_03930 gene fusA 3162 1072 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03930 3686 3216 gene locus_tag LOCUS_03940 gene rpsG 3686 3216 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_03940 4252 3839 gene locus_tag LOCUS_03950 gene rpsL 4252 3839 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_03950 4797 7934 gene locus_tag LOCUS_03960 gene ileS 4797 7934 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_03960 7927 9168 gene locus_tag LOCUS_03970 gene pyrC 7927 9168 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_03970 9150 9854 gene locus_tag LOCUS_03980 9150 9854 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_03980 9879 10784 gene locus_tag LOCUS_03990 gene pyrF 9879 10784 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_03990 10777 11568 gene locus_tag LOCUS_04000 10777 11568 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070078.1 protein_id gnl|my_center|LOCUS_04000 11570 12472 gene locus_tag LOCUS_04010 11570 12472 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_04010 12646 12515 gene locus_tag LOCUS_04020 12646 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 13116 12724 gene locus_tag LOCUS_04030 13116 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14321 13170 gene locus_tag LOCUS_04040 gene wecB 14321 13170 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_04040 15196 14342 gene locus_tag LOCUS_04050 15196 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 16628 15249 gene locus_tag LOCUS_04060 16628 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 17205 16699 gene locus_tag LOCUS_04070 17205 16699 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_04070 17601 17209 gene locus_tag LOCUS_04080 17601 17209 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583966.1 protein_id gnl|my_center|LOCUS_04080 19079 17598 gene locus_tag LOCUS_04090 gene glgA 19079 17598 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_04090 19690 19091 gene locus_tag LOCUS_04100 gene recR 19690 19091 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_04100 20038 19694 gene locus_tag LOCUS_04110 20038 19694 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_04110 21488 20064 gene locus_tag LOCUS_04120 21488 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 21674 22432 gene locus_tag LOCUS_04130 21674 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 22458 23492 gene locus_tag LOCUS_04140 22458 23492 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_04140 23514 24308 gene locus_tag LOCUS_04150 gene flgF 23514 24308 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_04150 24394 25215 gene locus_tag LOCUS_04160 gene flgG 24394 25215 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657111.1 protein_id gnl|my_center|LOCUS_04160 25258 25677 gene locus_tag LOCUS_04170 25258 25677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25674 27914 gene locus_tag LOCUS_04180 25674 27914 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_04180 27915 29063 gene locus_tag LOCUS_04190 27915 29063 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_04190 29111 29866 gene locus_tag LOCUS_04200 29111 29866 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858661.1 protein_id gnl|my_center|LOCUS_04200 30124 31341 gene locus_tag LOCUS_04210 30124 31341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582900.1 protein_id gnl|my_center|LOCUS_04210 31359 33257 gene locus_tag LOCUS_04220 gene thrS 31359 33257 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_04220 33258 33713 gene locus_tag LOCUS_04230 33258 33713 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_04230 33733 34896 gene locus_tag LOCUS_04240 33733 34896 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926807.1 protein_id gnl|my_center|LOCUS_04240 35605 34964 gene locus_tag LOCUS_04250 35605 34964 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_04250 36744 35671 gene locus_tag LOCUS_04260 36744 35671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 37379 36744 gene locus_tag LOCUS_04270 37379 36744 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_04270 37641 42683 gene locus_tag LOCUS_04280 37641 42683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 42704 43501 gene locus_tag LOCUS_04290 42704 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 43515 43880 gene locus_tag LOCUS_04300 43515 43880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 43884 44783 gene locus_tag LOCUS_04310 43884 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 46150 44780 gene locus_tag LOCUS_04320 gene rlmD 46150 44780 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_04320 46562 46362 gene locus_tag LOCUS_04330 gene cspA 46562 46362 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 protein_id gnl|my_center|LOCUS_04330 48392 46683 gene locus_tag LOCUS_04340 48392 46683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 48576 49754 gene locus_tag LOCUS_04350 48576 49754 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_04350 50767 49769 gene locus_tag LOCUS_04360 50767 49769 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_04360 51569 50772 gene locus_tag LOCUS_04370 gene etfB 51569 50772 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_04370 52731 51583 gene locus_tag LOCUS_04380 gene acdA 52731 51583 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_04380 53492 52749 gene locus_tag LOCUS_04390 53492 52749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 54664 53588 gene locus_tag LOCUS_04400 54664 53588 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_04400 57636 54661 gene locus_tag LOCUS_04410 57636 54661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 59187 57742 gene locus_tag LOCUS_04420 59187 57742 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_04420 60073 59168 gene locus_tag LOCUS_04430 60073 59168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 60908 60063 gene locus_tag LOCUS_04440 60908 60063 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_04440 62128 60947 gene locus_tag LOCUS_04450 62128 60947 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_04450 62561 62139 gene locus_tag LOCUS_04460 62561 62139 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_04460 63281 62604 gene locus_tag LOCUS_04470 63281 62604 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861815.1 protein_id gnl|my_center|LOCUS_04470 66398 63399 gene locus_tag LOCUS_04480 66398 63399 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_04480 66564 67631 gene locus_tag LOCUS_04490 66564 67631 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_04490 67680 68495 gene locus_tag LOCUS_04500 gene murI 67680 68495 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_04500 68588 69613 gene locus_tag LOCUS_04510 68588 69613 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_04510 69623 70468 gene locus_tag LOCUS_04520 69623 70468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 70468 70977 gene locus_tag LOCUS_04530 70468 70977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 70980 73508 gene locus_tag LOCUS_04540 70980 73508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 73554 74234 gene locus_tag LOCUS_04550 73554 74234 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_04550 74258 75073 gene locus_tag LOCUS_04560 74258 75073 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_04560 75088 76023 gene locus_tag LOCUS_04570 75088 76023 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_04570 76020 77081 gene locus_tag LOCUS_04580 gene nahK 76020 77081 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_04580 77078 78097 gene locus_tag LOCUS_04590 gene galE 77078 78097 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_04590 78048 78848 gene locus_tag LOCUS_04600 78048 78848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 78898 78969 gene locus_tag LOCUS_t00060 78898 78969 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 79729 80199 gene locus_tag LOCUS_04610 79729 80199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 80196 80534 gene locus_tag LOCUS_04620 80196 80534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 >Feature sequence06 <1 860 gene locus_tag LOCUS_04630 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000588613.1:DEAD/DEAH box helicase 876 1997 gene locus_tag LOCUS_04640 876 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2076 3689 gene locus_tag LOCUS_04650 2076 3689 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_04650 4113 7706 gene locus_tag LOCUS_04660 4113 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8242 7940 gene locus_tag LOCUS_04670 8242 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 8909 8385 gene locus_tag LOCUS_04680 gene lepB 8909 8385 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_04680 10194 8920 gene locus_tag LOCUS_04690 gene obgE 10194 8920 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_04690 10596 10300 gene locus_tag LOCUS_04700 gene rpmA 10596 10300 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_04700 10979 10602 gene locus_tag LOCUS_04710 10979 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11280 10969 gene locus_tag LOCUS_04720 gene rplU 11280 10969 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_04720 11522 12604 gene locus_tag LOCUS_04730 gene chvE 11522 12604 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_04730 12754 14226 gene locus_tag LOCUS_04740 gene gguA 12754 14226 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_04740 14294 15463 gene locus_tag LOCUS_04750 gene gguB 14294 15463 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_04750 15465 15818 gene locus_tag LOCUS_04760 15465 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 16490 15813 gene locus_tag LOCUS_04770 16490 15813 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_04770 17340 16540 gene locus_tag LOCUS_04780 17340 16540 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_04780 17446 19425 gene locus_tag LOCUS_04790 gene aguA 17446 19425 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_04790 20349 20276 gene locus_tag LOCUS_t00070 20349 20276 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23640 20716 gene locus_tag LOCUS_04800 23640 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 23746 24378 gene locus_tag LOCUS_04810 23746 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 24395 24682 gene locus_tag LOCUS_04820 24395 24682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 24699 25103 gene locus_tag LOCUS_04830 24699 25103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 30876 25189 gene locus_tag LOCUS_04840 30876 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 31516 30908 gene locus_tag LOCUS_04850 31516 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 32949 31792 gene locus_tag LOCUS_04860 gene spoVV 32949 31792 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_04860 33204 34112 gene locus_tag LOCUS_04870 33204 34112 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_04870 34113 35210 gene locus_tag LOCUS_04880 34113 35210 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_04880 35277 35417 gene locus_tag LOCUS_04890 35277 35417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 35402 37609 gene locus_tag LOCUS_04900 gene gyrA 35402 37609 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_04900 37686 38723 gene locus_tag LOCUS_04910 37686 38723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 39342 38776 gene locus_tag LOCUS_04920 gene ytaF 39342 38776 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861469.1 protein_id gnl|my_center|LOCUS_04920 40244 39414 gene locus_tag LOCUS_04930 gene iolE 40244 39414 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356924.1 protein_id gnl|my_center|LOCUS_04930 40748 40476 gene locus_tag LOCUS_04940 40748 40476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 41892 40762 gene locus_tag LOCUS_04950 41892 40762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 42206 41820 gene locus_tag LOCUS_04960 42206 41820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 43021 42203 gene locus_tag LOCUS_04970 43021 42203 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_04970 44651 43098 gene locus_tag LOCUS_04980 gene rny 44651 43098 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04980 45946 44891 gene locus_tag LOCUS_04990 45946 44891 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_04990 47184 45967 gene locus_tag LOCUS_05000 47184 45967 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671534.1 protein_id gnl|my_center|LOCUS_05000 48663 47218 gene locus_tag LOCUS_05010 48663 47218 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_05010 50510 48666 gene locus_tag LOCUS_05020 50510 48666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_05020 52409 50526 gene locus_tag LOCUS_05030 52409 50526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_05030 52542 53813 gene locus_tag LOCUS_05040 52542 53813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 54113 53865 gene locus_tag LOCUS_05050 54113 53865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 54368 54535 gene locus_tag LOCUS_05060 54368 54535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 54613 57228 gene locus_tag LOCUS_05070 54613 57228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 57234 61385 gene locus_tag LOCUS_05080 57234 61385 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272590.1 protein_id gnl|my_center|LOCUS_05080 62235 61348 gene locus_tag LOCUS_05090 62235 61348 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_05090 63009 62236 gene locus_tag LOCUS_05100 63009 62236 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_05100 64099 62996 gene locus_tag LOCUS_05110 64099 62996 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_05110 65889 64078 gene locus_tag LOCUS_05120 65889 64078 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_05120 66013 66243 gene locus_tag LOCUS_05130 66013 66243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 67062 66271 gene locus_tag LOCUS_05140 67062 66271 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674313.1 protein_id gnl|my_center|LOCUS_05140 68227 67082 gene locus_tag LOCUS_05150 gene rseP 68227 67082 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_05150 69384 68224 gene locus_tag LOCUS_05160 69384 68224 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_05160 70215 69394 gene locus_tag LOCUS_05170 70215 69394 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_05170 70912 70199 gene locus_tag LOCUS_05180 70912 70199 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_05180 71463 70909 gene locus_tag LOCUS_05190 gene frr 71463 70909 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_05190 71989 71492 gene locus_tag LOCUS_05200 71989 71492 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_05200 72705 71989 gene locus_tag LOCUS_05210 gene pyrH 72705 71989 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence07 1265 93 gene locus_tag LOCUS_05220 1265 93 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_05220 1426 2220 gene locus_tag LOCUS_05230 1426 2220 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_05230 2240 3256 gene locus_tag LOCUS_05240 2240 3256 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_05240 3249 4640 gene locus_tag LOCUS_05250 3249 4640 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_05250 6241 4772 gene locus_tag LOCUS_05260 6241 4772 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_05260 7812 6256 gene locus_tag LOCUS_05270 7812 6256 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_05270 11345 7827 gene locus_tag LOCUS_05280 11345 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 15077 11376 gene locus_tag LOCUS_05290 15077 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 15206 16855 gene locus_tag LOCUS_05300 15206 16855 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_05300 17698 16898 gene locus_tag LOCUS_05310 17698 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 18444 17734 gene locus_tag LOCUS_05320 18444 17734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_05320 18713 18985 gene locus_tag LOCUS_05330 18713 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 18987 19325 gene locus_tag LOCUS_05340 18987 19325 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146460.1 protein_id gnl|my_center|LOCUS_05340 20926 19322 gene locus_tag LOCUS_05350 20926 19322 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_05350 21585 20998 gene locus_tag LOCUS_05360 21585 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 21665 21874 gene locus_tag LOCUS_05370 21665 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 22776 21796 gene locus_tag LOCUS_05380 22776 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 23530 22778 gene locus_tag LOCUS_05390 23530 22778 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_05390 24576 23527 gene locus_tag LOCUS_05400 gene vanG 24576 23527 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_05400 25796 24669 gene locus_tag LOCUS_05410 25796 24669 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_05410 26433 25786 gene locus_tag LOCUS_05420 gene vanR 26433 25786 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_05420 27805 26456 gene locus_tag LOCUS_05430 27805 26456 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280099.1 protein_id gnl|my_center|LOCUS_05430 27972 28760 gene locus_tag LOCUS_05440 27972 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 28821 29735 gene locus_tag LOCUS_05450 28821 29735 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860715.1 protein_id gnl|my_center|LOCUS_05450 30696 29779 gene locus_tag LOCUS_05460 30696 29779 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_05460 31603 30731 gene locus_tag LOCUS_05470 31603 30731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446856.1 protein_id gnl|my_center|LOCUS_05470 32128 31697 gene locus_tag LOCUS_05480 32128 31697 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_05480 33174 32158 gene locus_tag LOCUS_05490 33174 32158 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037531.1 protein_id gnl|my_center|LOCUS_05490 35259 33187 gene locus_tag LOCUS_05500 gene topB 35259 33187 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140209.1 protein_id gnl|my_center|LOCUS_05500 35591 35310 gene locus_tag LOCUS_05510 35591 35310 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048297.1 protein_id gnl|my_center|LOCUS_05510 36383 35952 gene locus_tag LOCUS_05520 36383 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 36714 36403 gene locus_tag LOCUS_05530 36714 36403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 37295 36720 gene locus_tag LOCUS_05540 37295 36720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 38040 37336 gene locus_tag LOCUS_05550 38040 37336 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_05550 39612 38050 gene locus_tag LOCUS_05560 39612 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 40348 39614 gene locus_tag LOCUS_05570 40348 39614 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_05570 40560 40351 gene locus_tag LOCUS_05580 40560 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 42336 40705 gene locus_tag LOCUS_05590 42336 40705 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_05590 43030 42326 gene locus_tag LOCUS_05600 43030 42326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 44196 43027 gene locus_tag LOCUS_05610 gene anmK 44196 43027 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274964.1 protein_id gnl|my_center|LOCUS_05610 46257 44251 gene locus_tag LOCUS_05620 gene recG 46257 44251 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_05620 45572 45475 gene locus_tag LOCUS_t00080 45572 45475 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 47942 46254 gene locus_tag LOCUS_05630 47942 46254 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_05630 48310 47954 gene locus_tag LOCUS_05640 48310 47954 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_05640 49413 48334 gene locus_tag LOCUS_05650 gene rpoD 49413 48334 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_05650 51222 49462 gene locus_tag LOCUS_05660 gene dnaG 51222 49462 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_05660 51332 53278 gene locus_tag LOCUS_05670 51332 53278 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_05670 53398 54879 gene locus_tag LOCUS_05680 53398 54879 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_05680 54863 56215 gene locus_tag LOCUS_05690 54863 56215 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_05690 56217 57200 gene locus_tag LOCUS_05700 gene mraY 56217 57200 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_05700 57200 58588 gene locus_tag LOCUS_05710 gene murD 57200 58588 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_05710 58591 59757 gene locus_tag LOCUS_05720 gene spoVE 58591 59757 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_05720 59829 60206 gene locus_tag LOCUS_05730 59829 60206 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_05730 62065 60290 gene locus_tag LOCUS_05740 62065 60290 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_05740 63976 62078 gene locus_tag LOCUS_05750 gene nuoF 63976 62078 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_05750 64484 63990 gene locus_tag LOCUS_05760 gene nuoE 64484 63990 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_05760 65775 64558 gene locus_tag LOCUS_05770 65775 64558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 66247 65765 gene locus_tag LOCUS_05780 gene nrdR 66247 65765 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_05780 66514 66254 gene locus_tag LOCUS_05790 66514 66254 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_05790 66933 66604 gene locus_tag LOCUS_05800 66933 66604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 67124 67918 gene locus_tag LOCUS_05810 gene rpsB 67124 67918 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_05810 67964 68905 gene locus_tag LOCUS_05820 gene tsf 67964 68905 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence08 1376 114 gene locus_tag LOCUS_05830 1376 114 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_05830 2710 1532 gene locus_tag LOCUS_05840 2710 1532 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_05840 3671 2757 gene locus_tag LOCUS_05850 gene ftsX 3671 2757 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963820.1 protein_id gnl|my_center|LOCUS_05850 4350 3652 gene locus_tag LOCUS_05860 gene ftsE 4350 3652 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_05860 5554 4433 gene locus_tag LOCUS_05870 5554 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7775 5622 gene locus_tag LOCUS_05880 7775 5622 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047676.1 protein_id gnl|my_center|LOCUS_05880 8344 7772 gene locus_tag LOCUS_05890 8344 7772 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_05890 9025 8345 gene locus_tag LOCUS_05900 gene cmk 9025 8345 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 protein_id gnl|my_center|LOCUS_05900 10240 9074 gene locus_tag LOCUS_05910 gene thiI 10240 9074 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_05910 10870 10256 gene locus_tag LOCUS_05920 10870 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 12053 10923 gene locus_tag LOCUS_05930 12053 10923 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_05930 12390 12055 gene locus_tag LOCUS_05940 12390 12055 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_05940 14064 12397 gene locus_tag LOCUS_05950 14064 12397 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_05950 14204 14500 gene locus_tag LOCUS_05960 14204 14500 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811866.1 protein_id gnl|my_center|LOCUS_05960 14519 15148 gene locus_tag LOCUS_05970 gene gmk 14519 15148 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_05970 15196 15768 gene locus_tag LOCUS_05980 15196 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15772 18006 gene locus_tag LOCUS_05990 gene priA 15772 18006 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_05990 18022 18534 gene locus_tag LOCUS_06000 gene def 18022 18534 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_06000 18531 19484 gene locus_tag LOCUS_06010 gene fmt 18531 19484 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_06010 19997 19479 gene locus_tag LOCUS_06020 gene dcd 19997 19479 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_06020 20108 22477 gene locus_tag LOCUS_06030 20108 22477 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_06030 22523 23701 gene locus_tag LOCUS_06040 22523 23701 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_06040 25028 23706 gene locus_tag LOCUS_06050 25028 23706 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_06050 25802 25056 gene locus_tag LOCUS_06060 gene truA 25802 25056 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_06060 26596 25799 gene locus_tag LOCUS_06070 26596 25799 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_06070 27471 26593 gene locus_tag LOCUS_06080 27471 26593 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_06080 28307 27447 gene locus_tag LOCUS_06090 28307 27447 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_06090 30277 28304 gene locus_tag LOCUS_06100 gene gyrB 30277 28304 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_06100 31334 30291 gene locus_tag LOCUS_06110 31334 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 33170 31389 gene locus_tag LOCUS_06120 gene aspS 33170 31389 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_06120 34441 33173 gene locus_tag LOCUS_06130 gene hisS 34441 33173 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_06130 35856 34441 gene locus_tag LOCUS_06140 35856 34441 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_06140 36464 35856 gene locus_tag LOCUS_06150 36464 35856 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442291.1 protein_id gnl|my_center|LOCUS_06150 38827 36563 gene locus_tag LOCUS_06160 38827 36563 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_06160 39678 38887 gene locus_tag LOCUS_06170 39678 38887 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963493.1 protein_id gnl|my_center|LOCUS_06170 39810 39971 gene locus_tag LOCUS_06180 39810 39971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 39968 40702 gene locus_tag LOCUS_06190 39968 40702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_06190 40750 41223 gene locus_tag LOCUS_06200 40750 41223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 41230 43149 gene locus_tag LOCUS_06210 gene htpG 41230 43149 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_06210 43213 43764 gene locus_tag LOCUS_06220 gene rsmD 43213 43764 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_06220 43766 44248 gene locus_tag LOCUS_06230 gene coaD 43766 44248 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_06230 44264 44815 gene locus_tag LOCUS_06240 44264 44815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 45579 44839 gene locus_tag LOCUS_06250 gene udp 45579 44839 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_06250 46538 45585 gene locus_tag LOCUS_06260 46538 45585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_06260 47665 46535 gene locus_tag LOCUS_06270 47665 46535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_06270 49187 47676 gene locus_tag LOCUS_06280 49187 47676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_06280 50328 49255 gene locus_tag LOCUS_06290 50328 49255 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_06290 50793 50374 gene locus_tag LOCUS_06300 50793 50374 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_06300 51505 50777 gene locus_tag LOCUS_06310 gene deoC 51505 50777 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_06310 51640 53304 gene locus_tag LOCUS_06320 51640 53304 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_06320 53351 53755 gene locus_tag LOCUS_06330 53351 53755 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_06330 53755 54669 gene locus_tag LOCUS_06340 gene meaB 53755 54669 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_06340 54771 55898 gene locus_tag LOCUS_06350 