>Feature sequence01 518 354 gene locus_tag LOCUS_00010 518 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 416 425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 824 2581 gene locus_tag LOCUS_00020 824 2581 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537467.1 protein_id gnl|my_center|LOCUS_00020 2643 3668 gene locus_tag LOCUS_00030 2643 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3793 4719 gene locus_tag LOCUS_00040 3793 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4739 5821 gene locus_tag LOCUS_00050 4739 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5889 6329 gene locus_tag LOCUS_00060 5889 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7934 6384 gene locus_tag LOCUS_00070 7934 6384 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 protein_id gnl|my_center|LOCUS_00070 8527 7946 gene locus_tag LOCUS_00080 8527 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9807 8515 gene locus_tag LOCUS_00090 9807 8515 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_00090 10177 9815 gene locus_tag LOCUS_00100 10177 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11132 10278 gene locus_tag LOCUS_00110 11132 10278 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_00110 12809 11154 gene locus_tag LOCUS_00120 gene oxc 12809 11154 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878289.1 protein_id gnl|my_center|LOCUS_00120 14047 12806 gene locus_tag LOCUS_00130 gene frc 14047 12806 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_00130 15427 14414 gene locus_tag LOCUS_00140 15427 14414 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_00140 15717 17087 gene locus_tag LOCUS_00150 15717 17087 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_00150 17121 20186 gene locus_tag LOCUS_00160 17121 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20269 20718 gene locus_tag LOCUS_00170 20269 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20711 22057 gene locus_tag LOCUS_00180 20711 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22156 23382 gene locus_tag LOCUS_00190 22156 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23461 25509 gene locus_tag LOCUS_00200 23461 25509 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_00200 25526 26548 gene locus_tag LOCUS_00210 25526 26548 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_00210 26545 27657 gene locus_tag LOCUS_00220 26545 27657 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_00220 27698 28237 gene locus_tag LOCUS_00230 27698 28237 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_00230 29704 28280 gene locus_tag LOCUS_00240 29704 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29761 30918 gene locus_tag LOCUS_00250 29761 30918 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082971.1 protein_id gnl|my_center|LOCUS_00250 30915 31943 gene locus_tag LOCUS_00260 30915 31943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063640.1 protein_id gnl|my_center|LOCUS_00260 31974 32387 gene locus_tag LOCUS_00270 31974 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32404 33246 gene locus_tag LOCUS_00280 32404 33246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33278 34753 gene locus_tag LOCUS_00290 33278 34753 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_00290 36567 34750 gene locus_tag LOCUS_00300 36567 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36756 38324 gene locus_tag LOCUS_00310 36756 38324 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_00310 38369 40123 gene locus_tag LOCUS_00320 38369 40123 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_00320 41110 40202 gene locus_tag LOCUS_00330 41110 40202 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_00330 41330 43708 gene locus_tag LOCUS_00340 41330 43708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43705 45057 gene locus_tag LOCUS_00350 43705 45057 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_00350 45072 46727 gene locus_tag LOCUS_00360 45072 46727 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_00360 46738 47745 gene locus_tag LOCUS_00370 46738 47745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47863 48774 gene locus_tag LOCUS_00380 gene ada 47863 48774 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_00380 48821 50230 gene locus_tag LOCUS_00390 48821 50230 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_00390 50310 50714 gene locus_tag LOCUS_00400 50310 50714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50724 52142 gene locus_tag LOCUS_00410 50724 52142 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_00410 52201 52425 gene locus_tag LOCUS_00420 52201 52425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52447 53340 gene locus_tag LOCUS_00430 52447 53340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 53461 54528 gene locus_tag LOCUS_00440 53461 54528 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_00440 55882 54551 gene locus_tag LOCUS_00450 55882 54551 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_00450 57963 55939 gene locus_tag LOCUS_00460 57963 55939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 59030 57990 gene locus_tag LOCUS_00470 59030 57990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 62272 59048 gene locus_tag LOCUS_00480 62272 59048 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_00480 62416 63441 gene locus_tag LOCUS_00490 62416 63441 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_00490 64465 63476 gene locus_tag LOCUS_00500 64465 63476 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809641.1 protein_id gnl|my_center|LOCUS_00500 64528 66984 gene locus_tag LOCUS_00510 64528 66984 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_00510 67121 69040 gene locus_tag LOCUS_00520 67121 69040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 69028 70881 gene locus_tag LOCUS_00530 69028 70881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 70965 71198 gene locus_tag LOCUS_00540 70965 71198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 72739 71186 gene locus_tag LOCUS_00550 72739 71186 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_00550 72886 73275 gene locus_tag LOCUS_00560 72886 73275 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_00560 73287 74381 gene locus_tag LOCUS_00570 73287 74381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 74621 74403 gene locus_tag LOCUS_00580 74621 74403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 74595 75056 gene locus_tag LOCUS_00590 74595 75056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 78161 75000 gene locus_tag LOCUS_00600 78161 75000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 79335 78166 gene locus_tag LOCUS_00610 79335 78166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 80019 80237 gene locus_tag LOCUS_00620 80019 80237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 80364 80966 gene locus_tag LOCUS_00630 80364 80966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 81130 82497 gene locus_tag LOCUS_00640 81130 82497 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878019.1 protein_id gnl|my_center|LOCUS_00640 82607 84730 gene locus_tag LOCUS_00650 82607 84730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 84744 85352 gene locus_tag LOCUS_00660 84744 85352 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_00660 85384 87309 gene locus_tag LOCUS_00670 85384 87309 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_00670 87327 89210 gene locus_tag LOCUS_00680 87327 89210 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_00680 90489 89224 gene locus_tag LOCUS_00690 90489 89224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_00690 91436 90486 gene locus_tag LOCUS_00700 91436 90486 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_00700 91547 92566 gene locus_tag LOCUS_00710 91547 92566 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_00710 92598 93158 gene locus_tag LOCUS_00720 92598 93158 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_00720 93594 93211 gene locus_tag LOCUS_00730 93594 93211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818687.1 protein_id gnl|my_center|LOCUS_00730 93693 94160 gene locus_tag LOCUS_00740 93693 94160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 94796 94185 gene locus_tag LOCUS_00750 94796 94185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 94863 95072 gene locus_tag LOCUS_00760 94863 95072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 96487 95069 gene locus_tag LOCUS_00770 96487 95069 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_00770 97021 96569 gene locus_tag LOCUS_00780 97021 96569 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_00780 97266 97018 gene locus_tag LOCUS_00790 97266 97018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 98774 97341 gene locus_tag LOCUS_00800 98774 97341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_00800 99929 98817 gene locus_tag LOCUS_00810 99929 98817 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_00810 103897 99950 gene locus_tag LOCUS_00820 103897 99950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 105432 104014 gene locus_tag LOCUS_00830 105432 104014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105498 106511 gene locus_tag LOCUS_00840 105498 106511 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_00840 106528 107814 gene locus_tag LOCUS_00850 gene pvdM 106528 107814 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_00850 107883 108986 gene locus_tag LOCUS_00860 107883 108986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 109476 110603 gene locus_tag LOCUS_00870 109476 110603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 110637 111701 gene locus_tag LOCUS_00880 110637 111701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 112006 113328 gene locus_tag LOCUS_00890 112006 113328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 114604 113243 gene locus_tag LOCUS_00900 114604 113243 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_00900 116284 114632 gene locus_tag LOCUS_00910 116284 114632 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_00910 116359 117561 gene locus_tag LOCUS_00920 116359 117561 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00920 117659 117862 gene locus_tag LOCUS_00930 117659 117862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 117868 118251 gene locus_tag LOCUS_00940 gene vapc11 117868 118251 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_00940 118390 119625 gene locus_tag LOCUS_00950 118390 119625 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_00950 119663 120361 gene locus_tag LOCUS_00960 119663 120361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_00960 120358 121503 gene locus_tag LOCUS_00970 120358 121503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 121532 122689 gene locus_tag LOCUS_00980 121532 122689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_00980 122738 125476 gene locus_tag LOCUS_00990 122738 125476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 125466 127004 gene locus_tag LOCUS_01000 125466 127004 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_01000 127007 127963 gene locus_tag LOCUS_01010 127007 127963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 129048 127960 gene locus_tag LOCUS_01020 129048 127960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_01020 129148 129513 gene locus_tag LOCUS_01030 129148 129513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 129658 130959 gene locus_tag LOCUS_01040 129658 130959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 130956 132464 gene locus_tag LOCUS_01050 130956 132464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132469 135651 gene locus_tag LOCUS_01060 132469 135651 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_01060 136241 135612 gene locus_tag LOCUS_01070 136241 135612 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_01070 136328 136810 gene locus_tag LOCUS_01080 136328 136810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 136862 137077 gene locus_tag LOCUS_01090 136862 137077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 137086 138468 gene locus_tag LOCUS_01100 137086 138468 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_01100 139471 138539 gene locus_tag LOCUS_01110 139471 138539 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 protein_id gnl|my_center|LOCUS_01110 141602 139479 gene locus_tag LOCUS_01120 141602 139479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 142983 141937 gene locus_tag LOCUS_01130 142983 141937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 143876 142974 gene locus_tag LOCUS_01140 143876 142974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 144570 143914 gene locus_tag LOCUS_01150 144570 143914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 144709 144635 gene locus_tag LOCUS_t00010 144709 144635 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 144810 146159 gene locus_tag LOCUS_01160 144810 146159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_01160 146153 146779 gene locus_tag LOCUS_01170 146153 146779 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_01170 146836 147870 gene locus_tag LOCUS_01180 146836 147870 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110512.1 protein_id gnl|my_center|LOCUS_01180 151375 147908 gene locus_tag LOCUS_01190 151375 147908 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_01190 153767 151386 gene locus_tag LOCUS_01200 153767 151386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 154132 153764 gene locus_tag LOCUS_01210 154132 153764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 153897 153906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 155277 154129 gene locus_tag LOCUS_01220 155277 154129 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392016.1 protein_id gnl|my_center|LOCUS_01220 155812 155324 gene locus_tag LOCUS_01230 155812 155324 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_01230 156321 155890 gene locus_tag LOCUS_01240 156321 155890 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_01240 156557 156318 gene locus_tag LOCUS_01250 156557 156318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 156635 158374 gene locus_tag LOCUS_01260 156635 158374 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01260 158361 159506 gene locus_tag LOCUS_01270 158361 159506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 159551 162184 gene locus_tag LOCUS_01280 159551 162184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 162282 163331 gene locus_tag LOCUS_01290 162282 163331 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_01290 163412 165220 gene locus_tag LOCUS_01300 163412 165220 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_01300 165231 166487 gene locus_tag LOCUS_01310 165231 166487 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_01310 167123 166491 gene locus_tag LOCUS_01320 167123 166491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 167618 167175 gene locus_tag LOCUS_01330 167618 167175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 169762 167615 gene locus_tag LOCUS_01340 169762 167615 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_01340 171726 169759 gene locus_tag LOCUS_01350 171726 169759 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_01350 172220 171747 gene locus_tag LOCUS_01360 172220 171747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 172767 172243 gene locus_tag LOCUS_01370 172767 172243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_01370 173361 172828 gene locus_tag LOCUS_01380 173361 172828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 173970 173470 gene locus_tag LOCUS_01390 173970 173470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 175260 173995 gene locus_tag LOCUS_01400 175260 173995 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_01400 176183 175278 gene locus_tag LOCUS_01410 176183 175278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_01410 176791 176180 gene locus_tag LOCUS_01420 176791 176180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 176903 177637 gene locus_tag LOCUS_01430 176903 177637 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_01430 178542 177640 gene locus_tag LOCUS_01440 178542 177640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 179303 178539 gene locus_tag LOCUS_01450 gene xth 179303 178539 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_01450 179968 179345 gene locus_tag LOCUS_01460 179968 179345 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257344.1 protein_id gnl|my_center|LOCUS_01460 180054 181115 gene locus_tag LOCUS_01470 180054 181115 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_01470 181158 183764 gene locus_tag LOCUS_01480 181158 183764 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_01480 186942 183778 gene locus_tag LOCUS_01490 186942 183778 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_01490 188219 186951 gene locus_tag LOCUS_01500 188219 186951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 188685 188242 gene locus_tag LOCUS_01510 188685 188242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 188590 188889 gene locus_tag LOCUS_01520 188590 188889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 188900 189313 gene locus_tag LOCUS_01530 188900 189313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 190586 189282 gene locus_tag LOCUS_01540 190586 189282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 194167 190607 gene locus_tag LOCUS_01550 gene smc 194167 190607 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_01550 194323 194880 gene locus_tag LOCUS_01560 gene pyrR 194323 194880 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_01560 194877 195830 gene locus_tag LOCUS_01570 194877 195830 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_01570 195827 197116 gene locus_tag LOCUS_01580 195827 197116 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_01580 197937 197131 gene locus_tag LOCUS_01590 197937 197131 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_01590 198004 199497 gene locus_tag LOCUS_01600 gene tcuA 198004 199497 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_01600 199490 200533 gene locus_tag LOCUS_01610 199490 200533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 200550 201215 gene locus_tag LOCUS_01620 200550 201215 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_01620 201993 201199 gene locus_tag LOCUS_01630 201993 201199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 202126 203586 gene locus_tag LOCUS_01640 gene nrfD 202126 203586 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_01640 203588 204196 gene locus_tag LOCUS_01650 203588 204196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 204196 205431 gene locus_tag LOCUS_01660 204196 205431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_01660 205549 206265 gene locus_tag LOCUS_01670 205549 206265 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_01670 206307 208064 gene locus_tag LOCUS_01680 206307 208064 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_01680 208085 208684 gene locus_tag LOCUS_01690 208085 208684 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_01690 208737 209066 gene locus_tag LOCUS_01700 208737 209066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 209086 209559 gene locus_tag LOCUS_01710 209086 209559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 209556 210359 gene locus_tag LOCUS_01720 209556 210359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 210428 211822 gene locus_tag LOCUS_01730 210428 211822 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_01730 211870 212823 gene locus_tag LOCUS_01740 211870 212823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 213947 212838 gene locus_tag LOCUS_01750 213947 212838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 215042 213972 gene locus_tag LOCUS_01760 gene mer 215042 213972 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_01760 215212 218892 gene locus_tag LOCUS_01770 215212 218892 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_01770 218889 220406 gene locus_tag LOCUS_01780 218889 220406 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_01780 220474 220890 gene locus_tag LOCUS_01790 220474 220890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 221053 222471 gene locus_tag LOCUS_01800 gene amt 221053 222471 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_01800 222545 223603 gene locus_tag LOCUS_01810 222545 223603 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_01810 223637 224869 gene locus_tag LOCUS_01820 223637 224869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 226393 224981 gene locus_tag LOCUS_01830 226393 224981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 227647 226409 gene locus_tag LOCUS_01840 227647 226409 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_01840 227752 230670 gene locus_tag LOCUS_01850 227752 230670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 232006 230681 gene locus_tag LOCUS_01860 232006 230681 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_01860 232405 232752 gene locus_tag LOCUS_01870 232405 232752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 232889 233545 gene locus_tag LOCUS_01880 232889 233545 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_01880 233943 233554 gene locus_tag LOCUS_01890 gene bolA 233943 233554 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 protein_id gnl|my_center|LOCUS_01890 233987 234700 gene locus_tag LOCUS_01900 233987 234700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 234682 235986 gene locus_tag LOCUS_01910 234682 235986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 237108 235987 gene locus_tag LOCUS_01920 237108 235987 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_01920 237224 238111 gene locus_tag LOCUS_01930 237224 238111 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_01930 238129 238347 gene locus_tag LOCUS_01940 238129 238347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 238567 240291 gene locus_tag LOCUS_01950 gene rpoD 238567 240291 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_01950 240331 241035 gene locus_tag LOCUS_01960 240331 241035 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_01960 241059 242480 gene locus_tag LOCUS_01970 241059 242480 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_01970 244923 242518 gene locus_tag LOCUS_01980 244923 242518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 245077 245877 gene locus_tag LOCUS_01990 245077 245877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_01990 245877 247685 gene locus_tag LOCUS_02000 245877 247685 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_02000 247687 248445 gene locus_tag LOCUS_02010 247687 248445 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_02010 249786 248455 gene locus_tag LOCUS_02020 249786 248455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 249910 250590 gene locus_tag LOCUS_02030 249910 250590 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_02030 252552 250600 gene locus_tag LOCUS_02040 252552 250600 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_02040 253355 252558 gene locus_tag LOCUS_02050 253355 252558 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_02050 253786 253367 gene locus_tag LOCUS_02060 253786 253367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 253865 255277 gene locus_tag LOCUS_02070 gene trkA 253865 255277 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_02070 255324 256085 gene locus_tag LOCUS_02080 255324 256085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 257395 256166 gene locus_tag LOCUS_02090 257395 256166 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_02090 258680 257472 gene locus_tag LOCUS_02100 258680 257472 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965460.1 protein_id gnl|my_center|LOCUS_02100 258836 259180 gene locus_tag LOCUS_02110 258836 259180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 259185 260351 gene locus_tag LOCUS_02120 259185 260351 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_02120 260348 261523 gene locus_tag LOCUS_02130 260348 261523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 261520 262686 gene locus_tag LOCUS_02140 261520 262686 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_02140 262720 263244 gene locus_tag LOCUS_02150 262720 263244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02150 263278 264594 gene locus_tag LOCUS_02160 263278 264594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02160 264656 265813 gene locus_tag LOCUS_02170 264656 265813 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_02170 265930 266721 gene locus_tag LOCUS_02180 265930 266721 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_02180 266718 267389 gene locus_tag LOCUS_02190 266718 267389 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_02190 267386 268129 gene locus_tag LOCUS_02200 gene cobA 267386 268129 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258423.1 protein_id gnl|my_center|LOCUS_02200 269093 268074 gene locus_tag LOCUS_02210 269093 268074 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_02210 270882 269095 gene locus_tag LOCUS_02220 270882 269095 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_02220 272186 270879 gene locus_tag LOCUS_02230 272186 270879 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385434.1 protein_id gnl|my_center|LOCUS_02230 272722 272183 gene locus_tag LOCUS_02240 272722 272183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 273400 272762 gene locus_tag LOCUS_02250 273400 272762 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_02250 275692 273449 gene locus_tag LOCUS_02260 275692 273449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 275803 276807 gene locus_tag LOCUS_02270 275803 276807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 277627 276821 gene locus_tag LOCUS_02280 gene pcaD 277627 276821 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_02280 277898 277617 gene locus_tag LOCUS_02290 277898 277617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 277981 278898 gene locus_tag LOCUS_02300 277981 278898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 279508 278906 gene locus_tag LOCUS_02310 279508 278906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 281284 279536 gene locus_tag LOCUS_02320 281284 279536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 283358 281307 gene locus_tag LOCUS_02330 283358 281307 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_02330 283881 283450 gene locus_tag LOCUS_02340 283881 283450 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_02340 284165 283881 gene locus_tag LOCUS_02350 284165 283881 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393693.1 protein_id gnl|my_center|LOCUS_02350 284772 284236 gene locus_tag LOCUS_02360 284772 284236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 284869 285783 gene locus_tag LOCUS_02370 284869 285783 