>Feature sequence01 464 198 gene locus_tag LOCUS_00010 464 198 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_00010 1440 529 gene locus_tag LOCUS_00020 1440 529 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_00020 1975 1430 gene locus_tag LOCUS_00030 1975 1430 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267035.1 protein_id gnl|my_center|LOCUS_00030 2918 2001 gene locus_tag LOCUS_00040 2918 2001 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_00040 3802 2915 gene locus_tag LOCUS_00050 3802 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4326 3799 gene locus_tag LOCUS_00060 4326 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5093 4371 gene locus_tag LOCUS_00070 5093 4371 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_00070 5505 5029 gene locus_tag LOCUS_00080 5505 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5555 5701 gene locus_tag LOCUS_00090 5555 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6560 5805 gene locus_tag LOCUS_00100 6560 5805 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_00100 8023 6593 gene locus_tag LOCUS_00110 8023 6593 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_00110 8823 8038 gene locus_tag LOCUS_00120 8823 8038 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_00120 8940 11285 gene locus_tag LOCUS_00130 8940 11285 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_00130 11294 11920 gene locus_tag LOCUS_00140 11294 11920 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_00140 11926 12426 gene locus_tag LOCUS_00150 11926 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12634 15129 gene locus_tag LOCUS_00160 12634 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16028 15165 gene locus_tag LOCUS_00170 16028 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17294 16170 gene locus_tag LOCUS_00180 gene dnaJ 17294 16170 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_00180 19219 17360 gene locus_tag LOCUS_00190 gene dnaK 19219 17360 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_00190 19875 19279 gene locus_tag LOCUS_00200 19875 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20292 19990 gene locus_tag LOCUS_00210 20292 19990 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192097.1 protein_id gnl|my_center|LOCUS_00210 20828 20307 gene locus_tag LOCUS_00220 gene grpE 20828 20307 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_00220 21865 20840 gene locus_tag LOCUS_00230 gene hrcA 21865 20840 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_00230 22694 22053 gene locus_tag LOCUS_00240 22694 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24118 22928 gene locus_tag LOCUS_00250 24118 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24407 25540 gene locus_tag LOCUS_00260 24407 25540 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_00260 25564 26415 gene locus_tag LOCUS_00270 25564 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27497 26487 gene locus_tag LOCUS_00280 gene tsaD 27497 26487 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_00280 27888 27499 gene locus_tag LOCUS_00290 27888 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28346 27918 gene locus_tag LOCUS_00300 28346 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28951 28358 gene locus_tag LOCUS_00310 28951 28358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29519 28941 gene locus_tag LOCUS_00320 29519 28941 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_00320 30661 29750 gene locus_tag LOCUS_00330 30661 29750 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_00330 31184 30654 gene locus_tag LOCUS_00340 gene lspA 31184 30654 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130994.1 protein_id gnl|my_center|LOCUS_00340 32212 31175 gene locus_tag LOCUS_00350 gene aroB 32212 31175 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125161.1 protein_id gnl|my_center|LOCUS_00350 33440 32313 gene locus_tag LOCUS_00360 33440 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33677 34378 gene locus_tag LOCUS_00370 33677 34378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34463 37378 gene locus_tag LOCUS_00380 34463 37378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37400 38956 gene locus_tag LOCUS_00390 37400 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39032 39916 gene locus_tag LOCUS_00400 39032 39916 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_00400 39903 40472 gene locus_tag LOCUS_00410 39903 40472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40508 42088 gene locus_tag LOCUS_00420 40508 42088 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_00420 42468 43007 gene locus_tag LOCUS_00430 42468 43007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45372 43084 gene locus_tag LOCUS_00440 45372 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45905 49873 gene locus_tag LOCUS_00450 45905 49873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49974 50147 gene locus_tag LOCUS_00460 49974 50147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50169 51398 gene locus_tag LOCUS_00470 50169 51398 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_00470 51492 52286 gene locus_tag LOCUS_00480 gene dapF 51492 52286 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_00480 52283 53806 gene locus_tag LOCUS_00490 gene guaA 52283 53806 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_00490 53877 54527 gene locus_tag LOCUS_00500 53877 54527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54669 57545 gene locus_tag LOCUS_00510 54669 57545 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_00510 57565 58188 gene locus_tag LOCUS_00520 57565 58188 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052019.1 protein_id gnl|my_center|LOCUS_00520 58192 59433 gene locus_tag LOCUS_00530 58192 59433 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_00530 59417 59614 gene locus_tag LOCUS_00540 59417 59614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59677 59904 gene locus_tag LOCUS_00550 59677 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60004 60570 gene locus_tag LOCUS_00560 60004 60570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60671 61444 gene locus_tag LOCUS_00570 gene soj 60671 61444 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_00570 61452 62342 gene locus_tag LOCUS_00580 61452 62342 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_00580 62908 62339 gene locus_tag LOCUS_00590 gene thiT 62908 62339 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869028.1 protein_id gnl|my_center|LOCUS_00590 63105 63929 gene locus_tag LOCUS_00600 gene yidA 63105 63929 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065596971.1 protein_id gnl|my_center|LOCUS_00600 63992 64855 gene locus_tag LOCUS_00610 63992 64855 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_00610 65893 64907 gene locus_tag LOCUS_00620 gene galE 65893 64907 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_00620 66767 65913 gene locus_tag LOCUS_00630 gene garR 66767 65913 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297159.1 protein_id gnl|my_center|LOCUS_00630 67112 68563 gene locus_tag LOCUS_00640 67112 68563 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_00640 68625 69872 gene locus_tag LOCUS_00650 68625 69872 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_00650 70182 72359 gene locus_tag LOCUS_00660 70182 72359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72624 73628 gene locus_tag LOCUS_00670 72624 73628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671815.1 protein_id gnl|my_center|LOCUS_00670 73683 76313 gene locus_tag LOCUS_00680 73683 76313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76320 77309 gene locus_tag LOCUS_00690 76320 77309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_00690 77302 78849 gene locus_tag LOCUS_00700 77302 78849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78920 79105 gene locus_tag LOCUS_00710 78920 79105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 79179 80984 gene locus_tag LOCUS_00720 79179 80984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 81000 81800 gene locus_tag LOCUS_00730 81000 81800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 81880 82226 gene locus_tag LOCUS_tm00010 81880 82226 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 82298 82792 gene locus_tag LOCUS_00740 82298 82792 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_00740 82880 83035 gene locus_tag LOCUS_00750 82880 83035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 83137 83343 gene locus_tag LOCUS_00760 83137 83343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84314 83661 gene locus_tag LOCUS_00770 84314 83661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84480 84407 gene locus_tag LOCUS_t00010 84480 84407 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 85205 84624 gene locus_tag LOCUS_00780 85205 84624 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_00780 85492 85229 gene locus_tag LOCUS_00790 85492 85229 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_00790 85683 85489 gene locus_tag LOCUS_00800 85683 85489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85852 86556 gene locus_tag LOCUS_00810 85852 86556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 86575 87351 gene locus_tag LOCUS_00820 86575 87351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 87493 89472 gene locus_tag LOCUS_00830 gene uvrB 87493 89472 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_00830 89486 91582 gene locus_tag LOCUS_00840 89486 91582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 91597 94434 gene locus_tag LOCUS_00850 gene uvrA 91597 94434 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_00850 94478 95476 gene locus_tag LOCUS_00860 94478 95476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 95650 96198 gene locus_tag LOCUS_00870 95650 96198 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 protein_id gnl|my_center|LOCUS_00870 96349 96879 gene locus_tag LOCUS_00880 gene dcd 96349 96879 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_00880 96884 98146 gene locus_tag LOCUS_00890 96884 98146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98159 100804 gene locus_tag LOCUS_00900 98159 100804 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_00900 100801 102048 gene locus_tag LOCUS_00910 100801 102048 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_00910 102066 102215 gene locus_tag LOCUS_00920 102066 102215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 102216 103646 gene locus_tag LOCUS_00930 102216 103646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 103725 104072 gene locus_tag LOCUS_00940 103725 104072 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_00940 104190 104810 gene locus_tag LOCUS_00950 104190 104810 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033728358.1 protein_id gnl|my_center|LOCUS_00950 104960 105667 gene locus_tag LOCUS_00960 104960 105667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105726 107414 gene locus_tag LOCUS_00970 105726 107414 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_00970 107652 107736 gene locus_tag LOCUS_t00020 107652 107736 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108971 107862 gene locus_tag LOCUS_00980 108971 107862 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_00980 109626 108976 gene locus_tag LOCUS_00990 109626 108976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 110061 109654 gene locus_tag LOCUS_01000 110061 109654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 110209 110427 gene locus_tag LOCUS_01010 110209 110427 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398958.1 protein_id gnl|my_center|LOCUS_01010 110550 110774 gene locus_tag LOCUS_01020 110550 110774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110814 112730 gene locus_tag LOCUS_01030 110814 112730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 112958 112764 gene locus_tag LOCUS_01040 112958 112764 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681551.1 protein_id gnl|my_center|LOCUS_01040 113178 112951 gene locus_tag LOCUS_01050 113178 112951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 113251 114114 gene locus_tag LOCUS_01060 113251 114114 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_01060 114107 115357 gene locus_tag LOCUS_01070 114107 115357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 115383 115664 gene locus_tag LOCUS_01080 115383 115664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115664 117526 gene locus_tag LOCUS_01090 115664 117526 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_01090 117523 117804 gene locus_tag LOCUS_01100 117523 117804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117869 118861 gene locus_tag LOCUS_01110 117869 118861 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_01110 118933 119331 gene locus_tag LOCUS_01120 118933 119331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 119294 121897 gene locus_tag LOCUS_01130 119294 121897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007789938.1 protein_id gnl|my_center|LOCUS_01130 121932 122207 gene locus_tag LOCUS_01140 121932 122207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 122197 123324 gene locus_tag LOCUS_01150 122197 123324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 123324 123716 gene locus_tag LOCUS_01160 123324 123716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 123760 126753 gene locus_tag LOCUS_01170 123760 126753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 126753 128186 gene locus_tag LOCUS_01180 126753 128186 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_01180 128676 129776 gene locus_tag LOCUS_01190 128676 129776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 130669 130121 gene locus_tag LOCUS_01200 130669 130121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 130999 130730 gene locus_tag LOCUS_01210 130999 130730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 131262 130999 gene locus_tag LOCUS_01220 131262 130999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 131863 131363 gene locus_tag LOCUS_01230 131863 131363 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 protein_id gnl|my_center|LOCUS_01230 132097 131903 gene locus_tag LOCUS_01240 132097 131903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 132301 132513 gene locus_tag LOCUS_01250 132301 132513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134091 133189 gene locus_tag LOCUS_01260 134091 133189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 137183 134094 gene locus_tag LOCUS_01270 137183 134094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 138453 137176 gene locus_tag LOCUS_01280 138453 137176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139665 138565 gene locus_tag LOCUS_01290 139665 138565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 139787 141961 gene locus_tag LOCUS_01300 139787 141961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 142720 142160 gene locus_tag LOCUS_01310 142720 142160 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813959.1 protein_id gnl|my_center|LOCUS_01310 144019 142721 gene locus_tag LOCUS_01320 144019 142721 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681959.1 protein_id gnl|my_center|LOCUS_01320 145170 144304 gene locus_tag LOCUS_01330 gene fba 145170 144304 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_01330 145320 146093 gene locus_tag LOCUS_01340 145320 146093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 146122 147492 gene locus_tag LOCUS_01350 146122 147492 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence02 409 2601 gene locus_tag LOCUS_01360 409 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2714 3400 gene locus_tag LOCUS_01370 2714 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3748 3386 gene locus_tag LOCUS_01380 3748 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3849 4196 gene locus_tag LOCUS_01390 3849 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4189 4791 gene locus_tag LOCUS_01400 4189 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5738 5989 gene locus_tag LOCUS_01410 5738 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 6670 5936 gene locus_tag LOCUS_01420 gene sigE 6670 5936 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_01420 7115 6663 gene locus_tag LOCUS_01430 7115 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7249 7518 gene locus_tag LOCUS_01440 7249 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 9090 7639 gene locus_tag LOCUS_01450 9090 7639 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_01450 9501 9247 gene locus_tag LOCUS_01460 9501 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9930 9556 gene locus_tag LOCUS_01470 9930 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10045 9914 gene locus_tag LOCUS_01480 10045 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 10550 11485 gene locus_tag LOCUS_01490 10550 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11530 12408 gene locus_tag LOCUS_01500 11530 12408 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360134.1 protein_id gnl|my_center|LOCUS_01500 13590 12472 gene locus_tag LOCUS_01510 gene grdD 13590 12472 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948889.1 protein_id gnl|my_center|LOCUS_01510 15138 13603 gene locus_tag LOCUS_01520 gene grdC 15138 13603 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_01520 15708 15238 gene locus_tag LOCUS_01530 gene grdA 15708 15238 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986236.1 transl_except (pos:complement(15577..15579),aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01530 16182 15736 gene locus_tag LOCUS_01540 16182 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 16513 16196 gene locus_tag LOCUS_01550 16513 16196 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356487.1 protein_id gnl|my_center|LOCUS_01550 17831 16530 gene locus_tag LOCUS_01560 gene grdB 17831 16530 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:complement(16788..16790),aa:Sec) note codon on position 348 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01560 19139 17859 gene locus_tag LOCUS_01570 19139 17859 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_01570 19474 19217 gene locus_tag LOCUS_01580 19474 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 20463 19591 gene locus_tag LOCUS_01590 20463 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20596 21480 gene locus_tag LOCUS_01600 20596 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_01600 23029 21533 gene locus_tag LOCUS_01610 gene hutH 23029 21533 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_01610 23170 25155 gene locus_tag LOCUS_01620 23170 25155 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_01620 25188 25385 gene locus_tag LOCUS_01630 25188 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25427 26323 gene locus_tag LOCUS_01640 gene ftcD 25427 26323 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_01640 26332 27567 gene locus_tag LOCUS_01650 gene hutI 26332 27567 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_01650 27554 28183 gene locus_tag LOCUS_01660 27554 28183 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_01660 29398 28253 gene locus_tag LOCUS_01670 29398 28253 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_01670 29474 29644 gene locus_tag LOCUS_01680 29474 29644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 31177 29675 gene locus_tag LOCUS_01690 31177 29675 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_01690 31315 31845 gene locus_tag LOCUS_01700 31315 31845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 31848 32261 gene locus_tag LOCUS_01710 31848 32261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 32258 33208 gene locus_tag LOCUS_01720 32258 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 33328 33403 gene locus_tag LOCUS_t00030 33328 33403 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33475 35346 gene locus_tag LOCUS_01730 33475 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 36342 35566 gene locus_tag LOCUS_01740 36342 35566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 37113 36349 gene locus_tag LOCUS_01750 37113 36349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 37575 37129 gene locus_tag LOCUS_01760 37575 37129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 38579 37650 gene locus_tag LOCUS_01770 gene tsf 38579 37650 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_01770 39374 38607 gene locus_tag LOCUS_01780 gene rpsB 39374 38607 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_01780 39715 39521 gene locus_tag LOCUS_01790 39715 39521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 40985 40002 gene locus_tag LOCUS_01800 40985 40002 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_01800 42276 40996 gene locus_tag LOCUS_01810 42276 40996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 42902 42270 gene locus_tag LOCUS_01820 gene coaB 42902 42270 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282564.1 protein_id gnl|my_center|LOCUS_01820 45491 42918 gene locus_tag LOCUS_01830 45491 42918 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387314.1 protein_id gnl|my_center|LOCUS_01830 46038 45508 gene locus_tag LOCUS_01840 46038 45508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47416 46097 gene locus_tag LOCUS_01850 47416 46097 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_01850 49607 47406 gene locus_tag LOCUS_01860 49607 47406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 49713 50294 gene locus_tag LOCUS_01870 gene pyrE 49713 50294 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_01870 50359 51003 gene locus_tag LOCUS_01880 50359 51003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 51273 51019 gene locus_tag LOCUS_01890 51273 51019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798786.1 protein_id gnl|my_center|LOCUS_01890 52871 51282 gene locus_tag LOCUS_01900 52871 51282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 protein_id gnl|my_center|LOCUS_01900 53358 52954 gene locus_tag LOCUS_01910 53358 52954 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389721.1 protein_id gnl|my_center|LOCUS_01910 53754 55412 gene locus_tag LOCUS_01920 53754 55412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 55544 57202 gene locus_tag LOCUS_01930 55544 57202 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965410.1 protein_id gnl|my_center|LOCUS_01930 57202 57975 gene locus_tag LOCUS_01940 57202 57975 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_01940 58048 58452 gene locus_tag LOCUS_01950 58048 58452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 59360 58614 gene locus_tag LOCUS_01960 59360 58614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 59765 60502 gene locus_tag LOCUS_01970 59765 60502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_01970 60486 61151 gene locus_tag LOCUS_01980 60486 61151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 61584 61892 gene locus_tag LOCUS_01990 gene rpsJ 61584 61892 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_01990 61937 62593 gene locus_tag