54771 55898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 55944 56354 gene locus_tag LOCUS_06360 gene mce 55944 56354 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_06360 56385 57929 gene locus_tag LOCUS_06370 56385 57929 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_06370 57984 58241 gene locus_tag LOCUS_06380 57984 58241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 58238 58633 gene locus_tag LOCUS_06390 58238 58633 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_06390 58889 60028 gene locus_tag LOCUS_06400 58889 60028 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_06400 60021 60866 gene locus_tag LOCUS_06410 60021 60866 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869712.1 protein_id gnl|my_center|LOCUS_06410 60885 61403 gene locus_tag LOCUS_06420 60885 61403 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_06420 61735 61400 gene locus_tag LOCUS_06430 61735 61400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 62259 61795 gene locus_tag LOCUS_06440 62259 61795 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887321.1 protein_id gnl|my_center|LOCUS_06440 62831 62292 gene locus_tag LOCUS_06450 62831 62292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 63334 62843 gene locus_tag LOCUS_06460 63334 62843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 63660 63343 gene locus_tag LOCUS_06470 63660 63343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 65278 63689 gene locus_tag LOCUS_06480 65278 63689 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 protein_id gnl|my_center|LOCUS_06480 66143 65382 gene locus_tag LOCUS_06490 gene whiG 66143 65382 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_06490 66519 66205 gene locus_tag LOCUS_06500 66519 66205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 67013 66522 gene locus_tag LOCUS_06510 67013 66522 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_06510 67626 67015 gene locus_tag LOCUS_06520 67626 67015 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence09 1215 451 gene locus_tag LOCUS_06530 gene coaB 1215 451 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379731.1 protein_id gnl|my_center|LOCUS_06530 1810 1220 gene locus_tag LOCUS_06540 1810 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2767 1976 gene locus_tag LOCUS_06550 2767 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3275 2760 gene locus_tag LOCUS_06560 3275 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3923 3471 gene locus_tag LOCUS_06570 3923 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5849 3927 gene locus_tag LOCUS_06580 5849 3927 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 protein_id gnl|my_center|LOCUS_06580 6913 5852 gene locus_tag LOCUS_06590 6913 5852 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_06590 7038 7307 gene locus_tag LOCUS_06600 7038 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9640 7325 gene locus_tag LOCUS_06610 9640 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 10359 9691 gene locus_tag LOCUS_06620 10359 9691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_06620 10529 14458 gene locus_tag LOCUS_06630 10529 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 14544 15419 gene locus_tag LOCUS_06640 14544 15419 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986610.1 protein_id gnl|my_center|LOCUS_06640 16163 17095 gene locus_tag LOCUS_06650 16163 17095 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458931.1 protein_id gnl|my_center|LOCUS_06650 17305 17940 gene locus_tag LOCUS_06660 17305 17940 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817429.1 protein_id gnl|my_center|LOCUS_06660 18453 17968 gene locus_tag LOCUS_06670 18453 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 19680 18601 gene locus_tag LOCUS_06680 19680 18601 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_06680 19777 20583 gene locus_tag LOCUS_06690 19777 20583 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_06690 20691 22169 gene locus_tag LOCUS_06700 gene mttB 20691 22169 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 transl_except (pos:21675..21677,aa:Pyl) note codon on position 329 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_06700 22166 23578 gene locus_tag LOCUS_06710 22166 23578 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_06710 23579 24211 gene locus_tag LOCUS_06720 23579 24211 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_06720 24599 24396 gene locus_tag LOCUS_06730 24599 24396 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_06730 24766 25191 gene locus_tag LOCUS_06740 24766 25191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 25270 26403 gene locus_tag LOCUS_06750 25270 26403 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_06750 27579 26425 gene locus_tag LOCUS_06760 27579 26425 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_06760 28840 27593 gene locus_tag LOCUS_06770 28840 27593 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_06770 29801 28857 gene locus_tag LOCUS_06780 gene miaA 29801 28857 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_06780 31627 29798 gene locus_tag LOCUS_06790 gene mutL 31627 29798 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_06790 31869 31627 gene locus_tag LOCUS_06800 31869 31627 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_06800 32227 31949 gene locus_tag LOCUS_06810 32227 31949 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_06810 34794 32398 gene locus_tag LOCUS_06820 34794 32398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869728.1 protein_id gnl|my_center|LOCUS_06820 35256 34813 gene locus_tag LOCUS_06830 gene rimI 35256 34813 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_06830 35938 35249 gene locus_tag LOCUS_06840 gene tsaB 35938 35249 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_06840 36332 35919 gene locus_tag LOCUS_06850 gene tsaE 36332 35919 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_06850 37557 36334 gene locus_tag LOCUS_06860 37557 36334 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947940.1 protein_id gnl|my_center|LOCUS_06860 37663 39546 gene locus_tag LOCUS_06870 37663 39546 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_06870 39628 40662 gene locus_tag LOCUS_06880 gene tdh 39628 40662 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646014.1 protein_id gnl|my_center|LOCUS_06880 40653 41027 gene locus_tag LOCUS_06890 40653 41027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 41024 42214 gene locus_tag LOCUS_06900 41024 42214 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_06900 42334 42771 gene locus_tag LOCUS_06910 gene rplM 42334 42771 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_06910 42787 43179 gene locus_tag LOCUS_06920 gene rpsI 42787 43179 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_06920 43259 44188 gene locus_tag LOCUS_06930 gene arcC 43259 44188 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_06930 45516 44218 gene locus_tag LOCUS_06940 45516 44218 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_06940 46943 45516 gene locus_tag LOCUS_06950 46943 45516 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_06950 48255 47011 gene locus_tag LOCUS_06960 48255 47011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 49610 48270 gene locus_tag LOCUS_06970 49610 48270 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_06970 49900 50145 gene locus_tag LOCUS_06980 49900 50145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 50914 50693 gene locus_tag LOCUS_06990 50914 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 51462 50911 gene locus_tag LOCUS_07000 51462 50911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 52577 51462 gene locus_tag LOCUS_07010 52577 51462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 52817 52584 gene locus_tag LOCUS_07020 52817 52584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 53308 52832 gene locus_tag LOCUS_07030 53308 52832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 53972 53322 gene locus_tag LOCUS_07040 53972 53322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 55095 54004 gene locus_tag LOCUS_07050 55095 54004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 56989 55427 gene locus_tag LOCUS_07060 56989 55427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 58200 57004 gene locus_tag LOCUS_07070 58200 57004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 59349 58219 gene locus_tag LOCUS_07080 59349 58219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 60280 59351 gene locus_tag LOCUS_07090 60280 59351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence10 1864 140 gene locus_tag LOCUS_07100 1864 140 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_07100 1989 2492 gene locus_tag LOCUS_07110 1989 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2604 4466 gene locus_tag LOCUS_07120 2604 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4492 5394 gene locus_tag LOCUS_07130 4492 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5665 5402 gene locus_tag LOCUS_07140 5665 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6609 5689 gene locus_tag LOCUS_07150 6609 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 6863 7822 gene locus_tag LOCUS_07160 6863 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7925 8887 gene locus_tag LOCUS_07170 7925 8887 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_07170 8901 9773 gene locus_tag LOCUS_07180 8901 9773 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_07180 9842 11554 gene locus_tag LOCUS_07190 9842 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 11629 12153 gene locus_tag LOCUS_07200 gene purE 11629 12153 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_07200 12150 13313 gene locus_tag LOCUS_07210 gene purK 12150 13313 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_07210 13555 14004 gene locus_tag LOCUS_07220 13555 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14134 14847 gene locus_tag LOCUS_07230 14134 14847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_07230 14879 19036 gene locus_tag LOCUS_07240 14879 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 19038 20483 gene locus_tag LOCUS_07250 19038 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 20955 20452 gene locus_tag LOCUS_07260 20955 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 21658 20957 gene locus_tag LOCUS_07270 21658 20957 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_07270 21995 21768 gene locus_tag LOCUS_07280 21995 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 22815 21943 gene locus_tag LOCUS_07290 22815 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 23154 22864 gene locus_tag LOCUS_07300 23154 22864 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286335.1 protein_id gnl|my_center|LOCUS_07300 24005 23199 gene locus_tag LOCUS_07310 24005 23199 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_07310 25236 24310 gene locus_tag LOCUS_07320 gene yesR 25236 24310 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_07320 26246 25233 gene locus_tag LOCUS_07330 26246 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 27849 26317 gene locus_tag LOCUS_07340 27849 26317 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_07340 28833 27952 gene locus_tag LOCUS_07350 28833 27952 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_07350 29699 28845 gene locus_tag LOCUS_07360 29699 28845 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_07360 30095 30544 gene locus_tag LOCUS_07370 30095 30544 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_07370 30541 30942 gene locus_tag LOCUS_07380 30541 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 30939 33458 gene locus_tag LOCUS_07390 30939 33458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966825.1 protein_id gnl|my_center|LOCUS_07390 33483 34169 gene locus_tag LOCUS_07400 33483 34169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_07400 35326 34199 gene locus_tag LOCUS_07410 35326 34199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 35739 35341 gene locus_tag LOCUS_07420 35739 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 35911 36273 gene locus_tag LOCUS_07430 35911 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 36161 36838 gene locus_tag LOCUS_07440 36161 36838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 36861 37730 gene locus_tag LOCUS_07450 36861 37730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_07450 37760 39358 gene locus_tag LOCUS_07460 37760 39358 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_07460 39437 39718 gene locus_tag LOCUS_07470 39437 39718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07470 39688 40395 gene locus_tag LOCUS_07480 39688 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 40651 41523 gene locus_tag LOCUS_07490 40651 41523 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677802.1 protein_id gnl|my_center|LOCUS_07490 42017 41730 gene locus_tag LOCUS_07500 42017 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 42477 44318 gene locus_tag LOCUS_07510 42477 44318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 44758 45780 gene locus_tag LOCUS_07520 44758 45780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795384.1 protein_id gnl|my_center|LOCUS_07520 45797 46723 gene locus_tag LOCUS_07530 45797 46723 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196374.1 protein_id gnl|my_center|LOCUS_07530 46740 47705 gene locus_tag LOCUS_07540 46740 47705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287892.1 protein_id gnl|my_center|LOCUS_07540 47716 48579 gene locus_tag LOCUS_07550 47716 48579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960845.1 protein_id gnl|my_center|LOCUS_07550 48659 50467 gene locus_tag LOCUS_07560 48659 50467 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287894.1 protein_id gnl|my_center|LOCUS_07560 50554 52026 gene locus_tag LOCUS_07570 gene abfB 50554 52026 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_07570 52208 53419 gene locus_tag LOCUS_07580 52208 53419 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_07580 53502 55181 gene locus_tag LOCUS_07590 53502 55181 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_07590 55181 56248 gene locus_tag LOCUS_07600 55181 56248 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_07600 56245 57738 gene locus_tag LOCUS_07610 56245 57738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 60878 57783 gene locus_tag LOCUS_07620 60878 57783 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence11 1080 199 gene locus_tag LOCUS_07630 1080 199 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_07630 2610 1228 gene locus_tag LOCUS_07640 gene flhF 2610 1228 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_07640 4728 2686 gene locus_tag LOCUS_07650 gene flhA 4728 2686 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_07650 5876 4740 gene locus_tag LOCUS_07660 gene flhB 5876 4740 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_07660 6698 5895 gene locus_tag LOCUS_07670 gene fliR 6698 5895 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_07670 6974 6705 gene locus_tag LOCUS_07680 gene fliQ 6974 6705 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_07680 7784 6996 gene locus_tag LOCUS_07690 7784 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8233 7811 gene locus_tag LOCUS_07700 8233 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8608 8243 gene locus_tag LOCUS_07710 8608 8243 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_07710 9928 8660 gene locus_tag LOCUS_07720 9928 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10919 9921 gene locus_tag LOCUS_07730 gene fliM 10919 9921 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656446.1 protein_id gnl|my_center|LOCUS_07730 11478 10978 gene locus_tag LOCUS_07740 11478 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 12588 11503 gene locus_tag LOCUS_07750 12588 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13435 12641 gene locus_tag LOCUS_07760 13435 12641 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_07760 13682 13497 gene locus_tag LOCUS_07770 13682 13497 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_07770 15337 13835 gene locus_tag LOCUS_07780 gene flgE 15337 13835 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_07780 15906 15499 gene locus_tag LOCUS_07790 15906 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 16981 15932 gene locus_tag LOCUS_07800 16981 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18516 17086 gene locus_tag LOCUS_07810 18516 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 19362 18613 gene locus_tag LOCUS_07820 19362 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 19863 19402 gene locus_tag LOCUS_07830 gene fliJ 19863 19402 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392296.1 protein_id gnl|my_center|LOCUS_07830 21249 19942 gene locus_tag LOCUS_07840 gene fliI 21249 19942 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_07840 22143 21292 gene locus_tag LOCUS_07850 22143 21292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23164 22130 gene locus_tag LOCUS_07860 gene fliG 23164 22130 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_07860 24846 23197 gene locus_tag LOCUS_07870 24846 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 25233 24895 gene locus_tag LOCUS_07880 gene fliE 25233 24895 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081562.1 protein_id gnl|my_center|LOCUS_07880 25738 25259 gene locus_tag LOCUS_07890 gene flgC 25738 25259 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_07890 26152 25778 gene locus_tag LOCUS_07900 gene flgB 26152 25778 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 protein_id gnl|my_center|LOCUS_07900 27509 26199 gene locus_tag LOCUS_07910 gene purD 27509 26199 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_07910 28096 27506 gene locus_tag LOCUS_07920 gene purN 28096 27506 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_07920 29145 28084 gene locus_tag LOCUS_07930 gene purM 29145 28084 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_07930 32880 29149 gene locus_tag LOCUS_07940 32880 29149 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_07940 33802 32882 gene locus_tag LOCUS_07950 gene cheV 33802 32882 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_07950 33952 34545 gene locus_tag LOCUS_07960 33952 34545 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_07960 34592 35656 gene locus_tag LOCUS_07970 34592 35656 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_07970 35765 36718 gene locus_tag LOCUS_07980 35765 36718 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_07980 36771 37244 gene locus_tag LOCUS_07990 36771 37244 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_07990 37289 38101 gene locus_tag LOCUS_08000 37289 38101 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_08000 38112 38771 gene locus_tag LOCUS_08010 38112 38771 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_08010 38768 39577 gene locus_tag LOCUS_08020 38768 39577 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_08020 39588 40970 gene locus_tag LOCUS_08030 39588 40970 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_08030 42335 40986 gene locus_tag LOCUS_08040 42335 40986 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_08040 42976 42332 gene locus_tag LOCUS_08050 42976 42332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 43112 43270 gene locus_tag LOCUS_08060 43112 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 43308 44339 gene locus_tag LOCUS_08070 43308 44339 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_08070 45150 44515 gene locus_tag LOCUS_08080 45150 44515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 45293 46852 gene locus_tag LOCUS_08090 45293 46852 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_08090 47355 53159 gene locus_tag LOCUS_08100 47355 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 54055 53261 gene locus_tag LOCUS_08110 gene spo0A 54055 53261 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_08110 54224 54814 gene locus_tag LOCUS_08120 54224 54814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 54861 55178 gene locus_tag LOCUS_08130 gene trxA 54861 55178 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038858.1 protein_id gnl|my_center|LOCUS_08130 55300 57306 gene locus_tag LOCUS_08140 gene uvrB 55300 57306 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_08140 57426 57923 gene locus_tag LOCUS_08150 57426 57923 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902435.1 protein_id gnl|my_center|LOCUS_08150 57929 58402 gene locus_tag LOCUS_08160 57929 58402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 58448 58672 gene locus_tag LOCUS_08170 58448 58672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 58742 59791 gene locus_tag LOCUS_08180 58742 59791 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_08180 59760 60242 gene locus_tag LOCUS_08190 59760 60242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence12 346 107 gene locus_tag LOCUS_08200 346 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 447 662 gene locus_tag LOCUS_08210 447 662 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_08210 2013 655 gene locus_tag LOCUS_08220 gene glmM 2013 655 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860638.1 protein_id gnl|my_center|LOCUS_08220 3447 2107 gene locus_tag LOCUS_08230 3447 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4301 3459 gene locus_tag LOCUS_08240 gene cdaA 4301 3459 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_08240 5691 4555 gene locus_tag LOCUS_08250 5691 4555 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_08250 6198 5692 gene locus_tag LOCUS_08260 6198 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6746 6195 gene locus_tag LOCUS_08270 6746 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7830 6739 gene locus_tag LOCUS_08280 gene ugpC 7830 6739 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_08280 8331 7891 gene locus_tag LOCUS_08290 8331 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8908 8333 gene locus_tag LOCUS_08300 8908 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11099 9009 gene locus_tag LOCUS_08310 11099 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12048 11164 gene locus_tag LOCUS_08320 12048 11164 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_08320 13259 12240 gene locus_tag LOCUS_08330 13259 12240 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_08330 13934 13362 gene locus_tag LOCUS_08340 13934 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14964 13927 gene locus_tag LOCUS_08350 gene ugpC 14964 13927 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262876.1 protein_id gnl|my_center|LOCUS_08350 15809 14976 gene locus_tag LOCUS_08360 15809 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16252 15806 gene locus_tag LOCUS_08370 gene mscL 16252 15806 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08370 16468 17082 gene locus_tag LOCUS_08380 gene udk 16468 17082 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 protein_id gnl|my_center|LOCUS_08380 17079 17366 gene locus_tag LOCUS_08390 17079 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 17368 17613 gene locus_tag LOCUS_08400 17368 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 17669 17591 gene locus_tag LOCUS_t00090 17669 17591 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19005 17944 gene locus_tag LOCUS_08410 gene purR 19005 17944 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 protein_id gnl|my_center|LOCUS_08410 19157 21427 gene locus_tag LOCUS_08420 19157 21427 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845818.1 protein_id gnl|my_center|LOCUS_08420 21442 23214 gene locus_tag LOCUS_08430 21442 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 23275 24225 gene locus_tag LOCUS_08440 23275 24225 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_08440 24238 25149 gene locus_tag LOCUS_08450 24238 25149 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_08450 25152 27761 gene locus_tag LOCUS_08460 25152 27761 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084882.1 protein_id gnl|my_center|LOCUS_08460 27988 27746 gene locus_tag LOCUS_08470 27988 27746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 30441 27985 gene locus_tag LOCUS_08480 gene gyrA 30441 27985 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_08480 30992 30441 gene locus_tag LOCUS_08490 30992 30441 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_08490 32936 31011 gene locus_tag LOCUS_08500 gene gyrB 32936 31011 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_08500 34171 33053 gene locus_tag LOCUS_08510 gene recF 34171 33053 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_08510 35488 34373 gene locus_tag LOCUS_08520 gene dnaN 35488 34373 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_08520 37118 35784 gene locus_tag LOCUS_08530 gene dnaA 37118 35784 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08530 37513 37719 gene locus_tag LOCUS_08540 37513 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 37691 38092 gene locus_tag LOCUS_08550 gene rnpA 37691 38092 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_08550 38089 38298 gene locus_tag LOCUS_08560 38089 38298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 38464 39549 gene locus_tag LOCUS_08570 38464 39549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 39563 40366 gene locus_tag LOCUS_08580 39563 40366 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_08580 40350 41762 gene locus_tag LOCUS_08590 gene mnmE 40350 41762 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_08590 41765 43633 gene locus_tag LOCUS_08600 gene mnmG 41765 43633 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_08600 43623 44363 gene locus_tag LOCUS_08610 gene rsmG 43623 44363 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_08610 44467 45315 gene locus_tag LOCUS_08620 gene noc 44467 45315 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_08620 45315 45725 gene locus_tag LOCUS_08630 45315 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 45779 45988 gene locus_tag LOCUS_08640 45779 45988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 46077 47777 gene locus_tag LOCUS_08650 gene argS 46077 47777 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_08650 47877 48584 gene locus_tag LOCUS_08660 47877 48584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 49344 48643 gene locus_tag LOCUS_08670 49344 48643 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_08670 50495 49527 gene locus_tag LOCUS_08680 50495 49527 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_08680 51483 50488 gene locus_tag LOCUS_08690 51483 50488 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 protein_id gnl|my_center|LOCUS_08690 52373 51516 gene locus_tag LOCUS_08700 52373 51516 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_08700 52545 54065 gene locus_tag LOCUS_08710 52545 54065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_08710 54177 55106 gene locus_tag LOCUS_08720 54177 55106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_08720 55116 56015 gene locus_tag LOCUS_08730 55116 56015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_08730 56029 57024 gene locus_tag LOCUS_08740 56029 57024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence13 623 84 gene locus_tag LOCUS_08750 623 84 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_08750 826 3438 gene locus_tag LOCUS_08760 826 3438 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_08760 4633 3497 gene locus_tag LOCUS_08770 4633 3497 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 protein_id gnl|my_center|LOCUS_08770 5639 4911 gene locus_tag LOCUS_08780 5639 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986641.1 protein_id gnl|my_center|LOCUS_08780 7791 5632 gene locus_tag LOCUS_08790 7791 5632 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986642.1 protein_id gnl|my_center|LOCUS_08790 8647 7793 gene locus_tag LOCUS_08800 8647 7793 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986643.1 