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_02370 285794 287041 gene locus_tag LOCUS_02380 285794 287041 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_02380 288357 287047 gene locus_tag LOCUS_02390 288357 287047 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_02390 288369 289508 gene locus_tag LOCUS_02400 288369 289508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 289564 291243 gene locus_tag LOCUS_02410 289564 291243 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_02410 291255 292118 gene locus_tag LOCUS_02420 291255 292118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 293744 292122 gene locus_tag LOCUS_02430 293744 292122 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730448.1 protein_id gnl|my_center|LOCUS_02430 293837 295378 gene locus_tag LOCUS_02440 293837 295378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 295457 297328 gene locus_tag LOCUS_02450 295457 297328 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_02450 297335 298798 gene locus_tag LOCUS_02460 gene rimO 297335 298798 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_02460 298798 299736 gene locus_tag LOCUS_02470 gene ribF 298798 299736 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_02470 299764 300093 gene locus_tag LOCUS_02480 gene trxA 299764 300093 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_02480 300116 301342 gene locus_tag LOCUS_02490 300116 301342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 302870 301389 gene locus_tag LOCUS_02500 gene guaB 302870 301389 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256512.1 protein_id gnl|my_center|LOCUS_02500 303987 302944 gene locus_tag LOCUS_02510 303987 302944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 305777 303987 gene locus_tag LOCUS_02520 305777 303987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 304139 304148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 306854 305940 gene locus_tag LOCUS_02530 306854 305940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 308438 306927 gene locus_tag LOCUS_02540 308438 306927 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_02540 308978 310417 gene locus_tag LOCUS_02550 308978 310417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 310468 310761 gene locus_tag LOCUS_02560 310468 310761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 310769 311896 gene locus_tag LOCUS_02570 310769 311896 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_02570 311893 313131 gene locus_tag LOCUS_02580 311893 313131 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144295.1 protein_id gnl|my_center|LOCUS_02580 313128 314093 gene locus_tag LOCUS_02590 313128 314093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 314090 315418 gene locus_tag LOCUS_02600 314090 315418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 315534 316328 gene locus_tag LOCUS_02610 315534 316328 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_02610 316349 316855 gene locus_tag LOCUS_02620 316349 316855 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243065.1 protein_id gnl|my_center|LOCUS_02620 316852 317955 gene locus_tag LOCUS_02630 gene queG 316852 317955 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 protein_id gnl|my_center|LOCUS_02630 318164 320227 gene locus_tag LOCUS_02640 318164 320227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 320258 320581 gene locus_tag LOCUS_02650 320258 320581 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_02650 320644 321057 gene locus_tag LOCUS_02660 320644 321057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 321062 321259 gene locus_tag LOCUS_02670 321062 321259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 321333 322460 gene locus_tag LOCUS_02680 gene lpxB 321333 322460 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_02680 322466 323335 gene locus_tag LOCUS_02690 322466 323335 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_02690 323346 324044 gene locus_tag LOCUS_02700 gene gmk 323346 324044 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_02700 324022 324294 gene locus_tag LOCUS_02710 324022 324294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 324307 325539 gene locus_tag LOCUS_02720 gene coaBC 324307 325539 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_02720 325536 326234 gene locus_tag LOCUS_02730 325536 326234 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_02730 326246 327319 gene locus_tag LOCUS_02740 326246 327319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 328035 327295 gene locus_tag LOCUS_02750 328035 327295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 329312 328032 gene locus_tag LOCUS_02760 329312 328032 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_02760 330338 329319 gene locus_tag LOCUS_02770 330338 329319 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_02770 332211 330403 gene locus_tag LOCUS_02780 332211 330403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 332469 333512 gene locus_tag LOCUS_02790 332469 333512 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_02790 333528 335234 gene locus_tag LOCUS_02800 333528 335234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 335252 336772 gene locus_tag LOCUS_02810 335252 336772 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_02810 337680 336778 gene locus_tag LOCUS_02820 gene speB 337680 336778 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_02820 337866 338585 gene locus_tag LOCUS_02830 gene radC 337866 338585 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_02830 338653 339810 gene locus_tag LOCUS_02840 gene larC 338653 339810 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_02840 342155 339879 gene locus_tag LOCUS_02850 gene pnp 342155 339879 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_02850 342599 342330 gene locus_tag LOCUS_02860 gene rpsO 342599 342330 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 protein_id gnl|my_center|LOCUS_02860 343668 342721 gene locus_tag LOCUS_02870 343668 342721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 344660 343665 gene locus_tag LOCUS_02880 344660 343665 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_02880 344992 344657 gene locus_tag LOCUS_02890 gene rbfA 344992 344657 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_02890 347413 344999 gene locus_tag LOCUS_02900 347413 344999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 348930 347473 gene locus_tag LOCUS_02910 348930 347473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 349407 348946 gene locus_tag LOCUS_02920 gene rimP 349407 348946 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_02920 349845 351356 gene locus_tag LOCUS_02930 349845 351356 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_02930 351379 352746 gene locus_tag LOCUS_02940 351379 352746 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_02940 352743 353186 gene locus_tag LOCUS_02950 352743 353186 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_02950 353234 355912 gene locus_tag LOCUS_02960 353234 355912 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_02960 355925 356743 gene locus_tag LOCUS_02970 355925 356743 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931747.1 protein_id gnl|my_center|LOCUS_02970 356756 357439 gene locus_tag LOCUS_02980 356756 357439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 357959 357441 gene locus_tag LOCUS_02990 357959 357441 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418920.1 protein_id gnl|my_center|LOCUS_02990 360033 357976 gene locus_tag LOCUS_03000 360033 357976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 360344 360162 gene locus_tag LOCUS_03010 360344 360162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 361624 360596 gene locus_tag LOCUS_03020 361624 360596 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_03020 363161 361944 gene locus_tag LOCUS_03030 gene nqrF 363161 361944 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_03030 363775 363158 gene locus_tag LOCUS_03040 gene nqrE 363775 363158 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_03040 364415 363789 gene locus_tag LOCUS_03050 364415 363789 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_03050 365194 364415 gene locus_tag LOCUS_03060 365194 364415 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 protein_id gnl|my_center|LOCUS_03060 366486 365221 gene locus_tag LOCUS_03070 366486 365221 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_03070 367935 366493 gene locus_tag LOCUS_03080 367935 366493 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 protein_id gnl|my_center|LOCUS_03080 368651 368085 gene locus_tag LOCUS_03090 gene nfuA 368651 368085 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_03090 368684 369475 gene locus_tag LOCUS_03100 368684 369475 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_03100 369494 370255 gene locus_tag LOCUS_03110 369494 370255 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_03110 370286 373243 gene locus_tag LOCUS_03120 370286 373243 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_03120 373321 374547 gene locus_tag LOCUS_03130 373321 374547 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_03130 374630 375616 gene locus_tag LOCUS_03140 374630 375616 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 protein_id gnl|my_center|LOCUS_03140 375613 377772 gene locus_tag LOCUS_03150 375613 377772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 379060 377756 gene locus_tag LOCUS_03160 379060 377756 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_03160 379880 379053 gene locus_tag LOCUS_03170 379880 379053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 379970 381010 gene locus_tag LOCUS_03180 379970 381010 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_03180 381712 381023 gene locus_tag LOCUS_03190 381712 381023 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_03190 384266 381750 gene locus_tag LOCUS_03200 384266 381750 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092974.1 protein_id gnl|my_center|LOCUS_03200 385045 384320 gene locus_tag LOCUS_03210 385045 384320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 386055 385042 gene locus_tag LOCUS_03220 gene cofD 386055 385042 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_03220 386830 386069 gene locus_tag LOCUS_03230 gene cofE 386830 386069 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_03230 387626 386922 gene locus_tag LOCUS_03240 gene npdG 387626 386922 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_03240 388532 387735 gene locus_tag LOCUS_03250 388532 387735 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_03250 388640 389251 gene locus_tag LOCUS_03260 388640 389251 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_03260 390526 389267 gene locus_tag LOCUS_03270 390526 389267 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_03270 390599 391528 gene locus_tag LOCUS_03280 390599 391528 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_03280 391533 391997 gene locus_tag LOCUS_03290 391533 391997 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_03290 392015 393385 gene locus_tag LOCUS_03300 gene mgtE 392015 393385 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_03300 393405 394169 gene locus_tag LOCUS_03310 393405 394169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 394268 396007 gene locus_tag LOCUS_03320 gene mutL 394268 396007 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_03320 396636 396010 gene locus_tag LOCUS_03330 396636 396010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 397991 396693 gene locus_tag LOCUS_03340 gene asnS 397991 396693 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_03340 398068 398559 gene locus_tag LOCUS_03350 398068 398559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 398556 399029 gene locus_tag LOCUS_03360 398556 399029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 399070 399528 gene locus_tag LOCUS_03370 399070 399528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 400048 399545 gene locus_tag LOCUS_03380 400048 399545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 400837 400052 gene locus_tag LOCUS_03390 400837 400052 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_03390 402238 400919 gene locus_tag LOCUS_03400 gene gntT 402238 400919 CDS product guanitoxin biosynthesis MATE family efflux transporter GntT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_03400 402275 402859 gene locus_tag LOCUS_03410 402275 402859 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_03410 402856 404175 gene locus_tag LOCUS_03420 402856 404175 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_03420 406743 404188 gene locus_tag LOCUS_03430 406743 404188 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_03430 406794 408098 gene locus_tag LOCUS_03440 406794 408098 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_03440 409226 408105 gene locus_tag LOCUS_03450 409226 408105 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_03450 410222 409269 gene locus_tag LOCUS_03460 gene trxB 410222 409269 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_03460 410989 410219 gene locus_tag LOCUS_03470 gene pssA 410989 410219 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_03470 411684 410986 gene locus_tag LOCUS_03480 411684 410986 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_03480 411939 411712 gene locus_tag LOCUS_03490 411939 411712 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_03490 412649 411936 gene locus_tag LOCUS_03500 gene tsaB 412649 411936 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_03500 412770 415397 gene locus_tag LOCUS_03510 gene mutS 412770 415397 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_03510 415837 415394 gene locus_tag LOCUS_03520 415837 415394 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_03520 416089 415856 gene locus_tag LOCUS_03530 416089 415856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 416010 416447 gene locus_tag LOCUS_03540 gene dtd 416010 416447 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_03540 416714 416448 gene locus_tag LOCUS_03550 416714 416448 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_03550 416858 418939 gene locus_tag LOCUS_03560 416858 418939 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_03560 418959 419732 gene locus_tag LOCUS_03570 418959 419732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 419732 420637 gene locus_tag LOCUS_03580 gene ispE 419732 420637 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_03580 420654 420728 gene locus_tag LOCUS_t00020 420654 420728 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 420837 421811 gene locus_tag LOCUS_03590 420837 421811 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_03590 421838 422506 gene locus_tag LOCUS_03600 421838 422506 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_03600 422493 423083 gene locus_tag LOCUS_03610 gene pth 422493 423083 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_03610 423097 425169 gene locus_tag LOCUS_03620 423097 425169 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_03620 425324 425710 gene locus_tag LOCUS_03630 gene rpsF 425324 425710 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831345.1 protein_id gnl|my_center|LOCUS_03630 425713 425943 gene locus_tag LOCUS_03640 gene rpsR 425713 425943 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090471.1 protein_id gnl|my_center|LOCUS_03640 425986 426432 gene locus_tag LOCUS_03650 gene rplI 425986 426432 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_03650 426584 427654 gene locus_tag LOCUS_03660 426584 427654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 430140 427651 gene locus_tag LOCUS_03670 430140 427651 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_03670 430167 430634 gene locus_tag LOCUS_03680 430167 430634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 430636 432711 gene locus_tag LOCUS_03690 gene uvrB 430636 432711 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 protein_id gnl|my_center|LOCUS_03690 432711 434522 gene locus_tag LOCUS_03700 gene uvrC 432711 434522 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404327.1 protein_id gnl|my_center|LOCUS_03700 434918 435892 gene locus_tag LOCUS_03710 434918 435892 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_03710 435908 438046 gene locus_tag LOCUS_03720 gene recG 435908 438046 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_03720 438043 439242 gene locus_tag LOCUS_03730 438043 439242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 439239 440033 gene locus_tag LOCUS_03740 439239 440033 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_03740 440030 440647 gene locus_tag LOCUS_03750 gene scpB 440030 440647 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_03750 440640 441470 gene locus_tag LOCUS_03760 440640 441470 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_03760 441467 442135 gene locus_tag LOCUS_03770 gene cmk 441467 442135 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_03770 442132 445596 gene locus_tag LOCUS_03780 442132 445596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 447146 445557 gene locus_tag LOCUS_03790 447146 445557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 447227 448063 gene locus_tag LOCUS_03800 447227 448063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 448134 449138 gene locus_tag LOCUS_03810 448134 449138 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_03810 449402 449142 gene locus_tag LOCUS_03820 449402 449142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 449518 449593 gene locus_tag LOCUS_t00030 449518 449593 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 449661 450128 gene locus_tag LOCUS_03830 449661 450128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 451087 450092 gene locus_tag LOCUS_03840 451087 450092 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_03840 451614 451084 gene locus_tag LOCUS_03850 gene lspA 451614 451084 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_03850 452285 451647 gene locus_tag LOCUS_03860 gene thiE 452285 451647 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_03860 454460 452325 gene locus_tag LOCUS_03870 454460 452325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 454737 455210 gene locus_tag LOCUS_03880 454737 455210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 455246 455749 gene locus_tag LOCUS_03890 455246 455749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 455852 457267 gene locus_tag LOCUS_03900 gene cysS 455852 457267 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_03900 457276 457692 gene locus_tag LOCUS_03910 457276 457692 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_03910 457792 457866 gene locus_tag LOCUS_t00040 457792 457866 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 457909 457983 gene locus_tag LOCUS_t00050 457909 457983 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 458007 458094 gene locus_tag LOCUS_t00060 458007 458094 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 458153 458398 gene locus_tag LOCUS_03920 458153 458398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 458395 460323 gene locus_tag LOCUS_03930 gene feoB 458395 460323 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_03930 461116 460331 gene locus_tag LOCUS_03940 461116 460331 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_03940 462103 461156 gene locus_tag LOCUS_03950 462103 461156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 462393 463763 gene locus_tag LOCUS_03960 gene dnaB 462393 463763 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_03960 463826 464983 gene locus_tag LOCUS_03970 gene alr 463826 464983 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_03970 465791 464916 gene locus_tag LOCUS_03980 465791 464916 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_03980 465898 467514 gene locus_tag LOCUS_03990 465898 467514 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_03990 467724 469415 gene locus_tag LOCUS_04000 467724 469415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 469594 469509 gene locus_tag LOCUS_t00070 469594 469509 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 469917 470432 gene locus_tag LOCUS_04010 469917 470432 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_04010 470746 473199 gene locus_tag LOCUS_04020 470746 473199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 473214 474947 gene locus_tag LOCUS_04030 gene recJ 473214 474947 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_04030 474944 477157 gene locus_tag LOCUS_04040 474944 477157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 477154 477897 gene locus_tag LOCUS_04050 gene lptB 477154 477897 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_04050 477974 479536 gene locus_tag LOCUS_04060 gene rpoN 477974 479536 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 protein_id gnl|my_center|LOCUS_04060 479562 480017 gene locus_tag LOCUS_04070 479562 480017 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_04070 480019 480906 gene locus_tag LOCUS_04080 gene rapZ 480019 480906 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_04080 480903 481334 gene locus_tag LOCUS_04090 480903 481334 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_04090 481331 481600 gene locus_tag LOCUS_04100 481331 481600 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_04100 481597 483366 gene locus_tag LOCUS_04110 gene ptsP 481597 483366 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_04110 483429 484775 gene locus_tag LOCUS_04120 gene miaB 483429 484775 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_04120 484781 485365 gene locus_tag LOCUS_04130 484781 485365 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_04130 485373 486254 gene locus_tag LOCUS_04140 485373 486254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 486327 488762 gene locus_tag LOCUS_04150 486327 488762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 489914 488778 gene locus_tag LOCUS_04160 gene metK 489914 488778 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_04160 490036 490860 gene locus_tag LOCUS_04170 490036 490860 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_04170 491826 490906 gene locus_tag LOCUS_04180 491826 490906 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_04180 492677 491835 gene locus_tag LOCUS_04190 492677 491835 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_04190 492710 493516 gene locus_tag LOCUS_04200 gene tolQ 492710 493516 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_04200 493539 493958 gene locus_tag LOCUS_04210 gene tolR 493539 493958 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_04210 493973 494746 gene locus_tag LOCUS_04220 493973 494746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 494763 496145 gene locus_tag LOCUS_04230 gene tolB 494763 496145 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence02 224 1609 gene locus_tag LOCUS_04240 224 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1606 3108 gene locus_tag LOCUS_04250 1606 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3110 3934 gene locus_tag LOCUS_04260 gene mutM 3110 3934 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_04260 5716 3938 gene locus_tag LOCUS_04270 5716 3938 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_04270 6564 5731 gene locus_tag LOCUS_04280 6564 5731 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_04280 6641 10084 gene locus_tag LOCUS_04290 6641 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10081 11052 gene locus_tag LOCUS_04300 10081 11052 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105584.1 protein_id gnl|my_center|LOCUS_04300 12407 11040 gene locus_tag LOCUS_04310 12407 11040 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_04310 12524 14164 gene locus_tag LOCUS_04320 12524 14164 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_04320 15583 14168 gene locus_tag LOCUS_04330 15583 14168 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_04330 15667 16242 gene locus_tag LOCUS_04340 gene nthB 15667 16242 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_04340 16239 16820 gene locus_tag LOCUS_04350 gene nthA 16239 16820 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_04350 16817 17200 gene locus_tag LOCUS_04360 16817 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 17197 18054 gene locus_tag LOCUS_04370 17197 18054 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_04370 18071 20284 gene locus_tag LOCUS_04380 18071 20284 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_04380 21432 20329 gene locus_tag LOCUS_04390 21432 20329 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_04390 22540 21698 gene locus_tag LOCUS_04400 22540 21698 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_04400 22905 22537 gene locus_tag LOCUS_04410 22905 22537 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_04410 22904 24172 gene locus_tag LOCUS_04420 22904 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 26087 24564 gene locus_tag LOCUS_04430 26087 24564 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_04430 26276 27574 gene locus_tag LOCUS_04440 26276 27574 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_04440 27646 29295 gene locus_tag LOCUS_04450 27646 29295 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730448.1 protein_id gnl|my_center|LOCUS_04450 31093 29333 gene locus_tag LOCUS_04460 31093 29333 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390124.1 protein_id gnl|my_center|LOCUS_04460 32032 31163 gene locus_tag LOCUS_04470 32032 31163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 32458 32045 gene locus_tag LOCUS_04480 32458 32045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 33123 32455 gene locus_tag LOCUS_04490 gene rpoE 33123 32455 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_04490 33222 34040 gene locus_tag LOCUS_04500 33222 34040 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_04500 34729 34037 gene locus_tag LOCUS_04510 34729 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 36774 35137 gene locus_tag LOCUS_04520 36774 35137 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_04520 36878 37960 gene locus_tag LOCUS_04530 36878 37960 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926062.1 protein_id gnl|my_center|LOCUS_04530 38281 37961 gene locus_tag LOCUS_04540 38281 37961 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_04540 38528 38292 gene locus_tag LOCUS_04550 38528 38292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 39218 38553 gene locus_tag LOCUS_04560 gene msrA 39218 38553 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_04560 40625 39243 gene locus_tag LOCUS_04570 40625 39243 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_04570 40763 42058 gene locus_tag LOCUS_04580 40763 42058 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_04580 42048 42413 gene locus_tag LOCUS_04590 42048 