LOCUS_02000 gene rplC 61937 62593 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_02000 62617 63243 gene locus_tag LOCUS_02010 gene rplD 62617 63243 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_02010 63243 63545 gene locus_tag LOCUS_02020 gene rplW 63243 63545 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_02020 63568 64413 gene locus_tag LOCUS_02030 gene rplB 63568 64413 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_02030 64429 64926 gene locus_tag LOCUS_02040 64429 64926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 64942 65226 gene locus_tag LOCUS_02050 gene rpsS 64942 65226 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_02050 65284 65688 gene locus_tag LOCUS_02060 65284 65688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 65711 66478 gene locus_tag LOCUS_02070 gene rpsC 65711 66478 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_02070 66478 66960 gene locus_tag LOCUS_02080 gene rplP 66478 66960 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_02080 66981 67190 gene locus_tag LOCUS_02090 66981 67190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 67234 67503 gene locus_tag LOCUS_02100 gene rpsQ 67234 67503 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_02100 67549 67917 gene locus_tag LOCUS_02110 gene rplN 67549 67917 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_02110 67932 68264 gene locus_tag LOCUS_02120 gene rplX 67932 68264 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_02120 68315 68860 gene locus_tag LOCUS_02130 gene rplE 68315 68860 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_02130 68875 69060 gene locus_tag LOCUS_02140 68875 69060 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_02140 69107 69508 gene locus_tag LOCUS_02150 gene rpsH 69107 69508 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_02150 69573 70115 gene locus_tag LOCUS_02160 gene rplF 69573 70115 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_02160 70167 70535 gene locus_tag LOCUS_02170 gene rplR 70167 70535 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_02170 70545 71048 gene locus_tag LOCUS_02180 gene rpsE 70545 71048 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_02180 71070 71249 gene locus_tag LOCUS_02190 gene rpmD 71070 71249 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057245.1 protein_id gnl|my_center|LOCUS_02190 71271 71711 gene locus_tag LOCUS_02200 gene rplO 71271 71711 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_02200 71711 72949 gene locus_tag LOCUS_02210 gene secY 71711 72949 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_02210 73006 73665 gene locus_tag LOCUS_02220 73006 73665 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02220 73649 74401 gene locus_tag LOCUS_02230 gene map 73649 74401 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_02230 74398 74754 gene locus_tag LOCUS_02240 74398 74754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 74768 74986 gene locus_tag LOCUS_02250 gene infA 74768 74986 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_02250 75151 75519 gene locus_tag LOCUS_02260 gene rpsM 75151 75519 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_02260 75535 75936 gene locus_tag LOCUS_02270 gene rpsK 75535 75936 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_02270 75955 76551 gene locus_tag LOCUS_02280 gene rpsD 75955 76551 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_02280 76633 77586 gene locus_tag LOCUS_02290 76633 77586 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_02290 77626 78162 gene locus_tag LOCUS_02300 gene rplQ 77626 78162 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_02300 78265 78960 gene locus_tag LOCUS_02310 78265 78960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 79024 80382 gene locus_tag LOCUS_02320 gene rsmB 79024 80382 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 protein_id gnl|my_center|LOCUS_02320 80389 81432 gene locus_tag LOCUS_02330 gene rlmN 80389 81432 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_02330 81456 82217 gene locus_tag LOCUS_02340 81456 82217 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_02340 82214 84271 gene locus_tag LOCUS_02350 gene pknB 82214 84271 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_02350 84264 85136 gene locus_tag LOCUS_02360 gene rsgA 84264 85136 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_02360 85137 85790 gene locus_tag LOCUS_02370 gene rpe 85137 85790 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_02370 85801 86565 gene locus_tag LOCUS_02380 85801 86565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 86537 87022 gene locus_tag LOCUS_02390 86537 87022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 87040 87198 gene locus_tag LOCUS_02400 87040 87198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 87328 87528 gene locus_tag LOCUS_02410 87328 87528 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_02410 87666 88832 gene locus_tag LOCUS_02420 gene purK 87666 88832 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_02420 88834 89349 gene locus_tag LOCUS_02430 gene purE 88834 89349 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_02430 91334 89775 gene locus_tag LOCUS_02440 91334 89775 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963849.1 protein_id gnl|my_center|LOCUS_02440 92557 91607 gene locus_tag LOCUS_02450 92557 91607 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392391.1 protein_id gnl|my_center|LOCUS_02450 93458 92550 gene locus_tag LOCUS_02460 93458 92550 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813638.1 protein_id gnl|my_center|LOCUS_02460 94588 93440 gene locus_tag LOCUS_02470 94588 93440 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_02470 94707 95768 gene locus_tag LOCUS_02480 gene yedE 94707 95768 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_02480 95765 95974 gene locus_tag LOCUS_02490 95765 95974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 95971 96201 gene locus_tag LOCUS_02500 95971 96201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 96215 96874 gene locus_tag LOCUS_02510 96215 96874 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_02510 96864 97691 gene locus_tag LOCUS_02520 96864 97691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 98801 97890 gene locus_tag LOCUS_02530 98801 97890 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_02530 99531 98998 gene locus_tag LOCUS_02540 99531 98998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 99667 100347 gene locus_tag LOCUS_02550 99667 100347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_02550 100350 102224 gene locus_tag LOCUS_02560 100350 102224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 103559 102426 gene locus_tag LOCUS_02570 103559 102426 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_02570 104498 103632 gene locus_tag LOCUS_02580 104498 103632 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_02580 104647 106491 gene locus_tag LOCUS_02590 gene uvrC 104647 106491 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048309.1 protein_id gnl|my_center|LOCUS_02590 106974 106612 gene locus_tag LOCUS_02600 106974 106612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 108296 107316 gene locus_tag LOCUS_02610 108296 107316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 108426 109151 gene locus_tag LOCUS_02620 108426 109151 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_02620 109173 109616 gene locus_tag LOCUS_02630 gene tsaE 109173 109616 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_02630 109597 110280 gene locus_tag LOCUS_02640 gene tsaB 109597 110280 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865764.1 protein_id gnl|my_center|LOCUS_02640 110273 110749 gene locus_tag LOCUS_02650 gene rimI 110273 110749 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_02650 110736 113117 gene locus_tag LOCUS_02660 110736 113117 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_02660 113263 114282 gene locus_tag LOCUS_02670 113263 114282 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_02670 114305 115468 gene locus_tag LOCUS_02680 114305 115468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 115493 117850 gene locus_tag LOCUS_02690 115493 117850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 118485 117847 gene locus_tag LOCUS_02700 118485 117847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 118594 118472 gene locus_tag LOCUS_02710 118594 118472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 119580 118675 gene locus_tag LOCUS_02720 gene era 119580 118675 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_02720 119773 119591 gene locus_tag LOCUS_02730 119773 119591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 120258 119770 gene locus_tag LOCUS_02740 gene ybeY 120258 119770 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_02740 122386 120251 gene locus_tag LOCUS_02750 122386 120251 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_02750 123495 122512 gene locus_tag LOCUS_02760 123495 122512 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_02760 124714 123485 gene locus_tag LOCUS_02770 124714 123485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 124998 124717 gene locus_tag LOCUS_02780 124998 124717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 125103 125561 gene locus_tag LOCUS_02790 gene aroQ 125103 125561 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_02790 125561 126118 gene locus_tag LOCUS_02800 gene efp 125561 126118 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence03 1765 239 gene locus_tag LOCUS_02810 1765 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2728 1784 gene locus_tag LOCUS_02820 2728 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3593 2874 gene locus_tag LOCUS_02830 3593 2874 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_02830 3656 4558 gene locus_tag LOCUS_02840 3656 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4614 5759 gene locus_tag LOCUS_02850 4614 5759 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_02850 7020 5917 gene locus_tag LOCUS_02860 gene buk 7020 5917 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_02860 7194 7030 gene locus_tag LOCUS_02870 7194 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7777 7208 gene locus_tag LOCUS_02880 7777 7208 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_02880 9558 7795 gene locus_tag LOCUS_02890 gene iorA 9558 7795 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_02890 9924 9571 gene locus_tag LOCUS_02900 9924 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10744 9938 gene locus_tag LOCUS_02910 10744 9938 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 protein_id gnl|my_center|LOCUS_02910 11345 10737 gene locus_tag LOCUS_02920 gene yihA 11345 10737 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_02920 12593 11607 gene locus_tag LOCUS_02930 gene gpsA 12593 11607 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_02930 13588 12671 gene locus_tag LOCUS_02940 13588 12671 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_02940 13729 15006 gene locus_tag LOCUS_02950 gene serS 13729 15006 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_02950 14993 15952 gene locus_tag LOCUS_02960 14993 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 15968 18064 gene locus_tag LOCUS_02970 15968 18064 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_02970 18064 19902 gene locus_tag LOCUS_02980 gene recQ 18064 19902 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_02980 19914 21101 gene locus_tag LOCUS_02990 19914 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 22952 21138 gene locus_tag LOCUS_03000 22952 21138 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_03000 23040 24080 gene locus_tag LOCUS_03010 23040 24080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462321.1 protein_id gnl|my_center|LOCUS_03010 24122 24763 gene locus_tag LOCUS_03020 24122 24763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 24856 25215 gene locus_tag LOCUS_03030 24856 25215 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_03030 26093 25260 gene locus_tag LOCUS_03040 26093 25260 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948750.1 protein_id gnl|my_center|LOCUS_03040 26861 26118 gene locus_tag LOCUS_03050 26861 26118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_03050 27610 26873 gene locus_tag LOCUS_03060 27610 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 28901 28206 gene locus_tag LOCUS_03070 gene rplA 28901 28206 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_03070 29424 28984 gene locus_tag LOCUS_03080 29424 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 29753 29439 gene locus_tag LOCUS_03090 29753 29439 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462608.1 protein_id gnl|my_center|LOCUS_03090 30206 29781 gene locus_tag LOCUS_03100 gene rplK 30206 29781 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_03100 30811 30290 gene locus_tag LOCUS_03110 gene nusG 30811 30290 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_03110 31056 30829 gene locus_tag LOCUS_03120 31056 30829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 31218 31069 gene locus_tag LOCUS_03130 gene rpmG 31218 31069 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_03130 31710 31450 gene locus_tag LOCUS_03140 31710 31450 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_03140 33545 32196 gene locus_tag LOCUS_03150 33545 32196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 33739 35169 gene locus_tag LOCUS_03160 33739 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 35183 35650 gene locus_tag LOCUS_03170 35183 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 35647 36075 gene locus_tag LOCUS_03180 35647 36075 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288162.1 protein_id gnl|my_center|LOCUS_03180 36240 36731 gene locus_tag LOCUS_03190 36240 36731 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_03190 36728 37555 gene locus_tag LOCUS_03200 36728 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 37818 37585 gene locus_tag LOCUS_03210 37818 37585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 38336 39655 gene locus_tag LOCUS_03220 38336 39655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 40276 39656 gene locus_tag LOCUS_03230 gene cwlD 40276 39656 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_03230 40382 41011 gene locus_tag LOCUS_03240 40382 41011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 41004 41858 gene locus_tag LOCUS_03250 gene ylqF 41004 41858 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_03250 41851 42636 gene locus_tag LOCUS_03260 41851 42636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 42654 43487 gene locus_tag LOCUS_03270 42654 43487 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203489.1 protein_id gnl|my_center|LOCUS_03270 43490 44440 gene locus_tag LOCUS_03280 43490 44440 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_03280 44813 45298 gene locus_tag LOCUS_03290 44813 45298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 46326 45514 gene locus_tag LOCUS_03300 46326 45514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 48162 46510 gene locus_tag LOCUS_03310 48162 46510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485152.1 protein_id gnl|my_center|LOCUS_03310 49904 48147 gene locus_tag LOCUS_03320 49904 48147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_03320 50089 49901 gene locus_tag LOCUS_03330 50089 49901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 50195 51082 gene locus_tag LOCUS_03340 50195 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 51509 51087 gene locus_tag LOCUS_03350 51509 51087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 51801 51541 gene locus_tag LOCUS_03360 51801 51541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 53783 51969 gene locus_tag LOCUS_03370 53783 51969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 54102 53755 gene locus_tag LOCUS_03380 54102 53755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 55081 54116 gene locus_tag LOCUS_03390 55081 54116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 55435 55091 gene locus_tag LOCUS_03400 55435 55091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 55739 55419 gene locus_tag LOCUS_03410 55739 55419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 56223 55726 gene locus_tag LOCUS_03420 56223 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 56625 56236 gene locus_tag LOCUS_03430 56625 56236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 57232 56606 gene locus_tag LOCUS_03440 57232 56606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 57600 57232 gene locus_tag LOCUS_03450 57600 57232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 58545 57667 gene locus_tag LOCUS_03460 58545 57667 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861029.1 protein_id gnl|my_center|LOCUS_03460 58866 58615 gene locus_tag LOCUS_03470 58866 58615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 60274 58868 gene locus_tag LOCUS_03480 60274 58868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 61591 60296 gene locus_tag LOCUS_03490 61591 60296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 61967 61644 gene locus_tag LOCUS_03500 61967 61644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 62418 61951 gene locus_tag LOCUS_03510 62418 61951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 62905 62555 gene locus_tag LOCUS_03520 62905 62555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 64462 63698 gene locus_tag LOCUS_03530 64462 63698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 65172 64462 gene locus_tag LOCUS_03540 65172 64462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621679.1 protein_id gnl|my_center|LOCUS_03540 65308 65397 gene locus_tag LOCUS_t00040 65308 65397 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66136 65453 gene locus_tag LOCUS_03550 66136 65453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 67258 66191 gene locus_tag LOCUS_03560 67258 66191 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_03560 67710 67291 gene locus_tag LOCUS_03570 67710 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 68072 67707 gene locus_tag LOCUS_03580 68072 67707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 68566 68072 gene locus_tag LOCUS_03590 68566 68072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 68911 68579 gene locus_tag LOCUS_03600 68911 68579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 69972 68926 gene locus_tag LOCUS_03610 69972 68926 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 protein_id gnl|my_center|LOCUS_03610 71081 70113 gene locus_tag LOCUS_03620 71081 70113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 72284 71283 gene locus_tag LOCUS_03630 72284 71283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 73298 72378 gene locus_tag LOCUS_03640 73298 72378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 74107 73424 gene locus_tag LOCUS_03650 gene phoB 74107 73424 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208685.1 protein_id gnl|my_center|LOCUS_03650 77514 74323 gene locus_tag LOCUS_03660 77514 74323 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022007.1 protein_id gnl|my_center|LOCUS_03660 78580 77543 gene locus_tag LOCUS_03670 78580 77543 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_03670 81792 78694 gene locus_tag LOCUS_03680 gene ileS 81792 78694 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_03680 82161 81934 gene locus_tag LOCUS_03690 82161 81934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 82494 82327 gene locus_tag LOCUS_03700 82494 82327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 85101 82666 gene locus_tag LOCUS_03710 85101 82666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 85992 85774 gene locus_tag LOCUS_03720 85992 85774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence04 1743 151 gene locus_tag LOCUS_03730 1743 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1960 2175 gene locus_tag LOCUS_03740 gene rpmB 1960 2175 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_03740 2178 3338 gene locus_tag LOCUS_03750 gene wecB 2178 3338 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080488.1 protein_id gnl|my_center|LOCUS_03750 3355 3867 gene locus_tag LOCUS_03760 3355 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3869 4564 gene locus_tag LOCUS_03770 gene atpB 3869 4564 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_03770 4647 4982 gene locus_tag LOCUS_03780 4647 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5035 5613 gene locus_tag LOCUS_03790 5035 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5601 6170 gene locus_tag LOCUS_03800 gene atpH 5601 6170 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 protein_id gnl|my_center|LOCUS_03800 6189 7796 gene locus_tag LOCUS_03810 gene atpA 6189 7796 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_03810 7810 8685 gene locus_tag LOCUS_03820 gene atpG 7810 8685 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_03820 8713 10098 gene locus_tag LOCUS_03830 gene atpD 8713 10098 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_03830 10114 10551 gene locus_tag LOCUS_03840 10114 10551 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_03840 11084 10593 gene locus_tag LOCUS_03850 11084 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11677 11219 gene locus_tag LOCUS_03860 11677 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12021 13619 gene locus_tag LOCUS_03870 12021 13619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_03870 13813 15672 gene locus_tag LOCUS_03880 13813 15672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_03880 15836 17596 gene locus_tag LOCUS_03890 15836 17596 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03890 17705 19516 gene locus_tag LOCUS_03900 gene pepF 17705 19516 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_03900 19630 20340 gene locus_tag LOCUS_03910 gene ispD 19630 20340 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_03910 20341 21447 gene locus_tag LOCUS_03920 20341 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 21506 23041 gene locus_tag LOCUS_03930 21506 23041 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_03930 23059 25323 gene locus_tag LOCUS_03940 23059 25323 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_03940 25320 25838 gene locus_tag LOCUS_03950 25320 25838 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647216.1 protein_id gnl|my_center|LOCUS_03950 25914 26474 gene locus_tag LOCUS_03960 25914 26474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904666.1 protein_id gnl|my_center|LOCUS_03960 26710 26489 gene locus_tag LOCUS_03970 26710 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 27311 26772 gene locus_tag LOCUS_03980 27311 26772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 27534 28913 gene locus_tag LOCUS_03990 gene miaB 27534 28913 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_03990 28910 29170 gene locus_tag LOCUS_04000 28910 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29167 31698 gene locus_tag