protein_id gnl|my_center|LOCUS_08800 10106 8742 gene locus_tag LOCUS_08810 10106 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 10531 10103 gene locus_tag LOCUS_08820 10531 10103 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459510.1 protein_id gnl|my_center|LOCUS_08820 11171 10506 gene locus_tag LOCUS_08830 11171 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 12134 11259 gene locus_tag LOCUS_08840 12134 11259 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_08840 13220 12138 gene locus_tag LOCUS_08850 13220 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814297.1 protein_id gnl|my_center|LOCUS_08850 13560 13204 gene locus_tag LOCUS_08860 13560 13204 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814298.1 protein_id gnl|my_center|LOCUS_08860 13923 13747 gene locus_tag LOCUS_08870 gene rpsU 13923 13747 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_08870 14305 14054 gene locus_tag LOCUS_08880 14305 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 14775 14308 gene locus_tag LOCUS_08890 14775 14308 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_08890 15521 14841 gene locus_tag LOCUS_08900 gene prsW 15521 14841 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_08900 15643 16551 gene locus_tag LOCUS_08910 15643 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 16564 17421 gene locus_tag LOCUS_08920 16564 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 19236 17521 gene locus_tag LOCUS_08930 gene recJ 19236 17521 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987047.1 protein_id gnl|my_center|LOCUS_08930 21410 19233 gene locus_tag LOCUS_08940 gene secDF 21410 19233 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_08940 21543 22064 gene locus_tag LOCUS_08950 21543 22064 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_08950 22710 22213 gene locus_tag LOCUS_08960 gene smpB 22710 22213 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_08960 23180 22710 gene locus_tag LOCUS_08970 23180 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 25678 23267 gene locus_tag LOCUS_08980 gene leuS 25678 23267 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_08980 26299 25727 gene locus_tag LOCUS_08990 26299 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 27470 26313 gene locus_tag LOCUS_09000 27470 26313 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_09000 28112 27480 gene locus_tag LOCUS_09010 28112 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 28227 29048 gene locus_tag LOCUS_09020 28227 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_09020 29146 29430 gene locus_tag LOCUS_09030 29146 29430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 29427 29927 gene locus_tag LOCUS_09040 29427 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 29931 30266 gene locus_tag LOCUS_09050 29931 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 31434 30253 gene locus_tag LOCUS_09060 31434 30253 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241156.1 protein_id gnl|my_center|LOCUS_09060 32537 31434 gene locus_tag LOCUS_09070 32537 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 34752 32740 gene locus_tag LOCUS_09080 34752 32740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 36325 34796 gene locus_tag LOCUS_09090 36325 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 39462 36343 gene locus_tag LOCUS_09100 39462 36343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 40219 39503 gene locus_tag LOCUS_09110 40219 39503 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 protein_id gnl|my_center|LOCUS_09110 40858 40358 gene locus_tag LOCUS_09120 40858 40358 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 protein_id gnl|my_center|LOCUS_09120 41657 40878 gene locus_tag LOCUS_09130 41657 40878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 43139 41673 gene locus_tag LOCUS_09140 gene rho 43139 41673 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 protein_id gnl|my_center|LOCUS_09140 44492 43188 gene locus_tag LOCUS_09150 44492 43188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 44667 45314 gene locus_tag LOCUS_09160 44667 45314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 46438 45311 gene locus_tag LOCUS_09170 46438 45311 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_09170 46546 47190 gene locus_tag LOCUS_09180 46546 47190 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_09180 47303 48592 gene locus_tag LOCUS_09190 47303 48592 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_09190 49050 48589 gene locus_tag LOCUS_09200 49050 48589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 49131 50717 gene locus_tag LOCUS_09210 49131 50717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 50907 51191 gene locus_tag LOCUS_09220 gene groES 50907 51191 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_09220 51347 52972 gene locus_tag LOCUS_09230 gene groL 51347 52972 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_09230 53003 53371 gene locus_tag LOCUS_09240 gene acpS 53003 53371 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_09240 53822 53376 gene locus_tag LOCUS_09250 53822 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 54366 53893 gene locus_tag LOCUS_09260 gene rnhA 54366 53893 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_09260 54442 55158 gene locus_tag LOCUS_09270 54442 55158 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_09270 55158 55865 gene locus_tag LOCUS_09280 55158 55865 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence14 602 42 gene locus_tag LOCUS_09290 602 42 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_09290 1604 648 gene locus_tag LOCUS_09300 gene fba 1604 648 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_09300 1789 4119 gene locus_tag LOCUS_09310 1789 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4202 5962 gene locus_tag LOCUS_09320 4202 5962 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_09320 5946 6815 gene locus_tag LOCUS_09330 5946 6815 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_09330 7384 6803 gene locus_tag LOCUS_09340 7384 6803 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_09340 7724 7374 gene locus_tag LOCUS_09350 7724 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7866 9215 gene locus_tag LOCUS_09360 7866 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9217 10236 gene locus_tag LOCUS_09370 9217 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 10335 11201 gene locus_tag LOCUS_09380 10335 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 11502 11335 gene locus_tag LOCUS_09390 11502 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 11640 13301 gene locus_tag LOCUS_09400 11640 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 13318 14310 gene locus_tag LOCUS_09410 13318 14310 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_09410 14359 14685 gene locus_tag LOCUS_09420 14359 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 14707 15549 gene locus_tag LOCUS_09430 14707 15549 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_09430 16835 15564 gene locus_tag LOCUS_09440 16835 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 18259 16880 gene locus_tag LOCUS_09450 18259 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 19332 18469 gene locus_tag LOCUS_09460 19332 18469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19839 20114 gene locus_tag LOCUS_09470 19839 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 20212 20835 gene locus_tag LOCUS_09480 20212 20835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 20842 21378 gene locus_tag LOCUS_09490 20842 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 21698 21381 gene locus_tag LOCUS_09500 21698 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 21991 22890 gene locus_tag LOCUS_09510 21991 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23312 22893 gene locus_tag LOCUS_09520 23312 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 24622 23414 gene locus_tag LOCUS_09530 24622 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 26539 24623 gene locus_tag LOCUS_09540 26539 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 27280 26723 gene locus_tag LOCUS_09550 27280 26723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 29770 27839 gene locus_tag LOCUS_09560 29770 27839 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_09560 30744 29791 gene locus_tag LOCUS_09570 30744 29791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 32739 31030 gene locus_tag LOCUS_09580 32739 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 34462 32792 gene locus_tag LOCUS_09590 34462 32792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 34911 34666 gene locus_tag LOCUS_09600 34911 34666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35270 34908 gene locus_tag LOCUS_09610 35270 34908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 35749 35558 gene locus_tag LOCUS_09620 35749 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 35932 36129 gene locus_tag LOCUS_09630 35932 36129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 36169 37560 gene locus_tag LOCUS_09640 36169 37560 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_09640 38496 37555 gene locus_tag LOCUS_09650 38496 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 38624 40609 gene locus_tag LOCUS_09660 38624 40609 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_09660 40904 40593 gene locus_tag LOCUS_09670 40904 40593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 42834 41026 gene locus_tag LOCUS_09680 42834 41026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 43488 42856 gene locus_tag LOCUS_09690 43488 42856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 44205 43555 gene locus_tag LOCUS_09700 gene rpe 44205 43555 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_09700 44520 44783 gene locus_tag LOCUS_09710 44520 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 44892 45353 gene locus_tag LOCUS_09720 44892 45353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 45420 47468 gene locus_tag LOCUS_09730 45420 47468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 47484 49763 gene locus_tag LOCUS_09740 47484 49763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 49896 50333 gene locus_tag LOCUS_09750 gene fliW 49896 50333 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_09750 50363 50602 gene locus_tag LOCUS_09760 gene csrA 50363 50602 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_09760 51300 50587 gene locus_tag LOCUS_09770 51300 50587 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257716.1 protein_id gnl|my_center|LOCUS_09770 51611 51297 gene locus_tag LOCUS_09780 51611 51297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence15 <1 2691 gene locus_tag LOCUS_09790 <1 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401468.1:excinuclease ABC subunit UvrA 3517 2735 gene locus_tag LOCUS_09800 3517 2735 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_09800 4809 3496 gene locus_tag LOCUS_09810 4809 3496 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_09810 4970 5320 gene locus_tag LOCUS_09820 4970 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09820 5317 6420 gene locus_tag LOCUS_09830 5317 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09830 6414 7226 gene locus_tag LOCUS_09840 6414 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7219 8367 gene locus_tag LOCUS_09850 7219 8367 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925160.1 protein_id gnl|my_center|LOCUS_09850 8370 9485 gene locus_tag LOCUS_09860 8370 9485 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_09860 9513 11774 gene locus_tag LOCUS_09870 9513 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11974 12411 gene locus_tag LOCUS_09880 11974 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13686 12658 gene locus_tag LOCUS_09890 gene pheS 13686 12658 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_09890 14288 13689 gene locus_tag LOCUS_09900 14288 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16377 14272 gene locus_tag LOCUS_09910 gene topA 16377 14272 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_09910 17584 16433 gene locus_tag LOCUS_09920 gene dprA 17584 16433 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_09920 17835 18437 gene locus_tag LOCUS_09930 17835 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 18459 19229 gene locus_tag LOCUS_09940 18459 19229 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_09940 19271 20041 gene locus_tag LOCUS_09950 gene nagB 19271 20041 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_09950 20038 20340 gene locus_tag LOCUS_09960 gene yhbY 20038 20340 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_09960 20370 21164 gene locus_tag LOCUS_09970 20370 21164 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262778.1 protein_id gnl|my_center|LOCUS_09970 21466 21227 gene locus_tag LOCUS_09980 21466 21227 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_09980 22443 21589 gene locus_tag LOCUS_09990 22443 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 23937 22720 gene locus_tag LOCUS_10000 gene radA 23937 22720 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_10000 24364 23945 gene locus_tag LOCUS_10010 24364 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 25305 24412 gene locus_tag LOCUS_10020 gene rsmI 25305 24412 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_10020 26731 25286 gene locus_tag LOCUS_10030 26731 25286 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_10030 30443 26817 gene locus_tag LOCUS_10040 gene rpoC 30443 26817 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_10040 34552 30491 gene locus_tag LOCUS_10050 gene rpoB 34552 30491 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_10050 34788 35510 gene locus_tag LOCUS_10060 34788 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 36029 35616 gene locus_tag LOCUS_10070 36029 35616 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422821.1 protein_id gnl|my_center|LOCUS_10070 36809 36114 gene locus_tag LOCUS_10080 36809 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 36865 37488 gene locus_tag LOCUS_10090 36865 37488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_10090 37630 37923 gene locus_tag LOCUS_10100 37630 37923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 38015 38836 gene locus_tag LOCUS_10110 38015 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 38858 39832 gene locus_tag LOCUS_10120 38858 39832 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_10120 39892 40605 gene locus_tag LOCUS_10130 39892 40605 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_10130 40602 41444 gene locus_tag LOCUS_10140 40602 41444 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831102.1 protein_id gnl|my_center|LOCUS_10140 41450 41956 gene locus_tag LOCUS_10150 41450 41956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 42088 43380 gene locus_tag LOCUS_10160 42088 43380 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_10160 43551 44426 gene locus_tag LOCUS_10170 43551 44426 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_10170 44423 45247 gene locus_tag LOCUS_10180 44423 45247 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_10180 45315 48365 gene locus_tag LOCUS_10190 45315 48365 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_10190 49458 48502 gene locus_tag LOCUS_10200 49458 48502 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 protein_id gnl|my_center|LOCUS_10200 50527 49451 gene locus_tag LOCUS_10210 50527 49451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_10210 51054 50566 gene locus_tag LOCUS_10220 51054 50566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 52281 51082 gene locus_tag LOCUS_10230 52281 51082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence16 345 464 gene locus_tag LOCUS_10240 345 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 615 1085 gene locus_tag LOCUS_10250 gene grdA 615 1085 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084480923.1 transl_except (pos:744..746,aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10250 1098 2408 gene locus_tag LOCUS_10260 gene grdB 1098 2408 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:2145..2147,aa:Sec) note codon on position 350 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10260 2555 2788 gene locus_tag LOCUS_10270 2555 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2812 5397 gene locus_tag LOCUS_10280 2812 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6114 5428 gene locus_tag LOCUS_10290 6114 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6186 7379 gene locus_tag LOCUS_10300 6186 7379 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965125.1 protein_id gnl|my_center|LOCUS_10300 7481 9937 gene locus_tag LOCUS_10310 7481 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10061 11023 gene locus_tag LOCUS_10320 10061 11023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 protein_id gnl|my_center|LOCUS_10320 11025 12581 gene locus_tag LOCUS_10330 11025 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 12584 14677 gene locus_tag LOCUS_10340 12584 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 14670 15701 gene locus_tag LOCUS_10350 14670 15701 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 protein_id gnl|my_center|LOCUS_10350 15713 16093 gene locus_tag LOCUS_10360 15713 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 16110 16694 gene locus_tag LOCUS_10370 16110 16694 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_10370 16691 16837 gene locus_tag LOCUS_10380 16691 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 16842 17672 gene locus_tag LOCUS_10390 16842 17672 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_10390 17691 19139 gene locus_tag LOCUS_10400 17691 19139 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_10400 19129 20454 gene locus_tag LOCUS_10410 19129 20454 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_10410 20540 20758 gene locus_tag LOCUS_10420 20540 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 20848 21414 gene locus_tag LOCUS_10430 20848 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 22217 21432 gene locus_tag LOCUS_10440 22217 21432 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_10440 23176 22247 gene locus_tag LOCUS_10450 23176 22247 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_10450 24213 23173 gene locus_tag LOCUS_10460 gene holB 24213 23173 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_10460 24650 24210 gene locus_tag LOCUS_10470 24650 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 24982 24653 gene locus_tag LOCUS_10480 24982 24653 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_10480 25140 25916 gene locus_tag LOCUS_10490 25140 25916 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_10490 26926 25913 gene locus_tag LOCUS_10500 gene holA 26926 25913 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_10500 29306 26892 gene locus_tag LOCUS_10510 29306 26892 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_10510 29497 29303 gene locus_tag LOCUS_10520 29497 29303 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_10520 30003 29545 gene locus_tag LOCUS_10530 30003 29545 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_10530 30071 30925 gene locus_tag LOCUS_10540 30071 30925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 31502 30918 gene locus_tag LOCUS_10550 31502 30918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 31634 31894 gene locus_tag LOCUS_10560 31634 31894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 32201 32737 gene locus_tag LOCUS_10570 gene aac(6') 32201 32737 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_10570 32759 34507 gene locus_tag LOCUS_10580 32759 34507 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154881464.1 protein_id gnl|my_center|LOCUS_10580 35791 34526 gene locus_tag LOCUS_10590 35791 34526 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_10590 36217 35792 gene locus_tag LOCUS_10600 36217 35792 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_10600 37100 36270 gene locus_tag LOCUS_10610 37100 36270 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108251.1 protein_id gnl|my_center|LOCUS_10610 37279 37097 gene locus_tag LOCUS_10620 37279 37097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 37427 37203 gene locus_tag LOCUS_10630 37427 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 38675 37524 gene locus_tag LOCUS_10640 38675 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023568.1 protein_id gnl|my_center|LOCUS_10640 39347 38754 gene locus_tag LOCUS_10650 39347 38754 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 protein_id gnl|my_center|LOCUS_10650 40174 39344 gene locus_tag LOCUS_10660 40174 39344 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640334.1 protein_id gnl|my_center|LOCUS_10660 40680 40213 gene locus_tag LOCUS_10670 40680 40213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 41283 40738 gene locus_tag LOCUS_10680 41283 40738 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 protein_id gnl|my_center|LOCUS_10680 42267 41386 gene locus_tag LOCUS_10690 gene rsgA 42267 41386 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_10690 44718 42283 gene locus_tag LOCUS_10700 44718 42283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 45462 44731 gene locus_tag LOCUS_10710 45462 44731 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_10710 46578 45475 gene locus_tag LOCUS_10720 gene rlmN 46578 45475 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_10720 47945 46584 gene locus_tag LOCUS_10730 gene rsmB 47945 46584 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_10730 48015 48098 gene locus_tag LOCUS_t00100 48015 48098 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49288 48257 gene locus_tag LOCUS_10740 49288 48257 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876792.1 protein_id gnl|my_center|LOCUS_10740 50561 49290 gene locus_tag LOCUS_10750 50561 49290 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461090.1 protein_id gnl|my_center|LOCUS_10750 51729 50566 gene locus_tag LOCUS_10760 51729 50566 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence17 896 3319 gene locus_tag LOCUS_10770 gene spoIIE 896 3319 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_10770 3393 4580 gene locus_tag LOCUS_10780 3393 4580 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_10780 4954 6402 gene locus_tag LOCUS_10790 4954 6402 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_10790 8099 6723 gene locus_tag LOCUS_10800 8099 6723 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_10800 8234 9574 gene locus_tag LOCUS_10810 8234 9574 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_10810 9577 10257 gene locus_tag LOCUS_10820 gene argB 9577 10257 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_10820 10272 11189 gene locus_tag LOCUS_10830 gene argF 10272 11189 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_10830 11251 11901 gene locus_tag LOCUS_10840 11251 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 12003 12782 gene locus_tag LOCUS_10850 12003 12782 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878718.1 protein_id gnl|my_center|LOCUS_10850 13315 12779 gene locus_tag LOCUS_10860 13315 12779 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 protein_id gnl|my_center|LOCUS_10860 14548 13319 gene locus_tag LOCUS_10870 14548 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15219 14545 gene locus_tag LOCUS_10880 15219 14545 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_10880 16958 15216 gene locus_tag LOCUS_10890 16958 15216 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_10890 17804 17040 gene locus_tag LOCUS_10900 17804 17040 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_10900 18881 17814 gene locus_tag LOCUS_10910 gene gerLC 18881 17814 CDS product spore germination protein GerLC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681626.1 protein_id gnl|my_center|LOCUS_10910 19972 18878 gene locus_tag LOCUS_10920 19972 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 21460 19982 gene locus_tag LOCUS_10930 21460 19982 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_10930 21546 22505 gene locus_tag LOCUS_10940 21546 22505 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012708.1 protein_id gnl|my_center|LOCUS_10940 22519 23895 gene locus_tag LOCUS_10950 22519 23895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24006 24194 gene locus_tag LOCUS_10960 24006 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 24191 25318 gene locus_tag LOCUS_10970 24191 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 25435 27810 gene locus_tag LOCUS_10980 25435 27810 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_10980 27840 28313 gene locus_tag LOCUS_10990 27840 28313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 28561 28364 gene locus_tag LOCUS_11000 28561 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 28675 28884 gene locus_tag LOCUS_11010 28675 28884 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_11010 30000 28897 gene locus_tag LOCUS_11020 30000 28897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_11020 30950 29997 gene locus_tag LOCUS_11030 30950 29997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 protein_id gnl|my_center|LOCUS_11030 31487 30954 gene locus_tag LOCUS_11040 31487 30954 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_11040 31623 32624 gene locus_tag LOCUS_11050 31623 32624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 33278 32628 gene locus_tag LOCUS_11060 gene aat 33278 32628 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 protein_id gnl|my_center|LOCUS_11060 33387 34265 gene locus_tag LOCUS_11070 33387 34265 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_11070 34530 36482 gene locus_tag LOCUS_11080 34530 36482 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861470.1 protein_id gnl|my_center|LOCUS_11080 36479 37459 gene locus_tag LOCUS_11090 36479 37459 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861934.1 protein_id gnl|my_center|LOCUS_11090 37456 38250 gene locus_tag LOCUS_11100 37456 38250 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362077.1 protein_id gnl|my_center|LOCUS_11100 38247 39038 gene locus_tag LOCUS_11110 38247 39038 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 protein_id gnl|my_center|LOCUS_11110 40518 39052 gene locus_tag LOCUS_11120 40518 39052 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527988.1 protein_id gnl|my_center|LOCUS_11120 41855 40533 gene locus_tag LOCUS_11130 gene melA 41855 40533 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_11130 42770 41883 gene locus_tag LOCUS_11140 42770 41883 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_11140 43676 42783 gene locus_tag LOCUS_11150 43676 42783 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_11150 45403 43745 gene locus_tag LOCUS_11160 45403 43745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 47107 45599 gene locus_tag LOCUS_11170 47107 45599 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_11170 47528 47142 gene locus_tag LOCUS_11180 47528 47142 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367809.1 protein_id gnl|my_center|LOCUS_11180 47889 47509 gene locus_tag LOCUS_11190 47889 47509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 48563 47889 gene locus_tag LOCUS_11200 48563 47889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 48718 49218 gene locus_tag LOCUS_11210 48718 49218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 49248 50642 gene locus_tag LOCUS_11220 gene uxaC 49248 50642 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187445.