42413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 42421 44145 gene locus_tag LOCUS_04600 42421 44145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 45576 44152 gene locus_tag LOCUS_04610 45576 44152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 46982 45573 gene locus_tag LOCUS_04620 46982 45573 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_04620 47004 47726 gene locus_tag LOCUS_04630 47004 47726 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_04630 47723 49075 gene locus_tag LOCUS_04640 47723 49075 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_04640 50263 49076 gene locus_tag LOCUS_04650 50263 49076 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_04650 51702 50362 gene locus_tag LOCUS_04660 51702 50362 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_04660 53111 51771 gene locus_tag LOCUS_04670 53111 51771 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_04670 53216 55225 gene locus_tag LOCUS_04680 53216 55225 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_04680 55234 56823 gene locus_tag LOCUS_04690 55234 56823 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_04690 58952 56820 gene locus_tag LOCUS_04700 58952 56820 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_04700 59210 58992 gene locus_tag LOCUS_04710 59210 58992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 59197 60831 gene locus_tag LOCUS_04720 59197 60831 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537605.1 protein_id gnl|my_center|LOCUS_04720 60932 61714 gene locus_tag LOCUS_04730 60932 61714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 61879 63480 gene locus_tag LOCUS_04740 61879 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 63477 65114 gene locus_tag LOCUS_04750 63477 65114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 65754 65140 gene locus_tag LOCUS_04760 65754 65140 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_04760 65888 67486 gene locus_tag LOCUS_04770 65888 67486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 69814 67487 gene locus_tag LOCUS_04780 69814 67487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 72118 69818 gene locus_tag LOCUS_04790 72118 69818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 72602 72129 gene locus_tag LOCUS_04800 72602 72129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 73619 72621 gene locus_tag LOCUS_04810 73619 72621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479910.1 protein_id gnl|my_center|LOCUS_04810 74602 73625 gene locus_tag LOCUS_04820 74602 73625 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_04820 75875 74616 gene locus_tag LOCUS_04830 75875 74616 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_04830 77073 75880 gene locus_tag LOCUS_04840 77073 75880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 77571 77092 gene locus_tag LOCUS_04850 77571 77092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 78500 77568 gene locus_tag LOCUS_04860 78500 77568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 79459 78497 gene locus_tag LOCUS_04870 gene hflC 79459 78497 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_04870 82527 79456 gene locus_tag LOCUS_04880 82527 79456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 80211 80304 gene locus_tag LOCUS_t00080 80211 80304 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83388 82633 gene locus_tag LOCUS_04890 83388 82633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 86238 83392 gene locus_tag LOCUS_04900 86238 83392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 86338 88275 gene locus_tag LOCUS_04910 86338 88275 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_04910 88442 88272 gene locus_tag LOCUS_04920 88442 88272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 88562 88846 gene locus_tag LOCUS_04930 88562 88846 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_04930 88873 89115 gene locus_tag LOCUS_04940 88873 89115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 89137 90252 gene locus_tag LOCUS_04950 89137 90252 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_04950 90988 90257 gene locus_tag LOCUS_04960 90988 90257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 91912 91076 gene locus_tag LOCUS_04970 91912 91076 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_04970 93119 91929 gene locus_tag LOCUS_04980 93119 91929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 94238 93135 gene locus_tag LOCUS_04990 94238 93135 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_04990 94992 94213 gene locus_tag LOCUS_05000 94992 94213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_05000 96805 95138 gene locus_tag LOCUS_05010 96805 95138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 97018 99864 gene locus_tag LOCUS_05020 97018 99864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 99877 100410 gene locus_tag LOCUS_05030 99877 100410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 100459 100845 gene locus_tag LOCUS_05040 100459 100845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 100870 102249 gene locus_tag LOCUS_05050 100870 102249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 102714 102265 gene locus_tag LOCUS_05060 102714 102265 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_05060 103088 102711 gene locus_tag LOCUS_05070 103088 102711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 103088 104335 gene locus_tag LOCUS_05080 103088 104335 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_05080 104332 105282 gene locus_tag LOCUS_05090 104332 105282 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05090 105512 107302 gene locus_tag LOCUS_05100 105512 107302 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_05100 108648 107299 gene locus_tag LOCUS_05110 108648 107299 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_05110 108635 109597 gene locus_tag LOCUS_05120 108635 109597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 109615 110646 gene locus_tag LOCUS_05130 109615 110646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 113389 110657 gene locus_tag LOCUS_05140 113389 110657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_05140 115419 113404 gene locus_tag LOCUS_05150 115419 113404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05150 116119 115385 gene locus_tag LOCUS_05160 116119 115385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 116478 116137 gene locus_tag LOCUS_05170 116478 116137 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_05170 116521 117192 gene locus_tag LOCUS_05180 116521 117192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_05180 117192 118445 gene locus_tag LOCUS_05190 117192 118445 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_05190 118633 118457 gene locus_tag LOCUS_05200 118633 118457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 119553 118630 gene locus_tag LOCUS_05210 119553 118630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 120646 119543 gene locus_tag LOCUS_05220 120646 119543 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_05220 120768 122054 gene locus_tag LOCUS_05230 120768 122054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 123517 122051 gene locus_tag LOCUS_05240 123517 122051 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_05240 126785 123534 gene locus_tag LOCUS_05250 126785 123534 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_05250 126809 127351 gene locus_tag LOCUS_05260 126809 127351 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_05260 127409 127909 gene locus_tag LOCUS_05270 127409 127909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 128002 128229 gene locus_tag LOCUS_05280 128002 128229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 128201 128455 gene locus_tag LOCUS_05290 128201 128455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 130237 128465 gene locus_tag LOCUS_05300 130237 128465 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_05300 130307 133132 gene locus_tag LOCUS_05310 130307 133132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 133523 133134 gene locus_tag LOCUS_05320 133523 133134 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_05320 135124 133940 gene locus_tag LOCUS_05330 135124 133940 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_05330 136580 135210 gene locus_tag LOCUS_05340 136580 135210 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_05340 137736 136717 gene locus_tag LOCUS_05350 137736 136717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 139732 137750 gene locus_tag LOCUS_05360 139732 137750 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_05360 139769 140842 gene locus_tag LOCUS_05370 139769 140842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 140839 142179 gene locus_tag LOCUS_05380 140839 142179 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185271872.1 protein_id gnl|my_center|LOCUS_05380 142893 142189 gene locus_tag LOCUS_05390 142893 142189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 144179 142911 gene locus_tag LOCUS_05400 144179 142911 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_05400 145525 144176 gene locus_tag LOCUS_05410 145525 144176 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_05410 146654 145536 gene locus_tag LOCUS_05420 146654 145536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 147842 146688 gene locus_tag LOCUS_05430 147842 146688 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113220.1 protein_id gnl|my_center|LOCUS_05430 148932 147859 gene locus_tag LOCUS_05440 148932 147859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 149044 150132 gene locus_tag LOCUS_05450 149044 150132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 151368 150259 gene locus_tag LOCUS_05460 151368 150259 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_05460 151635 153236 gene locus_tag LOCUS_05470 gene ggt 151635 153236 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_05470 153247 157167 gene locus_tag LOCUS_05480 153247 157167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 159751 157172 gene locus_tag LOCUS_05490 gene ligD 159751 157172 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_05490 159832 160740 gene locus_tag LOCUS_05500 159832 160740 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_05500 161052 161429 gene locus_tag LOCUS_05510 161052 161429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 161471 162022 gene locus_tag LOCUS_05520 161471 162022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 162022 163503 gene locus_tag LOCUS_05530 162022 163503 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_05530 164742 163633 gene locus_tag LOCUS_05540 164742 163633 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385032.1 protein_id gnl|my_center|LOCUS_05540 164899 165510 gene locus_tag LOCUS_05550 164899 165510 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 protein_id gnl|my_center|LOCUS_05550 165551 167254 gene locus_tag LOCUS_05560 165551 167254 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_05560 167267 167929 gene locus_tag LOCUS_05570 167267 167929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 167941 168228 gene locus_tag LOCUS_05580 167941 168228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 169503 168229 gene locus_tag LOCUS_05590 169503 168229 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_05590 169528 170913 gene locus_tag LOCUS_05600 169528 170913 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_05600 170915 171814 gene locus_tag LOCUS_05610 170915 171814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_05610 171848 172393 gene locus_tag LOCUS_05620 171848 172393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 172482 173594 gene locus_tag LOCUS_05630 172482 173594 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_05630 173617 174567 gene locus_tag LOCUS_05640 gene nudC 173617 174567 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_05640 174684 175733 gene locus_tag LOCUS_05650 gene moaA 174684 175733 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_05650 175833 176876 gene locus_tag LOCUS_05660 gene fni 175833 176876 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_05660 176869 178146 gene locus_tag LOCUS_05670 gene hmgA 176869 178146 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_05670 178377 179507 gene locus_tag LOCUS_05680 178377 179507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 179520 180572 gene locus_tag LOCUS_05690 gene mvaD 179520 180572 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_05690 180569 181450 gene locus_tag LOCUS_05700 180569 181450 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_05700 181437 182114 gene locus_tag LOCUS_05710 181437 182114 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_05710 182620 182111 gene locus_tag LOCUS_05720 182620 182111 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_05720 184149 182611 gene locus_tag LOCUS_05730 gene accC 184149 182611 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_05730 184304 185593 gene locus_tag LOCUS_05740 184304 185593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_05740 185595 186335 gene locus_tag LOCUS_05750 185595 186335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 186343 187656 gene locus_tag LOCUS_05760 186343 187656 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841575.1 protein_id gnl|my_center|LOCUS_05760 187664 188548 gene locus_tag LOCUS_05770 187664 188548 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_05770 189502 188456 gene locus_tag LOCUS_05780 189502 188456 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_05780 189626 191056 gene locus_tag LOCUS_05790 189626 191056 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_05790 191053 192480 gene locus_tag LOCUS_05800 191053 192480 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_05800 192477 193268 gene locus_tag LOCUS_05810 192477 193268 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_05810 193284 193778 gene locus_tag LOCUS_05820 193284 193778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 193775 194791 gene locus_tag LOCUS_05830 193775 194791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 194788 196482 gene locus_tag LOCUS_05840 194788 196482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 197816 196479 gene locus_tag LOCUS_05850 gene selA 197816 196479 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_05850 197902 199017 gene locus_tag LOCUS_05860 197902 199017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 200449 199031 gene locus_tag LOCUS_05870 200449 199031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 201786 200446 gene locus_tag LOCUS_05880 201786 200446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 202007 203593 gene locus_tag LOCUS_05890 202007 203593 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_05890 203657 204166 gene locus_tag LOCUS_05900 gene purE 203657 204166 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404367.1 protein_id gnl|my_center|LOCUS_05900 204163 204405 gene locus_tag LOCUS_05910 204163 204405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 204414 204851 gene locus_tag LOCUS_05920 gene rpiB 204414 204851 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_05920 206201 204873 gene locus_tag LOCUS_05930 206201 204873 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_05930 206232 206996 gene locus_tag LOCUS_05940 206232 206996 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_05940 207016 207531 gene locus_tag LOCUS_05950 gene ruvC 207016 207531 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_05950 207698 208363 gene locus_tag LOCUS_05960 207698 208363 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_05960 208399 208827 gene locus_tag LOCUS_05970 208399 208827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 208882 209319 gene locus_tag LOCUS_05980 208882 209319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 209413 210156 gene locus_tag LOCUS_05990 209413 210156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 210239 211351 gene locus_tag LOCUS_06000 210239 211351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921032.1 protein_id gnl|my_center|LOCUS_06000 211643 212386 gene locus_tag LOCUS_06010 211643 212386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 212387 213559 gene locus_tag LOCUS_06020 212387 213559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 215058 213556 gene locus_tag LOCUS_06030 gene gatB 215058 213556 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_06030 215061 215765 gene locus_tag LOCUS_06040 215061 215765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 216064 215762 gene locus_tag LOCUS_06050 216064 215762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 216198 217136 gene locus_tag LOCUS_06060 216198 217136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 217181 217375 gene locus_tag LOCUS_06070 217181 217375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 218137 217388 gene locus_tag LOCUS_06080 218137 217388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 218583 218290 gene locus_tag LOCUS_06090 218583 218290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 219581 218712 gene locus_tag LOCUS_06100 219581 218712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 220231 219578 gene locus_tag LOCUS_06110 gene rpe 220231 219578 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_06110 221044 220265 gene locus_tag LOCUS_06120 221044 220265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 222368 221058 gene locus_tag LOCUS_06130 gene rseP 222368 221058 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_06130 223408 222380 gene locus_tag LOCUS_06140 gene dxr 223408 222380 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919783.1 protein_id gnl|my_center|LOCUS_06140 223298 223618 gene locus_tag LOCUS_06150 223298 223618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 224421 223573 gene locus_tag LOCUS_06160 224421 223573 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_06160 225176 224418 gene locus_tag LOCUS_06170 gene truA 225176 224418 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_06170 226597 225173 gene locus_tag LOCUS_06180 226597 225173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 226611 228098 gene locus_tag LOCUS_06190 226611 228098 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_06190 228109 228684 gene locus_tag LOCUS_06200 228109 228684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 228736 229239 gene locus_tag LOCUS_06210 228736 229239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 229316 230608 gene locus_tag LOCUS_06220 gene glmU 229316 230608 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 protein_id gnl|my_center|LOCUS_06220 230613 232937 gene locus_tag LOCUS_06230 230613 232937 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_06230 232977 233052 gene locus_tag LOCUS_t00090 232977 233052 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 233101 233177 gene locus_tag LOCUS_t00100 233101 233177 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 233209 233284 gene locus_tag LOCUS_t00110 233209 233284 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 233312 233388 gene locus_tag LOCUS_t00120 233312 233388 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 233412 234500 gene locus_tag LOCUS_06240 gene waaC 233412 234500 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_06240 234513 234767 gene locus_tag LOCUS_06250 234513 234767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 234783 235349 gene locus_tag LOCUS_06260 234783 235349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 235346 236026 gene locus_tag LOCUS_06270 235346 236026 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_06270 237059 236130 gene locus_tag LOCUS_06280 237059 236130 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_06280 237400 238998 gene locus_tag LOCUS_06290 237400 238998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 239048 240394 gene locus_tag LOCUS_06300 239048 240394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 240449 241111 gene locus_tag LOCUS_06310 240449 241111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 241589 242095 gene locus_tag LOCUS_06320 241589 242095 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06320 242114 242629 gene locus_tag LOCUS_06330 242114 242629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 242702 243565 gene locus_tag LOCUS_06340 gene ispH 242702 243565 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_06340 243691 244857 gene locus_tag LOCUS_06350 gene purD 243691 244857 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_06350 244854 245579 gene locus_tag LOCUS_06360 244854 245579 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_06360 247124 245685 gene locus_tag LOCUS_06370 247124 245685 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_06370 249302 247155 gene locus_tag LOCUS_06380 249302 247155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 250207 249299 gene locus_tag LOCUS_06390 250207 249299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_06390 251241 250204 gene locus_tag LOCUS_06400 251241 250204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 253004 251238 gene locus_tag LOCUS_06410 253004 251238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 253163 254455 gene locus_tag LOCUS_06420 gene serS 253163 254455 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_06420 254481 254571 gene locus_tag LOCUS_t00130 254481 254571 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 256959 254605 gene locus_tag LOCUS_06430 256959 254605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 257060 257230 gene locus_tag LOCUS_06440 257060 257230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 257422 258333 gene locus_tag LOCUS_06450 257422 258333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 259588 258317 gene locus_tag LOCUS_06460 259588 258317 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027989172.1 protein_id gnl|my_center|LOCUS_06460 260019 259585 gene locus_tag LOCUS_06470 260019 259585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence03 549 1328 gene locus_tag LOCUS_06480 549 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1357 4740 gene locus_tag LOCUS_06490 gene ileS 1357 4740 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_06490 4775 6154 gene locus_tag LOCUS_06500 4775 6154 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_06500 6932 6243 gene locus_tag LOCUS_06510 6932 6243 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_06510 7095 7733 gene locus_tag LOCUS_06520 7095 7733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948360.1 protein_id gnl|my_center|LOCUS_06520 7854 8201 gene locus_tag LOCUS_06530 7854 8201 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 protein_id gnl|my_center|LOCUS_06530 8625 8260 gene locus_tag LOCUS_06540 8625 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 9448 8855 gene locus_tag LOCUS_06550 9448 8855 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_06550 9575 9964 gene locus_tag LOCUS_06560 9575 9964 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_06560 11913 9961 gene locus_tag LOCUS_06570 11913 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 12671 11982 gene locus_tag LOCUS_06580 gene moaD 12671 11982 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417290.1 protein_id gnl|my_center|LOCUS_06580 12732 13436 gene locus_tag LOCUS_06590 12732 13436 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_06590 13433 14407 gene locus_tag LOCUS_06600 13433 14407 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_06600 14490 14726 gene locus_tag LOCUS_06610 14490 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 14730 15116 gene locus_tag LOCUS_06620 14730 15116 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_06620 15272 16228 gene locus_tag LOCUS_06630 15272 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_06630 16316 18031 gene locus_tag LOCUS_06640 16316 18031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_06640 18132 19280 gene locus_tag LOCUS_06650 18132 19280 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_06650 19277 22183 gene locus_tag LOCUS_06660 19277 22183 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_06660 23774 22323 gene locus_tag LOCUS_06670 gene moeB 23774 22323 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_06670 24271 23813 gene locus_tag LOCUS_06680 24271 23813 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_06680 25283 24279 gene locus_tag LOCUS_06690 25283 24279 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_06690 25410 26036 gene locus_tag LOCUS_06700 25410 26036 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227865.1 protein_id gnl|my_center|LOCUS_06700 26480 26022 gene locus_tag LOCUS_06710 gene argR 26480 26022 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_06710 27982 26477 gene locus_tag LOCUS_06720 gene argH 27982 26477 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_06720 29157 27979 gene locus_tag LOCUS_06730 29157 27979 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_06730 30022 29165 gene locus_tag LOCUS_06740 gene argB 30022 29165 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_06740 31239 30037 gene locus_tag LOCUS_06750 gene argJ 31239 30037 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_06750 32276 31236 gene locus_tag LOCUS_06760 gene argC 32276 31236 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_06760 33179 32334 gene locus_tag LOCUS_06770 33179 32334 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_06770 33472 33179 gene locus_tag LOCUS_06780 33472 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 34848 33496 gene locus_tag LOCUS_06790 gene xseA 34848 33496 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_06790 35417 34869 gene locus_tag LOCUS_06800 35417 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 36151 35519 gene locus_tag LOCUS_06810 36151 35519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 38700 36190 gene locus_tag LOCUS_06820 38700 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 39128 38718 gene locus_tag LOCUS_06830 39128 38718 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_06830 40188 39172 gene locus_tag LOCUS_06840 gene mltG 40188 39172 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_06840 40658 40245 gene locus_tag LOCUS_06850 gene ruvX 40658 40245 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_06850 40749 43097 gene locus_tag LOCUS_06860 gene lptD 40749 43097 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_06860 43094 43972 gene locus_tag LOCUS_06870 gene rfbD 43094 43972 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_06870 43969 44907 gene locus_tag LOCUS_06880 43969 44907 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_06880 45482 44904 gene locus_tag LOCUS_06890 45482 44904 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015559.1 protein_id gnl|my_center|LOCUS_06890 46438 45545 