LOCUS_04010 gene mutS 29167 31698 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_04010 31701 32594 gene locus_tag LOCUS_04020 gene miaA 31701 32594 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_04020 32591 33001 gene locus_tag LOCUS_04030 32591 33001 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_04030 33014 34306 gene locus_tag LOCUS_04040 33014 34306 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_04040 34687 34343 gene locus_tag LOCUS_04050 34687 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 34856 35434 gene locus_tag LOCUS_04060 34856 35434 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263281.1 protein_id gnl|my_center|LOCUS_04060 36947 35481 gene locus_tag LOCUS_04070 gene speA 36947 35481 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_04070 38379 36958 gene locus_tag LOCUS_04080 38379 36958 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_04080 38522 39367 gene locus_tag LOCUS_04090 38522 39367 CDS product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006686.1 protein_id gnl|my_center|LOCUS_04090 40605 39430 gene locus_tag LOCUS_04100 gene dacF 40605 39430 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_04100 40706 41167 gene locus_tag LOCUS_04110 gene trmL 40706 41167 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_04110 41183 43048 gene locus_tag LOCUS_04120 gene asnB 41183 43048 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_04120 43032 43247 gene locus_tag LOCUS_04130 43032 43247 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222698.1 protein_id gnl|my_center|LOCUS_04130 43263 43829 gene locus_tag LOCUS_04140 43263 43829 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_04140 43849 44565 gene locus_tag LOCUS_04150 43849 44565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 44647 45654 gene locus_tag LOCUS_04160 44647 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 45654 46523 gene locus_tag LOCUS_04170 45654 46523 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_04170 46508 47359 gene locus_tag LOCUS_04180 46508 47359 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_04180 47362 47481 gene locus_tag LOCUS_04190 47362 47481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 47612 48430 gene locus_tag LOCUS_04200 47612 48430 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_04200 48446 48880 gene locus_tag LOCUS_04210 48446 48880 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_04210 49669 48893 gene locus_tag LOCUS_04220 49669 48893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 49733 50473 gene locus_tag LOCUS_04230 gene truA 49733 50473 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_04230 51208 50822 gene locus_tag LOCUS_04240 51208 50822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 51842 51258 gene locus_tag LOCUS_04250 51842 51258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 53338 51914 gene locus_tag LOCUS_04260 53338 51914 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_04260 53881 53372 gene locus_tag LOCUS_04270 53881 53372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 54004 55443 gene locus_tag LOCUS_04280 54004 55443 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_04280 56375 55512 gene locus_tag LOCUS_04290 56375 55512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 56527 58032 gene locus_tag LOCUS_04300 gene ypwA 56527 58032 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_04300 58923 58144 gene locus_tag LOCUS_04310 58923 58144 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_04310 59930 58911 gene locus_tag LOCUS_04320 59930 58911 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166416.1 protein_id gnl|my_center|LOCUS_04320 60088 59930 gene locus_tag LOCUS_04330 60088 59930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 61456 60098 gene locus_tag LOCUS_04340 gene dnaB 61456 60098 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_04340 61915 61472 gene locus_tag LOCUS_04350 gene rplI 61915 61472 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_04350 63344 61929 gene locus_tag LOCUS_04360 63344 61929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 63596 65881 gene locus_tag LOCUS_04370 63596 65881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 66123 65992 gene locus_tag LOCUS_04380 66123 65992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 68635 66233 gene locus_tag LOCUS_04390 68635 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 68775 69458 gene locus_tag LOCUS_04400 68775 69458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 69654 71198 gene locus_tag LOCUS_04410 gene rny 69654 71198 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04410 71253 72029 gene locus_tag LOCUS_04420 71253 72029 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361040.1 protein_id gnl|my_center|LOCUS_04420 72020 72790 gene locus_tag LOCUS_04430 gene yidA 72020 72790 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_04430 72784 73332 gene locus_tag LOCUS_04440 72784 73332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 73333 74157 gene locus_tag LOCUS_04450 73333 74157 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_04450 74890 74453 gene locus_tag LOCUS_04460 74890 74453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 76671 74893 gene locus_tag LOCUS_04470 gene aspS 76671 74893 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence05 615 2330 gene locus_tag LOCUS_04480 gene ftsH 615 2330 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092281764.1 protein_id gnl|my_center|LOCUS_04480 2492 2836 gene locus_tag LOCUS_04490 2492 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2823 3317 gene locus_tag LOCUS_04500 2823 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4444 3359 gene locus_tag LOCUS_04510 4444 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4545 4727 gene locus_tag LOCUS_04520 4545 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5123 6406 gene locus_tag LOCUS_04530 gene nusA 5123 6406 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_04530 6474 6683 gene locus_tag LOCUS_04540 6474 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6683 7024 gene locus_tag LOCUS_04550 6683 7024 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_04550 7005 9803 gene locus_tag LOCUS_04560 gene infB 7005 9803 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_04560 9817 10173 gene locus_tag LOCUS_04570 9817 10173 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_04570 10173 11132 gene locus_tag LOCUS_04580 10173 11132 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_04580 11125 12018 gene locus_tag LOCUS_04590 gene truB 11125 12018 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_04590 12032 12946 gene locus_tag LOCUS_04600 12032 12946 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880033.1 protein_id gnl|my_center|LOCUS_04600 13062 13667 gene locus_tag LOCUS_04610 13062 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 13850 13674 gene locus_tag LOCUS_04620 13850 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 15412 14150 gene locus_tag LOCUS_04630 15412 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15393 15635 gene locus_tag LOCUS_04640 15393 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 15666 16025 gene locus_tag LOCUS_04650 15666 16025 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_04650 16025 16468 gene locus_tag LOCUS_04660 gene nusB 16025 16468 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 protein_id gnl|my_center|LOCUS_04660 16458 17570 gene locus_tag LOCUS_04670 gene xseA 16458 17570 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_04670 17567 17758 gene locus_tag LOCUS_04680 17567 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 17748 18560 gene locus_tag LOCUS_04690 17748 18560 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_04690 18570 19121 gene locus_tag LOCUS_04700 18570 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19118 19684 gene locus_tag LOCUS_04710 19118 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 19733 21604 gene locus_tag LOCUS_04720 gene dxs 19733 21604 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_04720 21597 22322 gene locus_tag LOCUS_04730 21597 22322 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_04730 22333 23124 gene locus_tag LOCUS_04740 22333 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 23256 24920 gene locus_tag LOCUS_04750 gene recN 23256 24920 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965373.1 protein_id gnl|my_center|LOCUS_04750 24932 26368 gene locus_tag LOCUS_04760 24932 26368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 26417 27718 gene locus_tag LOCUS_04770 26417 27718 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_04770 27742 28827 gene locus_tag LOCUS_04780 27742 28827 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_04780 28827 29045 gene locus_tag LOCUS_04790 28827 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 29055 29459 gene locus_tag LOCUS_04800 29055 29459 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_04800 29476 29889 gene locus_tag LOCUS_04810 29476 29889 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_04810 30026 30433 gene locus_tag LOCUS_04820 30026 30433 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_04820 30529 31674 gene locus_tag LOCUS_04830 30529 31674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 31705 32010 gene locus_tag LOCUS_04840 31705 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 33366 32176 gene locus_tag LOCUS_04850 33366 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 33525 34001 gene locus_tag LOCUS_04860 33525 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 34618 34034 gene locus_tag LOCUS_04870 34618 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 34965 35306 gene locus_tag LOCUS_04880 34965 35306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 37423 35348 gene locus_tag LOCUS_04890 37423 35348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 39508 37529 gene locus_tag LOCUS_04900 39508 37529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 42020 39519 gene locus_tag LOCUS_04910 42020 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 42781 42023 gene locus_tag LOCUS_04920 42781 42023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_04920 42912 43616 gene locus_tag LOCUS_04930 gene ycbL 42912 43616 CDS product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 protein_id gnl|my_center|LOCUS_04930 43613 44875 gene locus_tag LOCUS_04940 43613 44875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 45255 45800 gene locus_tag LOCUS_04950 gene spoVT 45255 45800 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_04950 47144 45930 gene locus_tag LOCUS_04960 47144 45930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 48075 47395 gene locus_tag LOCUS_04970 48075 47395 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_04970 48614 48084 gene locus_tag LOCUS_04980 48614 48084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 49196 48672 gene locus_tag LOCUS_04990 gene nudF 49196 48672 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_04990 50535 49198 gene locus_tag LOCUS_05000 gene asnS 50535 49198 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_05000 50659 51357 gene locus_tag LOCUS_05010 50659 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 51362 52249 gene locus_tag LOCUS_05020 51362 52249 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839124.1 protein_id gnl|my_center|LOCUS_05020 52325 53602 gene locus_tag LOCUS_05030 52325 53602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 53595 55355 gene locus_tag LOCUS_05040 53595 55355 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_05040 55336 55941 gene locus_tag LOCUS_05050 55336 55941 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_05050 55938 57098 gene locus_tag LOCUS_05060 55938 57098 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_05060 57110 57805 gene locus_tag LOCUS_05070 57110 57805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 58573 57797 gene locus_tag LOCUS_05080 58573 57797 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_05080 59885 58584 gene locus_tag LOCUS_05090 59885 58584 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_05090 60580 59882 gene locus_tag LOCUS_05100 60580 59882 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_05100 60670 61140 gene locus_tag LOCUS_05110 60670 61140 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_05110 61204 61674 gene locus_tag LOCUS_05120 61204 61674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 61689 64286 gene locus_tag LOCUS_05130 61689 64286 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460976.1 protein_id gnl|my_center|LOCUS_05130 64286 65848 gene locus_tag LOCUS_05140 gene murJ 64286 65848 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966328.1 protein_id gnl|my_center|LOCUS_05140 65841 68081 gene locus_tag LOCUS_05150 65841 68081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 68081 68812 gene locus_tag LOCUS_05160 68081 68812 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197426.1 protein_id gnl|my_center|LOCUS_05160 68812 69690 gene locus_tag LOCUS_05170 68812 69690 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812010.1 protein_id gnl|my_center|LOCUS_05170 69687 70538 gene locus_tag LOCUS_05180 gene pgoN 69687 70538 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence06 2517 370 gene locus_tag LOCUS_05190 2517 370 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_05190 2929 3435 gene locus_tag LOCUS_05200 2929 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3449 3775 gene locus_tag LOCUS_05210 3449 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3775 4242 gene locus_tag LOCUS_05220 3775 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4255 5256 gene locus_tag LOCUS_05230 4255 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5290 5805 gene locus_tag LOCUS_05240 5290 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5807 7495 gene locus_tag LOCUS_05250 5807 7495 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_05250 7583 8041 gene locus_tag LOCUS_05260 7583 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8060 9451 gene locus_tag LOCUS_05270 8060 9451 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_05270 9512 9967 gene locus_tag LOCUS_05280 9512 9967 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05280 9954 11150 gene locus_tag LOCUS_05290 gene nifS 9954 11150 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_05290 11150 11581 gene locus_tag LOCUS_05300 gene nifU 11150 11581 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_05300 11834 11628 gene locus_tag LOCUS_05310 11834 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12020 13681 gene locus_tag LOCUS_05320 12020 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 15572 13788 gene locus_tag LOCUS_05330 15572 13788 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_05330 15807 15541 gene locus_tag LOCUS_05340 15807 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16490 15984 gene locus_tag LOCUS_05350 16490 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17821 16640 gene locus_tag LOCUS_05360 17821 16640 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_05360 18015 17863 gene locus_tag LOCUS_05370 18015 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 18089 20020 gene locus_tag LOCUS_05380 gene ligA 18089 20020 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964508.1 protein_id gnl|my_center|LOCUS_05380 20495 20031 gene locus_tag LOCUS_05390 gene smpB 20495 20031 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_05390 20603 21580 gene locus_tag LOCUS_05400 20603 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 21577 22479 gene locus_tag LOCUS_05410 21577 22479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 22493 24589 gene locus_tag LOCUS_05420 gene topA 22493 24589 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_05420 24593 25450 gene locus_tag LOCUS_05430 24593 25450 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860910.1 protein_id gnl|my_center|LOCUS_05430 25580 26005 gene locus_tag LOCUS_05440 25580 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 26651 26136 gene locus_tag LOCUS_05450 26651 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 26754 28382 gene locus_tag LOCUS_05460 26754 28382 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_05460 28395 28844 gene locus_tag LOCUS_05470 28395 28844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 28949 31111 gene locus_tag LOCUS_05480 28949 31111 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_05480 31283 32227 gene locus_tag LOCUS_05490 31283 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 32228 32800 gene locus_tag LOCUS_05500 32228 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 32815 33213 gene locus_tag LOCUS_05510 32815 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 33250 33344 gene locus_tag LOCUS_t00050 33250 33344 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 33721 33404 gene locus_tag LOCUS_05520 33721 33404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 35012 33750 gene locus_tag LOCUS_05530 35012 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 35542 36450 gene locus_tag LOCUS_05540 gene selD 35542 36450 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_05540 36540 36848 gene locus_tag LOCUS_05550 36540 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 36851 38191 gene locus_tag LOCUS_05560 gene ffh 36851 38191 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05560 38226 38465 gene locus_tag LOCUS_05570 gene rpsP 38226 38465 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_05570 38468 38704 gene locus_tag LOCUS_05580 38468 38704 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_05580 38716 39225 gene locus_tag LOCUS_05590 gene rimM 38716 39225 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_05590 39222 39884 gene locus_tag LOCUS_05600 gene trmD 39222 39884 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_05600 39935 41224 gene locus_tag LOCUS_05610 gene mtaB 39935 41224 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_05610 41297 41563 gene locus_tag LOCUS_05620 41297 41563 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_05620 41563 41988 gene locus_tag LOCUS_05630 gene ruvX 41563 41988 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_05630 42046 42360 gene locus_tag LOCUS_05640 42046 42360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 42449 44125 gene locus_tag LOCUS_05650 42449 44125 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_05650 44138 45217 gene locus_tag LOCUS_05660 gene mltG 44138 45217 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_05660 45217 45888 gene locus_tag LOCUS_05670 45217 45888 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_05670 45872 47110 gene locus_tag LOCUS_05680 45872 47110 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_05680 47257 47415 gene locus_tag LOCUS_05690 47257 47415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 47415 47780 gene locus_tag LOCUS_05700 gene acpS 47415 47780 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048318.1 protein_id gnl|my_center|LOCUS_05700 47785 48972 gene locus_tag LOCUS_05710 47785 48972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 49165 49698 gene locus_tag LOCUS_05720 49165 49698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 49726 50016 gene locus_tag LOCUS_05730 49726 50016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 50066 51085 gene locus_tag LOCUS_05740 50066 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 51057 51422 gene locus_tag LOCUS_05750 gene rsfS 51057 51422 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_05750 51449 51715 gene locus_tag LOCUS_05760 51449 51715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 51882 53849 gene locus_tag LOCUS_05770 gene gyrB 51882 53849 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_05770 53869 54513 gene locus_tag LOCUS_05780 53869 54513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 54610 55689 gene locus_tag LOCUS_05790 54610 55689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 55842 56087 gene locus_tag LOCUS_05800 55842 56087 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_05800 56100 57131 gene locus_tag LOCUS_05810 56100 57131 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_05810 57106 57852 gene locus_tag LOCUS_05820 57106 57852 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_05820 57843 58415 gene locus_tag LOCUS_05830 57843 58415 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_05830 58423 59226 gene locus_tag LOCUS_05840 58423 59226 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_05840 60489 59350 gene locus_tag LOCUS_05850 60489 59350 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_05850 60572 61432 gene locus_tag LOCUS_05860 60572 61432 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_05860 61504 63858 gene locus_tag LOCUS_05870 61504 63858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 63870 64346 gene locus_tag LOCUS_05880 63870 64346 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_05880 64410 65600 gene locus_tag LOCUS_05890 64410 65600 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_05890 65616 65807 gene locus_tag LOCUS_05900 65616 65807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 65853 66344 gene locus_tag LOCUS_05910 65853 66344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 66347 66526 gene locus_tag LOCUS_05920 gene rpmF 66347 66526 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880688.1 protein_id gnl|my_center|LOCUS_05920 66532 67554 gene locus_tag LOCUS_05930 gene plsX 66532 67554 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_05930 67544 67774 gene locus_tag LOCUS_05940 gene acpP 67544 67774 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_05940 67774 68463 gene locus_tag LOCUS_05950 gene rnc 67774 68463 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05950 68664 69575 gene locus_tag LOCUS_05960 68664 69575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 69587 69904 gene locus_tag LOCUS_05970 69587 69904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 70590 69967 gene locus_tag LOCUS_05980 70590 69967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence07 151 1161 gene locus_tag LOCUS_05990 151 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1178 1438 gene locus_tag LOCUS_06000 1178 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1531 2019 gene locus_tag LOCUS_06010 1531 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2106 2954 gene locus_tag LOCUS_06020 2106 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3524 3042 gene locus_tag LOCUS_06030 3524 3042 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_06030 4316 3558 gene locus_tag LOCUS_06040 4316 3558 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_06040 4408 4794 gene locus_tag LOCUS_06050 4408 4794 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 protein_id gnl|my_center|LOCUS_06050 4781 5758 gene locus_tag LOCUS_06060 4781 5758 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 protein_id