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence18 674 282 gene locus_tag LOCUS_11230 674 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1110 718 gene locus_tag LOCUS_11240 1110 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11240 1206 2138 gene locus_tag LOCUS_11250 1206 2138 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_11250 2422 3189 gene locus_tag LOCUS_11260 2422 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3179 4027 gene locus_tag LOCUS_11270 3179 4027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_11270 3978 4937 gene locus_tag LOCUS_11280 3978 4937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_11280 6136 5114 gene locus_tag LOCUS_11290 6136 5114 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_11290 7273 6275 gene locus_tag LOCUS_11300 7273 6275 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_11300 8139 7261 gene locus_tag LOCUS_11310 8139 7261 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973777.1 protein_id gnl|my_center|LOCUS_11310 8718 8158 gene locus_tag LOCUS_11320 8718 8158 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023565.1 protein_id gnl|my_center|LOCUS_11320 10079 8814 gene locus_tag LOCUS_11330 gene murA 10079 8814 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_11330 10230 10640 gene locus_tag LOCUS_11340 10230 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 10656 11294 gene locus_tag LOCUS_11350 gene tmk 10656 11294 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677237.1 protein_id gnl|my_center|LOCUS_11350 12467 11370 gene locus_tag LOCUS_11360 12467 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 13930 12464 gene locus_tag LOCUS_11370 13930 12464 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031775.1 protein_id gnl|my_center|LOCUS_11370 14021 15082 gene locus_tag LOCUS_11380 14021 15082 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_11380 15091 15762 gene locus_tag LOCUS_11390 15091 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 16609 15749 gene locus_tag LOCUS_11400 gene ylqF 16609 15749 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723890.1 protein_id gnl|my_center|LOCUS_11400 17213 16611 gene locus_tag LOCUS_11410 17213 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17802 17452 gene locus_tag LOCUS_11420 17802 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 18211 17804 gene locus_tag LOCUS_11430 18211 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 19552 18410 gene locus_tag LOCUS_11440 19552 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 19944 19573 gene locus_tag LOCUS_11450 19944 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 20912 19938 gene locus_tag LOCUS_11460 20912 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21326 23158 gene locus_tag LOCUS_11470 21326 23158 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_11470 23273 23710 gene locus_tag LOCUS_11480 23273 23710 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022708.1 protein_id gnl|my_center|LOCUS_11480 24246 23662 gene locus_tag LOCUS_11490 24246 23662 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_11490 25013 24243 gene locus_tag LOCUS_11500 25013 24243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_11500 26025 25000 gene locus_tag LOCUS_11510 26025 25000 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680086.1 protein_id gnl|my_center|LOCUS_11510 26975 26022 gene locus_tag LOCUS_11520 26975 26022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680087.1 protein_id gnl|my_center|LOCUS_11520 27563 26988 gene locus_tag LOCUS_11530 gene cobC 27563 26988 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 protein_id gnl|my_center|LOCUS_11530 27889 27563 gene locus_tag LOCUS_11540 27889 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 28655 27918 gene locus_tag LOCUS_11550 28655 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 29226 28666 gene locus_tag LOCUS_11560 29226 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 30329 29223 gene locus_tag LOCUS_11570 gene cobT 30329 29223 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_11570 30975 31898 gene locus_tag LOCUS_11580 30975 31898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_11580 31946 32839 gene locus_tag LOCUS_11590 31946 32839 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_11590 32893 34482 gene locus_tag LOCUS_11600 32893 34482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_11600 34577 36412 gene locus_tag LOCUS_11610 34577 36412 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223431.1 protein_id gnl|my_center|LOCUS_11610 36450 37616 gene locus_tag LOCUS_11620 36450 37616 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_11620 37620 39539 gene locus_tag LOCUS_11630 37620 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 40387 39641 gene locus_tag LOCUS_11640 40387 39641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_11640 41402 40485 gene locus_tag LOCUS_11650 41402 40485 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_11650 42751 41480 gene locus_tag LOCUS_11660 42751 41480 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_11660 43074 44276 gene locus_tag LOCUS_11670 43074 44276 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003544617.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence19 4597 2864 gene locus_tag LOCUS_11680 4597 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5925 4621 gene locus_tag LOCUS_11690 5925 4621 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_11690 6409 5969 gene locus_tag LOCUS_11700 gene rplI 6409 5969 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_11700 6929 6456 gene locus_tag LOCUS_11710 6929 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7816 6965 gene locus_tag LOCUS_11720 gene amrS 7816 6965 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583380.1 protein_id gnl|my_center|LOCUS_11720 8727 7822 gene locus_tag LOCUS_11730 8727 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 10195 8729 gene locus_tag LOCUS_11740 10195 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10878 10192 gene locus_tag LOCUS_11750 10878 10192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_11750 10948 11814 gene locus_tag LOCUS_11760 10948 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 12636 12028 gene locus_tag LOCUS_11770 12636 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 16281 12736 gene locus_tag LOCUS_11780 gene mfd 16281 12736 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_11780 16876 16286 gene locus_tag LOCUS_11790 gene pth 16876 16286 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_11790 17899 16889 gene locus_tag LOCUS_11800 17899 16889 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_11800 19036 18041 gene locus_tag LOCUS_11810 19036 18041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_11810 20363 19149 gene locus_tag LOCUS_11820 20363 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 21477 20356 gene locus_tag LOCUS_11830 21477 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 22418 21474 gene locus_tag LOCUS_11840 22418 21474 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 protein_id gnl|my_center|LOCUS_11840 23461 22433 gene locus_tag LOCUS_11850 gene ltaE 23461 22433 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_11850 23571 24014 gene locus_tag LOCUS_11860 23571 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 26693 24033 gene locus_tag LOCUS_11870 gene alaS 26693 24033 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_11870 28109 26700 gene locus_tag LOCUS_11880 28109 26700 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_11880 28212 28661 gene locus_tag LOCUS_11890 28212 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 28910 29299 gene locus_tag LOCUS_11900 28910 29299 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_11900 29301 30122 gene locus_tag LOCUS_11910 29301 30122 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_11910 30299 30105 gene locus_tag LOCUS_11920 30299 30105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 30426 30617 gene locus_tag LOCUS_11930 30426 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 30642 31682 gene locus_tag LOCUS_11940 gene kdd 30642 31682 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_11940 31700 32959 gene locus_tag LOCUS_11950 gene ablA 31700 32959 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_11950 32949 34514 gene locus_tag LOCUS_11960 32949 34514 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_11960 34507 35259 gene locus_tag LOCUS_11970 34507 35259 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_11970 35256 36212 gene locus_tag LOCUS_11980 35256 36212 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_11980 36572 36303 gene locus_tag LOCUS_11990 36572 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 36508 36978 gene locus_tag LOCUS_12000 36508 36978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 37100 39271 gene locus_tag LOCUS_12010 37100 39271 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_12010 39287 40006 gene locus_tag LOCUS_12020 39287 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903230.1 protein_id gnl|my_center|LOCUS_12020 40038 40244 gene locus_tag LOCUS_12030 gene copZ 40038 40244 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 protein_id gnl|my_center|LOCUS_12030 40309 40848 gene locus_tag LOCUS_12040 40309 40848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 40927 43764 gene locus_tag LOCUS_12050 40927 43764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence20 <1 670 gene locus_tag LOCUS_12060 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002901079.1:tRNA epoxyqueuosine(34) reductase QueG 672 1199 gene locus_tag LOCUS_12070 gene recU 672 1199 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_12070 1225 2031 gene locus_tag LOCUS_12080 1225 2031 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_12080 2390 2034 gene locus_tag LOCUS_12090 2390 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2412 2660 gene locus_tag LOCUS_12100 2412 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6953 2694 gene locus_tag LOCUS_12110 6953 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7073 8890 gene locus_tag LOCUS_12120 7073 8890 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023898.1 protein_id gnl|my_center|LOCUS_12120 9069 8914 gene locus_tag LOCUS_12130 9069 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 10019 9093 gene locus_tag LOCUS_12140 10019 9093 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930902.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 10195 11643 gene locus_tag LOCUS_12150 10195 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 11644 12846 gene locus_tag LOCUS_12160 11644 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 12852 15569 gene locus_tag LOCUS_12170 12852 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 15596 16060 gene locus_tag LOCUS_12180 15596 16060 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_12180 16077 17759 gene locus_tag LOCUS_12190 gene dnaK 16077 17759 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_12190 17775 19709 gene locus_tag LOCUS_12200 17775 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 19714 21324 gene locus_tag LOCUS_12210 gene dnaK 19714 21324 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990713.1 protein_id gnl|my_center|LOCUS_12210 21525 23174 gene locus_tag LOCUS_12220 gene dnaK 21525 23174 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_12220 23506 24093 gene locus_tag LOCUS_12230 23506 24093 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775209.1 protein_id gnl|my_center|LOCUS_12230 24145 26217 gene locus_tag LOCUS_12240 24145 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 26246 27400 gene locus_tag LOCUS_12250 26246 27400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 27471 27638 gene locus_tag LOCUS_12260 27471 27638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 28292 28044 gene locus_tag LOCUS_12270 28292 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 29390 28398 gene locus_tag LOCUS_12280 29390 28398 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_12280 30372 29383 gene locus_tag LOCUS_12290 30372 29383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_12290 31279 30380 gene locus_tag LOCUS_12300 31279 30380 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_12300 32263 31292 gene locus_tag LOCUS_12310 gene appB 32263 31292 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_12310 34057 32384 gene locus_tag LOCUS_12320 34057 32384 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730661.1 protein_id gnl|my_center|LOCUS_12320 34849 34274 gene locus_tag LOCUS_12330 34849 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 35375 34872 gene locus_tag LOCUS_12340 35375 34872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 35490 36356 gene locus_tag LOCUS_12350 35490 36356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 36334 37020 gene locus_tag LOCUS_12360 36334 37020 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_12360 37070 37261 gene locus_tag LOCUS_12370 37070 37261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 38629 37490 gene locus_tag LOCUS_12380 38629 37490 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_12380 38744 39919 gene locus_tag LOCUS_12390 38744 39919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 39937 40941 gene locus_tag LOCUS_12400 39937 40941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 40957 42102 gene locus_tag LOCUS_12410 40957 42102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence21 227 424 gene locus_tag LOCUS_12420 227 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 860 2296 gene locus_tag LOCUS_12430 860 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2988 4679 gene locus_tag LOCUS_12440 2988 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4669 5250 gene locus_tag LOCUS_12450 4669 5250 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_12450 5254 5643 gene locus_tag LOCUS_12460 5254 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5683 6945 gene locus_tag LOCUS_12470 5683 6945 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721244.1 protein_id gnl|my_center|LOCUS_12470 7113 6991 gene locus_tag LOCUS_12480 7113 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7165 7794 gene locus_tag LOCUS_12490 7165 7794 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550464.1 protein_id gnl|my_center|LOCUS_12490 7841 8431 gene locus_tag LOCUS_12500 7841 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8481 10646 gene locus_tag LOCUS_12510 gene gnpA 8481 10646 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_12510 10639 11568 gene locus_tag LOCUS_12520 10639 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11651 12457 gene locus_tag LOCUS_12530 11651 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 12461 12919 gene locus_tag LOCUS_12540 12461 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 14032 12965 gene locus_tag LOCUS_12550 14032 12965 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_12550 14708 14022 gene locus_tag LOCUS_12560 14708 14022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_12560 16606 14759 gene locus_tag LOCUS_12570 16606 14759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814582.1 protein_id gnl|my_center|LOCUS_12570 18369 16603 gene locus_tag LOCUS_12580 18369 16603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_12580 18862 18413 gene locus_tag LOCUS_12590 18862 18413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814584.1 protein_id gnl|my_center|LOCUS_12590 18984 19163 gene locus_tag LOCUS_12600 18984 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 19239 20861 gene locus_tag LOCUS_12610 19239 20861 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_12610 22038 20815 gene locus_tag LOCUS_12620 gene spoIVB 22038 20815 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944619.1 protein_id gnl|my_center|LOCUS_12620 23007 22072 gene locus_tag LOCUS_12630 23007 22072 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357656.1 protein_id gnl|my_center|LOCUS_12630 23122 23931 gene locus_tag LOCUS_12640 23122 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 24071 26677 gene locus_tag LOCUS_12650 gene secA 24071 26677 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_12650 26850 27812 gene locus_tag LOCUS_12660 gene prfB 26850 27812 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_12660 27809 28573 gene locus_tag LOCUS_12670 27809 28573 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 protein_id gnl|my_center|LOCUS_12670 28540 29448 gene locus_tag LOCUS_12680 28540 29448 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_12680 29450 30085 gene locus_tag LOCUS_12690 29450 30085 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_12690 30112 30843 gene locus_tag LOCUS_12700 30112 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 30931 31476 gene locus_tag LOCUS_12710 gene spoVT 30931 31476 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_12710 31556 32629 gene locus_tag LOCUS_12720 gene uxuA 31556 32629 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_12720 32620 34134 gene locus_tag LOCUS_12730 32620 34134 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_12730 35093 34143 gene locus_tag LOCUS_12740 35093 34143 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 protein_id gnl|my_center|LOCUS_12740 35292 35086 gene locus_tag LOCUS_12750 35292 35086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 35611 35222 gene locus_tag LOCUS_12760 35611 35222 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_12760 35790 36572 gene locus_tag LOCUS_12770 35790 36572 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425887.1 protein_id gnl|my_center|LOCUS_12770 37326 36559 gene locus_tag LOCUS_12780 37326 36559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 37471 38196 gene locus_tag LOCUS_12790 37471 38196 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_12790 38206 38541 gene locus_tag LOCUS_12800 38206 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 38513 38779 gene locus_tag LOCUS_12810 38513 38779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 40215 38782 gene locus_tag LOCUS_12820 gene proS 40215 38782 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_12820 40990 40562 gene locus_tag LOCUS_12830 40990 40562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 41267 41103 gene locus_tag LOCUS_12840 41267 41103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 41400 41558 gene locus_tag LOCUS_12850 41400 41558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 41592 41885 gene locus_tag LOCUS_12860 41592 41885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence22 1706 108 gene locus_tag LOCUS_12870 1706 108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_12870 2410 1703 gene locus_tag LOCUS_12880 2410 1703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_12880 3205 2534 gene locus_tag LOCUS_12890 3205 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4599 3202 gene locus_tag LOCUS_12900 4599 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4776 5363 gene locus_tag LOCUS_12910 4776 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5778 5308 gene locus_tag LOCUS_12920 5778 5308 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_12920 5844 7658 gene locus_tag LOCUS_12930 gene rnr 5844 7658 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_12930 7691 8770 gene locus_tag LOCUS_12940 gene serC 7691 8770 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_12940 8783 9946 gene locus_tag LOCUS_12950 8783 9946 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_12950 9961 11208 gene locus_tag LOCUS_12960 9961 11208 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_12960 11219 12451 gene locus_tag LOCUS_12970 11219 12451 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_12970 13228 12503 gene locus_tag LOCUS_12980 13228 12503 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_12980 14439 13225 gene locus_tag LOCUS_12990 14439 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 14643 16952 gene locus_tag LOCUS_13000 14643 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_13000 17635 16940 gene locus_tag LOCUS_13010 17635 16940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_13010 18470 17622 gene locus_tag LOCUS_13020 18470 17622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186003.1 protein_id gnl|my_center|LOCUS_13020 19647 18463 gene locus_tag LOCUS_13030 19647 18463 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_13030 20594 19662 gene locus_tag LOCUS_13040 20594 19662 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080271.1 protein_id gnl|my_center|LOCUS_13040 21882 20698 gene locus_tag LOCUS_13050 21882 20698 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_13050 22971 21991 gene locus_tag LOCUS_13060 22971 21991 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_13060 23105 24472 gene locus_tag LOCUS_13070 23105 24472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 24615 29747 gene locus_tag LOCUS_13080 24615 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 31074 29824 gene locus_tag LOCUS_13090 31074 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 31242 32669 gene locus_tag LOCUS_13100 gene gltX 31242 32669 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_13100 32666 33226 gene locus_tag LOCUS_13110 32666 33226 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_13110 34387 33275 gene locus_tag LOCUS_13120 34387 33275 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861531.1 protein_id gnl|my_center|LOCUS_13120 35700 34399 gene locus_tag LOCUS_13130 35700 34399 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_13130 35956 35678 gene locus_tag LOCUS_13140 35956 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 36331 35957 gene locus_tag LOCUS_13150 36331 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 37405 36368 gene locus_tag LOCUS_13160 37405 36368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 38781 37420 gene locus_tag LOCUS_13170 38781 37420 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 protein_id gnl|my_center|LOCUS_13170 39312 40331 gene locus_tag LOCUS_13180 gene metN 39312 40331 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence23 667 233 gene locus_tag LOCUS_13190 667 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 582 2579 gene locus_tag LOCUS_13200 582 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3219 2950 gene locus_tag LOCUS_13210 3219 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3308 4684 gene locus_tag LOCUS_13220 3308 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4838 6739 gene locus_tag LOCUS_13230 4838 6739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_13230 6872 7870 gene locus_tag LOCUS_13240 6872 7870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584069.1 protein_id gnl|my_center|LOCUS_13240 7883 8737 gene locus_tag LOCUS_13250 7883 8737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582576.1 protein_id gnl|my_center|LOCUS_13250 8741 9721 gene locus_tag LOCUS_13260 8741 9721 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080134.1 protein_id gnl|my_center|LOCUS_13260 9723 10697 gene locus_tag LOCUS_13270 9723 10697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_13270 10719 11867 gene locus_tag LOCUS_13280 10719 11867 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_13280 11883 12953 gene locus_tag LOCUS_13290 11883 12953 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_13290 13002 14216 gene locus_tag LOCUS_13300 13002 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14266 15285 gene locus_tag LOCUS_13310 14266 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 15437 15356 gene locus_tag LOCUS_t00110 15437 15356 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15559 17511 gene locus_tag LOCUS_13320 15559 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 17615 18562 gene locus_tag LOCUS_13330 17615 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 18562 19683 gene locus_tag LOCUS_13340 18562 19683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722317.1 protein_id gnl|my_center|LOCUS_13340 19696 20727 gene locus_tag LOCUS_13350 19696 20727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854337.1 protein_id gnl|my_center|LOCUS_13350 20739 21683 gene locus_tag LOCUS_13360 20739 21683 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 protein_id gnl|my_center|LOCUS_13360 22633 21698 gene locus_tag LOCUS_13370 22633 21698 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_13370 24483 22645 gene locus_tag LOCUS_13380 24483 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 24574 25539 gene locus_tag LOCUS_13390 24574 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 26057 25578 gene locus_tag LOCUS_13400 26057 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 27426 26086 gene locus_tag LOCUS_13410 gene mgtE 27426 26086 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_13410 27644 29419 gene locus_tag LOCUS_13420 27644 29419 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_13420 29486 29872 gene locus_tag LOCUS_13430 29486 29872 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_13430 32338 30080 gene locus_tag LOCUS_13440 32338 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 32692 32429 gene locus_tag LOCUS_13450 gene rpsT 32692 32429 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_13450 32808 33815 gene locus_tag LOCUS_13460 gene gpr 32808 33815 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_13460 34513 33818 gene locus_tag LOCUS_13470 34513 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 34676 36037 gene locus_tag LOCUS_13480 34676 36037 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_13480 36056 36763 gene locus_tag LOCUS_13490 36056 36763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 38010 36820 gene locus_tag LOCUS_13500 38010 36820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 38180 39100 gene locus_tag LOCUS_13510 38180 39100 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_13510 39159 40112 gene locus_tag LOCUS_13520 39159 40112 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence24 1256 141 gene locus_tag LOCUS_13530 gene glgD 1256 141 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_13530 2542 1253 gene locus_tag LOCUS_13540 2542 1253 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418638.1 protein_id gnl|my_center|LOCUS_13540 2697 3116 gene locus_tag LOCUS_13550 gene fliS 2697 3116 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_13550 3116 3823 gene locus_tag LOCUS_13560 gene ispD 3116 3823 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288284.1 protein_id gnl|my_center|LOCUS_13560 3858 5819 gene locus_tag LOCUS_13570 3858 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5832 6410 gene locus_tag LOCUS_13580 5832 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6617 8632 gene locus_tag LOCUS_13590 6617 8632 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680599.1 protein_id gnl|my_center|LOCUS_13590 8629 9390 gene locus_tag LOCUS_13600 8629 9390 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965864.1 protein_id gnl|my_center|LOCUS_13600 9383 10276 gene locus_tag LOCUS_13610 gene ftcD 9383 10276 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_13610 10273 11514 gene locus_tag LOCUS_13620 gene hutI 10273 11514 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 protein_id gnl|my_center|LOCUS_13620 11508 12140 gene locus_tag LOCUS_13630 11508 12140 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666838.1 protein_id gnl|my_center|LOCUS_13630 12133 13647 gene locus_tag LOCUS_13640 gene hutH 12133 13647 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_13640 14009 13653 gene locus_tag LOCUS_13650 gene spoVAE 14009 13653 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_13650 15039 14020 gene locus_tag LOCUS_13660 gene spoVAD 15039 14020 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13660 15501 15043 gene locus_tag LOCUS_13670 gene spoVAC 15501 15043 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_13670 15949 15512 gene locus_tag LOCUS_13680 gene spoVAB 15949 15512 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572936.1 protein_id gnl|my_center|LOCUS_13680 16571 15933 gene locus_tag LOCUS_13690 gene spoVAA 16571 15933 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_13690 17328 16690 gene locus_tag LOCUS_13700 17328 