gene locus_tag LOCUS_06900 46438 45545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 47454 46474 gene locus_tag LOCUS_06910 47454 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 48758 47451 gene locus_tag LOCUS_06920 48758 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 50029 48755 gene locus_tag LOCUS_06930 50029 48755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 51949 50075 gene locus_tag LOCUS_06940 51949 50075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 52226 54163 gene locus_tag LOCUS_06950 52226 54163 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_06950 55437 54184 gene locus_tag LOCUS_06960 55437 54184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 56728 55478 gene locus_tag LOCUS_06970 gene ftsA 56728 55478 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_06970 57644 56748 gene locus_tag LOCUS_06980 57644 56748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 59104 57686 gene locus_tag LOCUS_06990 gene murC 59104 57686 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_06990 60228 59107 gene locus_tag LOCUS_07000 gene murG 60228 59107 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_07000 61301 60225 gene locus_tag LOCUS_07010 gene ftsW 61301 60225 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_07010 62748 61294 gene locus_tag LOCUS_07020 gene murD 62748 61294 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_07020 63828 62752 gene locus_tag LOCUS_07030 gene mraY 63828 62752 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_07030 65273 63828 gene locus_tag LOCUS_07040 65273 63828 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_07040 66883 65303 gene locus_tag LOCUS_07050 66883 65303 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_07050 68649 66859 gene locus_tag LOCUS_07060 68649 66859 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07060 69092 68706 gene locus_tag LOCUS_07070 69092 68706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 70089 69118 gene locus_tag LOCUS_07080 gene rsmH 70089 69118 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_07080 70565 70095 gene locus_tag LOCUS_07090 gene mraZ 70565 70095 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_07090 71905 70745 gene locus_tag LOCUS_07100 71905 70745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 72737 71916 gene locus_tag LOCUS_07110 72737 71916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 76228 72734 gene locus_tag LOCUS_07120 gene mfd 76228 72734 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_07120 76596 76246 gene locus_tag LOCUS_07130 76596 76246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 76687 76763 gene locus_tag LOCUS_t00140 76687 76763 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77997 76909 gene locus_tag LOCUS_07140 77997 76909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 79197 78022 gene locus_tag LOCUS_07150 79197 78022 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_07150 80902 79214 gene locus_tag LOCUS_07160 80902 79214 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_07160 81993 80899 gene locus_tag LOCUS_07170 81993 80899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_07170 82987 82037 gene locus_tag LOCUS_07180 82987 82037 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_07180 83375 83103 gene locus_tag LOCUS_07190 83375 83103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 84343 83378 gene locus_tag LOCUS_07200 gene ilvA 84343 83378 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_07200 84373 85320 gene locus_tag LOCUS_07210 84373 85320 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_07210 87046 85598 gene locus_tag LOCUS_07220 gene panF 87046 85598 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937399.1 protein_id gnl|my_center|LOCUS_07220 87130 88743 gene locus_tag LOCUS_07230 87130 88743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 88774 89829 gene locus_tag LOCUS_07240 88774 89829 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_07240 89832 90902 gene locus_tag LOCUS_07250 89832 90902 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_07250 90908 91657 gene locus_tag LOCUS_07260 90908 91657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_07260 91654 92139 gene locus_tag LOCUS_07270 91654 92139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 92152 93432 gene locus_tag LOCUS_07280 92152 93432 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_07280 93446 94417 gene locus_tag LOCUS_07290 93446 94417 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_07290 94463 95368 gene locus_tag LOCUS_07300 94463 95368 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_07300 95503 98289 gene locus_tag LOCUS_07310 95503 98289 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_07310 98627 101056 gene locus_tag LOCUS_07320 98627 101056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 101053 102882 gene locus_tag LOCUS_07330 101053 102882 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07330 102979 105099 gene locus_tag LOCUS_07340 102979 105099 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792117.1 protein_id gnl|my_center|LOCUS_07340 105193 115425 gene locus_tag LOCUS_07350 105193 115425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 115763 115392 gene locus_tag LOCUS_07360 115763 115392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 118238 116289 gene locus_tag LOCUS_07370 118238 116289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 118879 118238 gene locus_tag LOCUS_07380 118879 118238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 119516 118908 gene locus_tag LOCUS_07390 119516 118908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 121850 119517 gene locus_tag LOCUS_07400 121850 119517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 123178 121850 gene locus_tag LOCUS_07410 123178 121850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 123442 123179 gene locus_tag LOCUS_07420 123442 123179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 124206 123742 gene locus_tag LOCUS_07430 124206 123742 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_07430 125058 124219 gene locus_tag LOCUS_07440 125058 124219 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117548.1 protein_id gnl|my_center|LOCUS_07440 125860 125060 gene locus_tag LOCUS_07450 125860 125060 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077174050.1 protein_id gnl|my_center|LOCUS_07450 126873 125878 gene locus_tag LOCUS_07460 126873 125878 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_07460 127673 126873 gene locus_tag LOCUS_07470 127673 126873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 127984 127775 gene locus_tag LOCUS_07480 127984 127775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 129543 127981 gene locus_tag LOCUS_07490 129543 127981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 131081 129543 gene locus_tag LOCUS_07500 131081 129543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_07500 131659 131078 gene locus_tag LOCUS_07510 131659 131078 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070988.1 protein_id gnl|my_center|LOCUS_07510 131960 131652 gene locus_tag LOCUS_07520 131960 131652 CDS product winged-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006249663.1 protein_id gnl|my_center|LOCUS_07520 132307 131957 gene locus_tag LOCUS_07530 132307 131957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 132909 132304 gene locus_tag LOCUS_07540 132909 132304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 133254 132922 gene locus_tag LOCUS_07550 133254 132922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 133793 133251 gene locus_tag LOCUS_07560 133793 133251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 134425 133790 gene locus_tag LOCUS_07570 134425 133790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 134316 134834 gene locus_tag LOCUS_07580 134316 134834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 135243 134797 gene locus_tag LOCUS_07590 135243 134797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 135535 135236 gene locus_tag LOCUS_07600 135535 135236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 136412 135552 gene locus_tag LOCUS_07610 136412 135552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 136582 136409 gene locus_tag LOCUS_07620 136582 136409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 138180 136579 gene locus_tag LOCUS_07630 138180 136579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 138622 138185 gene locus_tag LOCUS_07640 138622 138185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 139365 138619 gene locus_tag LOCUS_07650 139365 138619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 139856 139362 gene locus_tag LOCUS_07660 139856 139362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 140047 139853 gene locus_tag LOCUS_07670 140047 139853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 140562 140044 gene locus_tag LOCUS_07680 140562 140044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 140833 140669 gene locus_tag LOCUS_07690 140833 140669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 142109 143320 gene locus_tag LOCUS_07700 142109 143320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 143570 144688 gene locus_tag LOCUS_07710 143570 144688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 144685 145041 gene locus_tag LOCUS_07720 144685 145041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 145041 146018 gene locus_tag LOCUS_07730 145041 146018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 146018 146335 gene locus_tag LOCUS_07740 146018 146335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 146335 146745 gene locus_tag LOCUS_07750 146335 146745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 146773 147315 gene locus_tag LOCUS_07760 146773 147315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 147315 147752 gene locus_tag LOCUS_07770 147315 147752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 147754 148788 gene locus_tag LOCUS_07780 147754 148788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 148802 149029 gene locus_tag LOCUS_07790 148802 149029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 149026 149502 gene locus_tag LOCUS_07800 149026 149502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 149499 149876 gene locus_tag LOCUS_07810 149499 149876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 149942 150187 gene locus_tag LOCUS_07820 149942 150187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 150187 152703 gene locus_tag LOCUS_07830 150187 152703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 152721 153065 gene locus_tag LOCUS_07840 152721 153065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 153062 155050 gene locus_tag LOCUS_07850 153062 155050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 155050 155766 gene locus_tag LOCUS_07860 155050 155766 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211708.1 protein_id gnl|my_center|LOCUS_07860 155763 157328 gene locus_tag LOCUS_07870 155763 157328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 157350 161837 gene locus_tag LOCUS_07880 157350 161837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 161950 162249 gene locus_tag LOCUS_07890 161950 162249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 162574 162350 gene locus_tag LOCUS_07900 162574 162350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 163152 162598 gene locus_tag LOCUS_07910 163152 162598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 163346 163149 gene locus_tag LOCUS_07920 163346 163149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 163710 163441 gene locus_tag LOCUS_07930 163710 163441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 164470 163715 gene locus_tag LOCUS_07940 164470 163715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 164697 164467 gene locus_tag LOCUS_07950 164697 164467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 166548 164824 gene locus_tag LOCUS_07960 166548 164824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 166663 169590 gene locus_tag LOCUS_07970 166663 169590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 169587 171167 gene locus_tag LOCUS_07980 169587 171167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_07980 171181 172875 gene locus_tag LOCUS_07990 171181 172875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 172892 173938 gene locus_tag LOCUS_08000 172892 173938 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_08000 176182 174038 gene locus_tag LOCUS_08010 176182 174038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 176897 176226 gene locus_tag LOCUS_08020 176897 176226 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_08020 178185 176926 gene locus_tag LOCUS_08030 178185 176926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 179445 178195 gene locus_tag LOCUS_08040 179445 178195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 180705 179455 gene locus_tag LOCUS_08050 180705 179455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 182035 180719 gene locus_tag LOCUS_08060 182035 180719 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_08060 183458 182067 gene locus_tag LOCUS_08070 183458 182067 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726822.1 protein_id gnl|my_center|LOCUS_08070 185435 183477 gene locus_tag LOCUS_08080 185435 183477 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_08080 188281 185432 gene locus_tag LOCUS_08090 188281 185432 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_08090 189933 188278 gene locus_tag LOCUS_08100 189933 188278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 191530 190049 gene locus_tag LOCUS_08110 191530 190049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 191611 192780 gene locus_tag LOCUS_08120 191611 192780 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_08120 192934 194004 gene locus_tag LOCUS_08130 192934 194004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_08130 194029 194721 gene locus_tag LOCUS_08140 194029 194721 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_08140 194711 195442 gene locus_tag LOCUS_08150 194711 195442 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_08150 195500 195751 gene locus_tag LOCUS_08160 195500 195751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 197310 195748 gene locus_tag LOCUS_08170 197310 195748 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_08170 198075 197356 gene locus_tag LOCUS_08180 198075 197356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 198459 198109 gene locus_tag LOCUS_08190 198459 198109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 198607 199743 gene locus_tag LOCUS_08200 198607 199743 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_08200 199772 201544 gene locus_tag LOCUS_08210 199772 201544 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_08210 201574 201861 gene locus_tag LOCUS_08220 201574 201861 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755918.1 protein_id gnl|my_center|LOCUS_08220 201876 203171 gene locus_tag LOCUS_08230 201876 203171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115906.1 protein_id gnl|my_center|LOCUS_08230 203283 203210 gene locus_tag LOCUS_t00150 203283 203210 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 204119 203319 gene locus_tag LOCUS_08240 204119 203319 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_08240 205285 204125 gene locus_tag LOCUS_08250 205285 204125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 205381 206925 gene locus_tag LOCUS_08260 205381 206925 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222576.1 protein_id gnl|my_center|LOCUS_08260 207028 207540 gene locus_tag LOCUS_08270 207028 207540 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_08270 207537 209765 gene locus_tag LOCUS_08280 207537 209765 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_08280 209772 210347 gene locus_tag LOCUS_08290 209772 210347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 210788 211639 gene locus_tag LOCUS_08300 210788 211639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 211687 212256 gene locus_tag LOCUS_08310 211687 212256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 212657 213136 gene locus_tag LOCUS_08320 212657 213136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 213133 213915 gene locus_tag LOCUS_08330 213133 213915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 214176 213937 gene locus_tag LOCUS_08340 214176 213937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 214189 214368 gene locus_tag LOCUS_08350 214189 214368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 214427 215989 gene locus_tag LOCUS_08360 214427 215989 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_08360 216034 217461 gene locus_tag LOCUS_08370 216034 217461 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence04 <1 702 gene locus_tag LOCUS_08380 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162491174.1:membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family 716 1771 gene locus_tag LOCUS_08390 716 1771 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_08390 1814 3022 gene locus_tag LOCUS_08400 gene soxC 1814 3022 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_08400 3009 3545 gene locus_tag LOCUS_08410 3009 3545 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_08410 5047 3554 gene locus_tag LOCUS_08420 5047 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5269 5991 gene locus_tag LOCUS_08430 5269 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 7375 6023 gene locus_tag LOCUS_08440 7375 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9030 7447 gene locus_tag LOCUS_08450 9030 7447 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 protein_id gnl|my_center|LOCUS_08450 9952 9047 gene locus_tag LOCUS_08460 9952 9047 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_08460 10791 9949 gene locus_tag LOCUS_08470 10791 9949 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063715.1 protein_id gnl|my_center|LOCUS_08470 10928 13468 gene locus_tag LOCUS_08480 10928 13468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_08480 14978 13458 gene locus_tag LOCUS_08490 14978 13458 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_08490 16456 14975 gene locus_tag LOCUS_08500 16456 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 17366 16443 gene locus_tag LOCUS_08510 17366 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 17447 18301 gene locus_tag LOCUS_08520 17447 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 19878 18298 gene locus_tag LOCUS_08530 19878 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 22028 19947 gene locus_tag LOCUS_08540 22028 19947 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_08540 22204 25125 gene locus_tag LOCUS_08550 22204 25125 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919676.1 protein_id gnl|my_center|LOCUS_08550 25145 26374 gene locus_tag LOCUS_08560 25145 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 26400 28859 gene locus_tag LOCUS_08570 26400 28859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 28859 30955 gene locus_tag LOCUS_08580 28859 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 30906 31976 gene locus_tag LOCUS_08590 30906 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 32097 31924 gene locus_tag LOCUS_08600 32097 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 33971 32109 gene locus_tag LOCUS_08610 33971 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 34012 34215 gene locus_tag LOCUS_08620 34012 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 34212 34577 gene locus_tag LOCUS_08630 34212 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 35422 34730 gene locus_tag LOCUS_08640 35422 34730 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_08640 35837 35631 gene locus_tag LOCUS_08650 35837 35631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 36101 36757 gene locus_tag LOCUS_08660 36101 36757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 38606 36768 gene locus_tag LOCUS_08670 38606 36768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 40342 38771 gene locus_tag LOCUS_08680 40342 38771 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_08680 40411 42021 gene locus_tag LOCUS_08690 40411 42021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_08690 42040 42978 gene locus_tag LOCUS_08700 42040 42978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_08700 42971 43909 gene locus_tag LOCUS_08710 42971 43909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_08710 43975 47949 gene locus_tag LOCUS_08720 43975 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 48149 48820 gene locus_tag LOCUS_08730 48149 48820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 49449 48901 gene locus_tag LOCUS_08740 49449 48901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 50656 49463 gene locus_tag LOCUS_08750 50656 49463 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_08750 50928 51377 gene locus_tag LOCUS_08760 50928 51377 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_08760 52258 51500 gene locus_tag LOCUS_08770 52258 51500 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_08770 53604 52255 gene locus_tag LOCUS_08780 53604 52255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_08780 56457 54502 gene locus_tag LOCUS_08790 56457 54502 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_08790 56890 57666 gene locus_tag LOCUS_08800 56890 57666 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530618.1 protein_id gnl|my_center|LOCUS_08800 57675 57866 gene locus_tag LOCUS_08810 57675 57866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 protein_id gnl|my_center|LOCUS_08810 57887 58099 gene locus_tag LOCUS_08820 57887 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 59580 58207 gene locus_tag LOCUS_08830 59580 58207 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_08830 59636 60169 gene locus_tag LOCUS_08840 59636 60169 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_08840 60175 61386 gene locus_tag LOCUS_08850 60175 61386 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_08850 62804 61401 gene locus_tag LOCUS_08860 62804 61401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 62932 63420 gene locus_tag LOCUS_08870 62932 63420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 63417 63965 gene locus_tag LOCUS_08880 63417 63965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 64518 65753 gene locus_tag LOCUS_08890 64518 65753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 67488 65848 gene locus_tag LOCUS_08900 67488 65848 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_08900 68952 67525 gene locus_tag LOCUS_08910 68952 67525 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_08910 71956 68975 gene locus_tag LOCUS_08920 71956 68975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 73807 71984 gene locus_tag LOCUS_08930 73807 71984 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_08930 73891 74673 gene locus_tag LOCUS_08940 73891 74673 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_08940 76406 74688 gene locus_tag LOCUS_08950 76406 74688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 78136 76403 gene locus_tag LOCUS_08960 78136 76403 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_08960 78337 80298 gene locus_tag LOCUS_08970 78337 80298 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_08970 80295 80981 gene locus_tag LOCUS_08980 80295 80981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 82347 80983 gene locus_tag LOCUS_08990 82347 80983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 83323 82397 gene locus_tag LOCUS_09000 83323 82397 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_09000 83377 84876 gene locus_tag LOCUS_09010 83377 84876 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_09010 84873 85481 gene locus_tag LOCUS_09020 84873 85481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 85483 86745 gene locus_tag LOCUS_09030 85483 86745 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_09030 88312 86771 gene locus_tag LOCUS_09040 88312 86771 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_09040 88454 90661 gene locus_tag LOCUS_09050 gene katG 88454 90661 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_09050 90769 91989 gene locus_tag LOCUS_09060 90769 91989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_09060 92914 92078 gene locus_tag LOCUS_09070 92914 92078 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 protein_id gnl|my_center|LOCUS_09070 93528 92950 gene locus_tag LOCUS_09080 93528 92950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 93573 94373 gene locus_tag LOCUS_09090 93573 94373 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_09090 94416 95384 gene locus_tag LOCUS_09100 94416 95384 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_09100 95399 96142 gene locus_tag LOCUS_09110 95399 96142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 97287 96139 gene locus_tag LOCUS_09120 97287 96139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_09120 98846 97305 gene locus_tag LOCUS_09130 98846 97305 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_09130 100036 98843 gene locus_tag LOCUS_09140 100036 98843 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_09140 100092 101642 gene locus_tag LOCUS_09150 100092 101642 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_09150 101639 103012 gene locus_tag LOCUS_09160 101639 103012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_09160 103072 103293 gene locus_tag LOCUS_09170 103072 103293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 103290 103631 gene locus_tag LOCUS_09180 103290 103631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 103809 104051 gene locus_tag LOCUS_09190 103809 104051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 104201 104428 gene locus_tag LOCUS_09200 104201 104428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 104394 105989 gene locus_tag LOCUS_09210 104394 105989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 105995 106708 gene locus_tag LOCUS_09220 105995 106708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 107576 106710 gene locus_tag LOCUS_09230 107576 106710 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_09230 107636 108595 gene locus_tag LOCUS_09240 107636 108595 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_09240 108610 109758 gene locus_tag LOCUS_09250 108610 109758 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_09250 109774 111036 gene locus_tag LOCUS_09260 109774 111036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 111434 111033 gene locus_tag LOCUS_09270 111434 111033 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_09270 111691 111431 gene locus_tag LOCUS_09280 111691 111431 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_09280 112495 111728 gene locus_tag LOCUS_09290 112495 111728 