gnl|my_center|LOCUS_06060 5956 7302 gene locus_tag LOCUS_06070 5956 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8169 7465 gene locus_tag LOCUS_06080 gene nadE 8169 7465 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_06080 8384 8166 gene locus_tag LOCUS_06090 8384 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8716 8453 gene locus_tag LOCUS_06100 8716 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 9606 8728 gene locus_tag LOCUS_06110 gene hslO 9606 8728 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_06110 10043 9648 gene locus_tag LOCUS_06120 10043 9648 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_06120 11206 10040 gene locus_tag LOCUS_06130 gene rodA 11206 10040 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_06130 11463 11203 gene locus_tag LOCUS_06140 gene minE 11463 11203 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_06140 12270 11476 gene locus_tag LOCUS_06150 gene minD 12270 11476 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_06150 12924 12283 gene locus_tag LOCUS_06160 gene minC 12924 12283 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024932954.1 protein_id gnl|my_center|LOCUS_06160 14363 12969 gene locus_tag LOCUS_06170 14363 12969 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_06170 14905 14372 gene locus_tag LOCUS_06180 14905 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 17581 14972 gene locus_tag LOCUS_06190 gene alaS 17581 14972 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_06190 17729 19273 gene locus_tag LOCUS_06200 gene purH 17729 19273 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_06200 19285 19737 gene locus_tag LOCUS_06210 19285 19737 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129415.1 protein_id gnl|my_center|LOCUS_06210 19731 20654 gene locus_tag LOCUS_06220 19731 20654 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_06220 21564 20683 gene locus_tag LOCUS_06230 21564 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 21835 21587 gene locus_tag LOCUS_06240 21835 21587 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356889.1 protein_id gnl|my_center|LOCUS_06240 22559 21966 gene locus_tag LOCUS_06250 22559 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 23728 22661 gene locus_tag LOCUS_06260 23728 22661 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_06260 24821 23703 gene locus_tag LOCUS_06270 24821 23703 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947971.1 protein_id gnl|my_center|LOCUS_06270 26343 24823 gene locus_tag LOCUS_06280 26343 24823 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_06280 26450 27793 gene locus_tag LOCUS_06290 26450 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 27803 28525 gene locus_tag LOCUS_06300 27803 28525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_06300 28527 29813 gene locus_tag LOCUS_06310 28527 29813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_06310 29810 30463 gene locus_tag LOCUS_06320 29810 30463 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767703.1 protein_id gnl|my_center|LOCUS_06320 30484 31146 gene locus_tag LOCUS_06330 30484 31146 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_06330 31240 32070 gene locus_tag LOCUS_06340 31240 32070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 32083 32985 gene locus_tag LOCUS_06350 32083 32985 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_06350 32995 33612 gene locus_tag LOCUS_06360 32995 33612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33802 33719 gene locus_tag LOCUS_t00060 33802 33719 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33927 35276 gene locus_tag LOCUS_06370 33927 35276 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542382.1 protein_id gnl|my_center|LOCUS_06370 37690 35345 gene locus_tag LOCUS_06380 gene spoIIE 37690 35345 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_06380 37733 37930 gene locus_tag LOCUS_06390 37733 37930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 38575 39051 gene locus_tag LOCUS_06400 gene nuoE 38575 39051 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_06400 39042 40775 gene locus_tag LOCUS_06410 gene nuoF 39042 40775 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_06410 40793 41830 gene locus_tag LOCUS_06420 40793 41830 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_06420 41842 43872 gene locus_tag LOCUS_06430 41842 43872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 43897 44370 gene locus_tag LOCUS_06440 43897 44370 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061617.1 protein_id gnl|my_center|LOCUS_06440 44396 44995 gene locus_tag LOCUS_06450 44396 44995 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262589.1 protein_id gnl|my_center|LOCUS_06450 45024 45272 gene locus_tag LOCUS_06460 45024 45272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 45376 45600 gene locus_tag LOCUS_06470 45376 45600 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_06470 45578 45985 gene locus_tag LOCUS_06480 45578 45985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 46338 46021 gene locus_tag LOCUS_06490 gene trxA 46338 46021 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958643.1 protein_id gnl|my_center|LOCUS_06490 46493 47587 gene locus_tag LOCUS_06500 46493 47587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 47809 48504 gene locus_tag LOCUS_06510 gene ftsE 47809 48504 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_06510 48485 49438 gene locus_tag LOCUS_06520 gene ftsX 48485 49438 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_06520 49486 50700 gene locus_tag LOCUS_06530 49486 50700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 51004 52224 gene locus_tag LOCUS_06540 51004 52224 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941636.1 protein_id gnl|my_center|LOCUS_06540 52946 52269 gene locus_tag LOCUS_06550 gene phoU 52946 52269 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_06550 53710 52958 gene locus_tag LOCUS_06560 gene pstB 53710 52958 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_06560 55576 53717 gene locus_tag LOCUS_06570 55576 53717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 56471 55593 gene locus_tag LOCUS_06580 56471 55593 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_06580 56835 57086 gene locus_tag LOCUS_06590 56835 57086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 57173 57766 gene locus_tag LOCUS_06600 57173 57766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 58023 57805 gene locus_tag LOCUS_06610 58023 57805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 59681 58116 gene locus_tag LOCUS_06620 gene spoVB 59681 58116 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence08 212 808 gene locus_tag LOCUS_06630 gene ruvA 212 808 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_06630 819 1820 gene locus_tag LOCUS_06640 gene ruvB 819 1820 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_06640 1957 2880 gene locus_tag LOCUS_06650 1957 2880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_06650 2880 3668 gene locus_tag LOCUS_06660 2880 3668 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731882.1 protein_id gnl|my_center|LOCUS_06660 3681 3884 gene locus_tag LOCUS_06670 3681 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3904 4149 gene locus_tag LOCUS_06680 3904 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4166 4465 gene locus_tag LOCUS_06690 4166 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4906 4700 gene locus_tag LOCUS_06700 4906 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5238 5420 gene locus_tag LOCUS_06710 5238 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5475 6248 gene locus_tag LOCUS_06720 5475 6248 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_06720 6245 6682 gene locus_tag LOCUS_06730 6245 6682 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965564.1 protein_id gnl|my_center|LOCUS_06730 6682 6915 gene locus_tag LOCUS_06740 6682 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 6930 7160 gene locus_tag LOCUS_06750 6930 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7164 8384 gene locus_tag LOCUS_06760 7164 8384 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_06760 9976 8651 gene locus_tag LOCUS_06770 9976 8651 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_06770 10646 10002 gene locus_tag LOCUS_06780 gene upp 10646 10002 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081012.1 protein_id gnl|my_center|LOCUS_06780 11660 10815 gene locus_tag LOCUS_06790 11660 10815 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288161.1 protein_id gnl|my_center|LOCUS_06790 11869 12417 gene locus_tag LOCUS_06800 11869 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13459 12392 gene locus_tag LOCUS_06810 13459 12392 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_06810 13560 15146 gene locus_tag LOCUS_06820 13560 15146 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_06820 15173 16252 gene locus_tag LOCUS_06830 15173 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 17602 16289 gene locus_tag LOCUS_06840 17602 16289 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_06840 17786 18088 gene locus_tag LOCUS_06850 17786 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 19056 18538 gene locus_tag LOCUS_06860 19056 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 20345 19053 gene locus_tag LOCUS_06870 20345 19053 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_06870 21806 20355 gene locus_tag LOCUS_06880 21806 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 23782 21800 gene locus_tag LOCUS_06890 23782 21800 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_06890 24141 23887 gene locus_tag LOCUS_06900 24141 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 24727 24233 gene locus_tag LOCUS_06910 24727 24233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 25433 25044 gene locus_tag LOCUS_06920 25433 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 26211 25426 gene locus_tag LOCUS_06930 26211 25426 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06930 26310 27359 gene locus_tag LOCUS_06940 26310 27359 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_06940 27346 28179 gene locus_tag LOCUS_06950 27346 28179 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_06950 28204 28878 gene locus_tag LOCUS_06960 28204 28878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 28902 30527 gene locus_tag LOCUS_06970 28902 30527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 30580 31398 gene locus_tag LOCUS_06980 30580 31398 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861906.1 protein_id gnl|my_center|LOCUS_06980 32465 31407 gene locus_tag LOCUS_06990 32465 31407 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_06990 32722 32477 gene locus_tag LOCUS_07000 32722 32477 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250307.1 protein_id gnl|my_center|LOCUS_07000 33343 32726 gene locus_tag LOCUS_07010 33343 32726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 33848 33357 gene locus_tag LOCUS_07020 33848 33357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 34756 33848 gene locus_tag LOCUS_07030 gene murB 34756 33848 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_07030 35637 34756 gene locus_tag LOCUS_07040 gene glcK 35637 34756 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_07040 36592 35639 gene locus_tag LOCUS_07050 gene hprK 36592 35639 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964404.1 protein_id gnl|my_center|LOCUS_07050 36848 36585 gene locus_tag LOCUS_07060 36848 36585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 36996 37451 gene locus_tag LOCUS_07070 36996 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 39816 37429 gene locus_tag LOCUS_07080 39816 37429 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_07080 39876 40520 gene locus_tag LOCUS_07090 39876 40520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 41394 40531 gene locus_tag LOCUS_07100 41394 40531 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_07100 42562 41402 gene locus_tag LOCUS_07110 gene ftsW 42562 41402 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_07110 43921 42575 gene locus_tag LOCUS_07120 gene murD 43921 42575 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_07120 44925 43918 gene locus_tag LOCUS_07130 gene mraY 44925 43918 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_07130 46292 44925 gene locus_tag LOCUS_07140 gene murF 46292 44925 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_07140 47746 46307 gene locus_tag LOCUS_07150 47746 46307 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966104.1 protein_id gnl|my_center|LOCUS_07150 49782 47809 gene locus_tag LOCUS_07160 49782 47809 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_07160 50089 49880 gene locus_tag LOCUS_07170 50089 49880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 50346 50122 gene locus_tag LOCUS_07180 50346 50122 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_07180 50563 50336 gene locus_tag LOCUS_07190 50563 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 51545 50541 gene locus_tag LOCUS_07200 51545 50541 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_07200 52110 51559 gene locus_tag LOCUS_07210 gene frr 52110 51559 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_07210 52844 52125 gene locus_tag LOCUS_07220 gene pyrH 52844 52125 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 protein_id gnl|my_center|LOCUS_07220 53059 52910 gene locus_tag LOCUS_07230 53059 52910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 53184 53837 gene locus_tag LOCUS_07240 53184 53837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 54493 53939 gene locus_tag LOCUS_07250 gene hpt 54493 53939 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019306.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence09 22 585 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagccgtgtcgtttagaatgccaccaaaac 883 686 gene locus_tag LOCUS_07260 883 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1064 1423 gene locus_tag LOCUS_07270 1064 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1656 2297 gene locus_tag LOCUS_07280 1656 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2245 2460 gene locus_tag LOCUS_07290 2245 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2985 2910 gene locus_tag LOCUS_t00070 2985 2910 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3431 3021 gene locus_tag LOCUS_07300 3431 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3501 4778 gene locus_tag LOCUS_07310 3501 4778 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_07310 4783 5628 gene locus_tag LOCUS_07320 4783 5628 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_07320 5701 5904 gene locus_tag LOCUS_07330 5701 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5987 6691 gene locus_tag LOCUS_07340 5987 6691 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_07340 6675 8030 gene locus_tag LOCUS_07350 gene rimO 6675 8030 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_07350 8014 8559 gene locus_tag LOCUS_07360 gene pgsA 8014 8559 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_07360 8556 9041 gene locus_tag LOCUS_07370 8556 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9034 10257 gene locus_tag LOCUS_07380 gene recA 9034 10257 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_07380 10260 10907 gene locus_tag LOCUS_07390 10260 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10879 11709 gene locus_tag LOCUS_07400 10879 11709 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_07400 11798 12280 gene locus_tag LOCUS_07410 11798 12280 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_07410 13044 12385 gene locus_tag LOCUS_07420 13044 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13207 14733 gene locus_tag LOCUS_07430 gene malQ 13207 14733 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_07430 15079 14789 gene locus_tag LOCUS_07440 15079 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 16117 15353 gene locus_tag LOCUS_07450 16117 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 17225 16203 gene locus_tag LOCUS_07460 gene floA 17225 16203 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_07460 17396 17229 gene locus_tag LOCUS_07470 17396 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 17879 17409 gene locus_tag LOCUS_07480 17879 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 18358 17960 gene locus_tag LOCUS_07490 18358 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 19360 18371 gene locus_tag LOCUS_07500 gene trpS 19360 18371 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_07500 20938 19409 gene locus_tag LOCUS_07510 20938 19409 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_07510 21488 20871 gene locus_tag LOCUS_07520 gene coaE 21488 20871 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_07520 24593 21993 gene locus_tag LOCUS_07530 gene polA 24593 21993 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_07530 24781 25647 gene locus_tag LOCUS_07540 gene ptb 24781 25647 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 protein_id gnl|my_center|LOCUS_07540 25658 26725 gene locus_tag LOCUS_07550 gene buk 25658 26725 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_07550 26748 27332 gene locus_tag LOCUS_07560 26748 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 27597 28688 gene locus_tag LOCUS_07570 27597 28688 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_07570 28688 29359 gene locus_tag LOCUS_07580 28688 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_07580 29383 29592 gene locus_tag LOCUS_07590 29383 29592 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_07590 29589 30632 gene locus_tag LOCUS_07600 29589 30632 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_07600 30613 31371 gene locus_tag LOCUS_07610 30613 31371 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_07610 31371 31904 gene locus_tag LOCUS_07620 31371 31904 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_07620 32016 32393 gene locus_tag LOCUS_07630 32016 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 32448 33380 gene locus_tag LOCUS_07640 32448 33380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 33377 34018 gene locus_tag LOCUS_07650 gene nth 33377 34018 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_07650 34011 34136 gene locus_tag LOCUS_07660 34011 34136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 34152 35063 gene locus_tag LOCUS_07670 gene lgt 34152 35063 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_07670 35274 36146 gene locus_tag LOCUS_07680 35274 36146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 36161 36511 gene locus_tag LOCUS_07690 36161 36511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 36575 36724 gene locus_tag LOCUS_07700 36575 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 37055 37597 gene locus_tag LOCUS_07710 37055 37597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 37667 39100 gene locus_tag LOCUS_07720 37667 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 39117 40961 gene locus_tag LOCUS_07730 39117 40961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 41152 41646 gene locus_tag LOCUS_07740 41152 41646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151333.1 protein_id gnl|my_center|LOCUS_07740 41763 43199 gene locus_tag LOCUS_07750 gene proS 41763 43199 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_07750 43220 44263 gene locus_tag LOCUS_07760 gene hgcA 43220 44263 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_07760 44267 44551 gene locus_tag LOCUS_07770 gene hgcB 44267 44551 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_07770 44573 44890 gene locus_tag LOCUS_07780 44573 44890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 44869 45165 gene locus_tag LOCUS_07790 44869 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07790 45162 45677 gene locus_tag LOCUS_07800 45162 45677 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_07800 45796 45725 gene locus_tag LOCUS_t00080 45796 45725 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46794 45877 gene locus_tag LOCUS_07810 gene pyrB 46794 45877 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_07810 48000 46870 gene locus_tag LOCUS_07820 48000 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 48122 48592 gene locus_tag LOCUS_07830 gene rnhA 48122 48592 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_07830 48589 49029 gene locus_tag LOCUS_07840 gene rlmH 48589 49029 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_07840 49393 49031 gene locus_tag LOCUS_07850 49393 49031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 49490 49825 gene locus_tag LOCUS_07860 49490 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 51139 49844 gene locus_tag LOCUS_07870 51139 49844 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 protein_id gnl|my_center|LOCUS_07870 51264 52178 gene locus_tag LOCUS_07880 gene arcC 51264 52178 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_07880 53259 52186 gene locus_tag LOCUS_07890 gene mnmA 53259 52186 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence10 1055 378 gene locus_tag LOCUS_07900 1055 378 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_07900 1165 1755 gene locus_tag LOCUS_07910 1165 1755 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_07910 1769 3265 gene locus_tag LOCUS_07920 1769 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3267 3560 gene locus_tag LOCUS_07930 3267 3560 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_07930 3547 3909 gene locus_tag LOCUS_07940 3547 3909 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_07940 3911 4693 gene locus_tag LOCUS_07950 gene pgeF 3911 4693 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_07950 4706 6031 gene locus_tag LOCUS_07960 4706 6031 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_07960 6019 7341 gene locus_tag LOCUS_07970 gene der 6019 7341 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_07970 7341 8000 gene locus_tag LOCUS_07980 gene plsY 7341 8000 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258978.1 protein_id gnl|my_center|LOCUS_07980 8065 8340 gene locus_tag LOCUS_07990 8065 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8345 8611 gene locus_tag LOCUS_08000 8345 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9045 10172 gene locus_tag LOCUS_08010 9045 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10346 11047 gene locus_tag LOCUS_08020 10346 11047 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_08020 11138 11593 gene locus_tag LOCUS_08030 11138 11593 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_08030 11623 11874 gene locus_tag LOCUS_08040 11623 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 11956 12324 gene locus_tag LOCUS_08050 11956 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 13354 12380 gene locus_tag LOCUS_08060 13354 12380 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_08060 14132 13347 gene locus_tag LOCUS_08070 14132 13347 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_08070 15275 14133 gene locus_tag