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 18236 17400 gene locus_tag LOCUS_13710 18236 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 21363 18247 gene locus_tag LOCUS_13720 21363 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 22391 21378 gene locus_tag LOCUS_13730 22391 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 22455 22604 gene locus_tag LOCUS_13740 22455 22604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 23339 22722 gene locus_tag LOCUS_13750 23339 22722 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_13750 24008 25078 gene locus_tag LOCUS_13760 24008 25078 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_13760 25071 25763 gene locus_tag LOCUS_13770 gene prmC 25071 25763 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_13770 25747 26811 gene locus_tag LOCUS_13780 gene prfA 25747 26811 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_13780 28041 26857 gene locus_tag LOCUS_13790 28041 26857 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_13790 28186 28677 gene locus_tag LOCUS_13800 28186 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 28683 28940 gene locus_tag LOCUS_13810 28683 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 28941 29267 gene locus_tag LOCUS_13820 28941 29267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 29280 29999 gene locus_tag LOCUS_13830 29280 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 29996 30229 gene locus_tag LOCUS_13840 29996 30229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 30233 30589 gene locus_tag LOCUS_13850 30233 30589 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_13850 30596 32173 gene locus_tag LOCUS_13860 30596 32173 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_13860 33009 32176 gene locus_tag LOCUS_13870 33009 32176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_13870 33431 33006 gene locus_tag LOCUS_13880 33431 33006 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107774.1 protein_id gnl|my_center|LOCUS_13880 34015 33590 gene locus_tag LOCUS_13890 34015 33590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 34596 34150 gene locus_tag LOCUS_13900 34596 34150 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_13900 35604 34780 gene locus_tag LOCUS_13910 35604 34780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279145.1 protein_id gnl|my_center|LOCUS_13910 36238 35735 gene locus_tag LOCUS_13920 36238 35735 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_13920 37035 36271 gene locus_tag LOCUS_13930 37035 36271 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969755.1 protein_id gnl|my_center|LOCUS_13930 38332 37145 gene locus_tag LOCUS_13940 38332 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 38666 38325 gene locus_tag LOCUS_13950 38666 38325 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence25 230 712 gene locus_tag LOCUS_13960 230 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 751 1434 gene locus_tag LOCUS_13970 gene radC 751 1434 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_13970 1496 1735 gene locus_tag LOCUS_13980 1496 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3130 1766 gene locus_tag LOCUS_13990 3130 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3746 3252 gene locus_tag LOCUS_14000 3746 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4745 3927 gene locus_tag LOCUS_14010 4745 3927 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_14010 5280 4738 gene locus_tag LOCUS_14020 5280 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5488 6048 gene locus_tag LOCUS_14030 5488 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6915 6049 gene locus_tag LOCUS_14040 6915 6049 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462326.1 protein_id gnl|my_center|LOCUS_14040 7695 6928 gene locus_tag LOCUS_14050 gene soj 7695 6928 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_14050 8432 7836 gene locus_tag LOCUS_14060 8432 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 9102 8458 gene locus_tag LOCUS_14070 9102 8458 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_14070 10413 9163 gene locus_tag LOCUS_14080 10413 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 11332 10400 gene locus_tag LOCUS_14090 11332 10400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 protein_id gnl|my_center|LOCUS_14090 12146 11352 gene locus_tag LOCUS_14100 12146 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13325 12180 gene locus_tag LOCUS_14110 gene dnaJ 13325 12180 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_14110 15278 13434 gene locus_tag LOCUS_14120 gene dnaK 15278 13434 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_14120 15851 15339 gene locus_tag LOCUS_14130 15851 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 16997 15915 gene locus_tag LOCUS_14140 gene hrcA 16997 15915 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_14140 18207 17095 gene locus_tag LOCUS_14150 gene hemW 18207 17095 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_14150 18320 18775 gene locus_tag LOCUS_14160 gene rpiB 18320 18775 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_14160 18744 19961 gene locus_tag LOCUS_14170 18744 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 20005 20364 gene locus_tag LOCUS_14180 gene rsfS 20005 20364 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_14180 20767 23433 gene locus_tag LOCUS_14190 20767 23433 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_14190 24110 23472 gene locus_tag LOCUS_14200 gene pgmB 24110 23472 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_14200 26080 24107 gene locus_tag LOCUS_14210 26080 24107 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 protein_id gnl|my_center|LOCUS_14210 28157 26061 gene locus_tag LOCUS_14220 28157 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 29833 28241 gene locus_tag LOCUS_14230 29833 28241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_14230 30795 29884 gene locus_tag LOCUS_14240 30795 29884 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_14240 31736 30810 gene locus_tag LOCUS_14250 31736 30810 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_14250 32078 33073 gene locus_tag LOCUS_14260 32078 33073 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_14260 33519 33085 gene locus_tag LOCUS_14270 33519 33085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 34278 33610 gene locus_tag LOCUS_14280 34278 33610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 37647 34294 gene locus_tag LOCUS_14290 37647 34294 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_14290 37980 37771 gene locus_tag LOCUS_14300 37980 37771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence26 228 419 gene locus_tag LOCUS_14310 228 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1710 472 gene locus_tag LOCUS_14320 gene egsA 1710 472 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_14320 2389 1697 gene locus_tag LOCUS_14330 2389 1697 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209426.1 protein_id gnl|my_center|LOCUS_14330 2853 2419 gene locus_tag LOCUS_14340 2853 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2966 3448 gene locus_tag LOCUS_14350 2966 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3438 4805 gene locus_tag LOCUS_14360 gene miaB 3438 4805 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_14360 5767 4787 gene locus_tag LOCUS_14370 5767 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 8105 5733 gene locus_tag LOCUS_14380 8105 5733 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_14380 8899 8117 gene locus_tag LOCUS_14390 8899 8117 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_14390 9338 8937 gene locus_tag LOCUS_14400 9338 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9753 9310 gene locus_tag LOCUS_14410 9753 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9818 10867 gene locus_tag LOCUS_14420 9818 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 11381 11788 gene locus_tag LOCUS_14430 11381 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11879 13003 gene locus_tag LOCUS_14440 11879 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 14273 13197 gene locus_tag LOCUS_14450 gene ychF 14273 13197 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_14450 14398 15303 gene locus_tag LOCUS_14460 14398 15303 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_14460 15317 16135 gene locus_tag LOCUS_14470 15317 16135 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_14470 16307 16807 gene locus_tag LOCUS_14480 16307 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 16809 17873 gene locus_tag LOCUS_14490 16809 17873 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462321.1 protein_id gnl|my_center|LOCUS_14490 18475 18008 gene locus_tag LOCUS_14500 18475 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 19580 18489 gene locus_tag LOCUS_14510 19580 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 19975 19580 gene locus_tag LOCUS_14520 19975 19580 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_14520 20896 20081 gene locus_tag LOCUS_14530 20896 20081 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_14530 21401 20985 gene locus_tag LOCUS_14540 21401 20985 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_14540 25560 21478 gene locus_tag LOCUS_14550 25560 21478 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_14550 26632 25532 gene locus_tag LOCUS_14560 gene ispG 26632 25532 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_14560 26978 26625 gene locus_tag LOCUS_14570 26978 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 27739 26990 gene locus_tag LOCUS_14580 27739 26990 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_14580 29014 27740 gene locus_tag LOCUS_14590 29014 27740 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_14590 29091 29162 gene locus_tag LOCUS_t00120 29091 29162 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29223 29293 gene locus_tag LOCUS_t00130 29223 29293 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29452 29877 gene locus_tag LOCUS_14600 29452 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 29886 30227 gene locus_tag LOCUS_14610 29886 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 30306 31385 gene locus_tag LOCUS_14620 30306 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 31401 33779 gene locus_tag LOCUS_14630 31401 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 33822 34124 gene locus_tag LOCUS_14640 33822 34124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 34129 34329 gene locus_tag LOCUS_14650 34129 34329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 35250 34336 gene locus_tag LOCUS_14660 35250 34336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 36628 35291 gene locus_tag LOCUS_14670 36628 35291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 36690 37208 gene locus_tag LOCUS_14680 36690 37208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence27 315 914 gene locus_tag LOCUS_14690 315 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14690 862 1068 gene locus_tag LOCUS_14700 862 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1960 1055 gene locus_tag LOCUS_14710 1960 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2205 2771 gene locus_tag LOCUS_14720 gene rplJ 2205 2771 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_14720 2808 3185 gene locus_tag LOCUS_14730 gene rplL 2808 3185 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_14730 3256 3747 gene locus_tag LOCUS_14740 3256 3747 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_14740 3777 5609 gene locus_tag LOCUS_14750 gene hflX 3777 5609 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 protein_id gnl|my_center|LOCUS_14750 5622 6110 gene locus_tag LOCUS_14760 5622 6110 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_14760 7820 6159 gene locus_tag LOCUS_14770 7820 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8276 7857 gene locus_tag LOCUS_14780 8276 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8275 8499 gene locus_tag LOCUS_14790 8275 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9744 10115 gene locus_tag LOCUS_14800 9744 10115 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_14800 10115 10975 gene locus_tag LOCUS_14810 10115 10975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_14810 10965 11642 gene locus_tag LOCUS_14820 10965 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 12723 11926 gene locus_tag LOCUS_14830 12723 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 13101 13541 gene locus_tag LOCUS_14840 13101 13541 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_14840 13538 14317 gene locus_tag LOCUS_14850 13538 14317 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547977.1 protein_id gnl|my_center|LOCUS_14850 14346 14933 gene locus_tag LOCUS_14860 14346 14933 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_14860 14977 15852 gene locus_tag LOCUS_14870 14977 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 15876 16253 gene locus_tag LOCUS_14880 15876 16253 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817449.1 protein_id gnl|my_center|LOCUS_14880 17247 16945 gene locus_tag LOCUS_14890 17247 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 17491 17231 gene locus_tag LOCUS_14900 17491 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 18394 17741 gene locus_tag LOCUS_14910 18394 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 19279 18458 gene locus_tag LOCUS_14920 19279 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 20893 19340 gene locus_tag LOCUS_14930 20893 19340 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_14930 21889 20948 gene locus_tag LOCUS_14940 21889 20948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_14940 22824 21889 gene locus_tag LOCUS_14950 gene rmgP 22824 21889 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_14950 24757 23063 gene locus_tag LOCUS_14960 24757 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 25982 24744 gene locus_tag LOCUS_14970 25982 24744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 27469 26057 gene locus_tag LOCUS_14980 27469 26057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 27593 31702 gene locus_tag LOCUS_14990 27593 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 31699 33021 gene locus_tag LOCUS_15000 31699 33021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33005 33880 gene locus_tag LOCUS_15010 33005 33880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence28 2068 1511 gene locus_tag LOCUS_15020 gene efp 2068 1511 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_15020 2347 2093 gene locus_tag LOCUS_15030 2347 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2903 2400 gene locus_tag LOCUS_15040 2903 2400 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_15040 3870 2896 gene locus_tag LOCUS_15050 gene lgt 3870 2896 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048192.1 protein_id gnl|my_center|LOCUS_15050 4713 3958 gene locus_tag LOCUS_15060 4713 3958 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_15060 5553 4717 gene locus_tag LOCUS_15070 5553 4717 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_15070 6838 5546 gene locus_tag LOCUS_15080 6838 5546 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986762.1 protein_id gnl|my_center|LOCUS_15080 7371 6838 gene locus_tag LOCUS_15090 7371 6838 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_15090 7525 9231 gene locus_tag LOCUS_15100 gene ftsH 7525 9231 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092281764.1 protein_id gnl|my_center|LOCUS_15100 9483 9256 gene locus_tag LOCUS_15110 9483 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 9563 9802 gene locus_tag LOCUS_15120 9563 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 9836 10297 gene locus_tag LOCUS_15130 9836 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 10312 10497 gene locus_tag LOCUS_15140 gene rpmF 10312 10497 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_15140 10502 11551 gene locus_tag LOCUS_15150 gene plsX 10502 11551 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_15150 11538 11768 gene locus_tag LOCUS_15160 gene acpP 11538 11768 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966840.1 protein_id gnl|my_center|LOCUS_15160 11796 12506 gene locus_tag LOCUS_15170 gene rncS 11796 12506 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_15170 13021 12503 gene locus_tag LOCUS_15180 13021 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 13402 13031 gene locus_tag LOCUS_15190 13402 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16959 13489 gene locus_tag LOCUS_15200 16959 13489 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_15200 17034 18260 gene locus_tag LOCUS_15210 17034 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 18344 19243 gene locus_tag LOCUS_15220 18344 19243 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_15220 19672 19520 gene locus_tag LOCUS_15230 19672 19520 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_15230 21532 19694 gene locus_tag LOCUS_15240 21532 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 22694 21543 gene locus_tag LOCUS_15250 22694 21543 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966122.1 protein_id gnl|my_center|LOCUS_15250 23254 22715 gene locus_tag LOCUS_15260 23254 22715 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_15260 24623 23319 gene locus_tag LOCUS_15270 24623 23319 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_15270 25581 24742 gene locus_tag LOCUS_15280 25581 24742 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257038.1 protein_id gnl|my_center|LOCUS_15280 26578 25571 gene locus_tag LOCUS_15290 26578 25571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257039.1 protein_id gnl|my_center|LOCUS_15290 27849 26599 gene locus_tag LOCUS_15300 27849 26599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257040.1 protein_id gnl|my_center|LOCUS_15300 28865 27861 gene locus_tag LOCUS_15310 28865 27861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257041.1 protein_id gnl|my_center|LOCUS_15310 30875 28995 gene locus_tag LOCUS_15320 30875 28995 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257042.1 protein_id gnl|my_center|LOCUS_15320 31078 33495 gene locus_tag LOCUS_15330 31078 33495 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_15330 33649 34542 gene locus_tag LOCUS_15340 gene citG 33649 34542 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704364.1 protein_id gnl|my_center|LOCUS_15340 35448 34648 gene locus_tag LOCUS_15350 35448 34648 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461467.1 protein_id gnl|my_center|LOCUS_15350 <36262 35576 gene locus_tag LOCUS_15360 <36262 35576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161798788.1:ABC transporter permease >Feature sequence29 509 3523 gene locus_tag LOCUS_15370 509 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3520 4116 gene locus_tag LOCUS_15380 3520 4116 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_15380 4202 6727 gene locus_tag LOCUS_15390 4202 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7246 6728 gene locus_tag LOCUS_15400 7246 6728 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_15400 7779 7252 gene locus_tag LOCUS_15410 gene nrdG 7779 7252 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_15410 10162 7757 gene locus_tag LOCUS_15420 10162 7757 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_15420 10348 12561 gene locus_tag LOCUS_15430 gene pcrA 10348 12561 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_15430 12598 13773 gene locus_tag LOCUS_15440 12598 13773 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_15440 14075 13782 gene locus_tag LOCUS_15450 14075 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 14491 14072 gene locus_tag LOCUS_15460 14491 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 14759 14831 gene locus_tag LOCUS_t00140 14759 14831 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14878 14951 gene locus_tag LOCUS_t00150 14878 14951 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15039 15557 gene locus_tag LOCUS_15470 15039 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202392502.1 protein_id gnl|my_center|LOCUS_15470 15567 18197 gene locus_tag LOCUS_15480 15567 18197 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989583.1 protein_id gnl|my_center|LOCUS_15480 18533 18189 gene locus_tag LOCUS_15490 gene pylSn 18533 18189 CDS product pyrrolysine--tRNA(Pyl) ligase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462266.1 protein_id gnl|my_center|LOCUS_15490 18604 18534 gene locus_tag LOCUS_t00160 18604 18534 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 19566 18727 gene locus_tag LOCUS_15500 gene pylSc 19566 18727 CDS product pyrrolysine--tRNA(Pyl) ligase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462270.1 protein_id gnl|my_center|LOCUS_15500 19690 21051 gene locus_tag LOCUS_15510 19690 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 21084 21731 gene locus_tag LOCUS_15520 21084 21731 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065003.1 protein_id gnl|my_center|LOCUS_15520 21733 23124 gene locus_tag LOCUS_15530 gene mtbB 21733 23124 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TN68 transl_except (pos:22780..22782,aa:Pyl) note codon on position 350 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_15530 23121 24038 gene locus_tag LOCUS_15540 23121 24038 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081179.1 protein_id gnl|my_center|LOCUS_15540 24047 24727 gene locus_tag LOCUS_15550 24047 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 24731 26209 gene locus_tag LOCUS_15560 24731 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 26193 26969 gene locus_tag LOCUS_15570 gene pylD 26193 26969 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020210.1 protein_id gnl|my_center|LOCUS_15570 26971 27996 gene locus_tag LOCUS_15580 gene pylB 26971 27996 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945507.1 protein_id gnl|my_center|LOCUS_15580 27989 29092 gene locus_tag LOCUS_15590 gene pylC 27989 29092 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462268.1 protein_id gnl|my_center|LOCUS_15590 29947 29045 gene locus_tag LOCUS_15600 29947 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 30453 29947 gene locus_tag LOCUS_15610 30453 29947 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_15610 31621 30632 gene locus_tag LOCUS_15620 gene floA 31621 30632 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_15620 32150 31650 gene locus_tag LOCUS_15630 32150 31650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 33644 32259 gene locus_tag LOCUS_15640 gene amrA 33644 32259 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_15640 <35353 33688 gene locus_tag LOCUS_15650 <35353 33688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002360456.1:ABC transporter ATP-binding protein/permease >Feature sequence30 185 1285 gene locus_tag LOCUS_15660 185 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1575 1790 gene locus_tag LOCUS_15670 1575 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1853 2707 gene locus_tag LOCUS_15680 1853 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 3281 3559 gene locus_tag LOCUS_15690 3281 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3552 4049 gene locus_tag LOCUS_15700 3552 4049 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_15700 4591 4519 gene locus_tag LOCUS_t00170 4591 4519 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4691 7258 gene locus_tag LOCUS_15710 gene mutS 4691 7258 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_15710 7392 7574 gene locus_tag LOCUS_15720 7392 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948524.1 protein_id gnl|my_center|LOCUS_15720 7601 7858 gene locus_tag LOCUS_15730 7601 7858 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002981.1 protein_id gnl|my_center|LOCUS_15730 8430 7855 gene locus_tag LOCUS_15740 8430 7855 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494716.1 protein_id gnl|my_center|LOCUS_15740 8924 8427 gene locus_tag LOCUS_15750 8924 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9466 8984 gene locus_tag LOCUS_15760 9466 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 11782 9536 gene locus_tag LOCUS_15770 11782 9536 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_15770 12374 11784 gene locus_tag LOCUS_15780 12374 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 13333 12392 gene locus_tag LOCUS_15790 gene rsmH 13333 12392 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_15790 13763 13335 gene locus_tag LOCUS_15800 gene mraZ 13763 13335 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_15800 13978 14709 gene locus_tag LOCUS_15810 13978 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 14898 16115 gene locus_tag LOCUS_15820 gene tyrS 14898 16115 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_15820 16801 16265 gene locus_tag LOCUS_15830 16801 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 17823 16864 gene locus_tag LOCUS_15840 gene rpoA 17823 16864 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_15840 18570 17926 gene locus_tag LOCUS_15850 gene rpsD 18570 17926 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966386.1 protein_id gnl|my_center|LOCUS_15850 18984 18583 gene locus_tag LOCUS_15860 gene rpsK 18984 18583 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_15860 19438 19070 gene locus_tag LOCUS_15870 gene rpsM 19438 19070 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_15870 19820 19602 gene locus_tag LOCUS_15880 gene infA 19820 19602 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_15880 20187 19909 gene locus_tag LOCUS_15890 20187 19909 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393914.1 protein_id gnl|my_center|LOCUS_15890 20985 20188 gene locus_tag LOCUS_15900 gene map 20985 20188 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_15900 21631 21002 gene locus_tag LOCUS_15910 21631 21002 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_15910 22901 21642 gene locus_tag LOCUS_15920 gene secY 22901 21642 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_15920 23344 22901 gene locus_tag LOCUS_15930 gene rplO 23344 22901 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_15930 23563 23363 gene locus_tag LOCUS_15940 gene rpmD 23563 23363 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_15940 24136 23636 gene locus_tag LOCUS_15950 gene rpsE 24136 23636 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_15950 24528 24160 gene locus_tag LOCUS_15960 gene rplR 24528 24160 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_15960 25086 24544 gene locus_tag LOCUS_15970 gene rplF 25086 24544 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_15970 25518 25108 gene locus_tag LOCUS_15980 gene rpsH 25518 25108 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_15980 25772 25587 gene locus_tag LOCUS_15990 25772 25587 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_15990 26393 25851 gene locus_tag LOCUS_16000 gene rplE 26393 25851 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_16000 26797 26435 gene locus_tag LOCUS_16010 gene rplX 26797 26435 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_16010 27166 26798 gene locus_tag LOCUS_16020 gene rplN 27166 26798 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_16020 27520 27182 gene locus_tag LOCUS_16030 27520 27182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 27761 27549 gene locus_tag LOCUS_16040 gene rpmC 27761 27549 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_16040 28263 27751 gene locus_tag LOCUS_16050 gene rplP 28263 27751 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_16050 29102 28263 gene locus_tag LOCUS_16060 gene rpsC 29102 28263 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_16060 29523 29113 gene locus_tag LOCUS_16070 gene rplV 29523 29113 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894484.1 protein_id gnl|my_center|LOCUS_16070 29821 29537 gene locus_tag LOCUS_16080 gene rpsS 29821 29537 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403584.1 