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731408.1 protein_id gnl|my_center|LOCUS_09290 113047 112508 gene locus_tag LOCUS_09300 113047 112508 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_09300 114312 113044 gene locus_tag LOCUS_09310 114312 113044 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 protein_id gnl|my_center|LOCUS_09310 115355 114309 gene locus_tag LOCUS_09320 115355 114309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 116565 115372 gene locus_tag LOCUS_09330 116565 115372 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_09330 117944 116562 gene locus_tag LOCUS_09340 117944 116562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_09340 117987 119231 gene locus_tag LOCUS_09350 117987 119231 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_09350 119977 119228 gene locus_tag LOCUS_09360 119977 119228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 121047 119977 gene locus_tag LOCUS_09370 gene bla 121047 119977 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_09370 121198 123579 gene locus_tag LOCUS_09380 121198 123579 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090108.1 protein_id gnl|my_center|LOCUS_09380 123624 124280 gene locus_tag LOCUS_09390 123624 124280 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_09390 124277 125599 gene locus_tag LOCUS_09400 124277 125599 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_09400 126714 125611 gene locus_tag LOCUS_09410 126714 125611 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 protein_id gnl|my_center|LOCUS_09410 128538 126754 gene locus_tag LOCUS_09420 gene ggt 128538 126754 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868894.1 protein_id gnl|my_center|LOCUS_09420 130135 128576 gene locus_tag LOCUS_09430 130135 128576 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_09430 130226 130975 gene locus_tag LOCUS_09440 130226 130975 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_09440 133044 130987 gene locus_tag LOCUS_09450 133044 130987 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338342.1 protein_id gnl|my_center|LOCUS_09450 134419 133046 gene locus_tag LOCUS_09460 134419 133046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_09460 135218 134409 gene locus_tag LOCUS_09470 135218 134409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 136420 135215 gene locus_tag LOCUS_09480 136420 135215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 137026 136448 gene locus_tag LOCUS_09490 137026 136448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 139193 137091 gene locus_tag LOCUS_09500 139193 137091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_09500 139280 140743 gene locus_tag LOCUS_09510 139280 140743 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_09510 140746 143241 gene locus_tag LOCUS_09520 140746 143241 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_09520 143238 144518 gene locus_tag LOCUS_09530 143238 144518 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_09530 144558 144842 gene locus_tag LOCUS_09540 144558 144842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 144839 145129 gene locus_tag LOCUS_09550 144839 145129 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_09550 146375 145194 gene locus_tag LOCUS_09560 146375 145194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 146497 150363 gene locus_tag LOCUS_09570 146497 150363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 150369 151103 gene locus_tag LOCUS_09580 150369 151103 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_09580 152036 151137 gene locus_tag LOCUS_09590 152036 151137 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_09590 152077 152835 gene locus_tag LOCUS_09600 152077 152835 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_09600 153300 152860 gene locus_tag LOCUS_09610 153300 152860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 155261 153297 gene locus_tag LOCUS_09620 155261 153297 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_09620 155992 155258 gene locus_tag LOCUS_09630 155992 155258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 156171 158072 gene locus_tag LOCUS_09640 156171 158072 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_09640 159409 158135 gene locus_tag LOCUS_09650 159409 158135 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_09650 159677 159601 gene locus_tag LOCUS_t00160 159677 159601 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 162277 159734 gene locus_tag LOCUS_09660 162277 159734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 162896 162522 gene locus_tag LOCUS_09670 162896 162522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 163695 162910 gene locus_tag LOCUS_09680 163695 162910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 164726 163695 gene locus_tag LOCUS_09690 164726 163695 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_09690 165918 164704 gene locus_tag LOCUS_09700 165918 164704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 168602 165987 gene locus_tag LOCUS_09710 168602 165987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 169194 168817 gene locus_tag LOCUS_09720 169194 168817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 171018 169228 gene locus_tag LOCUS_09730 171018 169228 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_09730 171066 171929 gene locus_tag LOCUS_09740 171066 171929 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_09740 171926 172771 gene locus_tag LOCUS_09750 171926 172771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 173745 172777 gene locus_tag LOCUS_09760 173745 172777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 protein_id gnl|my_center|LOCUS_09760 173744 174529 gene locus_tag LOCUS_09770 173744 174529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 174480 176279 gene locus_tag LOCUS_09780 174480 176279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 176301 176762 gene locus_tag LOCUS_09790 176301 176762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 176774 177262 gene locus_tag LOCUS_09800 176774 177262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 177323 178411 gene locus_tag LOCUS_09810 177323 178411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 178583 179815 gene locus_tag LOCUS_09820 178583 179815 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_09820 181784 179871 gene locus_tag LOCUS_09830 181784 179871 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_09830 181785 182423 gene locus_tag LOCUS_09840 181785 182423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 182420 184060 gene locus_tag LOCUS_09850 182420 184060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 184114 185742 gene locus_tag LOCUS_09860 184114 185742 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_09860 185852 186061 gene locus_tag LOCUS_09870 185852 186061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 187067 186072 gene locus_tag LOCUS_09880 187067 186072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 188773 187181 gene locus_tag LOCUS_09890 188773 187181 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_09890 190186 188891 gene locus_tag LOCUS_09900 190186 188891 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_09900 191077 190232 gene locus_tag LOCUS_09910 191077 190232 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_09910 192149 191082 gene locus_tag LOCUS_09920 192149 191082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 192296 192532 gene locus_tag LOCUS_09930 192296 192532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 192678 193358 gene locus_tag LOCUS_09940 192678 193358 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_09940 193390 194526 gene locus_tag LOCUS_09950 193390 194526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 196701 194494 gene locus_tag LOCUS_09960 196701 194494 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_09960 196853 197983 gene locus_tag LOCUS_09970 196853 197983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 199598 198642 gene locus_tag LOCUS_09980 199598 198642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 200092 199649 gene locus_tag LOCUS_09990 200092 199649 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 protein_id gnl|my_center|LOCUS_09990 200747 200085 gene locus_tag LOCUS_10000 200747 200085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 201237 200758 gene locus_tag LOCUS_10010 201237 200758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 202379 201291 gene locus_tag LOCUS_10020 202379 201291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 202695 202447 gene locus_tag LOCUS_10030 202695 202447 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_10030 203906 202698 gene locus_tag LOCUS_10040 203906 202698 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_10040 206704 203903 gene locus_tag LOCUS_10050 206704 203903 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_10050 206697 207506 gene locus_tag LOCUS_10060 gene fabG 206697 207506 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_10060 207499 208740 gene locus_tag LOCUS_10070 gene fabF 207499 208740 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence05 1916 5734 gene locus_tag LOCUS_10080 gene dnaE 1916 5734 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_10080 5746 7161 gene locus_tag LOCUS_10090 5746 7161 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_10090 7137 7221 gene locus_tag LOCUS_t00170 7137 7221 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10349 7158 gene locus_tag LOCUS_10100 10349 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11421 10321 gene locus_tag LOCUS_10110 11421 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 11550 11756 gene locus_tag LOCUS_10120 11550 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 11760 12071 gene locus_tag LOCUS_10130 11760 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 12533 12078 gene locus_tag LOCUS_10140 12533 12078 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225099.1 protein_id gnl|my_center|LOCUS_10140 14197 12530 gene locus_tag LOCUS_10150 14197 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 15853 14213 gene locus_tag LOCUS_10160 15853 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 17709 15904 gene locus_tag LOCUS_10170 17709 15904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 17781 19268 gene locus_tag LOCUS_10180 17781 19268 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_10180 20200 19262 gene locus_tag LOCUS_10190 gene phhA 20200 19262 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_10190 21374 20214 gene locus_tag LOCUS_10200 gene hppD 21374 20214 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_10200 22600 21371 gene locus_tag LOCUS_10210 22600 21371 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_10210 22764 23327 gene locus_tag LOCUS_10220 22764 23327 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_10220 23353 24909 gene locus_tag LOCUS_10230 23353 24909 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_10230 24914 25999 gene locus_tag LOCUS_10240 24914 25999 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_10240 25996 27039 gene locus_tag LOCUS_10250 25996 27039 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_10250 29390 27102 gene locus_tag LOCUS_10260 29390 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 30256 29549 gene locus_tag LOCUS_10270 30256 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 30333 30803 gene locus_tag LOCUS_10280 30333 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 31839 30811 gene locus_tag LOCUS_10290 31839 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 32327 31836 gene locus_tag LOCUS_10300 32327 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 32644 32743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32867 34198 gene locus_tag LOCUS_10310 32867 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 34209 34445 gene locus_tag LOCUS_10320 34209 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 35380 34460 gene locus_tag LOCUS_10330 35380 34460 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_10330 35379 35552 gene locus_tag LOCUS_10340 35379 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 36375 35563 gene locus_tag LOCUS_10350 36375 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 36980 36372 gene locus_tag LOCUS_10360 36980 36372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 37340 37840 gene locus_tag LOCUS_10370 37340 37840 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_10370 38653 37916 gene locus_tag LOCUS_10380 38653 37916 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_10380 44800 38711 gene locus_tag LOCUS_10390 44800 38711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 45444 44797 gene locus_tag LOCUS_10400 45444 44797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 46186 48681 gene locus_tag LOCUS_10410 46186 48681 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_10410 50155 48806 gene locus_tag LOCUS_10420 50155 48806 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_10420 51071 50166 gene locus_tag LOCUS_10430 51071 50166 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_10430 51783 51082 gene locus_tag LOCUS_10440 51783 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 52297 52025 gene locus_tag LOCUS_10450 52297 52025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 52671 52294 gene locus_tag LOCUS_10460 52671 52294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 52853 53719 gene locus_tag LOCUS_10470 52853 53719 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_10470 55062 53776 gene locus_tag LOCUS_10480 55062 53776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_10480 55104 57584 gene locus_tag LOCUS_10490 55104 57584 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_10490 57597 59333 gene locus_tag LOCUS_10500 57597 59333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 59330 61042 gene locus_tag LOCUS_10510 59330 61042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 61245 63371 gene locus_tag LOCUS_10520 61245 63371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 63558 67184 gene locus_tag LOCUS_10530 63558 67184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 67739 68197 gene locus_tag LOCUS_10540 67739 68197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 68803 72507 gene locus_tag LOCUS_10550 68803 72507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 72713 76393 gene locus_tag LOCUS_10560 72713 76393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 76492 78267 gene locus_tag LOCUS_10570 76492 78267 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_10570 78264 80000 gene locus_tag LOCUS_10580 78264 80000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 80897 80004 gene locus_tag LOCUS_10590 gene purU 80897 80004 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_10590 80938 83262 gene locus_tag LOCUS_10600 80938 83262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 83274 84752 gene locus_tag LOCUS_10610 83274 84752 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_10610 85087 88050 gene locus_tag LOCUS_10620 85087 88050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 88057 91095 gene locus_tag LOCUS_10630 88057 91095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 91952 91092 gene locus_tag LOCUS_10640 91952 91092 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_10640 93916 91949 gene locus_tag LOCUS_10650 93916 91949 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_10650 94139 95584 gene locus_tag LOCUS_10660 94139 95584 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_10660 95588 97168 gene locus_tag LOCUS_10670 95588 97168 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_10670 97174 98172 gene locus_tag LOCUS_10680 97174 98172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 99379 98243 gene locus_tag LOCUS_10690 gene serC 99379 98243 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_10690 99463 101505 gene locus_tag LOCUS_10700 99463 101505 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_10700 101514 102497 gene locus_tag LOCUS_10710 gene glpQ 101514 102497 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_10710 103536 102451 gene locus_tag LOCUS_10720 103536 102451 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_10720 103622 104839 gene locus_tag LOCUS_10730 103622 104839 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_10730 104841 105977 gene locus_tag LOCUS_10740 104841 105977 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_10740 106810 105974 gene locus_tag LOCUS_10750 106810 105974 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_10750 106874 108070 gene locus_tag LOCUS_10760 106874 108070 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256635.1 protein_id gnl|my_center|LOCUS_10760 108177 109130 gene locus_tag LOCUS_10770 108177 109130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 109185 110630 gene locus_tag LOCUS_10780 109185 110630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 110627 111805 gene locus_tag LOCUS_10790 110627 111805 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_10790 111805 112935 gene locus_tag LOCUS_10800 111805 112935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 114151 112949 gene locus_tag LOCUS_10810 114151 112949 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_10810 116536 114167 gene locus_tag LOCUS_10820 116536 114167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_10820 117278 116541 gene locus_tag LOCUS_10830 117278 116541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_10830 119434 117278 gene locus_tag LOCUS_10840 119434 117278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 120675 119431 gene locus_tag LOCUS_10850 120675 119431 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_10850 121091 120672 gene locus_tag LOCUS_10860 121091 120672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 122272 121088 gene locus_tag LOCUS_10870 122272 121088 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_10870 122629 122294 gene locus_tag LOCUS_10880 122629 122294 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_10880 123534 122626 gene locus_tag LOCUS_10890 123534 122626 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_10890 124493 123531 gene locus_tag LOCUS_10900 124493 123531 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_10900 125935 124493 gene locus_tag LOCUS_10910 125935 124493 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265725.1 protein_id gnl|my_center|LOCUS_10910 126133 126708 gene locus_tag LOCUS_10920 126133 126708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 127641 126769 gene locus_tag LOCUS_10930 127641 126769 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_10930 128596 127664 gene locus_tag LOCUS_10940 128596 127664 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_10940 129240 128722 gene locus_tag LOCUS_10950 129240 128722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 129315 130565 gene locus_tag LOCUS_10960 129315 130565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 130552 131676 gene locus_tag LOCUS_10970 130552 131676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 132338 131682 gene locus_tag LOCUS_10980 132338 131682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 132449 133096 gene locus_tag LOCUS_10990 132449 133096 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_10990 133093 136380 gene locus_tag LOCUS_11000 133093 136380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 136380 136967 gene locus_tag LOCUS_11010 136380 136967 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_11010 136982 138913 gene locus_tag LOCUS_11020 136982 138913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 138910 139395 gene locus_tag LOCUS_11030 138910 139395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 139407 140225 gene locus_tag LOCUS_11040 139407 140225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 140225 142000 gene locus_tag LOCUS_11050 140225 142000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 142068 144239 gene locus_tag LOCUS_11060 142068 144239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 144354 146090 gene locus_tag LOCUS_11070 144354 146090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 146093 146977 gene locus_tag LOCUS_11080 146093 146977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 147003 148352 gene locus_tag LOCUS_11090 147003 148352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_11090 148357 149256 gene locus_tag LOCUS_11100 148357 149256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 149438 150160 gene locus_tag LOCUS_11110 149438 150160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 150173 150652 gene locus_tag LOCUS_11120 150173 150652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 150670 152040 gene locus_tag LOCUS_11130 gene ahbD 150670 152040 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11130 152055 152708 gene locus_tag LOCUS_11140 152055 152708 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_11140 153598 152726 gene locus_tag LOCUS_11150 153598 152726 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_11150 154908 153694 gene locus_tag LOCUS_11160 154908 153694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_11160 156568 154913 gene locus_tag LOCUS_11170 gene metG 156568 154913 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113898.1 protein_id gnl|my_center|LOCUS_11170 156699 157301 gene locus_tag LOCUS_11180 gene sigE 156699 157301 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_11180 157385 157960 gene locus_tag LOCUS_11190 157385 157960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 157957 158517 gene locus_tag LOCUS_11200 157957 158517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 159390 158497 gene locus_tag LOCUS_11210 159390 158497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 160241 159468 gene locus_tag LOCUS_11220 160241 159468 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_11220 160354 161508 gene locus_tag LOCUS_11230 gene gshA 160354 161508 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_11230 162005 161526 gene locus_tag LOCUS_11240 162005 161526 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_11240 165563 162009 gene locus_tag LOCUS_11250 165563 162009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 165643 167352 gene locus_tag LOCUS_11260 165643 167352 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_11260 167349 167567 gene locus_tag LOCUS_11270 167349 167567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 167595 167969 gene locus_tag LOCUS_11280 167595 167969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 168055 169296 gene locus_tag LOCUS_11290 168055 169296 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_11290 169312 170190 gene locus_tag LOCUS_11300 169312 170190 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_11300 170235 171536 gene locus_tag LOCUS_11310 170235 171536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_11310 171584 172174 gene locus_tag LOCUS_11320 171584 172174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 172191 173624 gene locus_tag LOCUS_11330 172191 173624 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_11330 173893 173654 gene locus_tag LOCUS_11340 gene rpmB 173893 173654 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258648.1 protein_id gnl|my_center|LOCUS_11340 174074 175933 gene locus_tag LOCUS_11350 gene mdlC 174074 175933 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099962.1 protein_id gnl|my_center|LOCUS_11350 175950 178151 gene locus_tag LOCUS_11360 175950 178151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 178197 181475 gene locus_tag LOCUS_11370 178197 181475 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_11370 181491 181916 gene locus_tag LOCUS_11380 181491 181916 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_11380 182975 181947 gene locus_tag LOCUS_11390 182975 181947 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_11390 183501 182983 gene locus_tag LOCUS_11400 183501 182983 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_11400 184853 183498 gene locus_tag LOCUS_11410 184853 183498 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_11410 186031 184850 gene locus_tag LOCUS_11420 gene lysS 186031 184850 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_11420 187093 186254 gene locus_tag LOCUS_11430 187093 186254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 187183 187677 gene locus_tag LOCUS_11440 187183 187677 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_11440 187690 188802 gene locus_tag LOCUS_11450 187690 188802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_11450 188826 189431 gene locus_tag LOCUS_11460 188826 189431 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_11460 190280 189435 gene locus_tag LOCUS_11470 190280 189435 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_11470 192118 190292 gene locus_tag LOCUS_11480 192118 190292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 192923 192123 gene locus_tag LOCUS_11490 192923 192123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 194166 192997 gene locus_tag LOCUS_11500 194166 192997 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_11500 195221 194163 gene locus_tag LOCUS_11510 195221 194163 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_11510 196237 195218 gene locus_tag LOCUS_11520 196237 195218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 197172 196240 gene locus_tag LOCUS_11530 197172 196240 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_11530 198258 197191 gene locus_tag LOCUS_11540 198258 197191 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_11540 198992 198372 gene locus_tag LOCUS_11550 198992 198372 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_11550 199064 199816 gene locus_tag LOCUS_11560 199064 199816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 199783 200067 gene locus_tag LOCUS_11570 199783 200067 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_11570 203359 200120 gene locus_tag LOCUS_11580 203359 200120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 203813 205003 gene locus_tag LOCUS_11590 203813 205003 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_11590 206020 205013 gene locus_tag LOCUS_11600 206020 205013 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_11600 206081 207730 gene locus_tag LOCUS_11610 206081 207730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_11610 <208715 207734 gene locus_tag LOCUS_11620 <208715 207734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392119.1:radical SAM family heme chaperone HemW >Feature sequence06 <1 973 gene locus_tag LOCUS_11630 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022778.1:tetratricopeptide repeat protein 1108 3153 gene locus_tag LOCUS_11640 1108 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5393 3150 gene locus_tag LOCUS_11650 