LOCUS_08080 15275 14133 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_08080 15701 15285 gene locus_tag LOCUS_08090 15701 15285 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_08090 16417 15698 gene locus_tag LOCUS_08100 gene fabG 16417 15698 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_08100 17216 16464 gene locus_tag LOCUS_08110 17216 16464 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_08110 18771 17209 gene locus_tag LOCUS_08120 18771 17209 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_08120 20049 18814 gene locus_tag LOCUS_08130 gene ablA 20049 18814 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_08130 20503 20123 gene locus_tag LOCUS_08140 20503 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21599 20568 gene locus_tag LOCUS_08150 gene kdd 21599 20568 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_08150 22424 21603 gene locus_tag LOCUS_08160 22424 21603 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_08160 22800 22429 gene locus_tag LOCUS_08170 22800 22429 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_08170 23657 22797 gene locus_tag LOCUS_08180 23657 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 24310 23654 gene locus_tag LOCUS_08190 24310 23654 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_08190 24962 24303 gene locus_tag LOCUS_08200 24962 24303 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_08200 26154 24979 gene locus_tag LOCUS_08210 26154 24979 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861636.1 protein_id gnl|my_center|LOCUS_08210 26261 27145 gene locus_tag LOCUS_08220 26261 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_08220 27170 28114 gene locus_tag LOCUS_08230 27170 28114 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_08230 28101 29183 gene locus_tag LOCUS_08240 28101 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_08240 29180 30130 gene locus_tag LOCUS_08250 29180 30130 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_08250 30284 30409 gene locus_tag LOCUS_08260 30284 30409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 30524 31846 gene locus_tag LOCUS_08270 30524 31846 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_08270 31846 32682 gene locus_tag LOCUS_08280 31846 32682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 32790 34274 gene locus_tag LOCUS_08290 gene spoIVA 32790 34274 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_08290 35044 34337 gene locus_tag LOCUS_08300 35044 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 35254 36816 gene locus_tag LOCUS_08310 35254 36816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 36817 37209 gene locus_tag LOCUS_08320 gene tagD 36817 37209 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_08320 37248 38018 gene locus_tag LOCUS_08330 gene rfbF 37248 38018 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_08330 38023 39135 gene locus_tag LOCUS_08340 38023 39135 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_08340 39157 40314 gene locus_tag LOCUS_08350 39157 40314 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_08350 40325 41572 gene locus_tag LOCUS_08360 40325 41572 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763236.1 protein_id gnl|my_center|LOCUS_08360 41562 42638 gene locus_tag LOCUS_08370 41562 42638 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_08370 42626 43516 gene locus_tag LOCUS_08380 42626 43516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 43506 44744 gene locus_tag LOCUS_08390 43506 44744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 44757 45617 gene locus_tag LOCUS_08400 44757 45617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 45619 46617 gene locus_tag LOCUS_08410 45619 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 46619 47764 gene locus_tag LOCUS_08420 46619 47764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 47943 49283 gene locus_tag LOCUS_08430 47943 49283 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 protein_id gnl|my_center|LOCUS_08430 49288 49440 gene locus_tag LOCUS_08440 49288 49440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 49478 49630 gene locus_tag LOCUS_08450 49478 49630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 49908 50183 gene locus_tag LOCUS_08460 49908 50183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 51011 50178 gene locus_tag LOCUS_08470 51011 50178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 51213 52448 gene locus_tag LOCUS_08480 51213 52448 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_08480 52878 53255 gene locus_tag LOCUS_08490 52878 53255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence11 803 117 gene locus_tag LOCUS_08500 803 117 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964357.1 protein_id gnl|my_center|LOCUS_08500 996 2075 gene locus_tag LOCUS_08510 996 2075 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_08510 2077 3015 gene locus_tag LOCUS_08520 gene trxB 2077 3015 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_08520 3067 4386 gene locus_tag LOCUS_08530 gene selA 3067 4386 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_08530 4383 6311 gene locus_tag LOCUS_08540 gene selB 4383 6311 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_08540 6374 7345 gene locus_tag LOCUS_08550 gene dusB 6374 7345 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08550 7317 7823 gene locus_tag LOCUS_08560 7317 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7829 8590 gene locus_tag LOCUS_08570 7829 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8663 9136 gene locus_tag LOCUS_08580 gene greA 8663 9136 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_08580 9166 10638 gene locus_tag LOCUS_08590 gene lysS 9166 10638 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_08590 10677 11297 gene locus_tag LOCUS_08600 10677 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11321 12262 gene locus_tag LOCUS_08610 11321 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12271 13110 gene locus_tag LOCUS_08620 gene cdaA 12271 13110 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_08620 13110 14477 gene locus_tag LOCUS_08630 13110 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 14482 15822 gene locus_tag LOCUS_08640 gene glmM 14482 15822 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860638.1 protein_id gnl|my_center|LOCUS_08640 15819 16517 gene locus_tag LOCUS_08650 15819 16517 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_08650 17858 16683 gene locus_tag LOCUS_08660 17858 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18271 17861 gene locus_tag LOCUS_08670 18271 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 18699 18223 gene locus_tag LOCUS_08680 18699 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 19835 18711 gene locus_tag LOCUS_08690 gene nspC 19835 18711 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_08690 21110 19899 gene locus_tag LOCUS_08700 21110 19899 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_08700 21945 21103 gene locus_tag LOCUS_08710 gene speB 21945 21103 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_08710 22342 21935 gene locus_tag LOCUS_08720 22342 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 23221 22373 gene locus_tag LOCUS_08730 gene speE 23221 22373 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_08730 24693 23239 gene locus_tag LOCUS_08740 24693 23239 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_08740 25459 24686 gene locus_tag LOCUS_08750 gene speD 25459 24686 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_08750 26027 25695 gene locus_tag LOCUS_08760 26027 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 26981 26040 gene locus_tag LOCUS_08770 26981 26040 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_08770 28882 26969 gene locus_tag LOCUS_08780 28882 26969 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_08780 30245 28986 gene locus_tag LOCUS_08790 gene murA 30245 28986 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_08790 30791 30369 gene locus_tag LOCUS_08800 30791 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 31482 30910 gene locus_tag LOCUS_08810 31482 30910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_08810 32005 31460 gene locus_tag LOCUS_08820 32005 31460 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_08820 32479 32087 gene locus_tag LOCUS_08830 32479 32087 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_08830 33591 32479 gene locus_tag LOCUS_08840 33591 32479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_08840 33718 34890 gene locus_tag LOCUS_08850 33718 34890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 36234 34930 gene locus_tag LOCUS_08860 gene eno 36234 34930 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_08860 36529 36236 gene locus_tag LOCUS_08870 36529 36236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 37283 36534 gene locus_tag LOCUS_08880 gene tpiA 37283 36534 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_08880 38527 37334 gene locus_tag LOCUS_08890 38527 37334 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_08890 38637 39443 gene locus_tag LOCUS_08900 38637 39443 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_08900 39988 39512 gene locus_tag LOCUS_08910 39988 39512 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861302.1 protein_id gnl|my_center|LOCUS_08910 40377 39988 gene locus_tag LOCUS_08920 40377 39988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 40849 40397 gene locus_tag LOCUS_08930 40849 40397 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_08930 41333 47230 gene locus_tag LOCUS_08940 41333 47230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 47340 47753 gene locus_tag LOCUS_08950 47340 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence12 474 121 gene locus_tag LOCUS_08960 474 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 913 488 gene locus_tag LOCUS_08970 913 488 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477329.1 protein_id gnl|my_center|LOCUS_08970 1053 1427 gene locus_tag LOCUS_08980 1053 1427 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_08980 1424 3826 gene locus_tag LOCUS_08990 1424 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4632 3874 gene locus_tag LOCUS_09000 4632 3874 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_09000 4730 5764 gene locus_tag LOCUS_09010 gene pheS 4730 5764 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09010 5778 8168 gene locus_tag LOCUS_09020 gene pheT 5778 8168 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_09020 8299 8958 gene locus_tag LOCUS_09030 8299 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10528 8879 gene locus_tag LOCUS_09040 10528 8879 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_09040 11503 10541 gene locus_tag LOCUS_09050 11503 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 12073 11540 gene locus_tag LOCUS_09060 12073 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12228 12431 gene locus_tag LOCUS_09070 12228 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 12458 12634 gene locus_tag LOCUS_09080 12458 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12642 12938 gene locus_tag LOCUS_09090 12642 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 12946 13155 gene locus_tag LOCUS_09100 12946 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13133 13339 gene locus_tag LOCUS_09110 13133 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 13354 13602 gene locus_tag LOCUS_09120 13354 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13602 13820 gene locus_tag LOCUS_09130 13602 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 13817 14431 gene locus_tag LOCUS_09140 13817 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14409 14621 gene locus_tag LOCUS_09150 14409 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14618 14773 gene locus_tag LOCUS_09160 14618 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 14763 14933 gene locus_tag LOCUS_09170 14763 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 15173 15439 gene locus_tag LOCUS_09180 15173 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 15426 16319 gene locus_tag LOCUS_09190 15426 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 16328 16480 gene locus_tag LOCUS_09200 16328 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 16473 16730 gene locus_tag LOCUS_09210 16473 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 16721 17539 gene locus_tag LOCUS_09220 16721 17539 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_09220 17529 17711 gene locus_tag LOCUS_09230 17529 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 17716 18756 gene locus_tag LOCUS_09240 17716 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 18757 19263 gene locus_tag LOCUS_09250 18757 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 19469 19738 gene locus_tag LOCUS_09260 19469 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 19723 19875 gene locus_tag LOCUS_09270 19723 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19905 20210 gene locus_tag LOCUS_09280 19905 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 20232 20582 gene locus_tag LOCUS_09290 20232 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 20587 21234 gene locus_tag LOCUS_09300 20587 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 21470 21769 gene locus_tag LOCUS_09310 21470 21769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21941 22294 gene locus_tag LOCUS_09320 21941 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22294 23949 gene locus_tag LOCUS_09330 22294 23949 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_09330 23954 25222 gene locus_tag LOCUS_09340 23954 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 25140 25751 gene locus_tag LOCUS_09350 25140 25751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25748 26998 gene locus_tag LOCUS_09360 25748 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 27020 27343 gene locus_tag LOCUS_09370 27020 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 27330 27662 gene locus_tag LOCUS_09380 27330 27662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27659 28108 gene locus_tag LOCUS_09390 27659 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 28101 28454 gene locus_tag LOCUS_09400 28101 28454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 28459 29040 gene locus_tag LOCUS_09410 28459 29040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29077 29511 gene locus_tag LOCUS_09420 29077 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 29697 32771 gene locus_tag LOCUS_09430 29697 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 32768 33664 gene locus_tag LOCUS_09440 32768 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 33666 34787 gene locus_tag LOCUS_09450 33666 34787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 34804 35811 gene locus_tag LOCUS_09460 34804 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 35813 36724 gene locus_tag LOCUS_09470 35813 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 36737 36994 gene locus_tag LOCUS_09480 36737 36994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 36995 37384 gene locus_tag LOCUS_09490 36995 37384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 37374 38096 gene locus_tag LOCUS_09500 37374 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 38111 38404 gene locus_tag LOCUS_09510 38111 38404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 38420 38875 gene locus_tag LOCUS_09520 38420 38875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 38875 39591 gene locus_tag LOCUS_09530 38875 39591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 39787 39714 gene locus_tag LOCUS_t00090 39787 39714 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40294 39902 gene locus_tag LOCUS_09540 40294 39902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 41010 40315 gene locus_tag LOCUS_09550 41010 40315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 41168 41905 gene locus_tag LOCUS_09560 41168 41905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 41902 42033 gene locus_tag LOCUS_09570 41902 42033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 42051 43193 gene locus_tag LOCUS_09580 42051 43193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 44331 43234 gene locus_tag LOCUS_09590 gene ftsZ 44331 43234 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_09590 45096 44377 gene locus_tag LOCUS_09600 45096 44377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 45522 45181 gene locus_tag LOCUS_09610 45522 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 45706 46512 gene locus_tag LOCUS_09620 gene sigG 45706 46512 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence13 1245 154 gene locus_tag LOCUS_09630 1245 154 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_09630 1429 1563 gene locus_tag LOCUS_09640 gene rpmH 1429 1563 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701411.1 protein_id gnl|my_center|LOCUS_09640 1588 1926 gene locus_tag LOCUS_09650 gene rnpA 1588 1926 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_09650 2200 3300 gene locus_tag LOCUS_09660 2200 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3313 3930 gene locus_tag LOCUS_09670 3313 3930 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 protein_id gnl|my_center|LOCUS_09670 4089 4679 gene locus_tag LOCUS_09680 4089 4679 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358883.1 protein_id gnl|my_center|LOCUS_09680 4691 4903 gene locus_tag LOCUS_09690 4691 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5054 5398 gene locus_tag LOCUS_09700 gene spoIIAA 5054 5398 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_09700 5411 5836 gene locus_tag LOCUS_09710 gene spoIIAB 5411 5836 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_09710 5859 6605 gene locus_tag LOCUS_09720 gene sigF 5859 6605 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_09720 6865 7188 gene locus_tag LOCUS_09730 6865 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7322 8608 gene locus_tag LOCUS_09740 7322 8608 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_09740 8616 9407 gene locus_tag LOCUS_09750 8616 9407 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_09750 9712 9404 gene locus_tag LOCUS_09760 9712 9404 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_09760 9855 10079 gene locus_tag LOCUS_09770 9855 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11441 10125 gene locus_tag LOCUS_09780 gene murA 11441 10125 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_09780 11508 12866 gene locus_tag LOCUS_09790 gene mnmE 11508 12866 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_09790 12983 14866 gene locus_tag LOCUS_09800 gene mnmG 12983 14866 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_09800 14863 15513 gene locus_tag LOCUS_09810 gene rsmG 14863 15513 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_09810 16128 18386 gene locus_tag LOCUS_09820 16128 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18645 22601 gene locus_tag LOCUS_09830 18645 22601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 22707 24731 gene locus_tag LOCUS_09840 22707 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 24854 26731 gene locus_tag LOCUS_09850 24854 26731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_09850 26746 28029 gene locus_tag LOCUS_09860 26746 28029 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 protein_id gnl|my_center|LOCUS_09860 27998 28648 gene locus_tag LOCUS_09870 27998 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 28722 29234 gene locus_tag LOCUS_09880 28722 29234 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_09880 29239 30762 gene locus_tag LOCUS_09890 29239 30762 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_09890 30773 31684 gene locus_tag LOCUS_09900 30773 31684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 31681 32130 gene locus_tag LOCUS_09910 31681 32130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775651.1 protein_id gnl|my_center|LOCUS_09910 32148 33053 gene locus_tag LOCUS_09920 32148 33053 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132289.1 protein_id gnl|my_center|LOCUS_09920 33486 33848 gene locus_tag LOCUS_09930 33486 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 34338 33985 gene locus_tag LOCUS_09940 gene spoVAE 34338 33985 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_09940 35440 34427 gene locus_tag LOCUS_09950 gene spoVAD 35440 34427 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_09950 35893 35456 gene locus_tag LOCUS_09960 gene spoVAC 35893 35456 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_09960 36325 35894 gene locus_tag LOCUS_09970 36325 35894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 36954 36325 gene locus_tag LOCUS_09980 gene spoVAA 36954 36325 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_09980 38385 37510 gene locus_tag LOCUS_09990 38385 37510 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_09990 41244 38527 gene locus_tag LOCUS_10000 41244 38527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 41675 41448 gene locus_tag LOCUS_10010 41675 41448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 41992 41741 gene locus_tag LOCUS_10020 41992 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 42270 41989 gene locus_tag LOCUS_10030 42270 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 42360 43223 gene locus_tag LOCUS_10040 42360 43223 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_10040 43210 44106 gene locus_tag LOCUS_10050 43210 44106 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_10050 44224 44769 gene locus_tag LOCUS_10060 44224 44769 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence14 589 128 gene locus_tag LOCUS_10070 589 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 833 636 gene locus_tag LOCUS_10080 833 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1690 1049 gene locus_tag LOCUS_10090 1690 1049 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_10090 1917 3770 gene locus_tag LOCUS_10100 1917 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3790 4470 gene locus_tag LOCUS_10110 3790 4470 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898609.1 protein_id gnl|my_center|LOCUS_10110 4562 5089 gene locus_tag LOCUS_10120 4562 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5086 5391 gene locus_tag LOCUS_10130 5086 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7276 5534 gene locus_tag LOCUS_10140 7276 5534 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_10140 7618 9471 gene locus_tag LOCUS_10150 gene lepA 7618 9471 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_10150 9483 10073 gene locus_tag LOCUS_10160 9483 10073 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814895.1 protein_id gnl|my_center|LOCUS_10160 10083 11195 gene locus_tag LOCUS_10170 gene hemW 10083 11195 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013191.1 protein_id gnl|my_center|LOCUS_10170 11206 11859 gene locus_tag LOCUS_10180 11206 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11864 12568 gene locus_tag LOCUS_10190 gene