protein_id gnl|my_center|LOCUS_16080 30717 29884 gene locus_tag LOCUS_16090 gene rplB 30717 29884 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727696.1 protein_id gnl|my_center|LOCUS_16090 31074 30772 gene locus_tag LOCUS_16100 gene rplW 31074 30772 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_16100 31694 31074 gene locus_tag LOCUS_16110 gene rplD 31694 31074 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_16110 32340 31711 gene locus_tag LOCUS_16120 gene rplC 32340 31711 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_16120 32672 32361 gene locus_tag LOCUS_16130 gene rpsJ 32672 32361 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_16130 33186 33308 gene locus_tag LOCUS_16140 33186 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 33305 33487 gene locus_tag LOCUS_16150 33305 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 34274 33798 gene locus_tag LOCUS_16160 34274 33798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 34439 34669 gene locus_tag LOCUS_16170 34439 34669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 34682 35164 gene locus_tag LOCUS_16180 34682 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence31 1614 4067 gene locus_tag LOCUS_16190 1614 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4247 7594 gene locus_tag LOCUS_16200 4247 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 8576 7599 gene locus_tag LOCUS_16210 8576 7599 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_16210 9577 8573 gene locus_tag LOCUS_16220 9577 8573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_16220 10495 9596 gene locus_tag LOCUS_16230 10495 9596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_16230 11439 10492 gene locus_tag LOCUS_16240 11439 10492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_16240 13052 11520 gene locus_tag LOCUS_16250 13052 11520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_16250 14889 13219 gene locus_tag LOCUS_16260 14889 13219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_16260 15875 14955 gene locus_tag LOCUS_16270 15875 14955 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_16270 16829 15888 gene locus_tag LOCUS_16280 16829 15888 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_16280 16998 19412 gene locus_tag LOCUS_16290 16998 19412 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582726.1 protein_id gnl|my_center|LOCUS_16290 20464 19409 gene locus_tag LOCUS_16300 gene yesR 20464 19409 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_16300 20664 21956 gene locus_tag LOCUS_16310 20664 21956 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582824.1 protein_id gnl|my_center|LOCUS_16310 22063 22962 gene locus_tag LOCUS_16320 22063 22962 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_16320 22959 23837 gene locus_tag LOCUS_16330 22959 23837 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972767.1 protein_id gnl|my_center|LOCUS_16330 23890 26019 gene locus_tag LOCUS_16340 gene gnpA 23890 26019 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068765.1 protein_id gnl|my_center|LOCUS_16340 26832 26026 gene locus_tag LOCUS_16350 26832 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 27302 26889 gene locus_tag LOCUS_16360 27302 26889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 29395 27464 gene locus_tag LOCUS_16370 29395 27464 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_16370 29733 30794 gene locus_tag LOCUS_16380 29733 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 30797 31369 gene locus_tag LOCUS_16390 30797 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 32696 31569 gene locus_tag LOCUS_16400 32696 31569 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263500.1 protein_id gnl|my_center|LOCUS_16400 33145 33765 gene locus_tag LOCUS_16410 33145 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 34044 33972 gene locus_tag LOCUS_t00180 34044 33972 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 1063 1296 gene locus_tag LOCUS_16420 1063 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1247 2140 gene locus_tag LOCUS_16430 1247 2140 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931616.1 protein_id gnl|my_center|LOCUS_16430 2153 3163 gene locus_tag LOCUS_16440 2153 3163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_16440 3156 3977 gene locus_tag LOCUS_16450 3156 3977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_16450 3974 4696 gene locus_tag LOCUS_16460 3974 4696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_16460 4740 5963 gene locus_tag LOCUS_16470 4740 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6076 6552 gene locus_tag LOCUS_16480 6076 6552 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_16480 6565 6840 gene locus_tag LOCUS_16490 6565 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6830 7183 gene locus_tag LOCUS_16500 gene mnhG 6830 7183 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031338.1 protein_id gnl|my_center|LOCUS_16500 7187 8140 gene locus_tag LOCUS_16510 7187 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8145 8516 gene locus_tag LOCUS_16520 8145 8516 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080098.1 protein_id gnl|my_center|LOCUS_16520 8543 10135 gene locus_tag LOCUS_16530 8543 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 11039 10119 gene locus_tag LOCUS_16540 11039 10119 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_16540 12645 11044 gene locus_tag LOCUS_16550 12645 11044 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_16550 13459 12671 gene locus_tag LOCUS_16560 13459 12671 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_16560 15438 13534 gene locus_tag LOCUS_16570 gene metG 15438 13534 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_16570 15548 16225 gene locus_tag LOCUS_16580 15548 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 16251 16595 gene locus_tag LOCUS_16590 16251 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 16595 17683 gene locus_tag LOCUS_16600 16595 17683 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868952.1 protein_id gnl|my_center|LOCUS_16600 19912 18584 gene locus_tag LOCUS_16610 gene eno 19912 18584 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_16610 20674 19928 gene locus_tag LOCUS_16620 gene tpiA 20674 19928 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_16620 21877 20684 gene locus_tag LOCUS_16630 21877 20684 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_16630 21998 22810 gene locus_tag LOCUS_16640 21998 22810 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_16640 24191 22821 gene locus_tag LOCUS_16650 gene murC 24191 22821 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_16650 24387 24623 gene locus_tag LOCUS_16660 24387 24623 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_16660 25420 24815 gene locus_tag LOCUS_16670 25420 24815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 25746 25417 gene locus_tag LOCUS_16680 25746 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 26355 25753 gene locus_tag LOCUS_16690 26355 25753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903106.1 protein_id gnl|my_center|LOCUS_16690 27641 26352 gene locus_tag LOCUS_16700 27641 26352 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_16700 28435 27638 gene locus_tag LOCUS_16710 28435 27638 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence33 <1 996 gene locus_tag LOCUS_16720 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728946.1:ABC transporter ATP-binding protein 969 1238 gene locus_tag LOCUS_16730 969 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1247 2092 gene locus_tag LOCUS_16740 1247 2092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_16740 2096 2878 gene locus_tag LOCUS_16750 2096 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2897 3394 gene locus_tag LOCUS_16760 2897 3394 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405734.1 protein_id gnl|my_center|LOCUS_16760 3387 4211 gene locus_tag LOCUS_16770 3387 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4204 4683 gene locus_tag LOCUS_16780 4204 4683 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_16780 4708 5748 gene locus_tag LOCUS_16790 4708 5748 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_16790 5799 6134 gene locus_tag LOCUS_16800 5799 6134 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_16800 6134 6565 gene locus_tag LOCUS_16810 gene nusB 6134 6565 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 protein_id gnl|my_center|LOCUS_16810 6562 7743 gene locus_tag LOCUS_16820 gene xseA 6562 7743 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_16820 7712 7945 gene locus_tag LOCUS_16830 7712 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 7951 8829 gene locus_tag LOCUS_16840 7951 8829 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_16840 8878 9324 gene locus_tag LOCUS_16850 8878 9324 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_16850 9340 11226 gene locus_tag LOCUS_16860 gene dxs 9340 11226 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_16860 11223 11960 gene locus_tag LOCUS_16870 11223 11960 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_16870 12064 12792 gene locus_tag LOCUS_16880 12064 12792 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_16880 12812 14494 gene locus_tag LOCUS_16890 gene recN 12812 14494 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_16890 14835 14491 gene locus_tag LOCUS_16900 14835 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 14994 15332 gene locus_tag LOCUS_16910 14994 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 15685 15317 gene locus_tag LOCUS_16920 15685 15317 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_16920 15983 15672 gene locus_tag LOCUS_16930 15983 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 17486 15987 gene locus_tag LOCUS_16940 17486 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 18169 17588 gene locus_tag LOCUS_16950 18169 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18541 19689 gene locus_tag LOCUS_16960 18541 19689 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_16960 19702 20706 gene locus_tag LOCUS_16970 19702 20706 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803841.1 protein_id gnl|my_center|LOCUS_16970 20703 21137 gene locus_tag LOCUS_16980 20703 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 21134 21574 gene locus_tag LOCUS_16990 21134 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 22758 21736 gene locus_tag LOCUS_17000 22758 21736 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680886.1 protein_id gnl|my_center|LOCUS_17000 22909 23628 gene locus_tag LOCUS_17010 gene deoD 22909 23628 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_17010 23639 24469 gene locus_tag LOCUS_17020 23639 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 24466 26367 gene locus_tag LOCUS_17030 gene uvrC 24466 26367 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_17030 26419 27339 gene locus_tag LOCUS_17040 gene hprK 26419 27339 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_17040 27350 28270 gene locus_tag LOCUS_17050 gene murB 27350 28270 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905790.1 protein_id gnl|my_center|LOCUS_17050 28278 29150 gene locus_tag LOCUS_17060 gene rapZ 28278 29150 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_17060 29155 30078 gene locus_tag LOCUS_17070 gene whiA 29155 30078 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_17070 30100 30348 gene locus_tag LOCUS_17080 30100 30348 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_17080 30354 31076 gene locus_tag LOCUS_17090 30354 31076 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence34 <1 889 gene locus_tag LOCUS_17100 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964368.1:NAD(+) synthase 981 1508 gene locus_tag LOCUS_17110 981 1508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965892.1 protein_id gnl|my_center|LOCUS_17110 1797 1501 gene locus_tag LOCUS_17120 1797 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3212 1827 gene locus_tag LOCUS_17130 gene asnS 3212 1827 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_17130 3444 3977 gene locus_tag LOCUS_17140 3444 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4932 3985 gene locus_tag LOCUS_17150 gene scrK 4932 3985 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246646.1 protein_id gnl|my_center|LOCUS_17150 6580 5966 gene locus_tag LOCUS_17160 6580 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6934 8349 gene locus_tag LOCUS_17170 6934 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 8354 9277 gene locus_tag LOCUS_17180 8354 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 9361 10644 gene locus_tag LOCUS_17190 9361 10644 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_17190 10641 11498 gene locus_tag LOCUS_17200 10641 11498 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_17200 11514 11837 gene locus_tag LOCUS_17210 11514 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 12365 11919 gene locus_tag LOCUS_17220 12365 11919 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_17220 13001 12405 gene locus_tag LOCUS_17230 gene yihA 13001 12405 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_17230 13513 13001 gene locus_tag LOCUS_17240 gene apt 13513 13001 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_17240 13633 14088 gene locus_tag LOCUS_17250 13633 14088 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905770.1 protein_id gnl|my_center|LOCUS_17250 14099 15283 gene locus_tag LOCUS_17260 14099 15283 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_17260 17433 15247 gene locus_tag LOCUS_17270 17433 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 17975 17568 gene locus_tag LOCUS_17280 gene mgsA 17975 17568 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_17280 19205 18045 gene locus_tag LOCUS_17290 gene rodA 19205 18045 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17290 19511 19236 gene locus_tag LOCUS_17300 gene minE 19511 19236 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_17300 20324 19530 gene locus_tag LOCUS_17310 gene minD 20324 19530 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_17310 20472 21116 gene locus_tag LOCUS_17320 gene nth 20472 21116 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_17320 21454 21083 gene locus_tag LOCUS_17330 21454 21083 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_17330 22098 21472 gene locus_tag LOCUS_17340 22098 21472 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_17340 22390 22091 gene locus_tag LOCUS_17350 22390 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 22484 23734 gene locus_tag LOCUS_17360 gene serS 22484 23734 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_17360 24606 23731 gene locus_tag LOCUS_17370 24606 23731 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_17370 26784 24769 gene locus_tag LOCUS_17380 26784 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 28460 26856 gene locus_tag LOCUS_17390 28460 26856 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_17390 29493 28567 gene locus_tag LOCUS_17400 29493 28567 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_17400 30426 29509 gene locus_tag LOCUS_17410 30426 29509 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_17410 30632 30781 gene locus_tag LOCUS_17420 30632 30781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence35 1307 990 gene locus_tag LOCUS_17430 1307 990 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356487.1 protein_id gnl|my_center|LOCUS_17430 2288 1347 gene locus_tag LOCUS_17440 gene trxB 2288 1347 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_17440 2674 2285 gene locus_tag LOCUS_17450 2674 2285 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 protein_id gnl|my_center|LOCUS_17450 4152 2860 gene locus_tag LOCUS_17460 4152 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5222 4284 gene locus_tag LOCUS_17470 5222 4284 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582777.1 protein_id gnl|my_center|LOCUS_17470 6238 5219 gene locus_tag LOCUS_17480 6238 5219 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_17480 6382 7203 gene locus_tag LOCUS_17490 6382 7203 CDS product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006686.1 protein_id gnl|my_center|LOCUS_17490 7240 9663 gene locus_tag LOCUS_17500 7240 9663 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_17500 9665 10513 gene locus_tag LOCUS_17510 9665 10513 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_17510 10659 11615 gene locus_tag LOCUS_17520 10659 11615 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969888.1 protein_id gnl|my_center|LOCUS_17520 11682 13163 gene locus_tag LOCUS_17530 gene gguA 11682 13163 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 protein_id gnl|my_center|LOCUS_17530 13221 14198 gene locus_tag LOCUS_17540 13221 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_17540 14236 15228 gene locus_tag LOCUS_17550 gene rbsC 14236 15228 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_17550 15389 19699 gene locus_tag LOCUS_17560 15389 19699 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_17560 19910 20257 gene locus_tag LOCUS_17570 gene rplS 19910 20257 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_17570 20272 20874 gene locus_tag LOCUS_17580 gene lepB 20272 20874 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_17580 20926 24516 gene locus_tag LOCUS_17590 gene smc 20926 24516 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280953.1 protein_id gnl|my_center|LOCUS_17590 24516 25442 gene locus_tag LOCUS_17600 24516 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 25622 26125 gene locus_tag LOCUS_17610 25622 26125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 26236 26556 gene locus_tag LOCUS_17620 26236 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 26671 27891 gene locus_tag LOCUS_17630 gene yqfD 26671 27891 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_17630 27902 28900 gene locus_tag LOCUS_17640 27902 28900 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_17640 28905 29348 gene locus_tag LOCUS_17650 28905 29348 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948662.1 protein_id gnl|my_center|LOCUS_17650 29352 29702 gene locus_tag LOCUS_17660 29352 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence36 920 1374 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagggttcgtcgccgcagactgtgcattc 10018 10109 gene locus_tag LOCUS_t00190 10018 10109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13817 10983 gene locus_tag LOCUS_17670 13817 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 14425 13838 gene locus_tag LOCUS_17680 14425 13838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879642.1 protein_id gnl|my_center|LOCUS_17680 18178 14540 gene locus_tag LOCUS_17690 gene addA 18178 14540 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_17690 20881 18257 gene locus_tag LOCUS_17700 gene ppdK 20881 18257 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_17700 22366 21131 gene locus_tag LOCUS_17710 22366 21131 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_17710 23396 22443 gene locus_tag LOCUS_17720 23396 22443 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_17720 23672 24178 gene locus_tag LOCUS_17730 gene infC 23672 24178 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_17730 24213 24413 gene locus_tag LOCUS_17740 gene rpmI 24213 24413 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_17740 24448 24801 gene locus_tag LOCUS_17750 gene rplT 24448 24801 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_17750 24953 25390 gene locus_tag LOCUS_17760 24953 25390 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067200.1 protein_id gnl|my_center|LOCUS_17760 25383 27098 gene locus_tag LOCUS_17770 25383 27098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453764.1 protein_id gnl|my_center|LOCUS_17770 27151 27303 gene locus_tag LOCUS_17780 27151 27303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 27300 28655 gene locus_tag LOCUS_17790 gene scfB 27300 28655 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence37 4161 2521 gene locus_tag LOCUS_17800 4161 2521 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047966.1 protein_id gnl|my_center|LOCUS_17800 5038 4199 gene locus_tag LOCUS_17810 5038 4199 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_17810 5268 6530 gene locus_tag LOCUS_17820 5268 6530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_17820 6546 6950 gene locus_tag LOCUS_17830 6546 6950 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026330850.1 protein_id gnl|my_center|LOCUS_17830 8277 7003 gene locus_tag LOCUS_17840 8277 7003 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_17840 8967 8290 gene locus_tag LOCUS_17850 gene pyrE 8967 8290 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_17850 9864 8989 gene locus_tag LOCUS_17860 9864 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 11129 9861 gene locus_tag LOCUS_17870 11129 9861 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_17870 13483 11258 gene locus_tag LOCUS_17880 gene pnp 13483 11258 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_17880 13817 13560 gene locus_tag LOCUS_17890 gene rpsO 13817 13560 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_17890 14681 14148 gene locus_tag LOCUS_17900 14681 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 15288 14815 gene locus_tag LOCUS_17910 15288 14815 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_17910 16885 15281 gene locus_tag LOCUS_17920 16885 15281 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_17920 18077 16896 gene locus_tag LOCUS_17930 18077 16896 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_17930 18523 18095 gene locus_tag LOCUS_17940 18523 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 18756 18625 gene locus_tag LOCUS_17950 18756 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 20024 19089 gene locus_tag LOCUS_17960 20024 19089 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_17960 20210 21559 gene locus_tag LOCUS_17970 20210 21559 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_17970 21640 22536 gene locus_tag LOCUS_17980 21640 22536 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_17980 22538 23377 gene locus_tag LOCUS_17990 gene araQ 22538 23377 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_17990 23407 24906 gene locus_tag LOCUS_18000 gene abfA 23407 24906 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_18000 24918 26351 gene locus_tag LOCUS_18010 gene abnB 24918 26351 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 protein_id gnl|my_center|LOCUS_18010 26379 27518 gene locus_tag LOCUS_18020 26379 27518 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_18020 27540 28346 gene locus_tag LOCUS_18030 27540 28346 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence38 2630 1197 gene locus_tag LOCUS_18040 2630 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3280 2642 gene locus_tag LOCUS_18050 3280 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3777 3280 gene locus_tag LOCUS_18060 gene trmL 3777 3280 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_18060 3850 7032 gene locus_tag LOCUS_18070 3850 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7029 7958 gene locus_tag LOCUS_18080 gene hag 7029 7958 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228021.1 protein_id gnl|my_center|LOCUS_18080 7970 8437 gene locus_tag LOCUS_18090 7970 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 9138 8497 gene locus_tag LOCUS_18100 9138 8497 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072966140.1 protein_id gnl|my_center|LOCUS_18100 9764 9162 gene locus_tag LOCUS_18110 9764 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 10950 9757 gene locus_tag LOCUS_18120 10950 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 11076 11765 gene locus_tag LOCUS_18130 11076 11765 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_18130 11752 13155 gene locus_tag LOCUS_18140 gene tilS 11752 13155 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_18140 13213 13743 gene locus_tag LOCUS_18150 gene hpt 13213 13743 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_18150 13823 15808 gene locus_tag LOCUS_18160 gene ftsH 13823 15808 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_18160 15892 16671 gene locus_tag LOCUS_18170 15892 16671 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_18170 16668 17636 gene locus_tag LOCUS_18180 gene dusB 16668 17636 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18180 17681 18274 gene locus_tag LOCUS_18190 17681 18274 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_18190 18390 18602 gene locus_tag LOCUS_18200 18390 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 18599 19072 gene locus_tag LOCUS_18210 gene greA 18599 19072 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_18210 19087 20580 gene locus_tag LOCUS_18220 gene lysS 19087 20580 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_18220 20610 21068 gene locus_tag LOCUS_18230 20610 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 21052 22164 gene locus_tag LOCUS_18240 21052 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 22171 22266 gene locus_tag LOCUS_t00200 22171 22266 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 23848 22541 gene locus_tag LOCUS_18250 23848 22541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 24286 23867 gene locus_tag LOCUS_18260 24286 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18260 24705 24286 gene locus_tag LOCUS_18270 24705 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18270 >Feature sequence39 303 4208 gene locus_tag LOCUS_18280 303 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4208 4942 gene locus_tag LOCUS_18290 4208 4942 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_18290 5086 5643 gene locus_tag LOCUS_18300 5086 5643 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_18300 5812 6027 gene locus_tag LOCUS_18310 5812 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6040 9207 gene locus_tag LOCUS_18320 6040 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 9239 11380 gene locus_tag LOCUS_18330 9239 11380 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_18330 11380 12999 gene locus_tag LOCUS_18340 11380 12999 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_18340 13084 14076 gene locus_tag LOCUS_18350 13084 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14238 15659 gene locus_tag LOCUS_18360 14238 15659 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948835.1 protein_id gnl|my_center|LOCUS_18360 16088 15666 gene locus_tag LOCUS_18370 16088 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 17309 16284 gene locus_tag LOCUS_18380 17309 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 19082 18267 gene locus_tag LOCUS_18390 gene spo0A 19082 18267 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_18390 19200 19571 gene locus_tag LOCUS_18400 19200 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 19644 19964 gene locus_tag LOCUS_18410 19644 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 20435 19989 gene locus_tag LOCUS_18420 20435 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 21867 20539 gene locus_tag LOCUS_18430 21867 20539 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_18430 22078 24096 gene locus_tag LOCUS_18440 22078 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence40 211 414 gene locus_tag LOCUS_18450 gene rpmE 211 414 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_18450 476 1600 gene locus_tag LOCUS_18460 gene tgt 476 1600 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_18460 1593 2474 gene locus_tag LOCUS_18470 1593 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3960 2509 gene locus_tag LOCUS_18480 gene guaB 3960 2509 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_18480 4490 3981 gene locus_tag LOCUS_18490 4490 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 4578 5678 gene locus_tag LOCUS_18500 4578 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 6574 5729 gene