5393 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7122 5443 gene locus_tag LOCUS_11660 7122 5443 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_11660 9062 7107 gene locus_tag LOCUS_11670 9062 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10807 9059 gene locus_tag LOCUS_11680 10807 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 12333 10810 gene locus_tag LOCUS_11690 12333 10810 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256989.1 protein_id gnl|my_center|LOCUS_11690 12384 13664 gene locus_tag LOCUS_11700 12384 13664 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_11700 13741 17415 gene locus_tag LOCUS_11710 13741 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 18738 17428 gene locus_tag LOCUS_11720 gene eno 18738 17428 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_11720 18889 20871 gene locus_tag LOCUS_11730 18889 20871 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_11730 22290 20887 gene locus_tag LOCUS_11740 22290 20887 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_11740 24125 22287 gene locus_tag LOCUS_11750 24125 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 25790 24213 gene locus_tag LOCUS_11760 25790 24213 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_11760 25824 26849 gene locus_tag LOCUS_11770 25824 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 26936 27073 gene locus_tag LOCUS_11780 26936 27073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 27082 28593 gene locus_tag LOCUS_11790 gene panF 27082 28593 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_11790 28643 29722 gene locus_tag LOCUS_11800 28643 29722 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_11800 31135 29723 gene locus_tag LOCUS_11810 31135 29723 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_11810 31446 31138 gene locus_tag LOCUS_11820 31446 31138 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_11820 32619 31492 gene locus_tag LOCUS_11830 32619 31492 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_11830 33977 32712 gene locus_tag LOCUS_11840 33977 32712 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_11840 34104 35150 gene locus_tag LOCUS_11850 34104 35150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 35147 37447 gene locus_tag LOCUS_11860 35147 37447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 37768 37526 gene locus_tag LOCUS_11870 37768 37526 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_11870 40542 37855 gene locus_tag LOCUS_11880 gene leuS 40542 37855 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_11880 40551 41687 gene locus_tag LOCUS_11890 40551 41687 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394617.1 protein_id gnl|my_center|LOCUS_11890 42600 41725 gene locus_tag LOCUS_11900 42600 41725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_11900 42699 43478 gene locus_tag LOCUS_11910 42699 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 43534 44001 gene locus_tag LOCUS_11920 43534 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 46742 44037 gene locus_tag LOCUS_11930 46742 44037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 47578 46739 gene locus_tag LOCUS_11940 47578 46739 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310200.1 protein_id gnl|my_center|LOCUS_11940 48458 47604 gene locus_tag LOCUS_11950 48458 47604 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_11950 49237 48455 gene locus_tag LOCUS_11960 49237 48455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 50304 49234 gene locus_tag LOCUS_11970 50304 49234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 50462 50301 gene locus_tag LOCUS_11980 50462 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 50737 50459 gene locus_tag LOCUS_11990 50737 50459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 50825 51958 gene locus_tag LOCUS_12000 50825 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 53160 51964 gene locus_tag LOCUS_12010 53160 51964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 54082 53189 gene locus_tag LOCUS_12020 54082 53189 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_12020 54224 54871 gene locus_tag LOCUS_12030 54224 54871 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_12030 54886 55665 gene locus_tag LOCUS_12040 54886 55665 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_12040 56407 55715 gene locus_tag LOCUS_12050 56407 55715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123273.1 protein_id gnl|my_center|LOCUS_12050 58523 56451 gene locus_tag LOCUS_12060 58523 56451 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_12060 59978 58548 gene locus_tag LOCUS_12070 59978 58548 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_12070 61391 59979 gene locus_tag LOCUS_12080 61391 59979 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_12080 62146 61388 gene locus_tag LOCUS_12090 62146 61388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_12090 65580 62143 gene locus_tag LOCUS_12100 65580 62143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 66476 65577 gene locus_tag LOCUS_12110 66476 65577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_12110 68885 66516 gene locus_tag LOCUS_12120 68885 66516 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066717.1 protein_id gnl|my_center|LOCUS_12120 69413 69036 gene locus_tag LOCUS_12130 69413 69036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 69439 70680 gene locus_tag LOCUS_12140 69439 70680 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_12140 70677 71582 gene locus_tag LOCUS_12150 70677 71582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 71671 72579 gene locus_tag LOCUS_12160 71671 72579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 72636 74717 gene locus_tag LOCUS_12170 gene shc 72636 74717 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_12170 74740 75741 gene locus_tag LOCUS_12180 gene hpnH 74740 75741 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_12180 75770 76771 gene locus_tag LOCUS_12190 75770 76771 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_12190 76768 77517 gene locus_tag LOCUS_12200 76768 77517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 77591 78493 gene locus_tag LOCUS_12210 77591 78493 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_12210 78567 79952 gene locus_tag LOCUS_12220 78567 79952 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_12220 82463 79962 gene locus_tag LOCUS_12230 82463 79962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 83257 82514 gene locus_tag LOCUS_12240 83257 82514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 84969 83254 gene locus_tag LOCUS_12250 84969 83254 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_12250 85105 86193 gene locus_tag LOCUS_12260 85105 86193 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_12260 86190 87965 gene locus_tag LOCUS_12270 86190 87965 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_12270 88042 88719 gene locus_tag LOCUS_12280 88042 88719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 88749 89120 gene locus_tag LOCUS_12290 88749 89120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 90461 89127 gene locus_tag LOCUS_12300 90461 89127 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_12300 90517 92526 gene locus_tag LOCUS_12310 90517 92526 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_12310 92519 93220 gene locus_tag LOCUS_12320 92519 93220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 94617 93310 gene locus_tag LOCUS_12330 94617 93310 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_12330 95885 94644 gene locus_tag LOCUS_12340 95885 94644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 98274 95905 gene locus_tag LOCUS_12350 98274 95905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 98347 98883 gene locus_tag LOCUS_12360 98347 98883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334707.1 protein_id gnl|my_center|LOCUS_12360 102331 98888 gene locus_tag LOCUS_12370 102331 98888 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_12370 102215 103420 gene locus_tag LOCUS_12380 102215 103420 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_12380 103428 104087 gene locus_tag LOCUS_12390 103428 104087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 104204 104755 gene locus_tag LOCUS_12400 104204 104755 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_12400 104766 105620 gene locus_tag LOCUS_12410 104766 105620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 108705 105559 gene locus_tag LOCUS_12420 108705 105559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 109912 108725 gene locus_tag LOCUS_12430 109912 108725 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169995.1 protein_id gnl|my_center|LOCUS_12430 109984 110823 gene locus_tag LOCUS_12440 109984 110823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 110865 111791 gene locus_tag LOCUS_12450 110865 111791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 111862 113181 gene locus_tag LOCUS_12460 111862 113181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 114785 113268 gene locus_tag LOCUS_12470 114785 113268 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 protein_id gnl|my_center|LOCUS_12470 117017 114819 gene locus_tag LOCUS_12480 117017 114819 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_12480 118160 117120 gene locus_tag LOCUS_12490 118160 117120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125658.1 protein_id gnl|my_center|LOCUS_12490 119503 118148 gene locus_tag LOCUS_12500 119503 118148 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125657.1 protein_id gnl|my_center|LOCUS_12500 120861 119527 gene locus_tag LOCUS_12510 120861 119527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 121768 120845 gene locus_tag LOCUS_12520 121768 120845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 122164 121796 gene locus_tag LOCUS_12530 122164 121796 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_12530 122910 122347 gene locus_tag LOCUS_12540 122910 122347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 123325 122867 gene locus_tag LOCUS_12550 123325 122867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 123433 123645 gene locus_tag LOCUS_12560 123433 123645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 124794 123673 gene locus_tag LOCUS_12570 124794 123673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 124864 125730 gene locus_tag LOCUS_12580 124864 125730 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_12580 125714 127135 gene locus_tag LOCUS_12590 125714 127135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 129571 127076 gene locus_tag LOCUS_12600 129571 127076 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_12600 129618 133115 gene locus_tag LOCUS_12610 129618 133115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 133524 133183 gene locus_tag LOCUS_12620 133524 133183 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_12620 134880 133543 gene locus_tag LOCUS_12630 134880 133543 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_12630 137185 135188 gene locus_tag LOCUS_12640 gene tynA 137185 135188 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705615.1 protein_id gnl|my_center|LOCUS_12640 139249 137264 gene locus_tag LOCUS_12650 gene tynA 139249 137264 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705615.1 protein_id gnl|my_center|LOCUS_12650 139362 140303 gene locus_tag LOCUS_12660 139362 140303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 140323 140826 gene locus_tag LOCUS_12670 140323 140826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 141908 140832 gene locus_tag LOCUS_12680 141908 140832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_12680 142054 143235 gene locus_tag LOCUS_12690 142054 143235 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_12690 144548 143271 gene locus_tag LOCUS_12700 144548 143271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 144817 146049 gene locus_tag LOCUS_12710 144817 146049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_12710 148094 146046 gene locus_tag LOCUS_12720 148094 146046 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_12720 149026 148100 gene locus_tag LOCUS_12730 149026 148100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 150026 149046 gene locus_tag LOCUS_12740 150026 149046 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_12740 151644 150064 gene locus_tag LOCUS_12750 151644 150064 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_12750 151769 153085 gene locus_tag LOCUS_12760 151769 153085 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_12760 153082 153504 gene locus_tag LOCUS_12770 153082 153504 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243290.1 protein_id gnl|my_center|LOCUS_12770 154741 153476 gene locus_tag LOCUS_12780 154741 153476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 156643 154823 gene locus_tag LOCUS_12790 156643 154823 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_12790 156811 158142 gene locus_tag LOCUS_12800 156811 158142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 158153 158824 gene locus_tag LOCUS_12810 158153 158824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 160092 158821 gene locus_tag LOCUS_12820 160092 158821 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995765.1 protein_id gnl|my_center|LOCUS_12820 161709 160114 gene locus_tag LOCUS_12830 161709 160114 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_12830 161864 162454 gene locus_tag LOCUS_12840 161864 162454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 163021 162464 gene locus_tag LOCUS_12850 163021 162464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 162926 163201 gene locus_tag LOCUS_12860 162926 163201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 165510 163420 gene locus_tag LOCUS_12870 165510 163420 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_12870 166365 165568 gene locus_tag LOCUS_12880 166365 165568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 166364 167701 gene locus_tag LOCUS_12890 166364 167701 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_12890 168864 167689 gene locus_tag LOCUS_12900 168864 167689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 168942 169709 gene locus_tag LOCUS_12910 168942 169709 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_12910 169706 171154 gene locus_tag LOCUS_12920 169706 171154 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_12920 171986 171159 gene locus_tag LOCUS_12930 171986 171159 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_12930 173489 172011 gene locus_tag LOCUS_12940 173489 172011 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_12940 174869 173508 gene locus_tag LOCUS_12950 gene trkA 174869 173508 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228490.1 protein_id gnl|my_center|LOCUS_12950 176334 174907 gene locus_tag LOCUS_12960 176334 174907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 176483 177346 gene locus_tag LOCUS_12970 176483 177346 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 protein_id gnl|my_center|LOCUS_12970 177434 178507 gene locus_tag LOCUS_12980 177434 178507 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_12980 178591 179364 gene locus_tag LOCUS_12990 178591 179364 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_12990 179508 180479 gene locus_tag LOCUS_13000 179508 180479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 180507 181529 gene locus_tag LOCUS_13010 180507 181529 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_13010 182967 181549 gene locus_tag LOCUS_13020 182967 181549 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_13020 184229 182943 gene locus_tag LOCUS_13030 184229 182943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 186763 184262 gene locus_tag LOCUS_13040 186763 184262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 187640 186825 gene locus_tag LOCUS_13050 187640 186825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 188471 187686 gene locus_tag LOCUS_13060 188471 187686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 189765 188554 gene locus_tag LOCUS_13070 189765 188554 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_13070 189832 190113 gene locus_tag LOCUS_13080 189832 190113 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_13080 190133 190984 gene locus_tag LOCUS_13090 190133 190984 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_13090 190981 193185 gene locus_tag LOCUS_13100 190981 193185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 193811 193284 gene locus_tag LOCUS_13110 193811 193284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 195630 194224 gene locus_tag LOCUS_13120 195630 194224 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_13120 196464 195637 gene locus_tag LOCUS_13130 196464 195637 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911100.1 protein_id gnl|my_center|LOCUS_13130 197759 196527 gene locus_tag LOCUS_13140 197759 196527 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_13140 197889 198365 gene locus_tag LOCUS_13150 197889 198365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 198450 199526 gene locus_tag LOCUS_13160 198450 199526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 199930 199541 gene locus_tag LOCUS_13170 199930 199541 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_13170 200216 199923 gene locus_tag LOCUS_13180 200216 199923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 200987 200310 gene locus_tag LOCUS_13190 200987 200310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 <203291 200984 gene locus_tag LOCUS_13200 <203291 200984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837952.1:ABC transporter ATP-binding protein >Feature sequence07 1885 1244 gene locus_tag LOCUS_13210 gene purN 1885 1244 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583769.1 protein_id gnl|my_center|LOCUS_13210 2928 1882 gene locus_tag LOCUS_13220 gene purM 2928 1882 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_13220 4328 2925 gene locus_tag LOCUS_13230 gene purF 4328 2925 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_13230 6587 4335 gene locus_tag LOCUS_13240 gene purL 6587 4335 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_13240 7315 6593 gene locus_tag LOCUS_13250 gene purQ 7315 6593 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_13250 7578 7312 gene locus_tag LOCUS_13260 gene purS 7578 7312 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975653.1 protein_id gnl|my_center|LOCUS_13260 8478 7600 gene locus_tag LOCUS_13270 8478 7600 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_13270 11398 8486 gene locus_tag LOCUS_13280 11398 8486 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_13280 12136 11408 gene locus_tag LOCUS_13290 12136 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 12718 12209 gene locus_tag LOCUS_13300 12718 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 12784 13953 gene locus_tag LOCUS_13310 gene dprA 12784 13953 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_13310 16639 13964 gene locus_tag LOCUS_13320 gene topA 16639 13964 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_13320 16727 18121 gene locus_tag LOCUS_13330 gene trmFO 16727 18121 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_13330 18055 19029 gene locus_tag LOCUS_13340 gene xerC 18055 19029 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_13340 19064 19876 gene locus_tag LOCUS_13350 19064 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 19928 20476 gene locus_tag LOCUS_13360 gene hslV 19928 20476 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_13360 20473 21846 gene locus_tag LOCUS_13370 gene hslU 20473 21846 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_13370 21836 22087 gene locus_tag LOCUS_13380 21836 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 22084 22908 gene locus_tag LOCUS_13390 gene dapF 22084 22908 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_13390 22932 24167 gene locus_tag LOCUS_13400 gene tyrS 22932 24167 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 protein_id gnl|my_center|LOCUS_13400 24154 24462 gene locus_tag LOCUS_13410 24154 24462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 27500 24501 gene locus_tag LOCUS_13420 27500 24501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 28954 27608 gene locus_tag LOCUS_13430 28954 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 29391 28951 gene locus_tag LOCUS_13440 29391 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 31195 29804 gene locus_tag LOCUS_13450 31195 29804 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_13450 31401 32183 gene locus_tag LOCUS_13460 31401 32183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 32180 33787 gene locus_tag LOCUS_13470 32180 33787 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_13470 34221 33784 gene locus_tag LOCUS_13480 34221 33784 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_13480 35096 34227 gene locus_tag LOCUS_13490 gene sucD 35096 34227 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_13490 36291 35101 gene locus_tag LOCUS_13500 gene sucC 36291 35101 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403880.1 protein_id gnl|my_center|LOCUS_13500 37567 36305 gene locus_tag LOCUS_13510 gene icd 37567 36305 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_13510 37623 38090 gene locus_tag LOCUS_13520 37623 38090 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_13520 38514 38167 gene locus_tag LOCUS_13530 38514 38167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 39224 38550 gene locus_tag LOCUS_13540 39224 38550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 39496 39221 gene locus_tag LOCUS_13550 39496 39221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 40475 39501 gene locus_tag LOCUS_13560 40475 39501 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_13560 42604 40475 gene locus_tag LOCUS_13570 42604 40475 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 protein_id gnl|my_center|LOCUS_13570 43229 42597 gene locus_tag LOCUS_13580 43229 42597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 44422 43292 gene locus_tag LOCUS_13590 44422 43292 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_13590 45621 44419 gene locus_tag LOCUS_13600 45621 44419 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940481.1 protein_id gnl|my_center|LOCUS_13600 45620 47494 gene locus_tag LOCUS_13610 45620 47494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 48599 47511 gene locus_tag LOCUS_13620 48599 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 49249 48626 gene locus_tag LOCUS_13630 49249 48626 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_13630 49638 49291 gene locus_tag LOCUS_13640 gene rplS 49638 49291 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_13640 50408 49686 gene locus_tag LOCUS_13650 gene trmD 50408 49686 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_13650 50917 50390 gene locus_tag LOCUS_13660 gene rimM 50917 50390 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_13660 51224 50979 gene locus_tag LOCUS_13670 51224 50979 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880022.1 protein_id gnl|my_center|LOCUS_13670 51493 51239 gene locus_tag LOCUS_13680 gene rpsP 51493 51239 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_13680 52889 51576 gene locus_tag LOCUS_13690 gene ffh 52889 51576 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_13690 55492 52889 gene locus_tag LOCUS_13700 55492 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 56162 55548 gene locus_tag LOCUS_13710 gene pgsA 56162 55548 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_13710 58810 56177 gene locus_tag LOCUS_13720 gene alaS 58810 56177 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_13720 59328 58804 gene locus_tag LOCUS_13730 59328 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 60048 59362 gene locus_tag LOCUS_13740 60048 59362 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_13740 61189 60077 gene locus_tag LOCUS_13750 gene dnaJ 61189 60077 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_13750 61740 61198 gene locus_tag LOCUS_13760 gene grpE 61740 61198 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13760 62815 61775 gene locus_tag LOCUS_13770 gene hrcA 62815 61775 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_13770 62895 63323 gene locus_tag LOCUS_13780 gene nrdR 62895 63323 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_13780 63379 65775 gene locus_tag LOCUS_13790 gene lon 63379 65775 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_13790 65751 66743 gene locus_tag LOCUS_13800 gene thiL 65751 66743 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113052.1 protein_id gnl|my_center|LOCUS_13800 67650 66733 gene locus_tag LOCUS_13810 67650 66733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 71011 67766 gene locus_tag LOCUS_13820 71011 67766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 72333 71008 gene locus_tag LOCUS_13830 gene aroA 72333 71008 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 protein_id gnl|my_center|LOCUS_13830 72998 72321 gene locus_tag LOCUS_13840 gene lpxH 72998 72321 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262169.1 protein_id gnl|my_center|LOCUS_13840 74089 73016 gene locus_tag LOCUS_13850 74089 73016 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_13850 74837 74082 gene locus_tag LOCUS_13860 74837 74082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 75018 75797 gene locus_tag LOCUS_13870 75018 75797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_13870 75784 76587 gene locus_tag LOCUS_13880 75784 76587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_13880 76577 77737 gene locus_tag LOCUS_13890 76577 77737 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932017.1 protein_id gnl|my_center|LOCUS_13890 77734 78015 gene locus_tag LOCUS_13900 77734 78015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 78626 78027 gene locus_tag LOCUS_13910 78626 78027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 79254 78628 gene locus_tag LOCUS_13920 gene folE 79254 78628 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_13920 79383 79538 gene locus_tag LOCUS_13930 79383 79538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 79585 80070 gene locus_tag LOCUS_13940 79585 80070 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_13940 80081 80515 gene locus_tag LOCUS_13950 80081 80515 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_13950 81930 80563 gene locus_tag LOCUS_13960 gene rlmD 81930 80563 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_13960 82099 81863 gene locus_tag LOCUS_13970 82099 81863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 82699 82148 gene locus_tag LOCUS_13980 82699 82148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 85596 82726 gene locus_tag LOCUS_13990 85596 82726 