walR 11864 12568 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 protein_id gnl|my_center|LOCUS_10190 14051 12630 gene locus_tag LOCUS_10200 14051 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 14600 14073 gene locus_tag LOCUS_10210 14600 14073 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837391.1 protein_id gnl|my_center|LOCUS_10210 15091 14621 gene locus_tag LOCUS_10220 15091 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17456 15270 gene locus_tag LOCUS_10230 gene oraE 17456 15270 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_10230 18240 17476 gene locus_tag LOCUS_10240 18240 17476 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_10240 18621 18259 gene locus_tag LOCUS_10250 18621 18259 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_10250 18999 18658 gene locus_tag LOCUS_10260 18999 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20488 19070 gene locus_tag LOCUS_10270 gene ortB 20488 19070 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_10270 20759 20478 gene locus_tag LOCUS_10280 20759 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 21100 20765 gene locus_tag LOCUS_10290 21100 20765 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073492.1 protein_id gnl|my_center|LOCUS_10290 21732 21118 gene locus_tag LOCUS_10300 21732 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 22780 21722 gene locus_tag LOCUS_10310 gene ord 22780 21722 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_10310 24068 23076 gene locus_tag LOCUS_10320 gene argF 24068 23076 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_10320 24620 24099 gene locus_tag LOCUS_10330 24620 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 25900 24668 gene locus_tag LOCUS_10340 gene arcA 25900 24668 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_10340 26279 26103 gene locus_tag LOCUS_10350 26279 26103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 27675 26299 gene locus_tag LOCUS_10360 27675 26299 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_10360 27785 28042 gene locus_tag LOCUS_10370 27785 28042 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811353.1 protein_id gnl|my_center|LOCUS_10370 28202 28771 gene locus_tag LOCUS_10380 28202 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 28758 29576 gene locus_tag LOCUS_10390 28758 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 29694 31091 gene locus_tag LOCUS_10400 gene gltX 29694 31091 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_10400 31336 32268 gene locus_tag LOCUS_10410 31336 32268 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_10410 32281 33447 gene locus_tag LOCUS_10420 32281 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 33434 36295 gene locus_tag LOCUS_10430 33434 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 36349 38121 gene locus_tag LOCUS_10440 36349 38121 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_10440 38151 38600 gene locus_tag LOCUS_10450 gene glmS 38151 38600 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_10450 38644 40047 gene locus_tag LOCUS_10460 gene glmL 38644 40047 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_10460 40047 40169 gene locus_tag LOCUS_10470 40047 40169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 40186 40707 gene locus_tag LOCUS_10480 40186 40707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_10480 40721 41173 gene locus_tag LOCUS_10490 40721 41173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence15 2035 122 gene locus_tag LOCUS_10500 gene rnr 2035 122 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_10500 2410 2150 gene locus_tag LOCUS_10510 2410 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2794 2426 gene locus_tag LOCUS_10520 2794 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4480 2795 gene locus_tag LOCUS_10530 4480 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5915 4587 gene locus_tag LOCUS_10540 5915 4587 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_10540 6357 5932 gene locus_tag LOCUS_10550 gene fabZ 6357 5932 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_10550 6865 6359 gene locus_tag LOCUS_10560 gene accB 6865 6359 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 protein_id gnl|my_center|LOCUS_10560 8107 6869 gene locus_tag LOCUS_10570 gene fabF 8107 6869 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287619.1 protein_id gnl|my_center|LOCUS_10570 8848 8129 gene locus_tag LOCUS_10580 gene fabG 8848 8129 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_10580 9744 8851 gene locus_tag LOCUS_10590 gene fabD 9744 8851 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_10590 10688 9744 gene locus_tag LOCUS_10600 gene fabK 10688 9744 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373895.1 protein_id gnl|my_center|LOCUS_10600 11668 10703 gene locus_tag LOCUS_10610 11668 10703 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_10610 15219 11905 gene locus_tag LOCUS_10620 gene mfd 15219 11905 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_10620 15829 15170 gene locus_tag LOCUS_10630 gene pth 15829 15170 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_10630 16616 15834 gene locus_tag LOCUS_10640 16616 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17104 16637 gene locus_tag LOCUS_10650 17104 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 17805 17110 gene locus_tag LOCUS_10660 17805 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19880 17823 gene locus_tag LOCUS_10670 19880 17823 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047676.1 protein_id gnl|my_center|LOCUS_10670 20464 19883 gene locus_tag LOCUS_10680 20464 19883 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_10680 21507 20464 gene locus_tag LOCUS_10690 21507 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 21661 22032 gene locus_tag LOCUS_10700 21661 22032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775014.1 protein_id gnl|my_center|LOCUS_10700 22016 22714 gene locus_tag LOCUS_10710 22016 22714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_10710 22704 23528 gene locus_tag LOCUS_10720 22704 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 24500 23640 gene locus_tag LOCUS_10730 24500 23640 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_10730 24801 25901 gene locus_tag LOCUS_10740 24801 25901 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921367.1 protein_id gnl|my_center|LOCUS_10740 26022 26798 gene locus_tag LOCUS_10750 26022 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 28606 26990 gene locus_tag LOCUS_10760 28606 26990 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_10760 28819 31113 gene locus_tag LOCUS_10770 28819 31113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 31837 31145 gene locus_tag LOCUS_10780 31837 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 31944 34736 gene locus_tag LOCUS_10790 31944 34736 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657480.1 protein_id gnl|my_center|LOCUS_10790 34843 34923 gene locus_tag LOCUS_t00100 34843 34923 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35733 35002 gene locus_tag LOCUS_10800 35733 35002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 35977 36543 gene locus_tag LOCUS_10810 35977 36543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10810 37793 37542 gene locus_tag LOCUS_10820 37793 37542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 38554 38054 gene locus_tag LOCUS_10830 38554 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 39432 38662 gene locus_tag LOCUS_10840 39432 38662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence16 305 1000 gene locus_tag LOCUS_10850 305 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5199 1186 gene locus_tag LOCUS_10860 5199 1186 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_10860 5557 5219 gene locus_tag LOCUS_10870 5557 5219 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_10870 5695 6492 gene locus_tag LOCUS_10880 5695 6492 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_10880 7029 6541 gene locus_tag LOCUS_10890 7029 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7419 7042 gene locus_tag LOCUS_10900 gene perR 7419 7042 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_10900 7903 7733 gene locus_tag LOCUS_10910 7903 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9710 7941 gene locus_tag LOCUS_10920 gene pyk 9710 7941 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_10920 13245 9736 gene locus_tag LOCUS_10930 13245 9736 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_10930 16949 13320 gene locus_tag LOCUS_10940 gene rpoC 16949 13320 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_10940 20950 16952 gene locus_tag LOCUS_10950 gene rpoB 20950 16952 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_10950 21336 21875 gene locus_tag LOCUS_10960 21336 21875 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10960 21992 22579 gene locus_tag LOCUS_10970 21992 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 22623 23750 gene locus_tag LOCUS_10980 22623 23750 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_10980 24277 23762 gene locus_tag LOCUS_10990 24277 23762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 25454 24330 gene locus_tag LOCUS_11000 25454 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 25553 25984 gene locus_tag LOCUS_11010 gene tadA 25553 25984 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_11010 25994 26506 gene locus_tag LOCUS_11020 25994 26506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 27961 26801 gene locus_tag LOCUS_11030 27961 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 29299 28616 gene locus_tag LOCUS_11040 29299 28616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 29948 29313 gene locus_tag LOCUS_11050 29948 29313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 30602 29991 gene locus_tag LOCUS_11060 30602 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 31706 30618 gene locus_tag LOCUS_11070 31706 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 32108 31722 gene locus_tag LOCUS_11080 gene spoIIIAD 32108 31722 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_11080 32321 32127 gene locus_tag LOCUS_11090 32321 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 32856 32341 gene locus_tag LOCUS_11100 gene spoIIIAB 32856 32341 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238691.1 protein_id gnl|my_center|LOCUS_11100 33758 32853 gene locus_tag LOCUS_11110 gene spoIIIAA 33758 32853 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_11110 33915 34271 gene locus_tag LOCUS_11120 33915 34271 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_11120 34264 35112 gene locus_tag LOCUS_11130 34264 35112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439347.1 protein_id gnl|my_center|LOCUS_11130 35115 35792 gene locus_tag LOCUS_11140 35115 35792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 35893 36105 gene locus_tag LOCUS_11150 35893 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 38119 36287 gene locus_tag LOCUS_11160 38119 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence17 229 2292 gene locus_tag LOCUS_11170 229 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3002 2412 gene locus_tag LOCUS_11180 gene dpaB 3002 2412 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053596.1 protein_id gnl|my_center|LOCUS_11180 3778 2999 gene locus_tag LOCUS_11190 3778 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3881 5005 gene locus_tag LOCUS_11200 3881 5005 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_11200 5333 5037 gene locus_tag LOCUS_11210 5333 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5739 5951 gene locus_tag LOCUS_11220 5739 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 6611 6195 gene locus_tag LOCUS_11230 6611 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6810 6634 gene locus_tag LOCUS_11240 6810 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7424 6888 gene locus_tag LOCUS_11250 7424 6888 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_11250 7980 7405 gene locus_tag LOCUS_11260 7980 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8135 8986 gene locus_tag LOCUS_11270 8135 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8993 9706 gene locus_tag LOCUS_11280 8993 9706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_11280 9703 11013 gene locus_tag LOCUS_11290 9703 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 11082 11672 gene locus_tag LOCUS_11300 11082 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11836 11994 gene locus_tag LOCUS_11310 11836 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 12253 11966 gene locus_tag LOCUS_11320 12253 11966 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922237.1 protein_id gnl|my_center|LOCUS_11320 12676 12254 gene locus_tag LOCUS_11330 12676 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12856 13056 gene locus_tag LOCUS_11340 12856 13056 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_11340 13340 14497 gene locus_tag LOCUS_11350 13340 14497 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_11350 14562 14999 gene locus_tag LOCUS_11360 14562 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 15011 16408 gene locus_tag LOCUS_11370 15011 16408 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925376.1 protein_id gnl|my_center|LOCUS_11370 16419 17435 gene locus_tag LOCUS_11380 gene queA 16419 17435 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_11380 17455 18375 gene locus_tag LOCUS_11390 17455 18375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 18546 19505 gene locus_tag LOCUS_11400 18546 19505 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_11400 19553 20080 gene locus_tag LOCUS_11410 19553 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 20091 20483 gene locus_tag LOCUS_11420 20091 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 20483 20908 gene locus_tag LOCUS_11430 20483 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 20914 21957 gene locus_tag LOCUS_11440 20914 21957 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050842.1 protein_id gnl|my_center|LOCUS_11440 21991 24486 gene locus_tag LOCUS_11450 gene clpC 21991 24486 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_11450 24629 24904 gene locus_tag LOCUS_11460 24629 24904 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_11460 24975 26264 gene locus_tag LOCUS_11470 24975 26264 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_11470 30139 26270 gene locus_tag LOCUS_11480 30139 26270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 31398 30319 gene locus_tag LOCUS_11490 31398 30319 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_11490 32558 31494 gene locus_tag LOCUS_11500 gene ytvI 32558 31494 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048447.1 protein_id gnl|my_center|LOCUS_11500 32635 35139 gene locus_tag LOCUS_11510 32635 35139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 35111 35593 gene locus_tag LOCUS_11520 35111 35593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 36429 35590 gene locus_tag LOCUS_11530 36429 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 36476 37801 gene locus_tag LOCUS_11540 gene tilS 36476 37801 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence18 2576 138 gene locus_tag LOCUS_11550 2576 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2718 3407 gene locus_tag LOCUS_11560 gene walR 2718 3407 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_11560 3420 5228 gene locus_tag LOCUS_11570 gene walK 3420 5228 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 protein_id gnl|my_center|LOCUS_11570 5609 5175 gene locus_tag LOCUS_11580 5609 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5766 6509 gene locus_tag LOCUS_11590 gene dapB 5766 6509 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_11590 6520 8100 gene locus_tag LOCUS_11600 6520 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 8097 8936 gene locus_tag LOCUS_11610 gene rsmA 8097 8936 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_11610 9168 9098 gene locus_tag LOCUS_t00110 9168 9098 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9302 9231 gene locus_tag LOCUS_t00120 9302 9231 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9756 9418 gene locus_tag LOCUS_11620 9756 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9883 10158 gene locus_tag LOCUS_11630 9883 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10184 10420 gene locus_tag LOCUS_11640 10184 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10563 10919 gene locus_tag LOCUS_11650 10563 10919 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_11650 10912 12567 gene locus_tag LOCUS_11660 10912 12567 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 protein_id gnl|my_center|LOCUS_11660 12576 14639 gene locus_tag LOCUS_11670 gene recG 12576 14639 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_11670 14714 15235 gene locus_tag LOCUS_11680 gene rsmD 14714 15235 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11680 15232 15711 gene locus_tag LOCUS_11690 gene coaD 15232 15711 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_11690 15751 16296 gene locus_tag LOCUS_11700 15751 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 16315 18012 gene locus_tag LOCUS_11710 gene argS 16315 18012 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_11710 19363 18473 gene locus_tag LOCUS_11720 19363 18473 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_11720 19508 19720 gene locus_tag LOCUS_11730 gene rpmE 19508 19720 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_11730 19797 20756 gene locus_tag LOCUS_11740 19797 20756 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_11740 20743 21582 gene locus_tag LOCUS_11750 gene prmC 20743 21582 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_11750 21575 22642 gene locus_tag LOCUS_11760 gene prfA 21575 22642 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_11760 22690 24240 gene locus_tag LOCUS_11770 gene metG 22690 24240 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_11770 24255 24668 gene locus_tag LOCUS_11780 24255 24668 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 protein_id gnl|my_center|LOCUS_11780 24659 25438 gene locus_tag LOCUS_11790 24659 25438 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_11790 25724 25485 gene locus_tag LOCUS_11800 25724 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 26206 25718 gene locus_tag LOCUS_11810 gene fliW 26206 25718 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 protein_id gnl|my_center|LOCUS_11810 28039 26252 gene locus_tag LOCUS_11820 28039 26252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 30029 28062 gene locus_tag LOCUS_11830 30029 28062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 31979 30096 gene locus_tag LOCUS_11840 31979 30096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 32502 32005 gene locus_tag LOCUS_11850 32502 32005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 32840 32568 gene locus_tag LOCUS_11860 32840 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 33886 32915 gene locus_tag LOCUS_11870 33886 32915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence19 667 119 gene locus_tag LOCUS_11880 gene lepB 667 119 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_11880 1052 690 gene locus_tag LOCUS_11890 gene rplS 1052 690 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_11890 1093 1275 gene locus_tag LOCUS_11900 1093 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1215 1805 gene locus_tag LOCUS_11910 1215 1805 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_11910 2242 1898 gene locus_tag LOCUS_11920 2242 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3060 2311 gene locus_tag LOCUS_11930 3060 2311 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_11930 4352 3039 gene locus_tag LOCUS_11940 4352 3039 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_11940 5715 4354 gene locus_tag LOCUS_11950 5715 4354 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_11950 6215 5862 gene locus_tag LOCUS_11960 6215 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962846.1 protein_id gnl|my_center|LOCUS_11960 7388 6387 gene locus_tag LOCUS_11970 7388 6387 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 protein_id gnl|my_center|LOCUS_11970 7744 7385 gene locus_tag LOCUS_11980 7744 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8269 7778 gene locus_tag LOCUS_11990 8269 7778 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151333.1 protein_id gnl|my_center|LOCUS_11990 8994 8281 gene locus_tag LOCUS_12000 gene prdB 8994 8281 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:complement(8554..8556),aa:Sec) note codon on position 147 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_12000 9242 9060 gene locus_tag LOCUS_12010 9242 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11045 9243 gene locus_tag LOCUS_12020 gene prdA 11045 9243 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_12020 12335 11160 gene locus_tag LOCUS_12030 gene prdC 12335 11160 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_12030 12970 12419 gene locus_tag LOCUS_12040 12970 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 14621 13029 gene locus_tag LOCUS_12050 gene tndX 14621 13029 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_12050 14803 14618 gene locus_tag LOCUS_12060 14803 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 15131 15925 gene locus_tag LOCUS_12070 15131 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 16368 16279 gene locus_tag LOCUS_t00130 16368 16279 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16504 17325 gene locus_tag LOCUS_12080 16504 17325 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966219.1 protein_id gnl|my_center|LOCUS_12080 19514 17412 gene locus_tag LOCUS_12090 19514 17412 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_12090 19769 19629 gene locus_tag LOCUS_12100 19769 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 20044 19784 gene locus_tag LOCUS_12110 20044 19784 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869331.1 protein_id gnl|my_center|LOCUS_12110 20126 21043 gene locus_tag LOCUS_12120 20126 21043 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_12120 21040 21855 gene locus_tag LOCUS_12130 21040 21855 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311310.1 protein_id gnl|my_center|LOCUS_12130 23169 22075 gene locus_tag LOCUS_12140 23169 22075 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011578509.1 protein_id gnl|my_center|LOCUS_12140 25202 23193 gene locus_tag LOCUS_12150 25202 23193 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_12150 25423 25351 gene locus_tag LOCUS_t00140 25423 25351 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25583 25508 gene locus_tag LOCUS_t00150 25583 25508 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 25820 26389 gene locus_tag LOCUS_12160 25820 26389 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_12160 26509 27450 gene locus_tag LOCUS_12170 26509 27450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 27734 27477 gene