locus_tag LOCUS_18510 6574 5729 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_18510 8670 6577 gene locus_tag LOCUS_18520 8670 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 8811 10130 gene locus_tag LOCUS_18530 gene xylA 8811 10130 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_18530 10144 11664 gene locus_tag LOCUS_18540 gene xylB 10144 11664 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_18540 11661 12095 gene locus_tag LOCUS_18550 11661 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 12113 13351 gene locus_tag LOCUS_18560 gene rhaA 12113 13351 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_18560 14548 13406 gene locus_tag LOCUS_18570 14548 13406 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_18570 14878 14561 gene locus_tag LOCUS_18580 gene rhaM 14878 14561 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 protein_id gnl|my_center|LOCUS_18580 15013 15948 gene locus_tag LOCUS_18590 15013 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 16634 15951 gene locus_tag LOCUS_18600 16634 15951 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964733.1 protein_id gnl|my_center|LOCUS_18600 17171 16743 gene locus_tag LOCUS_18610 17171 16743 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_18610 18575 17172 gene locus_tag LOCUS_18620 gene atpD 18575 17172 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_18620 19513 18626 gene locus_tag LOCUS_18630 19513 18626 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_18630 21061 19562 gene locus_tag LOCUS_18640 gene atpA 21061 19562 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_18640 21618 21058 gene locus_tag LOCUS_18650 21618 21058 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_18650 22112 21606 gene locus_tag LOCUS_18660 gene atpF 22112 21606 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167042.1 protein_id gnl|my_center|LOCUS_18660 22512 22213 gene locus_tag LOCUS_18670 22512 22213 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187193.1 protein_id gnl|my_center|LOCUS_18670 23250 22561 gene locus_tag LOCUS_18680 gene atpB 23250 22561 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_18680 23691 23290 gene locus_tag LOCUS_18690 23691 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 23950 23714 gene locus_tag LOCUS_18700 23950 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 24152 24223 gene locus_tag LOCUS_t00210 24152 24223 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence41 185 3133 gene locus_tag LOCUS_18710 gene ygfK 185 3133 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_18710 3118 4146 gene locus_tag LOCUS_18720 3118 4146 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082604.1 protein_id gnl|my_center|LOCUS_18720 4143 5123 gene locus_tag LOCUS_18730 4143 5123 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_18730 5128 5898 gene locus_tag LOCUS_18740 5128 5898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_18740 5981 7144 gene locus_tag LOCUS_18750 5981 7144 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_18750 7209 8738 gene locus_tag LOCUS_18760 7209 8738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_18760 8735 9829 gene locus_tag LOCUS_18770 8735 9829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_18770 9843 10823 gene locus_tag LOCUS_18780 9843 10823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529891.1 protein_id gnl|my_center|LOCUS_18780 10891 11397 gene locus_tag LOCUS_18790 10891 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 11437 12726 gene locus_tag LOCUS_18800 11437 12726 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_18800 12732 14849 gene locus_tag LOCUS_18810 12732 14849 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_18810 14846 15322 gene locus_tag LOCUS_18820 14846 15322 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_18820 15316 16131 gene locus_tag LOCUS_18830 gene xdhB 15316 16131 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_18830 16295 16134 gene locus_tag LOCUS_18840 16295 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 18034 16346 gene locus_tag LOCUS_18850 gene ade 18034 16346 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_18850 18209 18027 gene locus_tag LOCUS_18860 18209 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 18985 18272 gene locus_tag LOCUS_18870 18985 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 19823 18975 gene locus_tag LOCUS_18880 19823 18975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560921.1 protein_id gnl|my_center|LOCUS_18880 20184 19816 gene locus_tag LOCUS_18890 20184 19816 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_18890 20361 21500 gene locus_tag LOCUS_18900 20361 21500 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_18900 21521 22558 gene locus_tag LOCUS_18910 21521 22558 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 protein_id gnl|my_center|LOCUS_18910 22555 23451 gene locus_tag LOCUS_18920 22555 23451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079516.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence42 1325 732 gene locus_tag LOCUS_18930 1325 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1999 1322 gene locus_tag LOCUS_18940 1999 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2634 2017 gene locus_tag LOCUS_18950 2634 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2764 3057 gene locus_tag LOCUS_18960 2764 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3749 3123 gene locus_tag LOCUS_18970 3749 3123 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_18970 5028 3742 gene locus_tag LOCUS_18980 5028 3742 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_18980 5321 6904 gene locus_tag LOCUS_18990 gene lonB 5321 6904 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816883.1 protein_id gnl|my_center|LOCUS_18990 6927 7673 gene locus_tag LOCUS_19000 6927 7673 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_19000 7901 8542 gene locus_tag LOCUS_19010 7901 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 10164 8539 gene locus_tag LOCUS_19020 10164 8539 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_19020 10338 10171 gene locus_tag LOCUS_19030 10338 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 10988 10389 gene locus_tag LOCUS_19040 gene yfbR 10988 10389 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 protein_id gnl|my_center|LOCUS_19040 12454 11045 gene locus_tag LOCUS_19050 gene ortB 12454 11045 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_19050 12777 12451 gene locus_tag LOCUS_19060 12777 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 13700 12789 gene locus_tag LOCUS_19070 gene rocF 13700 12789 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964372.1 protein_id gnl|my_center|LOCUS_19070 13844 14692 gene locus_tag LOCUS_19080 13844 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 14706 15395 gene locus_tag LOCUS_19090 14706 15395 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_19090 15395 16051 gene locus_tag LOCUS_19100 15395 16051 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_19100 16052 17023 gene locus_tag LOCUS_19110 16052 17023 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_19110 17816 17121 gene locus_tag LOCUS_19120 gene rplA 17816 17121 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_19120 18277 17852 gene locus_tag LOCUS_19130 gene rplK 18277 17852 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_19130 18884 18342 gene locus_tag LOCUS_19140 gene nusG 18884 18342 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_19140 19152 18898 gene locus_tag LOCUS_19150 19152 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 19344 19195 gene locus_tag LOCUS_19160 gene rpmG 19344 19195 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_19160 20291 19422 gene locus_tag LOCUS_19170 gene rsmA 20291 19422 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_19170 21460 20288 gene locus_tag LOCUS_19180 21460 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 21575 22351 gene locus_tag LOCUS_19190 21575 22351 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_19190 22541 22374 gene locus_tag LOCUS_19200 22541 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence43 716 180 gene locus_tag LOCUS_19210 716 180 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_19210 2081 747 gene locus_tag LOCUS_19220 2081 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2226 3602 gene locus_tag LOCUS_19230 2226 3602 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_19230 3595 4470 gene locus_tag LOCUS_19240 3595 4470 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 protein_id gnl|my_center|LOCUS_19240 4492 6282 gene locus_tag LOCUS_19250 gene iorA 4492 6282 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_19250 6275 6853 gene locus_tag LOCUS_19260 6275 6853 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_19260 6855 7919 gene locus_tag LOCUS_19270 gene buk 6855 7919 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_19270 9003 8011 gene locus_tag LOCUS_19280 9003 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9140 10711 gene locus_tag LOCUS_19290 gene nagZ 9140 10711 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_19290 10713 11612 gene locus_tag LOCUS_19300 gene murQ 10713 11612 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_19300 11602 12576 gene locus_tag LOCUS_19310 11602 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 12761 12585 gene locus_tag LOCUS_19320 12761 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12859 13107 gene locus_tag LOCUS_19330 12859 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 13201 13362 gene locus_tag LOCUS_19340 13201 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 13547 13371 gene locus_tag LOCUS_19350 13547 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 13658 13903 gene locus_tag LOCUS_19360 13658 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 14343 14167 gene locus_tag LOCUS_19370 14343 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 14438 14668 gene locus_tag LOCUS_19380 14438 14668 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_19380 15559 14765 gene locus_tag LOCUS_19390 15559 14765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19390 16071 15469 gene locus_tag LOCUS_19400 16071 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19400 16679 16092 gene locus_tag LOCUS_19410 gene clpP 16679 16092 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_19410 18037 16697 gene locus_tag LOCUS_19420 gene tig 18037 16697 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_19420 20200 18143 gene locus_tag LOCUS_19430 gene malZ 20200 18143 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930730.1 protein_id gnl|my_center|LOCUS_19430 22676 20217 gene locus_tag LOCUS_19440 22676 20217 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence44 1695 1333 gene locus_tag LOCUS_19450 1695 1333 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_19450 2795 1707 gene locus_tag LOCUS_19460 2795 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4232 2823 gene locus_tag LOCUS_19470 gene ortB 4232 2823 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_19470 4528 4235 gene locus_tag LOCUS_19480 gene ortA 4528 4235 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_19480 5602 4544 gene locus_tag LOCUS_19490 gene ord 5602 4544 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_19490 6773 5616 gene locus_tag LOCUS_19500 gene alr 6773 5616 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_19500 7039 6848 gene locus_tag LOCUS_19510 7039 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 7859 7053 gene locus_tag LOCUS_19520 7859 7053 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_19520 8431 7856 gene locus_tag LOCUS_19530 gene rsxA 8431 7856 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_19530 9058 8432 gene locus_tag LOCUS_19540 9058 8432 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_19540 9648 9058 gene locus_tag LOCUS_19550 9648 9058 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_19550 10624 9623 gene locus_tag LOCUS_19560 10624 9623 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_19560 11993 10614 gene locus_tag LOCUS_19570 gene rsxC 11993 10614 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_19570 12746 12096 gene locus_tag LOCUS_19580 gene plsY 12746 12096 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_19580 13417 12770 gene locus_tag LOCUS_19590 gene plsY 13417 12770 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_19590 14772 13444 gene locus_tag LOCUS_19600 gene der 14772 13444 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_19600 16155 14851 gene locus_tag LOCUS_19610 16155 14851 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_19610 16349 16152 gene locus_tag LOCUS_19620 gene rpmB 16349 16152 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_19620 17053 16418 gene locus_tag LOCUS_19630 17053 16418 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_19630 17407 17165 gene locus_tag LOCUS_19640 17407 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18097 17408 gene locus_tag LOCUS_19650 gene walR 18097 17408 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971872.1 protein_id gnl|my_center|LOCUS_19650 18261 20063 gene locus_tag LOCUS_19660 18261 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 20298 20119 gene locus_tag LOCUS_19670 20298 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 20705 20295 gene locus_tag LOCUS_19680 20705 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 21067 20702 gene locus_tag LOCUS_19690 21067 20702 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence45 302 970 gene locus_tag LOCUS_19700 302 970 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_19700 1018 2118 gene locus_tag LOCUS_19710 1018 2118 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_19710 2118 2882 gene locus_tag LOCUS_19720 gene rlmB 2118 2882 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_19720 2879 3430 gene locus_tag LOCUS_19730 2879 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3432 4496 gene locus_tag LOCUS_19740 3432 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4669 5988 gene locus_tag LOCUS_19750 4669 5988 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_19750 5999 6544 gene locus_tag LOCUS_19760 5999 6544 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813959.1 protein_id gnl|my_center|LOCUS_19760 7451 6579 gene locus_tag LOCUS_19770 gene hslO 7451 6579 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_19770 7825 7535 gene locus_tag LOCUS_19780 7825 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 7909 8142 gene locus_tag LOCUS_19790 7909 8142 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286254.1 protein_id gnl|my_center|LOCUS_19790 8827 8156 gene locus_tag LOCUS_19800 8827 8156 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015965.1 protein_id gnl|my_center|LOCUS_19800 8947 9825 gene locus_tag LOCUS_19810 gene spoIIGA 8947 9825 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_19810 9828 10556 gene locus_tag LOCUS_19820 gene sigE 9828 10556 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_19820 11541 10558 gene locus_tag LOCUS_19830 11541 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 12058 11534 gene locus_tag LOCUS_19840 12058 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 12128 12541 gene locus_tag LOCUS_19850 12128 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 12510 13541 gene locus_tag LOCUS_19860 12510 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 13645 14808 gene locus_tag LOCUS_19870 13645 14808 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_19870 17459 14850 gene locus_tag LOCUS_19880 17459 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 17631 18869 gene locus_tag LOCUS_19890 17631 18869 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263449.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence46 357 1073 gene locus_tag LOCUS_19900 357 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2102 1131 gene locus_tag LOCUS_19910 2102 1131 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023456.1 protein_id gnl|my_center|LOCUS_19910 2266 3483 gene locus_tag LOCUS_19920 2266 3483 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_19920 3480 4457 gene locus_tag LOCUS_19930 3480 4457 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808171.1 protein_id gnl|my_center|LOCUS_19930 4454 5170 gene locus_tag LOCUS_19940 4454 5170 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_19940 5170 6987 gene locus_tag LOCUS_19950 5170 6987 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_19950 7961 6984 gene locus_tag LOCUS_19960 7961 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 10261 7973 gene locus_tag LOCUS_19970 10261 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 10655 11146 gene locus_tag LOCUS_19980 10655 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 11418 11203 gene locus_tag LOCUS_19990 11418 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 12055 11510 gene locus_tag LOCUS_20000 12055 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 13125 12067 gene locus_tag LOCUS_20010 13125 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 14588 13137 gene locus_tag LOCUS_20020 14588 13137 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_20020 14815 14585 gene locus_tag LOCUS_20030 14815 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 16361 14868 gene locus_tag LOCUS_20040 16361 14868 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_20040 18022 16358 gene locus_tag LOCUS_20050 18022 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 18809 18324 gene locus_tag LOCUS_20060 18809 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence47 398 1528 gene locus_tag LOCUS_20070 398 1528 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 protein_id gnl|my_center|LOCUS_20070 1637 2659 gene locus_tag LOCUS_20080 1637 2659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613875.1 protein_id gnl|my_center|LOCUS_20080 2677 4254 gene locus_tag LOCUS_20090 2677 4254 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_20090 4268 5266 gene locus_tag LOCUS_20100 gene rbsC 4268 5266 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612396.1 protein_id gnl|my_center|LOCUS_20100 5328 6332 gene locus_tag LOCUS_20110 5328 6332 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_20110 6345 7391 gene locus_tag LOCUS_20120 6345 7391 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861508.1 protein_id gnl|my_center|LOCUS_20120 8157 7393 gene locus_tag LOCUS_20130 8157 7393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_20130 9697 8168 gene locus_tag LOCUS_20140 gene xylB 9697 8168 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_20140 9800 10567 gene locus_tag LOCUS_20150 9800 10567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_20150 12104 10596 gene locus_tag LOCUS_20160 gene xylB 12104 10596 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_20160 13155 12118 gene locus_tag LOCUS_20170 13155 12118 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_20170 14186 13167 gene locus_tag LOCUS_20180 gene iolX 14186 13167 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_20180 14303 15229 gene locus_tag LOCUS_20190 14303 15229 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_20190 15245 15817 gene locus_tag LOCUS_20200 gene pgiA 15245 15817 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_20200 15897 16841 gene locus_tag LOCUS_20210 15897 16841 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_20210 17761 16850 gene locus_tag LOCUS_20220 17761 16850 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_20220 18245 17730 gene locus_tag LOCUS_20230 gene lspA 18245 17730 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775073.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence48 <1 1189 gene locus_tag LOCUS_20240 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086845818.1:glycoside hydrolase family 127 protein 1262 1777 gene locus_tag LOCUS_20250 1262 1777 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262516.1 protein_id gnl|my_center|LOCUS_20250 1877 2377 gene locus_tag LOCUS_20260 gene ureI 1877 2377 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_20260 2408 2926 gene locus_tag LOCUS_20270 2408 2926 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_20270 3007 3966 gene locus_tag LOCUS_20280 3007 3966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_20280 4040 4113 gene locus_tag LOCUS_t00220 4040 4113 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4211 5473 gene locus_tag LOCUS_20290 4211 5473 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_20290 9547 5465 gene locus_tag LOCUS_20300 9547 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 10253 9663 gene locus_tag LOCUS_20310 10253 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 12068 10350 gene locus_tag LOCUS_20320 12068 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 12790 12065 gene locus_tag LOCUS_20330 12790 12065 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_20330 14502 12874 gene locus_tag LOCUS_20340 14502 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 14632 14793 gene locus_tag LOCUS_20350 14632 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 14890 15039 gene locus_tag LOCUS_20360 14890 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 15959 15093 gene locus_tag LOCUS_20370 15959 15093 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303949.1 protein_id gnl|my_center|LOCUS_20370 17435 15975 gene locus_tag LOCUS_20380 17435 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 <18410 17513 gene locus_tag LOCUS_20390 <18410 17513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776865.1:extracellular solute-binding protein >Feature sequence49 606 2330 gene locus_tag LOCUS_20400 606 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20400 2331 2675 gene locus_tag LOCUS_20410 gene rbfA 2331 2675 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948461.1 protein_id gnl|my_center|LOCUS_20410 2668 3726 gene locus_tag LOCUS_20420 2668 3726 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_20420 3653 4564 gene locus_tag LOCUS_20430 gene truB 3653 4564 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_20430 4564 5319 gene locus_tag LOCUS_20440 4564 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 5336 6214 gene locus_tag LOCUS_20450 5336 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 6291 7688 gene locus_tag LOCUS_20460 6291 7688 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_20460 7702 8586 gene locus_tag LOCUS_20470 7702 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 8589 9458 gene locus_tag LOCUS_20480 8589 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 10020 9532 gene locus_tag LOCUS_20490 10020 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 10401 10246 gene locus_tag LOCUS_20500 10401 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 11855 10485 gene locus_tag LOCUS_20510 11855 10485 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_20510 12090 11929 gene locus_tag LOCUS_20520 12090 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 12281 12448 gene locus_tag LOCUS_20530 12281 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 12442 16245 gene locus_tag LOCUS_20540 12442 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 16358 16855 gene locus_tag LOCUS_20550 16358 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 16943 17758 gene locus_tag LOCUS_20560 16943 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence50 <1 718 gene locus_tag LOCUS_20570 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895465.1:D-ornithine 4,5-aminomutase subunit OraE 722 2068 gene locus_tag LOCUS_20580 722 2068 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_20580 2065 3126 gene locus_tag LOCUS_20590 gene orr 2065 3126 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_20590 3286 4479 gene locus_tag LOCUS_20600 gene rocD 3286 4479 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_20600 4634 6268 gene locus_tag LOCUS_20610 4634 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 6311 6751 gene locus_tag LOCUS_20620 6311 6751 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_20620 6806 7987 gene locus_tag LOCUS_20630 gene nifS 6806 7987 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_20630 8015 8419 gene locus_tag LOCUS_20640 gene nifU 8015 8419 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_20640 9095 8448 gene locus_tag LOCUS_20650 9095 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9291 9124 gene locus_tag LOCUS_20660 9291 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 9874 9335 gene locus_tag LOCUS_20670 9874 9335 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_20670 10663 9932 gene locus_tag LOCUS_20680 10663 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 12429 10810 gene locus_tag LOCUS_20690 12429 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 12790 12422 gene locus_tag LOCUS_20700 12790 12422 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 protein_id gnl|my_center|LOCUS_20700 13396 13031 gene locus_tag LOCUS_20710 13396 13031 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_20710 14549 13434 gene locus_tag LOCUS_20720 gene tig 14549 13434 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_20720 14778 15761 gene locus_tag LOCUS_20730 gene pfkA 14778 15761 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_20730 15820 16122 gene locus_tag LOCUS_20740 15820 16122 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667009.1 protein_id gnl|my_center|LOCUS_20740 16592 16798 gene locus_tag LOCUS_20750 16592 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20750 17490 17131 gene locus_tag LOCUS_20760 17490 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence51 250 3063 gene locus_tag LOCUS_20770 250 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3050 3592 gene locus_tag LOCUS_20780 3050 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3620 5287 gene locus_tag LOCUS_20790 3620 5287 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_20790 5307 6182 gene locus_tag LOCUS_20800 gene folD 5307 6182 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_20800 6175 7509 gene locus_tag LOCUS_20810 gene rimO 6175 7509 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_20810 7525 8085 gene locus_tag LOCUS_20820 gene pgsA 7525 8085 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052965.1 protein_id gnl|my_center|LOCUS_20820 8082 9317 gene locus_tag LOCUS_20830 8082 9317 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_20830 9343 10653 gene locus_tag LOCUS_20840 9343 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 10657 11181 gene locus_tag LOCUS_20850 10657 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 11203 12525 gene locus_tag LOCUS_20860 11203 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 12708 14789 gene locus_tag LOCUS_20870 gene fusA 12708 14789 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_20870 14845 16266 gene locus_tag LOCUS_20880 14845 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 16839 16288 gene locus_tag LOCUS_20890 16839 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 17234 17599 gene locus_tag LOCUS_20900 17234 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence52 1039 152 gene locus_tag LOCUS_20910 1039 152 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 protein_id gnl|my_center|LOCUS_20910 3666 1060 gene locus_tag LOCUS_20920 3666 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5941 3788 gene locus_tag LOCUS_20930 5941 3788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_20930 6425 5931 gene locus_tag LOCUS_20940 6425 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 6986 6456 gene locus_tag LOCUS_20950 6986 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 7654 6983 gene locus_tag LOCUS_20960 7654 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 9926 7662 gene locus_tag LOCUS_20970 9926 7662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_20970 11795 10017 gene locus_tag LOCUS_20980 11795 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 