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_13990 85853 87421 gene locus_tag LOCUS_14000 85853 87421 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_14000 90965 87699 gene locus_tag LOCUS_14010 gene carB 90965 87699 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_14010 92560 91316 gene locus_tag LOCUS_14020 92560 91316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_14020 93623 92553 gene locus_tag LOCUS_14030 gene carA 93623 92553 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_14030 94021 93620 gene locus_tag LOCUS_14040 gene mce 94021 93620 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_14040 95064 94024 gene locus_tag LOCUS_14050 gene meaB 95064 94024 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_14050 96869 95061 gene locus_tag LOCUS_14060 96869 95061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 97627 96878 gene locus_tag LOCUS_14070 97627 96878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_14070 98055 97624 gene locus_tag LOCUS_14080 98055 97624 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_14080 100005 98056 gene locus_tag LOCUS_14090 gene dnaK 100005 98056 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_14090 100709 100230 gene locus_tag LOCUS_14100 100709 100230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 100681 101556 gene locus_tag LOCUS_14110 gene mazG 100681 101556 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_14110 102784 101564 gene locus_tag LOCUS_14120 102784 101564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 103130 102792 gene locus_tag LOCUS_14130 103130 102792 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_14130 103593 103120 gene locus_tag LOCUS_14140 103593 103120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 104095 103607 gene locus_tag LOCUS_14150 gene dcd 104095 103607 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776509.1 protein_id gnl|my_center|LOCUS_14150 105106 104132 gene locus_tag LOCUS_14160 gene glpX 105106 104132 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479842.1 protein_id gnl|my_center|LOCUS_14160 106323 105103 gene locus_tag LOCUS_14170 106323 105103 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_14170 106422 107261 gene locus_tag LOCUS_14180 106422 107261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 108590 107391 gene locus_tag LOCUS_14190 108590 107391 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_14190 109573 108617 gene locus_tag LOCUS_14200 gene hflC 109573 108617 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_14200 110607 109570 gene locus_tag LOCUS_14210 gene hflK 110607 109570 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_14210 110671 113154 gene locus_tag LOCUS_14220 110671 113154 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139603260.1 protein_id gnl|my_center|LOCUS_14220 113151 114206 gene locus_tag LOCUS_14230 113151 114206 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_14230 114203 115429 gene locus_tag LOCUS_14240 114203 115429 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_14240 116313 115348 gene locus_tag LOCUS_14250 116313 115348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 116466 118142 gene locus_tag LOCUS_14260 116466 118142 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_14260 121631 118155 gene locus_tag LOCUS_14270 gene metH 121631 118155 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_14270 122063 121674 gene locus_tag LOCUS_14280 122063 121674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 123828 122107 gene locus_tag LOCUS_14290 123828 122107 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_14290 123914 125464 gene locus_tag LOCUS_14300 123914 125464 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_14300 127016 125466 gene locus_tag LOCUS_14310 127016 125466 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_14310 128059 127007 gene locus_tag LOCUS_14320 gene gmd 128059 127007 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_14320 129288 128056 gene locus_tag LOCUS_14330 129288 128056 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_14330 130131 129328 gene locus_tag LOCUS_14340 130131 129328 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_14340 130789 130136 gene locus_tag LOCUS_14350 130789 130136 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_14350 131754 130861 gene locus_tag LOCUS_14360 131754 130861 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_14360 132008 131751 gene locus_tag LOCUS_14370 132008 131751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 132676 132023 gene locus_tag LOCUS_14380 132676 132023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 132621 133493 gene locus_tag LOCUS_14390 132621 133493 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_14390 134297 133512 gene locus_tag LOCUS_14400 134297 133512 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_14400 135876 134308 gene locus_tag LOCUS_14410 gene rny 135876 134308 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_14410 136430 136113 gene locus_tag LOCUS_14420 136430 136113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 136690 136475 gene locus_tag LOCUS_14430 136690 136475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 137073 136690 gene locus_tag LOCUS_14440 137073 136690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 137293 137102 gene locus_tag LOCUS_14450 gene rpmI 137293 137102 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720098.1 protein_id gnl|my_center|LOCUS_14450 139318 137381 gene locus_tag LOCUS_14460 gene thrS 139318 137381 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_14460 139466 139390 gene locus_tag LOCUS_t00180 139466 139390 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 139568 139492 gene locus_tag LOCUS_t00190 139568 139492 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 139702 140949 gene locus_tag LOCUS_14470 139702 140949 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 protein_id gnl|my_center|LOCUS_14470 141106 142455 gene locus_tag LOCUS_14480 141106 142455 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_14480 144165 142426 gene locus_tag LOCUS_14490 144165 142426 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_14490 144239 146068 gene locus_tag LOCUS_14500 144239 146068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 146991 146065 gene locus_tag LOCUS_14510 146991 146065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 147555 147040 gene locus_tag LOCUS_14520 147555 147040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 148221 147634 gene locus_tag LOCUS_14530 148221 147634 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_14530 148374 149066 gene locus_tag LOCUS_14540 148374 149066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_14540 149063 149743 gene locus_tag LOCUS_14550 149063 149743 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_14550 149782 149955 gene locus_tag LOCUS_14560 149782 149955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 149924 150415 gene locus_tag LOCUS_14570 gene ccmE 149924 150415 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_14570 150412 152412 gene locus_tag LOCUS_14580 150412 152412 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_14580 152409 152945 gene locus_tag LOCUS_14590 152409 152945 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_14590 152947 153495 gene locus_tag LOCUS_14600 152947 153495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 153693 154415 gene locus_tag LOCUS_14610 153693 154415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 154912 154412 gene locus_tag LOCUS_14620 154912 154412 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881430.1 protein_id gnl|my_center|LOCUS_14620 154911 155144 gene locus_tag LOCUS_14630 154911 155144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 156700 155066 gene locus_tag LOCUS_14640 156700 155066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 157796 156714 gene locus_tag LOCUS_14650 157796 156714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 158520 157906 gene locus_tag LOCUS_14660 gene thiE 158520 157906 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_14660 159980 158601 gene locus_tag LOCUS_14670 gene accC 159980 158601 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_14670 160450 159977 gene locus_tag LOCUS_14680 160450 159977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 160658 160440 gene locus_tag LOCUS_14690 160658 160440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 161557 160670 gene locus_tag LOCUS_14700 161557 160670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 162311 161640 gene locus_tag LOCUS_14710 162311 161640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 164637 162403 gene locus_tag LOCUS_14720 164637 162403 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_14720 165826 164648 gene locus_tag LOCUS_14730 165826 164648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 167411 165837 gene locus_tag LOCUS_14740 gene secD 167411 165837 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880603.1 protein_id gnl|my_center|LOCUS_14740 167719 167408 gene locus_tag LOCUS_14750 gene yajC 167719 167408 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_14750 168843 167794 gene locus_tag LOCUS_14760 gene tgt 168843 167794 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_14760 169676 168939 gene locus_tag LOCUS_14770 169676 168939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 169716 170900 gene locus_tag LOCUS_14780 169716 170900 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_14780 171577 170867 gene locus_tag LOCUS_14790 171577 170867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 172650 171595 gene locus_tag LOCUS_14800 172650 171595 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_14800 173368 172658 gene locus_tag LOCUS_14810 173368 172658 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_14810 174449 173361 gene locus_tag LOCUS_14820 174449 173361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 175546 174584 gene locus_tag LOCUS_14830 175546 174584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 176184 175543 gene locus_tag LOCUS_14840 gene tmk 176184 175543 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_14840 177744 176191 gene locus_tag LOCUS_14850 177744 176191 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665541.1 protein_id gnl|my_center|LOCUS_14850 178618 177731 gene locus_tag LOCUS_14860 178618 177731 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615605.1 protein_id gnl|my_center|LOCUS_14860 180092 178764 gene locus_tag LOCUS_14870 180092 178764 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_14870 180179 180844 gene locus_tag LOCUS_14880 180179 180844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 180890 182032 gene locus_tag LOCUS_14890 180890 182032 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_14890 183237 182029 gene locus_tag LOCUS_14900 183237 182029 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_14900 183359 183682 gene locus_tag LOCUS_14910 183359 183682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 183800 183701 gene locus_tag LOCUS_t00200 183800 183701 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 183855 184454 gene locus_tag LOCUS_14920 183855 184454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 184549 184474 gene locus_tag LOCUS_t00210 184549 184474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 184651 184660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 185363 184812 gene locus_tag LOCUS_14930 185363 184812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 185430 186164 gene locus_tag LOCUS_14940 185430 186164 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_14940 186187 188286 gene locus_tag LOCUS_14950 186187 188286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 188637 188422 gene locus_tag LOCUS_14960 188637 188422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 189861 189166 gene locus_tag LOCUS_14970 189861 189166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 190386 193181 gene locus_tag LOCUS_14980 190386 193181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 193178 194557 gene locus_tag LOCUS_14990 193178 194557 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_14990 195198 194554 gene locus_tag LOCUS_15000 195198 194554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546133.1 protein_id gnl|my_center|LOCUS_15000 196096 195425 gene locus_tag LOCUS_15010 196096 195425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 196739 196344 gene locus_tag LOCUS_15020 196739 196344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 <197445 196919 gene locus_tag LOCUS_15030 <197445 196919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084641929.1:nitrilase-related carbon-nitrogen hydrolase >Feature sequence08 189 629 gene locus_tag LOCUS_15040 gene gloA 189 629 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_15040 1047 655 gene locus_tag LOCUS_15050 1047 655 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_15050 2310 1090 gene locus_tag LOCUS_15060 2310 1090 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868574.1 protein_id gnl|my_center|LOCUS_15060 2381 3667 gene locus_tag LOCUS_15070 2381 3667 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_15070 3700 4887 gene locus_tag LOCUS_15080 3700 4887 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817751.1 protein_id gnl|my_center|LOCUS_15080 4971 5735 gene locus_tag LOCUS_15090 4971 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_15090 5738 6541 gene locus_tag LOCUS_15100 5738 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7732 6461 gene locus_tag LOCUS_15110 7732 6461 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_15110 7983 9029 gene locus_tag LOCUS_15120 7983 9029 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704825.1 protein_id gnl|my_center|LOCUS_15120 9026 9832 gene locus_tag LOCUS_15130 9026 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9844 10776 gene locus_tag LOCUS_15140 9844 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 11934 10786 gene locus_tag LOCUS_15150 11934 10786 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_15150 12008 12946 gene locus_tag LOCUS_15160 12008 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 12972 13508 gene locus_tag LOCUS_15170 12972 13508 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_15170 13550 14920 gene locus_tag LOCUS_15180 13550 14920 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_15180 15010 16125 gene locus_tag LOCUS_15190 15010 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 17376 16129 gene locus_tag LOCUS_15200 17376 16129 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974941.1 protein_id gnl|my_center|LOCUS_15200 17794 17390 gene locus_tag LOCUS_15210 17794 17390 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085844.1 protein_id gnl|my_center|LOCUS_15210 18558 17827 gene locus_tag LOCUS_15220 18558 17827 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_15220 19172 18579 gene locus_tag LOCUS_15230 gene rpsD 19172 18579 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_15230 20471 19392 gene locus_tag LOCUS_15240 20471 19392 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_15240 22778 20544 gene locus_tag LOCUS_15250 22778 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 23998 22778 gene locus_tag LOCUS_15260 23998 22778 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_15260 25823 24033 gene locus_tag LOCUS_15270 25823 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 25893 26123 gene locus_tag LOCUS_15280 25893 26123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 26701 26132 gene locus_tag LOCUS_15290 26701 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 27057 26698 gene locus_tag LOCUS_15300 27057 26698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 28444 27071 gene locus_tag LOCUS_15310 28444 27071 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_15310 29262 28441 gene locus_tag LOCUS_15320 29262 28441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 30773 29262 gene locus_tag LOCUS_15330 30773 29262 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_15330 32854 30887 gene locus_tag LOCUS_15340 32854 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 33840 32851 gene locus_tag LOCUS_15350 33840 32851 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_15350 34535 33792 gene locus_tag LOCUS_15360 34535 33792 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_15360 35388 34543 gene locus_tag LOCUS_15370 35388 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 35440 36564 gene locus_tag LOCUS_15380 35440 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 36561 37955 gene locus_tag LOCUS_15390 36561 37955 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_15390 38301 38023 gene locus_tag LOCUS_15400 38301 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 38356 39402 gene locus_tag LOCUS_15410 38356 39402 CDS product sugar phosphate isomerase/epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421554.1 protein_id gnl|my_center|LOCUS_15410 40651 39407 gene locus_tag LOCUS_15420 40651 39407 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_15420 40670 40903 gene locus_tag LOCUS_15430 40670 40903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 41335 40937 gene locus_tag LOCUS_15440 41335 40937 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_15440 41571 41332 gene locus_tag LOCUS_15450 41571 41332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 42496 41618 gene locus_tag LOCUS_15460 gene tesB 42496 41618 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_15460 43011 42493 gene locus_tag LOCUS_15470 43011 42493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 44276 43038 gene locus_tag LOCUS_15480 44276 43038 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444040.1 protein_id gnl|my_center|LOCUS_15480 44260 45492 gene locus_tag LOCUS_15490 44260 45492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 46982 45495 gene locus_tag LOCUS_15500 46982 45495 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_15500 48474 46990 gene locus_tag LOCUS_15510 48474 46990 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_15510 48901 48503 gene locus_tag LOCUS_15520 48901 48503 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_15520 49398 48898 gene locus_tag LOCUS_15530 49398 48898 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_15530 49958 49395 gene locus_tag LOCUS_15540 49958 49395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 50277 49945 gene locus_tag LOCUS_15550 gene mnhG 50277 49945 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_15550 50555 50274 gene locus_tag LOCUS_15560 50555 50274 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_15560 51046 50555 gene locus_tag LOCUS_15570 51046 50555 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_15570 51508 51077 gene locus_tag LOCUS_15580 51508 51077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 53646 51505 gene locus_tag LOCUS_15590 53646 51505 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 protein_id gnl|my_center|LOCUS_15590 54694 53660 gene locus_tag LOCUS_15600 54694 53660 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126540609.1 protein_id gnl|my_center|LOCUS_15600 56242 54701 gene locus_tag LOCUS_15610 56242 54701 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_15610 56397 57455 gene locus_tag LOCUS_15620 56397 57455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 57520 58071 gene locus_tag LOCUS_15630 gene thpR 57520 58071 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 protein_id gnl|my_center|LOCUS_15630 59019 58078 gene locus_tag LOCUS_15640 59019 58078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_15640 62273 59016 gene locus_tag LOCUS_15650 62273 59016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 63306 62278 gene locus_tag LOCUS_15660 63306 62278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 63454 64020 gene locus_tag LOCUS_15670 63454 64020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 64330 64025 gene locus_tag LOCUS_15680 gene rpsN 64330 64025 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_15680 66673 64451 gene locus_tag LOCUS_15690 66673 64451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 67278 66670 gene locus_tag LOCUS_15700 gene pyrE 67278 66670 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_15700 67323 67892 gene locus_tag LOCUS_15710 gene mog 67323 67892 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_15710 67904 70117 gene locus_tag LOCUS_15720 67904 70117 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_15720 70128 70811 gene locus_tag LOCUS_15730 70128 70811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 72100 71030 gene locus_tag LOCUS_15740 72100 71030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 73422 72343 gene locus_tag LOCUS_15750 73422 72343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 73957 73496 gene locus_tag LOCUS_15760 73957 73496 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 protein_id gnl|my_center|LOCUS_15760 75363 73987 gene locus_tag LOCUS_15770 75363 73987 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 protein_id gnl|my_center|LOCUS_15770 76445 75408 gene locus_tag LOCUS_15780 76445 75408 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257661.1 protein_id gnl|my_center|LOCUS_15780 76563 77720 gene locus_tag LOCUS_15790 76563 77720 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_15790 77869 79032 gene locus_tag LOCUS_15800 77869 79032 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_15800 79063 82626 gene locus_tag LOCUS_15810 79063 82626 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_15810 82623 85751 gene locus_tag LOCUS_15820 82623 85751 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_15820 85966 89136 gene locus_tag LOCUS_15830 85966 89136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 91271 89715 gene locus_tag LOCUS_15840 91271 89715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 92964 91297 gene locus_tag LOCUS_15850 92964 91297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 94625 92973 gene locus_tag LOCUS_15860 94625 92973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 96322 94622 gene locus_tag LOCUS_15870 96322 94622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 97706 96363 gene locus_tag LOCUS_15880 97706 96363 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_15880 99433 97703 gene locus_tag LOCUS_15890 99433 97703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 99846 99439 gene locus_tag LOCUS_15900 99846 99439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 100230 99898 gene locus_tag LOCUS_15910 100230 99898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 102716 100731 gene locus_tag LOCUS_15920 102716 100731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 103162 102713 gene locus_tag LOCUS_15930 103162 102713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 105569 103200 gene locus_tag LOCUS_15940 105569 103200 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_15940 105619 107580 gene locus_tag LOCUS_15950 105619 107580 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204928.1 protein_id gnl|my_center|LOCUS_15950 107593 108372 gene locus_tag LOCUS_15960 107593 108372 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_15960 108372 110348 gene locus_tag LOCUS_15970 108372 110348 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_15970 110350 111096 gene locus_tag LOCUS_15980 gene map 110350 111096 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061441.1 protein_id gnl|my_center|LOCUS_15980 111111 112919 gene locus_tag LOCUS_15990 111111 112919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 112938 114119 gene locus_tag LOCUS_16000 112938 114119 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_16000 114173 115150 gene locus_tag LOCUS_16010 114173 115150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 115147 116034 gene locus_tag LOCUS_16020 115147 116034 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_16020 116476 116039 gene locus_tag LOCUS_16030 116476 116039 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_16030 116721 116473 gene locus_tag LOCUS_16040 116721 116473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975287.1 protein_id gnl|my_center|LOCUS_16040 117858 116728 gene locus_tag LOCUS_16050 117858 116728 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_16050 118544 117864 gene locus_tag LOCUS_16060 118544 117864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 119596 118541 gene locus_tag LOCUS_16070 119596 118541 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_16070 120230 119685 gene locus_tag LOCUS_16080 120230 119685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 121249 120302 gene locus_tag LOCUS_16090 121249 120302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_16090 122616 121246 gene locus_tag LOCUS_16100 122616 121246 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_16100 122809 123045 gene locus_tag LOCUS_16110 122809 123045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 123973 123062 gene locus_tag LOCUS_16120 123973 123062 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_16120 124896 124021 gene locus_tag LOCUS_16130 124896 124021 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_16130 125425 124919 gene locus_tag LOCUS_16140 gene phaR 125425 124919 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_16140 125598 125933 gene locus_tag LOCUS_16150 125598 125933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 125943 126332 gene locus_tag LOCUS_16160 125943 126332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 126329 127456 gene locus_tag LOCUS_16170 126329 127456 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085669.1 protein_id gnl|my_center|LOCUS_16170 127470 128111 gene locus_tag LOCUS_16180 127470 128111 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_16180 128163 129701 gene locus_tag LOCUS_16190 gene fadD13 128163 129701 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_16190 129770 131296 gene locus_tag LOCUS_16200 129770 131296 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538264.1 protein_id gnl|my_center|LOCUS_16200 131696 131316 gene locus_tag LOCUS_16210 131696 131316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 133431 131689 gene locus_tag LOCUS_16220 133431 131689 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_16220 134954 133422 gene locus_tag LOCUS_16230 134954 133422 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_16230 135060 136865 gene locus_tag LOCUS_16240 135060 136865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_16240 136865 138385 gene locus_tag LOCUS_16250 136865 138385 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_16250 139155 138382 gene locus_tag LOCUS_16260 139155 138382 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_16260 139239 141023 gene locus_tag