locus_tag LOCUS_12180 27734 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 28242 27850 gene locus_tag LOCUS_12190 28242 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 28492 29523 gene locus_tag LOCUS_12200 gene hydE 28492 29523 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_12200 29516 30919 gene locus_tag LOCUS_12210 gene hydG 29516 30919 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_12210 30916 32097 gene locus_tag LOCUS_12220 gene hydF 30916 32097 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence20 528 719 gene locus_tag LOCUS_12230 528 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 819 2441 gene locus_tag LOCUS_12240 819 2441 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_12240 2697 2527 gene locus_tag LOCUS_12250 2697 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2839 3753 gene locus_tag LOCUS_12260 2839 3753 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_12260 5363 3951 gene locus_tag LOCUS_12270 5363 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5567 6661 gene locus_tag LOCUS_12280 5567 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7256 6735 gene locus_tag LOCUS_12290 7256 6735 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_12290 8528 7416 gene locus_tag LOCUS_12300 gene ald 8528 7416 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_12300 9680 8550 gene locus_tag LOCUS_12310 gene alr 9680 8550 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12310 10052 10345 gene locus_tag LOCUS_12320 10052 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11791 10430 gene locus_tag LOCUS_12330 gene rho 11791 10430 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_12330 12686 11781 gene locus_tag LOCUS_12340 12686 11781 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_12340 13309 12686 gene locus_tag LOCUS_12350 13309 12686 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_12350 16728 13411 gene locus_tag LOCUS_12360 gene addB 16728 13411 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_12360 16857 17276 gene locus_tag LOCUS_12370 16857 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17752 17273 gene locus_tag LOCUS_12380 17752 17273 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965952.1 protein_id gnl|my_center|LOCUS_12380 18369 17749 gene locus_tag LOCUS_12390 18369 17749 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_12390 18951 18373 gene locus_tag LOCUS_12400 gene raiA 18951 18373 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_12400 19506 19018 gene locus_tag LOCUS_12410 19506 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 19980 19507 gene locus_tag LOCUS_12420 19980 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 21838 19982 gene locus_tag LOCUS_12430 21838 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 23016 21853 gene locus_tag LOCUS_12440 23016 21853 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_12440 23191 24321 gene locus_tag LOCUS_12450 gene tgt 23191 24321 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_12450 25948 24374 gene locus_tag LOCUS_12460 25948 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 26161 27081 gene locus_tag LOCUS_12470 gene cysK 26161 27081 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_12470 27078 27656 gene locus_tag LOCUS_12480 gene cysE 27078 27656 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_12480 27663 28568 gene locus_tag LOCUS_12490 27663 28568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 28697 29278 gene locus_tag LOCUS_12500 gene infC 28697 29278 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_12500 29271 29468 gene locus_tag LOCUS_12510 gene rpmI 29271 29468 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_12510 29516 29869 gene locus_tag LOCUS_12520 gene rplT 29516 29869 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_12520 30751 30404 gene locus_tag LOCUS_12530 30751 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 31532 30975 gene locus_tag LOCUS_12540 31532 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence21 975 166 gene locus_tag LOCUS_12550 975 166 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963807.1 protein_id gnl|my_center|LOCUS_12550 1022 1456 gene locus_tag LOCUS_12560 1022 1456 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_12560 1440 2222 gene locus_tag LOCUS_12570 1440 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3567 2485 gene locus_tag LOCUS_12580 3567 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3996 3577 gene locus_tag LOCUS_12590 3996 3577 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531772.1 protein_id gnl|my_center|LOCUS_12590 5181 4018 gene locus_tag LOCUS_12600 gene metK 5181 4018 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_12600 5373 6107 gene locus_tag LOCUS_12610 5373 6107 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_12610 6472 7800 gene locus_tag LOCUS_12620 6472 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7805 7957 gene locus_tag LOCUS_12630 7805 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8058 8201 gene locus_tag LOCUS_12640 8058 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8441 8719 gene locus_tag LOCUS_12650 8441 8719 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_12650 9626 8850 gene locus_tag LOCUS_12660 9626 8850 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_12660 9926 9687 gene locus_tag LOCUS_12670 9926 9687 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287739.1 protein_id gnl|my_center|LOCUS_12670 10056 10277 gene locus_tag LOCUS_12680 10056 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 11482 10316 gene locus_tag LOCUS_12690 11482 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 11953 13134 gene locus_tag LOCUS_12700 11953 13134 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_12700 13265 14908 gene locus_tag LOCUS_12710 13265 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15027 16529 gene locus_tag LOCUS_12720 15027 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 16545 17573 gene locus_tag LOCUS_12730 16545 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 17655 19982 gene locus_tag LOCUS_12740 17655 19982 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_12740 19985 20650 gene locus_tag LOCUS_12750 19985 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 20655 21671 gene locus_tag LOCUS_12760 gene holA 20655 21671 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_12760 21879 22055 gene locus_tag LOCUS_12770 21879 22055 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_12770 22057 22260 gene locus_tag LOCUS_12780 22057 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 22263 23588 gene locus_tag LOCUS_12790 22263 23588 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_12790 23585 24658 gene locus_tag LOCUS_12800 gene orr 23585 24658 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_12800 25147 24596 gene locus_tag LOCUS_12810 25147 24596 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930588.1 protein_id gnl|my_center|LOCUS_12810 25453 25154 gene locus_tag LOCUS_12820 25453 25154 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_12820 26167 25457 gene locus_tag LOCUS_12830 26167 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 26672 26154 gene locus_tag LOCUS_12840 26672 26154 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475789.1 protein_id gnl|my_center|LOCUS_12840 27145 26672 gene locus_tag LOCUS_12850 27145 26672 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963906.1 protein_id gnl|my_center|LOCUS_12850 29584 27206 gene locus_tag LOCUS_12860 29584 27206 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_12860 30210 29584 gene locus_tag LOCUS_12870 30210 29584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 31152 30223 gene locus_tag LOCUS_12880 gene rsmH 31152 30223 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence22 1450 263 gene locus_tag LOCUS_12890 gene thiI 1450 263 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732553.1 protein_id gnl|my_center|LOCUS_12890 2571 1459 gene locus_tag LOCUS_12900 2571 1459 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_12900 3322 2555 gene locus_tag LOCUS_12910 3322 2555 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_12910 3726 3337 gene locus_tag LOCUS_12920 3726 3337 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_12920 4683 3730 gene locus_tag LOCUS_12930 gene prmA 4683 3730 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583319.1 protein_id gnl|my_center|LOCUS_12930 5625 4699 gene locus_tag LOCUS_12940 5625 4699 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_12940 6909 5626 gene locus_tag LOCUS_12950 6909 5626 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_12950 7396 7115 gene locus_tag LOCUS_12960 7396 7115 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_12960 8219 7479 gene locus_tag LOCUS_12970 8219 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9021 8221 gene locus_tag LOCUS_12980 gene racE 9021 8221 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027621.1 protein_id gnl|my_center|LOCUS_12980 10081 9014 gene locus_tag LOCUS_12990 10081 9014 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_12990 10870 10124 gene locus_tag LOCUS_13000 10870 10124 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_13000 10956 12971 gene locus_tag LOCUS_13010 10956 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 14120 12966 gene locus_tag LOCUS_13020 14120 12966 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971122.1 protein_id gnl|my_center|LOCUS_13020 15457 14144 gene locus_tag LOCUS_13030 15457 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 15939 15526 gene locus_tag LOCUS_13040 15939 15526 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_13040 16031 16414 gene locus_tag LOCUS_13050 16031 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 16797 16462 gene locus_tag LOCUS_13060 16797 16462 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_13060 16933 17331 gene locus_tag LOCUS_13070 16933 17331 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902570.1 protein_id gnl|my_center|LOCUS_13070 17413 19185 gene locus_tag LOCUS_13080 gene recJ 17413 19185 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987047.1 protein_id gnl|my_center|LOCUS_13080 19201 19644 gene locus_tag LOCUS_13090 19201 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 19672 20193 gene locus_tag LOCUS_13100 19672 20193 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_13100 20193 20705 gene locus_tag LOCUS_13110 20193 20705 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_13110 20729 21862 gene locus_tag LOCUS_13120 20729 21862 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_13120 22437 21904 gene locus_tag LOCUS_13130 22437 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 22704 24512 gene locus_tag LOCUS_13140 gene glmS 22704 24512 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_13140 24624 25043 gene locus_tag LOCUS_13150 24624 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 25077 25547 gene locus_tag LOCUS_13160 25077 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 26344 25571 gene locus_tag LOCUS_13170 26344 25571 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_13170 27131 26475 gene locus_tag LOCUS_13180 27131 26475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 27276 29537 gene locus_tag LOCUS_13190 27276 29537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 30715 29579 gene locus_tag LOCUS_13200 30715 29579 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence23 952 2547 gene locus_tag LOCUS_13210 952 2547 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13210 2602 3036 gene locus_tag LOCUS_13220 2602 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4443 3145 gene locus_tag LOCUS_13230 4443 3145 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_13230 6057 4624 gene locus_tag LOCUS_13240 gene purB 6057 4624 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_13240 6597 6070 gene locus_tag LOCUS_13250 6597 6070 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_13250 7576 6581 gene locus_tag LOCUS_13260 7576 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7905 7573 gene locus_tag LOCUS_13270 7905 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9305 7920 gene locus_tag LOCUS_13280 gene purF 9305 7920 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_13280 9810 9388 gene locus_tag LOCUS_13290 9810 9388 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972203.1 protein_id gnl|my_center|LOCUS_13290 10262 9807 gene locus_tag LOCUS_13300 10262 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 11520 10330 gene locus_tag LOCUS_13310 gene tuf 11520 10330 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_13310 13714 11618 gene locus_tag LOCUS_13320 gene fusA 13714 11618 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459098.1 protein_id gnl|my_center|LOCUS_13320 13869 13732 gene locus_tag LOCUS_13330 13869 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 14363 13893 gene locus_tag LOCUS_13340 gene rpsG 14363 13893 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_13340 14921 14508 gene locus_tag LOCUS_13350 gene rpsL 14921 14508 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_13350 19417 15098 gene locus_tag LOCUS_13360 19417 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 26414 19428 gene locus_tag LOCUS_13370 26414 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 26689 26859 gene locus_tag LOCUS_13380 26689 26859 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_13380 27030 27158 gene locus_tag LOCUS_13390 27030 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 28844 27285 gene locus_tag LOCUS_13400 28844 27285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence24 482 150 gene locus_tag LOCUS_13410 482 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 660 1550 gene locus_tag LOCUS_13420 660 1550 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_13420 1543 1779 gene locus_tag LOCUS_13430 1543 1779 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_13430 1791 2921 gene locus_tag LOCUS_13440 1791 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2923 3534 gene locus_tag LOCUS_13450 gene gmk 2923 3534 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 protein_id gnl|my_center|LOCUS_13450 3556 3966 gene locus_tag LOCUS_13460 3556 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3959 6400 gene locus_tag LOCUS_13470 gene priA 3959 6400 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861610.1 protein_id gnl|my_center|LOCUS_13470 6418 6882 gene locus_tag LOCUS_13480 gene def 6418 6882 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_13480 6879 7796 gene locus_tag LOCUS_13490 gene fmt 6879 7796 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_13490 7810 8532 gene locus_tag LOCUS_13500 7810 8532 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_13500 8996 8577 gene locus_tag LOCUS_13510 8996 8577 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_13510 9575 9012 gene locus_tag LOCUS_13520 9575 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9738 10808 gene locus_tag LOCUS_13530 9738 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11191 10805 gene locus_tag LOCUS_13540 11191 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 11574 11215 gene locus_tag LOCUS_13550 11574 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 12860 11697 gene locus_tag LOCUS_13560 12860 11697 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_13560 16493 12891 gene locus_tag LOCUS_13570 gene addA 16493 12891 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_13570 17658 16474 gene locus_tag LOCUS_13580 17658 16474 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_13580 17756 18235 gene locus_tag LOCUS_13590 gene ispF 17756 18235 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_13590 18232 19599 gene locus_tag LOCUS_13600 gene cysS 18232 19599 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_13600 19586 19999 gene locus_tag LOCUS_13610 19586 19999 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_13610 19989 20828 gene locus_tag LOCUS_13620 gene rlmB 19989 20828 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_13620 20815 21399 gene locus_tag LOCUS_13630 gene sigH 20815 21399 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966429.1 protein_id gnl|my_center|LOCUS_13630 21591 22715 gene locus_tag LOCUS_13640 gene rsgA 21591 22715 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_13640 22712 23581 gene locus_tag LOCUS_13650 22712 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 23632 25428 gene locus_tag LOCUS_13660 23632 25428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_13660 25421 27205 gene locus_tag LOCUS_13670 25421 27205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence25 508 119 gene locus_tag LOCUS_13680 508 119 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081002.1 protein_id gnl|my_center|LOCUS_13680 1758 505 gene locus_tag LOCUS_13690 gene hisS 1758 505 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_13690 1851 2993 gene locus_tag LOCUS_13700 1851 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2995 4167 gene locus_tag LOCUS_13710 2995 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4216 6924 gene locus_tag LOCUS_13720 4216 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6959 8626 gene locus_tag LOCUS_13730 gene dnaK 6959 8626 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_13730 8642 9220 gene locus_tag LOCUS_13740 8642 9220 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814895.1 protein_id gnl|my_center|LOCUS_13740 9235 9891 gene locus_tag LOCUS_13750 9235 9891 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964733.1 protein_id gnl|my_center|LOCUS_13750 9884 11770 gene locus_tag LOCUS_13760 9884 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 11841 13361 gene locus_tag LOCUS_13770 11841 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13617 15251 gene locus_tag LOCUS_13780 13617 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15465 17537 gene locus_tag LOCUS_13790 15465 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 17552 18391 gene locus_tag LOCUS_13800 17552 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 18540 19562 gene locus_tag LOCUS_13810 18540 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 19645 20367 gene locus_tag LOCUS_13820 gene deoD 19645 20367 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_13820 20486 20989 gene locus_tag LOCUS_13830 20486 20989 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 protein_id gnl|my_center|LOCUS_13830 21124 22824 gene locus_tag LOCUS_13840 gene msbA 21124 22824 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_13840 22824 24581 gene locus_tag LOCUS_13850 gene msbA 22824 24581 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 protein_id gnl|my_center|LOCUS_13850 25016 24639 gene locus_tag LOCUS_13860 25016 24639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 25211 25816 gene locus_tag LOCUS_13870 25211 25816 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence26 1750 185 gene locus_tag LOCUS_13880 1750 185 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_13880 1923 2777 gene locus_tag LOCUS_13890 gene noc 1923 2777 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_13890 3812 2814 gene locus_tag LOCUS_13900 3812 2814 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458931.1 protein_id gnl|my_center|LOCUS_13900 4308 3868 gene locus_tag LOCUS_13910 4308 3868 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022414.1 protein_id gnl|my_center|LOCUS_13910 5139 4318 gene locus_tag LOCUS_13920 5139 4318 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060181.1 protein_id gnl|my_center|LOCUS_13920 5781 5164 gene locus_tag LOCUS_13930 5781 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8083 5786 gene locus_tag LOCUS_13940 8083 5786 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_13940 8581 8150 gene locus_tag LOCUS_13950 8581 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 9417 8599 gene locus_tag LOCUS_13960 gene flgG 9417 8599 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_13960 10224 9439 gene locus_tag LOCUS_13970 10224 9439 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943783.1 protein_id gnl|my_center|LOCUS_13970 11825 10836 gene locus_tag LOCUS_13980 11825 10836 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_13980 13133 11901 gene locus_tag LOCUS_13990 gene aroA 13133 11901 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_13990 13274 15343 gene locus_tag LOCUS_14000 gene fusA 13274 15343 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_14000 15925 15410 gene locus_tag LOCUS_14010 15925 15410 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_14010 17729 16551 gene locus_tag LOCUS_14020 17729 16551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 17920 17726 gene locus_tag LOCUS_14030 17920 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 18172 17936 gene locus_tag LOCUS_14040 18172 17936 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_14040 18636 18199 gene locus_tag LOCUS_14050 18636 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 18776 18931 gene locus_tag LOCUS_14060 18776 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 19037 19657 gene locus_tag LOCUS_14070 gene lepB 19037 19657 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_14070 19684 20250 gene locus_tag LOCUS_14080 gene lepB 19684 20250 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_14080 20285 20503 gene locus_tag LOCUS_14090 20285 20503 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_14090 20716 22392 gene locus_tag LOCUS_14100 20716 22392 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14100 22449 23543 gene locus_tag LOCUS_14110 22449 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 23620 24162 gene locus_tag LOCUS_14120 23620 24162 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_14120 24185 24451 gene locus_tag LOCUS_14130 24185 24451 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430198.1 protein_id gnl|my_center|LOCUS_14130 24500 25729 gene locus_tag LOCUS_14140 24500 25729 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence27 2689 200 gene locus_tag LOCUS_14150 2689 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3204 2689 gene locus_tag LOCUS_14160 3204 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4126 3302 gene locus_tag LOCUS_14170 gene mreC 4126 3302 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_14170 5172 4141 gene locus_tag LOCUS_14180 5172 4141 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_14180 5467 6495 gene locus_tag LOCUS_14190 gene ltaE 5467 6495 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_14190 6507 7118 gene locus_tag LOCUS_14200 6507 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7383 8057 gene locus_tag LOCUS_14210 7383 8057 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_14210 8069 9466 gene locus_tag LOCUS_14220 8069 9466 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_14220 9530 12181 gene locus_tag LOCUS_14230 gene ppdK 9530 12181 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14230 12239 