12218 12724 gene locus_tag LOCUS_20990 12218 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 12892 13419 gene locus_tag LOCUS_21000 12892 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 13678 15051 gene locus_tag LOCUS_21010 13678 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 15088 16029 gene locus_tag LOCUS_21020 15088 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence53 <1 648 gene locus_tag LOCUS_21030 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896068.1:DNA polymerase I 648 1259 gene locus_tag LOCUS_21040 gene coaE 648 1259 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_21040 1240 1812 gene locus_tag LOCUS_21050 1240 1812 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_21050 1986 3386 gene locus_tag LOCUS_21060 1986 3386 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_21060 3403 4404 gene locus_tag LOCUS_21070 gene trpS 3403 4404 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 protein_id gnl|my_center|LOCUS_21070 4429 4839 gene locus_tag LOCUS_21080 4429 4839 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_21080 4836 5297 gene locus_tag LOCUS_21090 4836 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 5318 6310 gene locus_tag LOCUS_21100 5318 6310 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_21100 6363 7388 gene locus_tag LOCUS_21110 6363 7388 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_21110 7897 7418 gene locus_tag LOCUS_21120 7897 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 8009 8734 gene locus_tag LOCUS_21130 8009 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8790 9884 gene locus_tag LOCUS_21140 8790 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 9899 10942 gene locus_tag LOCUS_21150 9899 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 10947 11288 gene locus_tag LOCUS_21160 10947 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 11293 11754 gene locus_tag LOCUS_21170 11293 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 11767 12246 gene locus_tag LOCUS_21180 11767 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 12350 12703 gene locus_tag LOCUS_21190 12350 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 12723 13781 gene locus_tag LOCUS_21200 12723 13781 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_21200 13904 15379 gene locus_tag LOCUS_21210 13904 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence54 499 1830 gene locus_tag LOCUS_21220 499 1830 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243920.1 protein_id gnl|my_center|LOCUS_21220 1833 3098 gene locus_tag LOCUS_21230 1833 3098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582451.1 protein_id gnl|my_center|LOCUS_21230 3372 4613 gene locus_tag LOCUS_21240 gene spoIVA 3372 4613 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_21240 8558 4596 gene locus_tag LOCUS_21250 8558 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8797 10380 gene locus_tag LOCUS_21260 8797 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 10443 11225 gene locus_tag LOCUS_21270 10443 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11464 11739 gene locus_tag LOCUS_21280 11464 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 11762 12475 gene locus_tag LOCUS_21290 11762 12475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002661.1 protein_id gnl|my_center|LOCUS_21290 12578 13780 gene locus_tag LOCUS_21300 12578 13780 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_21300 13767 14564 gene locus_tag LOCUS_21310 13767 14564 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_21310 14564 14884 gene locus_tag LOCUS_21320 14564 14884 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_21320 14881 15369 gene locus_tag LOCUS_21330 14881 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence55 3140 111 gene locus_tag LOCUS_21340 3140 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4164 3160 gene locus_tag LOCUS_21350 4164 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5160 4168 gene locus_tag LOCUS_21360 5160 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 6269 5175 gene locus_tag LOCUS_21370 6269 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7703 6444 gene locus_tag LOCUS_21380 7703 6444 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_21380 7782 8603 gene locus_tag LOCUS_21390 7782 8603 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_21390 8692 10881 gene locus_tag LOCUS_21400 8692 10881 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860851.1 protein_id gnl|my_center|LOCUS_21400 10920 11396 gene locus_tag LOCUS_21410 10920 11396 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_21410 11489 12487 gene locus_tag LOCUS_21420 gene pta 11489 12487 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_21420 12526 13728 gene locus_tag LOCUS_21430 12526 13728 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_21430 13805 14008 gene locus_tag LOCUS_21440 13805 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 14021 14404 gene locus_tag LOCUS_21450 14021 14404 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_21450 14443 14613 gene locus_tag LOCUS_21460 14443 14613 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence56 249 1145 gene locus_tag LOCUS_21470 249 1145 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_21470 1525 1142 gene locus_tag LOCUS_21480 1525 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2100 1525 gene locus_tag LOCUS_21490 2100 1525 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_21490 2831 2100 gene locus_tag LOCUS_21500 2831 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5179 2987 gene locus_tag LOCUS_21510 5179 2987 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_21510 6195 5185 gene locus_tag LOCUS_21520 gene cytR 6195 5185 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644910.1 protein_id gnl|my_center|LOCUS_21520 8444 6192 gene locus_tag LOCUS_21530 8444 6192 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 protein_id gnl|my_center|LOCUS_21530 8618 9937 gene locus_tag LOCUS_21540 8618 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 10006 10881 gene locus_tag LOCUS_21550 10006 10881 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_21550 10890 11723 gene locus_tag LOCUS_21560 10890 11723 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_21560 11829 12365 gene locus_tag LOCUS_21570 11829 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12479 12667 gene locus_tag LOCUS_21580 12479 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 13381 12686 gene locus_tag LOCUS_21590 13381 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 13605 13378 gene locus_tag LOCUS_21600 13605 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence57 1054 1128 gene locus_tag LOCUS_t00230 1054 1128 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1191 2459 gene locus_tag LOCUS_21610 1191 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2456 2950 gene locus_tag LOCUS_21620 2456 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 5567 2982 gene locus_tag LOCUS_21630 gene xdh 5567 2982 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 protein_id gnl|my_center|LOCUS_21630 6178 5564 gene locus_tag LOCUS_21640 6178 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 7575 6187 gene locus_tag LOCUS_21650 gene hydA 7575 6187 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047948.1 protein_id gnl|my_center|LOCUS_21650 8775 7585 gene locus_tag LOCUS_21660 gene ygeW 8775 7585 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_21660 10096 8780 gene locus_tag LOCUS_21670 10096 8780 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_21670 11332 10130 gene locus_tag LOCUS_21680 gene dpaL 11332 10130 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_21680 12800 11325 gene locus_tag LOCUS_21690 12800 11325 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence58 <1 952 gene locus_tag LOCUS_21700 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272316.1:ABC transporter ATP-binding protein 949 1773 gene locus_tag LOCUS_21710 949 1773 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_21710 1892 2707 gene locus_tag LOCUS_21720 1892 2707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_21720 2710 3756 gene locus_tag LOCUS_21730 2710 3756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_21730 3876 4862 gene locus_tag LOCUS_21740 3876 4862 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027712.1 protein_id gnl|my_center|LOCUS_21740 4899 5123 gene locus_tag LOCUS_21750 4899 5123 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132501.1 protein_id gnl|my_center|LOCUS_21750 5120 6076 gene locus_tag LOCUS_21760 gene fabK 5120 6076 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373895.1 protein_id gnl|my_center|LOCUS_21760 6073 7014 gene locus_tag LOCUS_21770 gene fabD 6073 7014 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_21770 7011 7742 gene locus_tag LOCUS_21780 gene fabG 7011 7742 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356283.1 protein_id gnl|my_center|LOCUS_21780 8021 9001 gene locus_tag LOCUS_21790 gene fabF 8021 9001 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_21790 9058 9498 gene locus_tag LOCUS_21800 gene fabZ 9058 9498 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_21800 9518 11092 gene locus_tag LOCUS_21810 gene gpmI 9518 11092 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_21810 11098 11703 gene locus_tag LOCUS_21820 11098 11703 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236552.1 protein_id gnl|my_center|LOCUS_21820 11803 12225 gene locus_tag LOCUS_21830 11803 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 12289 12948 gene locus_tag LOCUS_21840 12289 12948 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_21840 12951 13841 gene locus_tag LOCUS_21850 gene ispE 12951 13841 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence59 858 2420 gene locus_tag LOCUS_21860 858 2420 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_21860 2436 4646 gene locus_tag LOCUS_21870 2436 4646 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_21870 4665 5255 gene locus_tag LOCUS_21880 4665 5255 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_21880 5257 5883 gene locus_tag LOCUS_21890 5257 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 5885 6331 gene locus_tag LOCUS_21900 5885 6331 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989756.1 protein_id gnl|my_center|LOCUS_21900 6969 6328 gene locus_tag LOCUS_21910 6969 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 7933 7040 gene locus_tag LOCUS_21920 7933 7040 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082369.1 protein_id gnl|my_center|LOCUS_21920 8901 7933 gene locus_tag LOCUS_21930 8901 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 9372 8989 gene locus_tag LOCUS_21940 9372 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 11113 9401 gene locus_tag LOCUS_21950 11113 9401 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_21950 11566 11132 gene locus_tag LOCUS_21960 11566 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 12631 11603 gene locus_tag LOCUS_21970 gene ruvB 12631 11603 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence60 1762 56 gene locus_tag LOCUS_21980 1762 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3264 1957 gene locus_tag LOCUS_21990 gene kbaZ 3264 1957 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 protein_id gnl|my_center|LOCUS_21990 3900 3271 gene locus_tag LOCUS_22000 3900 3271 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258664.1 protein_id gnl|my_center|LOCUS_22000 4853 3897 gene locus_tag LOCUS_22010 4853 3897 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_22010 4930 5112 gene locus_tag LOCUS_22020 4930 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6072 5152 gene locus_tag LOCUS_22030 6072 5152 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_22030 6653 6069 gene locus_tag LOCUS_22040 6653 6069 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_22040 7198 6650 gene locus_tag LOCUS_22050 7198 6650 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_22050 8762 7221 gene locus_tag LOCUS_22060 gene purH 8762 7221 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_22060 9338 8775 gene locus_tag LOCUS_22070 9338 8775 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_22070 <12652 9335 gene locus_tag LOCUS_22080 <12652 9335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965561.1:helicase-exonuclease AddAB subunit AddB >Feature sequence61 <1 791 gene locus_tag LOCUS_22090 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000690934.1:D-galactonate dehydratase family protein 1167 2108 gene locus_tag LOCUS_22100 1167 2108 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_22100 2132 3028 gene locus_tag LOCUS_22110 2132 3028 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130090.1 protein_id gnl|my_center|LOCUS_22110 3066 4550 gene locus_tag LOCUS_22120 3066 4550 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_22120 4613 5068 gene locus_tag LOCUS_22130 4613 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5094 6305 gene locus_tag LOCUS_22140 5094 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 7100 6309 gene locus_tag LOCUS_22150 7100 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 7384 8751 gene locus_tag LOCUS_22160 7384 8751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929215.1 protein_id gnl|my_center|LOCUS_22160 8870 9082 gene locus_tag LOCUS_22170 8870 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22170 9130 9792 gene locus_tag LOCUS_22180 9130 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 9789 10628 gene locus_tag LOCUS_22190 9789 10628 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_22190 10636 11496 gene locus_tag LOCUS_22200 10636 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence62 891 187 gene locus_tag LOCUS_22210 gene cwlD 891 187 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_22210 1940 942 gene locus_tag LOCUS_22220 1940 942 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_22220 2290 2048 gene locus_tag LOCUS_22230 2290 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2217 2624 gene locus_tag LOCUS_22240 2217 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2975 4081 gene locus_tag LOCUS_22250 gene ytvI 2975 4081 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_22250 4065 6017 gene locus_tag LOCUS_22260 gene ligA 4065 6017 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_22260 6094 6951 gene locus_tag LOCUS_22270 6094 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 6951 7259 gene locus_tag LOCUS_22280 6951 7259 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_22280 7351 8955 gene locus_tag LOCUS_22290 7351 8955 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_22290 8949 9848 gene locus_tag LOCUS_22300 8949 9848 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_22300 10347 9826 gene locus_tag LOCUS_22310 10347 9826 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888743.1 protein_id gnl|my_center|LOCUS_22310 11569 10397 gene locus_tag LOCUS_22320 11569 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 12021 11668 gene locus_tag LOCUS_22330 12021 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 <12555 12025 gene locus_tag LOCUS_22340 <12555 12025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583525.1:dipeptide ABC transporter ATP-binding protein >Feature sequence63 204 476 gene locus_tag LOCUS_22350 204 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1555 539 gene locus_tag LOCUS_22360 gene queA 1555 539 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_22360 3190 1568 gene locus_tag LOCUS_22370 3190 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4779 3190 gene locus_tag LOCUS_22380 4779 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6674 4776 gene locus_tag LOCUS_22390 gene selB 6674 4776 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 protein_id gnl|my_center|LOCUS_22390 7540 6671 gene locus_tag LOCUS_22400 7540 6671 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_22400 8058 7546 gene locus_tag LOCUS_22410 8058 7546 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_22410 9441 8059 gene locus_tag LOCUS_22420 gene selA 9441 8059 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_22420 9853 9434 gene locus_tag LOCUS_22430 9853 9434 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 protein_id gnl|my_center|LOCUS_22430 11027 9855 gene locus_tag LOCUS_22440 gene metK 11027 9855 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_22440 <11651 11033 gene locus_tag LOCUS_22450 <11651 11033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880434.1:1,4-alpha-glucan branching protein GlgB >Feature sequence64 2333 1167 gene locus_tag LOCUS_22460 gene dcm 2333 1167 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183201.1 protein_id gnl|my_center|LOCUS_22460 2570 2355 gene locus_tag LOCUS_22470 2570 2355 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994645.1 protein_id gnl|my_center|LOCUS_22470 2907 2833 gene locus_tag LOCUS_t00240 2907 2833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3184 2951 gene locus_tag LOCUS_22480 gene rpsR 3184 2951 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_22480 3708 3232 gene locus_tag LOCUS_22490 3708 3232 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131953.1 protein_id gnl|my_center|LOCUS_22490 4010 3723 gene locus_tag LOCUS_22500 gene rpsF 4010 3723 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_22500 4682 4128 gene locus_tag LOCUS_22510 gene raiA 4682 4128 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_22510 5214 4729 gene locus_tag LOCUS_22520 5214 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 5705 5217 gene locus_tag LOCUS_22530 5705 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 7583 5706 gene locus_tag LOCUS_22540 7583 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8667 7609 gene locus_tag LOCUS_22550 8667 7609 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969120.1 protein_id gnl|my_center|LOCUS_22550 <9944 8760 gene locus_tag LOCUS_22560 <9944 8760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939836.1:diaminopimelate decarboxylase >Feature sequence65 <1 540 gene locus_tag LOCUS_22570 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583208.1:sigma-70 family RNA polymerase sigma factor 530 1171 gene locus_tag LOCUS_22580 530 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1171 1791 gene locus_tag LOCUS_22590 1171 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1852 2853 gene locus_tag LOCUS_22600 gene tsaD 1852 2853 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_22600 2913 3926 gene locus_tag LOCUS_22610 2913 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5355 3880 gene locus_tag LOCUS_22620 5355 3880 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_22620 6469 5348 gene locus_tag LOCUS_22630 6469 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6615 7505 gene locus_tag LOCUS_22640 6615 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7884 9050 gene locus_tag LOCUS_22650 7884 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence66 501 1280 gene locus_tag LOCUS_22660 501 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2312 1284 gene locus_tag LOCUS_22670 2312 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3001 3810 gene locus_tag LOCUS_22680 3001 3810 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_22680 3929 4357 gene locus_tag LOCUS_22690 3929 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4656 4967 gene locus_tag LOCUS_22700 4656 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5150 5881 gene locus_tag LOCUS_22710 gene sigI 5150 5881 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965076.1 protein_id gnl|my_center|LOCUS_22710 5878 7593 gene locus_tag LOCUS_22720 5878 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7876 8493 gene locus_tag LOCUS_22730 7876 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence67 1981 3612 gene locus_tag LOCUS_22740 gene malQ 1981 3612 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173324.1 protein_id gnl|my_center|LOCUS_22740 3614 4456 gene locus_tag LOCUS_22750 3614 4456 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_22750 4459 5433 gene locus_tag LOCUS_22760 gene prmA 4459 5433 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_22760 5430 6161 gene locus_tag LOCUS_22770 5430 6161 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_22770 6162 6917 gene locus_tag LOCUS_22780 6162 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 6868 7203 gene locus_tag LOCUS_22790 6868 7203 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence68 1832 345 gene locus_tag LOCUS_22800 gene pap 1832 345 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_22800 2516 1902 gene locus_tag LOCUS_22810 2516 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2649 2482 gene locus_tag LOCUS_22820 2649 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3615 2704 gene locus_tag LOCUS_22830 gene era 3615 2704 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_22830 4812 3637 gene locus_tag LOCUS_22840 4812 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5331 4897 gene locus_tag LOCUS_22850 gene ybeY 5331 4897 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_22850 <7151 5309 gene locus_tag LOCUS_22860 <7151 5309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047997.1:HDIG domain-containing protein >Feature sequence69 2384 537 gene locus_tag LOCUS_22870 gene walK 2384 537 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 protein_id gnl|my_center|LOCUS_22870 3106 2381 gene locus_tag LOCUS_22880 3106 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5877 3232 gene locus_tag LOCUS_22890 5877 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence70 902 303 gene locus_tag LOCUS_22900 gene ruvA 902 303 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_22900 1297 2241 gene locus_tag LOCUS_22910 gene selD 1297 2241 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_22910 3800 2220 gene locus_tag LOCUS_22920 gene spoVB 3800 2220 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_22920 5084 3912 gene locus_tag LOCUS_22930 gene dacF 5084 3912 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_22930 5630 5241 gene locus_tag LOCUS_22940 5630 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5584 6042 gene locus_tag LOCUS_22950 gene lepB 5584 6042 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence71 209 1000 gene locus_tag LOCUS_22960 209 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1017 1592 gene locus_tag LOCUS_22970 1017 1592 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_22970 1957 1649 gene locus_tag LOCUS_22980 1957 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2576 2794 gene locus_tag LOCUS_22990 2576 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3180 3105 gene locus_tag LOCUS_t00250 3180 3105 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3870 3259 gene locus_tag LOCUS_23000 3870 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4685 3870 gene locus_tag LOCUS_23010 gene menH 4685 3870 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103366.1 protein_id gnl|my_center|LOCUS_23010 <5967 4708 gene locus_tag LOCUS_23020 <5967 4708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199804.1:acetyl-CoA hydrolase/transferase C-terminal domain-containing protein >Feature sequence72 648 3134 gene locus_tag LOCUS_23030 648 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4181 3309 gene locus_tag LOCUS_23040 4181 3309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_23040 5028 4171 gene locus_tag LOCUS_23050 5028 4171 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_23050 <5693 5100 gene locus_tag LOCUS_23060 <5693 5100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989910.1:sugar phosphate isomerase/epimerase >Feature sequence73 890 2185 gene locus_tag LOCUS_23070 890 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2182 2856 gene locus_tag LOCUS_23080 2182 2856 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939858.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence74 42 1466 gene locus_tag LOCUS_23090 42 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1463 2647 gene locus_tag LOCUS_23100 1463 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2637 3893 gene locus_tag LOCUS_23110 2637 3893 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence75 1137 115 gene locus_tag LOCUS_23120 1137 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1480 2430 gene locus_tag LOCUS_23130 1480 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2461 3117 gene locus_tag LOCUS_23140 2461 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 4057 3164 gene locus_tag LOCUS_23150 4057 3164 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence76 1594 827 gene locus_tag LOCUS_23160 gene spo0A 1594 827 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_23160 2945 1725 gene locus_tag LOCUS_23170 gene spoIVB 2945 1725 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_23170 3211 3591 gene locus_tag LOCUS_23180 3211 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence77 1482 241 gene locus_tag LOCUS_23190 1482 241 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_23190 1805 2698 gene locus_tag LOCUS_23200 1805 2698 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_23200 <3768 2729 gene locus_tag LOCUS_23210 <3768 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459687.1:RNA-splicing ligase RtcB >Feature sequence78 1007 60 gene locus_tag LOCUS_23220 1007 60 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_23220 1298 1041 gene locus_tag LOCUS_23230 1298 1041 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_23230 1498 2382 gene locus_tag LOCUS_23240 1498 2382 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_23240 2796 2491 gene locus_tag LOCUS_23250 2796 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence79 1689 1048 gene locus_tag LOCUS_23260 1689 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1809 2084 gene locus_tag LOCUS_23270 1809 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2306 2136 gene locus_tag LOCUS_23280 2306 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3338 2325 gene locus_tag LOCUS_23290 gene gapA 3338 2325 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence80 436 1104 gene locus_tag LOCUS_23300 436 1104 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_23300 1104 1610 gene locus_tag LOCUS_23310 gene ispF 1104 1610 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_23310 1597 2931 gene locus_tag LOCUS_23320 gene cysS 1597 2931 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence81 92 2050 gene locus_tag LOCUS_23330 92 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence82 1628 810 gene locus_tag LOCUS_23340 1628 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2182 1640 gene locus_tag LOCUS_23350 2182 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2740 2195 gene locus_tag LOCUS_23360 2740 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2903 2757 gene locus_tag LOCUS_23370 2903 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence83 107 1477 gene locus_tag LOCUS_23380 gene nusA 107 1477 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_23380 1568 1786 gene locus_tag LOCUS_23390 1568 1786 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_23390 1796 2125 gene locus_tag LOCUS_23400 1796 2125 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565784.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence84 71 1054 gene locus_tag LOCUS_23410 71 1054 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_23410 1067 1954 gene locus_tag LOCUS_23420 1067 1954 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_23420 1956 2672 gene locus_tag LOCUS_23430 1956 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence85 1527 754 gene locus_tag LOCUS_23440 gene tepA 1527 754 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_23440 1635 2615 gene locus_tag LOCUS_23450 1635 2615 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164481.1 protein_id gnl|my_center|LOCUS_23450