12694 gene locus_tag LOCUS_14240 12239 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12691 13104 gene locus_tag LOCUS_14250 12691 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 13771 13139 gene locus_tag LOCUS_14260 13771 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 14673 13882 gene locus_tag LOCUS_14270 14673 13882 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438774.1 protein_id gnl|my_center|LOCUS_14270 16058 14688 gene locus_tag LOCUS_14280 gene radA 16058 14688 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_14280 16543 16061 gene locus_tag LOCUS_14290 16543 16061 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_14290 17786 16605 gene locus_tag LOCUS_14300 17786 16605 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_14300 18867 17821 gene locus_tag LOCUS_14310 gene tdh 18867 17821 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646013.1 protein_id gnl|my_center|LOCUS_14310 19309 20457 gene locus_tag LOCUS_14320 19309 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 20530 21201 gene locus_tag LOCUS_14330 20530 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 21216 21584 gene locus_tag LOCUS_14340 21216 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 21589 21936 gene locus_tag LOCUS_14350 21589 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 21993 22358 gene locus_tag LOCUS_14360 21993 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence28 2028 184 gene locus_tag LOCUS_14370 gene malZ 2028 184 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_14370 2301 3086 gene locus_tag LOCUS_14380 2301 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3535 4503 gene locus_tag LOCUS_14390 3535 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4697 4539 gene locus_tag LOCUS_14400 4697 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4823 5002 gene locus_tag LOCUS_14410 4823 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5711 5043 gene locus_tag LOCUS_14420 5711 5043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941338.1 protein_id gnl|my_center|LOCUS_14420 6870 5704 gene locus_tag LOCUS_14430 6870 5704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_14430 7240 6875 gene locus_tag LOCUS_14440 7240 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8250 7255 gene locus_tag LOCUS_14450 8250 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8615 8247 gene locus_tag LOCUS_14460 8615 8247 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_14460 8793 9641 gene locus_tag LOCUS_14470 8793 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9658 10527 gene locus_tag LOCUS_14480 9658 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10542 10934 gene locus_tag LOCUS_14490 10542 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10931 11920 gene locus_tag LOCUS_14500 10931 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11933 12562 gene locus_tag LOCUS_14510 11933 12562 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131377.1 protein_id gnl|my_center|LOCUS_14510 12582 12716 gene locus_tag LOCUS_14520 12582 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 12786 13316 gene locus_tag LOCUS_14530 12786 13316 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 protein_id gnl|my_center|LOCUS_14530 13844 13353 gene locus_tag LOCUS_14540 13844 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14129 13932 gene locus_tag LOCUS_14550 14129 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 15327 14140 gene locus_tag LOCUS_14560 gene tyrS 15327 14140 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_14560 15829 15341 gene locus_tag LOCUS_14570 15829 15341 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_14570 16157 15840 gene locus_tag LOCUS_14580 16157 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16554 16138 gene locus_tag LOCUS_14590 16554 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 16865 16563 gene locus_tag LOCUS_14600 16865 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 17339 16938 gene locus_tag LOCUS_14610 17339 16938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 17555 17403 gene locus_tag LOCUS_14620 17555 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 17502 17786 gene locus_tag LOCUS_14630 17502 17786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17850 19745 gene locus_tag LOCUS_14640 17850 19745 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_14640 19943 20137 gene locus_tag LOCUS_14650 19943 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 20130 20285 gene locus_tag LOCUS_14660 20130 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 21008 21349 gene locus_tag LOCUS_14670 21008 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 21298 22338 gene locus_tag LOCUS_14680 21298 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence29 192 1121 gene locus_tag LOCUS_14690 192 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1124 2200 gene locus_tag LOCUS_14700 1124 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2675 2277 gene locus_tag LOCUS_14710 2675 2277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888313.1 protein_id gnl|my_center|LOCUS_14710 4486 2672 gene locus_tag LOCUS_14720 gene tet 4486 2672 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_14720 4747 6024 gene locus_tag LOCUS_14730 gene obgE 4747 6024 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_14730 6044 7417 gene locus_tag LOCUS_14740 6044 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7466 7756 gene locus_tag LOCUS_14750 gene yhbY 7466 7756 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721997.1 protein_id gnl|my_center|LOCUS_14750 7753 9456 gene locus_tag LOCUS_14760 7753 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 9469 9933 gene locus_tag LOCUS_14770 9469 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10037 10624 gene locus_tag LOCUS_14780 10037 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 10883 14386 gene locus_tag LOCUS_14790 10883 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 14507 14974 gene locus_tag LOCUS_14800 14507 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 15129 15470 gene locus_tag LOCUS_14810 15129 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 15498 16028 gene locus_tag LOCUS_14820 15498 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16473 17375 gene locus_tag LOCUS_14830 16473 17375 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680087.1 protein_id gnl|my_center|LOCUS_14830 17372 18394 gene locus_tag LOCUS_14840 17372 18394 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680086.1 protein_id gnl|my_center|LOCUS_14840 18394 19056 gene locus_tag LOCUS_14850 18394 19056 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429358.1 protein_id gnl|my_center|LOCUS_14850 19046 19318 gene locus_tag LOCUS_14860 19046 19318 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_14860 19302 20060 gene locus_tag LOCUS_14870 19302 20060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_14870 20060 20833 gene locus_tag LOCUS_14880 20060 20833 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612384.1 protein_id gnl|my_center|LOCUS_14880 20905 21141 gene locus_tag LOCUS_14890 20905 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence30 238 1698 gene locus_tag LOCUS_14900 238 1698 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_14900 1735 3003 gene locus_tag LOCUS_14910 1735 3003 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_14910 3638 4690 gene locus_tag LOCUS_14920 3638 4690 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433354.1 protein_id gnl|my_center|LOCUS_14920 4700 6067 gene locus_tag LOCUS_14930 4700 6067 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124259.1 protein_id gnl|my_center|LOCUS_14930 6064 6378 gene locus_tag LOCUS_14940 6064 6378 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817378.1 protein_id gnl|my_center|LOCUS_14940 6381 7220 gene locus_tag LOCUS_14950 6381 7220 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_14950 7217 7747 gene locus_tag LOCUS_14960 7217 7747 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_14960 7783 8091 gene locus_tag LOCUS_14970 7783 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8159 8923 gene locus_tag LOCUS_14980 8159 8923 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_14980 12698 8979 gene locus_tag LOCUS_14990 12698 8979 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_14990 13553 12711 gene locus_tag LOCUS_15000 gene rsmI 13553 12711 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_15000 14265 13534 gene locus_tag LOCUS_15010 14265 13534 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_15010 15161 14265 gene locus_tag LOCUS_15020 15161 14265 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_15020 16124 15180 gene locus_tag LOCUS_15030 16124 15180 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_15030 16574 16134 gene locus_tag LOCUS_15040 16574 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 16926 16585 gene locus_tag LOCUS_15050 16926 16585 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_15050 17570 16947 gene locus_tag LOCUS_15060 gene tmk 17570 16947 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_15060 17680 19479 gene locus_tag LOCUS_15070 17680 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence31 1280 2068 gene locus_tag LOCUS_15080 gene srtB 1280 2068 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_15080 2283 3035 gene locus_tag LOCUS_15090 2283 3035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_15090 3032 3829 gene locus_tag LOCUS_15100 3032 3829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393844.1 protein_id gnl|my_center|LOCUS_15100 5754 3874 gene locus_tag LOCUS_15110 5754 3874 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039674.1 protein_id gnl|my_center|LOCUS_15110 6645 5785 gene locus_tag LOCUS_15120 6645 5785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938141.1 protein_id gnl|my_center|LOCUS_15120 7622 6657 gene locus_tag LOCUS_15130 7622 6657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287892.1 protein_id gnl|my_center|LOCUS_15130 8563 7634 gene locus_tag LOCUS_15140 8563 7634 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660720.1 protein_id gnl|my_center|LOCUS_15140 9582 8560 gene locus_tag LOCUS_15150 9582 8560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795384.1 protein_id gnl|my_center|LOCUS_15150 10327 9677 gene locus_tag LOCUS_15160 10327 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10512 11348 gene locus_tag LOCUS_15170 gene folD 10512 11348 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_15170 11405 12355 gene locus_tag LOCUS_15180 11405 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 12412 14094 gene locus_tag LOCUS_15190 12412 14094 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_15190 15562 14567 gene locus_tag LOCUS_15200 15562 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 16174 15749 gene locus_tag LOCUS_15210 16174 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16881 16177 gene locus_tag LOCUS_15220 16881 16177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 17013 17696 gene locus_tag LOCUS_15230 17013 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 17748 18158 gene locus_tag LOCUS_15240 17748 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 18158 18442 gene locus_tag LOCUS_15250 18158 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 18610 19059 gene locus_tag LOCUS_15260 18610 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence32 132 425 gene locus_tag LOCUS_15270 132 425 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_15270 909 1271 gene locus_tag LOCUS_15280 909 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2368 1343 gene locus_tag LOCUS_15290 2368 1343 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_15290 2738 3301 gene locus_tag LOCUS_15300 gene ahpC 2738 3301 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_15300 3369 4973 gene locus_tag LOCUS_15310 3369 4973 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015958.1 protein_id gnl|my_center|LOCUS_15310 5429 4998 gene locus_tag LOCUS_15320 5429 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7086 5476 gene locus_tag LOCUS_15330 7086 5476 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_15330 7218 9137 gene locus_tag LOCUS_15340 7218 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 9616 9197 gene locus_tag LOCUS_15350 9616 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9718 9927 gene locus_tag LOCUS_15360 9718 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 10703 9981 gene locus_tag LOCUS_15370 10703 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 12399 10768 gene locus_tag LOCUS_15380 12399 10768 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_15380 13839 12415 gene locus_tag LOCUS_15390 gene clpX 13839 12415 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804582.1 protein_id gnl|my_center|LOCUS_15390 14462 13851 gene locus_tag LOCUS_15400 gene clpP 14462 13851 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_15400 15818 14496 gene locus_tag LOCUS_15410 gene tig 15818 14496 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_15410 16031 17026 gene locus_tag LOCUS_15420 16031 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 17338 17054 gene locus_tag LOCUS_15430 gene rpmA 17338 17054 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_15430 17645 17331 gene locus_tag LOCUS_15440 17645 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 17953 17654 gene locus_tag LOCUS_15450 gene rplU 17953 17654 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700335.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence33 347 679 gene locus_tag LOCUS_15460 347 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 698 1858 gene locus_tag LOCUS_15470 698 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2034 3404 gene locus_tag LOCUS_15480 2034 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3615 4343 gene locus_tag LOCUS_15490 3615 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4632 4396 gene locus_tag LOCUS_15500 4632 4396 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_15500 5968 4673 gene locus_tag LOCUS_15510 gene murC 5968 4673 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_15510 6100 7365 gene locus_tag LOCUS_15520 6100 7365 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_15520 7378 8487 gene locus_tag LOCUS_15530 gene glgD 7378 8487 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_15530 9155 8583 gene locus_tag LOCUS_15540 gene cobC 9155 8583 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_15540 9603 9202 gene locus_tag LOCUS_15550 gene fliS 9603 9202 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_15550 10119 9634 gene locus_tag LOCUS_15560 10119 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 10587 10153 gene locus_tag LOCUS_15570 10587 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12981 10612 gene locus_tag LOCUS_15580 12981 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 13160 13690 gene locus_tag LOCUS_15590 13160 13690 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_15590 15356 13683 gene locus_tag LOCUS_15600 15356 13683 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15600 15810 15379 gene locus_tag LOCUS_15610 15810 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 15930 17054 gene locus_tag LOCUS_15620 gene ychF 15930 17054 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence34 382 149 gene locus_tag LOCUS_15630 gene rpsR 382 149 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_15630 881 405 gene locus_tag LOCUS_15640 gene ssb 881 405 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_15640 1205 894 gene locus_tag LOCUS_15650 gene rpsF 1205 894 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_15650 1885 1325 gene locus_tag LOCUS_15660 1885 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2448 1906 gene locus_tag LOCUS_15670 2448 1906 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583048.1 protein_id gnl|my_center|LOCUS_15670 2674 2747 gene locus_tag LOCUS_t00160 2674 2747 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2814 4574 gene locus_tag LOCUS_15680 gene thrS 2814 4574 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080983.1 protein_id gnl|my_center|LOCUS_15680 4598 5572 gene locus_tag LOCUS_15690 4598 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6969 5734 gene locus_tag LOCUS_15700 6969 5734 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_15700 8160 7039 gene locus_tag LOCUS_15710 8160 7039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_15710 8598 8218 gene locus_tag LOCUS_15720 8598 8218 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_15720 8712 9671 gene locus_tag LOCUS_15730 8712 9671 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_15730 9668 10777 gene locus_tag LOCUS_15740 9668 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 10790 11989 gene locus_tag LOCUS_15750 10790 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 11976 12764 gene locus_tag LOCUS_15760 11976 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12856 13710 gene locus_tag LOCUS_15770 12856 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14066 14401 gene locus_tag LOCUS_15780 14066 14401 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_15780 14391 14954 gene locus_tag LOCUS_15790 14391 14954 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721612.1 protein_id gnl|my_center|LOCUS_15790 16304 15030 gene locus_tag LOCUS_15800 gene hflX 16304 15030 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_15800 16990 16388 gene locus_tag LOCUS_15810 16990 16388 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence35 529 122 gene locus_tag LOCUS_15820 529 122 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_15820 554 1330 gene locus_tag LOCUS_15830 554 1330 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390209.1 protein_id gnl|my_center|LOCUS_15830 2077 1325 gene locus_tag LOCUS_15840 2077 1325 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_15840 4564 2135 gene locus_tag LOCUS_15850 gene leuS 4564 2135 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_15850 4684 5751 gene locus_tag LOCUS_15860 4684 5751 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_15860 5763 6662 gene locus_tag LOCUS_15870 5763 6662 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_15870 6835 6659 gene locus_tag LOCUS_15880 6835 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6889 7311 gene locus_tag LOCUS_15890 6889 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 7370 7870 gene locus_tag LOCUS_15900 7370 7870 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_15900 7824 8894 gene locus_tag LOCUS_15910 7824 8894 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_15910 8896 9345 gene locus_tag LOCUS_15920 8896 9345 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_15920 9342 9782 gene locus_tag LOCUS_15930 gene rpiB 9342 9782 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_15930 9820 10911 gene locus_tag LOCUS_15940 9820 10911 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_15940 10889 11644 gene locus_tag LOCUS_15950 10889 11644 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence36 566 216 gene locus_tag LOCUS_15960 566 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2071 737 gene locus_tag LOCUS_15970 2071 737 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 protein_id gnl|my_center|LOCUS_15970 2750 2058 gene locus_tag LOCUS_15980 2750 2058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_15980 6210 2875 gene locus_tag LOCUS_15990 6210 2875 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964365.1 protein_id gnl|my_center|LOCUS_15990 7587 6781 gene locus_tag LOCUS_16000 7587 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7959 7887 gene locus_tag LOCUS_t00170 7959 7887 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 910 1062 gene locus_tag LOCUS_16010 910 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1516 1013 gene locus_tag LOCUS_16020 1516 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2814 1747 gene locus_tag LOCUS_16030 gene ispG 2814 1747 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_16030 3785 2826 gene locus_tag LOCUS_16040 3785 2826 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412965.1 protein_id gnl|my_center|LOCUS_16040 3880 4224 gene locus_tag LOCUS_16050 3880 4224 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_16050 4221 4601 gene locus_tag LOCUS_16060 4221 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16060 4680 4606 gene locus_tag LOCUS_t00180 4680 4606 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6099 4714 gene locus_tag LOCUS_16070 gene rlmD 6099 4714 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence38 320 580 gene locus_tag LOCUS_16080 gene rpsO 320 580 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_16080 588 1046 gene locus_tag LOCUS_16090 588 1046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_16090 1093 3336 gene locus_tag LOCUS_16100 gene pnp 1093 3336 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_16100 3333 3779 gene locus_tag LOCUS_16110 gene dut 3333 3779 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_16110 3871 4305 gene locus_tag LOCUS_16120 3871 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4319 4924 gene locus_tag LOCUS_16130 4319 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4927 5622 gene locus_tag LOCUS_16140 4927 5622 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence39 121 450 gene locus_tag LOCUS_16150 121 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 443 1177 gene locus_tag LOCUS_16160 443 1177 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922683.1 protein_id gnl|my_center|LOCUS_16160 1186 1851 gene locus_tag LOCUS_16170 1186 1851 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_16170 1851 2978 gene locus_tag LOCUS_16180 1851 2978 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_16180 2975 4069 gene locus_tag LOCUS_16190 gene rseP 2975 4069 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence40 989 495 gene locus_tag LOCUS_16200 989 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2840 1032 gene locus_tag LOCUS_16210 gene glmS 2840 1032 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence41 461 377 gene locus_tag LOCUS_t00190 461 377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 856 1068 gene locus_tag LOCUS_16220 856 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2880 1189 gene locus_tag LOCUS_16230 2880 1189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence42 100 516 gene locus_tag LOCUS_16240 100 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2110 569 gene locus_tag LOCUS_16250 2110 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2663 2163 gene locus_tag LOCUS_16260 2663 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2908 3039 gene locus_tag LOCUS_16270 2908 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence43 1496 696 gene locus_tag LOCUS_16280 1496 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1755 1976 gene locus_tag LOCUS_16290 1755 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290