LOCUS_16270 gene ggt 139239 141023 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595115.1 protein_id gnl|my_center|LOCUS_16270 141020 141778 gene locus_tag LOCUS_16280 gene modA 141020 141778 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_16280 141791 142468 gene locus_tag LOCUS_16290 gene modB 141791 142468 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_16290 142458 143576 gene locus_tag LOCUS_16300 gene modC 142458 143576 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_16300 143607 144914 gene locus_tag LOCUS_16310 143607 144914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_16310 145023 147788 gene locus_tag LOCUS_16320 145023 147788 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_16320 149789 147837 gene locus_tag LOCUS_16330 149789 147837 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_16330 149858 150235 gene locus_tag LOCUS_16340 149858 150235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 151585 150263 gene locus_tag LOCUS_16350 151585 150263 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_16350 152987 151623 gene locus_tag LOCUS_16360 152987 151623 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_16360 153066 154067 gene locus_tag LOCUS_16370 153066 154067 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_16370 154130 154534 gene locus_tag LOCUS_16380 154130 154534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 154844 155770 gene locus_tag LOCUS_16390 154844 155770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 156995 155898 gene locus_tag LOCUS_16400 156995 155898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 158068 157052 gene locus_tag LOCUS_16410 158068 157052 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_16410 158106 159299 gene locus_tag LOCUS_16420 158106 159299 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_16420 159316 160740 gene locus_tag LOCUS_16430 159316 160740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 162098 160746 gene locus_tag LOCUS_16440 162098 160746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 162865 162041 gene locus_tag LOCUS_16450 162865 162041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 164034 162952 gene locus_tag LOCUS_16460 164034 162952 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110512.1 protein_id gnl|my_center|LOCUS_16460 165828 164107 gene locus_tag LOCUS_16470 165828 164107 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_16470 166484 165843 gene locus_tag LOCUS_16480 166484 165843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 166981 166496 gene locus_tag LOCUS_16490 166981 166496 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_16490 168720 166978 gene locus_tag LOCUS_16500 168720 166978 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_16500 169679 168717 gene locus_tag LOCUS_16510 169679 168717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965847.1 protein_id gnl|my_center|LOCUS_16510 169828 170640 gene locus_tag LOCUS_16520 169828 170640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 170840 170637 gene locus_tag LOCUS_16530 170840 170637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 170883 171242 gene locus_tag LOCUS_16540 170883 171242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 171418 171200 gene locus_tag LOCUS_16550 171418 171200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 171678 171439 gene locus_tag LOCUS_16560 171678 171439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 173258 171675 gene locus_tag LOCUS_16570 173258 171675 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_16570 174133 173255 gene locus_tag LOCUS_16580 174133 173255 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_16580 176232 174130 gene locus_tag LOCUS_16590 176232 174130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 176649 176269 gene locus_tag LOCUS_16600 176649 176269 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_16600 176906 176652 gene locus_tag LOCUS_16610 176906 176652 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_16610 177003 178031 gene locus_tag LOCUS_16620 177003 178031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 178532 178035 gene locus_tag LOCUS_16630 178532 178035 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775378.1 protein_id gnl|my_center|LOCUS_16630 178660 178935 gene locus_tag LOCUS_16640 178660 178935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 178990 179196 gene locus_tag LOCUS_16650 178990 179196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 179196 180326 gene locus_tag LOCUS_16660 179196 180326 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_16660 180323 181807 gene locus_tag LOCUS_16670 180323 181807 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_16670 181828 182376 gene locus_tag LOCUS_16680 181828 182376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 182413 183984 gene locus_tag LOCUS_16690 182413 183984 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_16690 184003 184716 gene locus_tag LOCUS_16700 184003 184716 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_16700 185909 184713 gene locus_tag LOCUS_16710 185909 184713 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_16710 186109 187149 gene locus_tag LOCUS_16720 186109 187149 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_16720 187167 188843 gene locus_tag LOCUS_16730 187167 188843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 188840 190516 gene locus_tag LOCUS_16740 188840 190516 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_16740 191666 190527 gene locus_tag LOCUS_16750 191666 190527 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_16750 192286 191699 gene locus_tag LOCUS_16760 192286 191699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 192432 193133 gene locus_tag LOCUS_16770 192432 193133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_16770 193176 194114 gene locus_tag LOCUS_16780 193176 194114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 194115 194729 gene locus_tag LOCUS_16790 194115 194729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 195313 194726 gene locus_tag LOCUS_16800 195313 194726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 196299 195313 gene locus_tag LOCUS_16810 196299 195313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence09 77 706 gene locus_tag LOCUS_16820 77 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 877 6093 gene locus_tag LOCUS_16830 877 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6517 6203 gene locus_tag LOCUS_16840 6517 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6411 10367 gene locus_tag LOCUS_16850 6411 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10904 10407 gene locus_tag LOCUS_16860 10904 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 12210 10915 gene locus_tag LOCUS_16870 12210 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 13685 12207 gene locus_tag LOCUS_16880 13685 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 14059 13682 gene locus_tag LOCUS_16890 14059 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 14519 14064 gene locus_tag LOCUS_16900 14519 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 14806 16005 gene locus_tag LOCUS_16910 14806 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 16007 17446 gene locus_tag LOCUS_16920 16007 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 17443 20259 gene locus_tag LOCUS_16930 17443 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 21134 21751 gene locus_tag LOCUS_16940 gene cas4 21134 21751 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_16940 21739 22755 gene locus_tag LOCUS_16950 gene cas1c 21739 22755 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_16950 22759 23049 gene locus_tag LOCUS_16960 gene cas2 22759 23049 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_16960 23254 23885 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgtcgccggggcctatgctccggccttcgttgagcg 23889 24361 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgtcgccggggcttaggctccggcctt 24560 25024 gene locus_tag LOCUS_16970 24560 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 25021 26295 gene locus_tag LOCUS_16980 25021 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 26361 29465 gene locus_tag LOCUS_16990 26361 29465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 29796 30830 gene locus_tag LOCUS_17000 29796 30830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 31015 31434 gene locus_tag LOCUS_17010 31015 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 31434 31751 gene locus_tag LOCUS_17020 31434 31751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 31912 32268 gene locus_tag LOCUS_17030 31912 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 34626 32578 gene locus_tag LOCUS_17040 34626 32578 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965347.1 protein_id gnl|my_center|LOCUS_17040 34959 34889 gene locus_tag LOCUS_t00220 34959 34889 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35076 35003 gene locus_tag LOCUS_t00230 35076 35003 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35750 35097 gene locus_tag LOCUS_17050 35750 35097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 36348 35887 gene locus_tag LOCUS_17060 36348 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 37200 36946 gene locus_tag LOCUS_17070 37200 36946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 37461 38165 gene locus_tag LOCUS_17080 37461 38165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 38338 38901 gene locus_tag LOCUS_17090 38338 38901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 38934 39119 gene locus_tag LOCUS_17100 gene rpmF 38934 39119 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_17100 39183 40211 gene locus_tag LOCUS_17110 gene plsX 39183 40211 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_17110 40244 41251 gene locus_tag LOCUS_17120 40244 41251 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_17120 41274 42203 gene locus_tag LOCUS_17130 gene fabD 41274 42203 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_17130 42200 42946 gene locus_tag LOCUS_17140 gene fabG 42200 42946 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389704.1 protein_id gnl|my_center|LOCUS_17140 43066 43305 gene locus_tag LOCUS_17150 gene acpP 43066 43305 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_17150 43339 44580 gene locus_tag LOCUS_17160 gene fabF 43339 44580 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_17160 45200 44598 gene locus_tag LOCUS_17170 45200 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 45281 45982 gene locus_tag LOCUS_17180 45281 45982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 46337 47878 gene locus_tag LOCUS_17190 46337 47878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 47875 48876 gene locus_tag LOCUS_17200 47875 48876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 48873 49511 gene locus_tag LOCUS_17210 gene hisG 48873 49511 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_17210 49504 50904 gene locus_tag LOCUS_17220 gene hisD 49504 50904 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391986.1 protein_id gnl|my_center|LOCUS_17220 50901 51995 gene locus_tag LOCUS_17230 50901 51995 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227928.1 protein_id gnl|my_center|LOCUS_17230 51992 52591 gene locus_tag LOCUS_17240 gene hisB 51992 52591 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_17240 52588 53253 gene locus_tag LOCUS_17250 gene hisH 52588 53253 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404308.1 protein_id gnl|my_center|LOCUS_17250 53231 53971 gene locus_tag LOCUS_17260 gene hisA 53231 53971 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_17260 53968 54777 gene locus_tag LOCUS_17270 gene hisF 53968 54777 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111203.1 protein_id gnl|my_center|LOCUS_17270 54774 55427 gene locus_tag LOCUS_17280 gene hisIE 54774 55427 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_17280 55424 56917 gene locus_tag LOCUS_17290 gene trpE 55424 56917 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17290 56914 57492 gene locus_tag LOCUS_17300 56914 57492 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 protein_id gnl|my_center|LOCUS_17300 57485 58525 gene locus_tag LOCUS_17310 gene trpD 57485 58525 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_17310 58529 59365 gene locus_tag LOCUS_17320 gene trpC 58529 59365 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_17320 59362 60003 gene locus_tag LOCUS_17330 59362 60003 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 protein_id gnl|my_center|LOCUS_17330 60000 61292 gene locus_tag LOCUS_17340 gene trpB 60000 61292 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_17340 61289 62119 gene locus_tag LOCUS_17350 gene trpA 61289 62119 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_17350 62258 62428 gene locus_tag LOCUS_17360 62258 62428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 62468 63517 gene locus_tag LOCUS_17370 62468 63517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 63507 65825 gene locus_tag LOCUS_17380 63507 65825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 67554 65833 gene locus_tag LOCUS_17390 67554 65833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 69333 67579 gene locus_tag LOCUS_17400 69333 67579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 69499 70440 gene locus_tag LOCUS_17410 69499 70440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 70551 71174 gene locus_tag LOCUS_17420 70551 71174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 71189 74023 gene locus_tag LOCUS_17430 71189 74023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 74023 74973 gene locus_tag LOCUS_17440 74023 74973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_17440 74960 75832 gene locus_tag LOCUS_17450 74960 75832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 75829 76785 gene locus_tag LOCUS_17460 75829 76785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_17460 76782 77636 gene locus_tag LOCUS_17470 76782 77636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 77763 78185 gene locus_tag LOCUS_17480 gene arfB 77763 78185 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957569.1 protein_id gnl|my_center|LOCUS_17480 78596 78189 gene locus_tag LOCUS_17490 78596 78189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 78650 79975 gene locus_tag LOCUS_17500 78650 79975 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_17500 80770 80012 gene locus_tag LOCUS_17510 80770 80012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 81694 80774 gene locus_tag LOCUS_17520 81694 80774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 82517 81735 gene locus_tag LOCUS_17530 82517 81735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 83269 82559 gene locus_tag LOCUS_17540 83269 82559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 83872 83318 gene locus_tag LOCUS_17550 83872 83318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 83795 84133 gene locus_tag LOCUS_17560 83795 84133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 84133 84300 gene locus_tag LOCUS_17570 84133 84300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 84755 84324 gene locus_tag LOCUS_17580 84755 84324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 84970 85161 gene locus_tag LOCUS_17590 84970 85161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 85161 85388 gene locus_tag LOCUS_17600 85161 85388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 86141 85668 gene locus_tag LOCUS_17610 86141 85668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 86440 86141 gene locus_tag LOCUS_17620 86440 86141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 91854 86386 gene locus_tag LOCUS_17630 91854 86386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 86708 86717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92516 91848 gene locus_tag LOCUS_17640 92516 91848 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211708.1 protein_id gnl|my_center|LOCUS_17640 93247 92558 gene locus_tag LOCUS_17650 93247 92558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 93606 93244 gene locus_tag LOCUS_17660 93606 93244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 96146 93606 gene locus_tag LOCUS_17670 96146 93606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 96411 96139 gene locus_tag LOCUS_17680 96411 96139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 96845 96474 gene locus_tag LOCUS_17690 96845 96474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 97861 96842 gene locus_tag LOCUS_17700 97861 96842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 98324 97863 gene locus_tag LOCUS_17710 98324 97863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 98830 98321 gene locus_tag LOCUS_17720 98830 98321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 99314 98850 gene locus_tag LOCUS_17730 99314 98850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 99502 99323 gene locus_tag LOCUS_17740 99502 99323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 100478 99528 gene locus_tag LOCUS_17750 100478 99528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 protein_id gnl|my_center|LOCUS_17750 100851 100495 gene locus_tag LOCUS_17760 100851 100495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 101919 100852 gene locus_tag LOCUS_17770 101919 100852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 101995 102258 gene locus_tag LOCUS_17780 101995 102258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 102259 104967 gene locus_tag LOCUS_17790 102259 104967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 104972 105679 gene locus_tag LOCUS_17800 104972 105679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 105783 106715 gene locus_tag LOCUS_17810 105783 106715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 106712 107233 gene locus_tag LOCUS_17820 106712 107233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 108075 107230 gene locus_tag LOCUS_17830 108075 107230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900086.1 protein_id gnl|my_center|LOCUS_17830 108857 109171 gene locus_tag LOCUS_17840 108857 109171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 109923 109429 gene locus_tag LOCUS_17850 109923 109429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 109944 110204 gene locus_tag LOCUS_17860 109944 110204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 110405 110881 gene locus_tag LOCUS_17870 110405 110881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 110881 111081 gene locus_tag LOCUS_17880 110881 111081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 111078 111593 gene locus_tag LOCUS_17890 111078 111593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 111590 111871 gene locus_tag LOCUS_17900 111590 111871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 111868 112647 gene locus_tag LOCUS_17910 111868 112647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 112644 113036 gene locus_tag LOCUS_17920 112644 113036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 113083 114672 gene locus_tag LOCUS_17930 113083 114672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 114669 115520 gene locus_tag LOCUS_17940 114669 115520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 115517 115846 gene locus_tag LOCUS_17950 115517 115846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 115843 116778 gene locus_tag LOCUS_17960 115843 116778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 116898 117071 gene locus_tag LOCUS_17970 116898 117071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 117068 117529 gene locus_tag LOCUS_17980 117068 117529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 117526 117708 gene locus_tag LOCUS_17990 117526 117708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 117705 118400 gene locus_tag LOCUS_18000 117705 118400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 118397 118687 gene locus_tag LOCUS_18010 118397 118687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 118680 119351 gene locus_tag LOCUS_18020 118680 119351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 119354 119710 gene locus_tag LOCUS_18030 119354 119710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 119707 120027 gene locus_tag LOCUS_18040 119707 120027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 120047 120580 gene locus_tag LOCUS_18050 120047 120580 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018652012.1 protein_id gnl|my_center|LOCUS_18050 120577 122094 gene locus_tag LOCUS_18060 120577 122094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_18060 122094 123662 gene locus_tag LOCUS_18070 122094 123662 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_18070 123652 124464 gene locus_tag LOCUS_18080 123652 124464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 124461 126224 gene locus_tag LOCUS_18090 124461 126224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 126224 127243 gene locus_tag LOCUS_18100 126224 127243 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_18100 127236 128846 gene locus_tag LOCUS_18110 127236 128846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 128974 129252 gene locus_tag LOCUS_18120 128974 129252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 129252 129701 gene locus_tag LOCUS_18130 129252 129701 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_18130 130408 129809 gene locus_tag LOCUS_18140 130408 129809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 131142 130411 gene locus_tag LOCUS_18150 131142 130411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 131846 131145 gene locus_tag LOCUS_18160 131846 131145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 133652 131856 gene locus_tag LOCUS_18170 133652 131856 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_18170 134452 133649 gene locus_tag LOCUS_18180 gene otsB 134452 133649 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_18180 134534 135889 gene locus_tag LOCUS_18190 134534 135889 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_18190 135895 137139 gene locus_tag LOCUS_18200 135895 137139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 137172 138269 gene locus_tag LOCUS_18210 gene msrP 137172 138269 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_18210 138311 138571 gene locus_tag LOCUS_18220 138311 138571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 138885 138568 gene locus_tag LOCUS_18230 138885 138568 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_18230 140588 139008 gene locus_tag LOCUS_18240 140588 139008 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_18240 140703 140912 gene locus_tag LOCUS_18250 140703 140912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 141002 142459 gene locus_tag LOCUS_18260 141002 142459 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_18260 142456 143574 gene locus_tag LOCUS_18270 142456 143574 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_18270 145074 143638 gene locus_tag LOCUS_18280 145074 143638 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_18280 146535 145135 gene locus_tag LOCUS_18290 gene hemG 146535 145135 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383354.1 protein_id gnl|my_center|LOCUS_18290 147500 146532 gene locus_tag LOCUS_18300 gene hemE 147500 146532 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_18300 148981 147623 gene locus_tag LOCUS_18310 148981 147623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 150112 149027 gene locus_tag LOCUS_18320 gene hemH 150112 149027 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_18320 151129 150119 gene locus_tag LOCUS_18330 gene hemF 151129 150119 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 protein_id gnl|my_center|LOCUS_18330 152424 151126 gene locus_tag LOCUS_18340 gene hemL 152424 151126 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_18340 154304 152421 gene locus_tag LOCUS_18350 154304 152421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 154433 156253 gene locus_tag LOCUS_18360 154433 156253 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_18360 156258 157034 gene locus_tag LOCUS_18370 gene xth 156258 157034 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_18370 158650 157040 gene locus_tag LOCUS_18380 158650 157040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_18380 159191 158664 gene locus_tag LOCUS_18390 159191 158664 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_18390 160279 159299 gene locus_tag LOCUS_18400 160279 159299 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_18400 160622 160449 gene locus_tag LOCUS_18410 160622 160449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 160570 163950 gene locus_tag LOCUS_18420 160570 163950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 164008 165033 gene locus_tag LOCUS_18430 gene galE 164008 165033 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_18430 165030 165692 gene locus_tag LOCUS_18440 165030 165692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 165693 167426 gene locus_tag LOCUS_18450 165693 167426 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18450 167423 168787 gene locus_tag LOCUS_18460 167423 168787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 168784 170274 gene locus_tag LOCUS_18470 gene gltX 168784 170274 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_18470 170633 170283 gene locus_tag LOCUS_18480 170633 170283 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967765.1 protein_id gnl|my_center|LOCUS_18480 171227 170685 gene locus_tag LOCUS_18490 171227 170685 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_18490 172970 171270 gene locus_tag LOCUS_18500 172970 171270 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_18500 173064 174272 gene locus_tag LOCUS_18510 173064 174272 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_18510 175012 174290 gene locus_tag LOCUS_18520 175012 174290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_18520 175335 175009 gene locus_tag LOCUS_18530 175335 175009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 175321 175602 gene locus_tag LOCUS_18540 175321 175602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 176618 175665 gene locus_tag LOCUS_18550 176618 175665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 176779 177291 gene locus_tag LOCUS_18560 176779 177291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 177429 178319 gene locus_tag LOCUS_18570 177429 178319 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_18570 180616 178316 gene locus_tag LOCUS_18580 180616 178316 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_18580 181752 180655 gene locus_tag LOCUS_18590 181752 180655 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_18590 <186868 181752 gene locus_tag LOCUS_18600 <186868 181752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein >Feature sequence10 94 1023 gene locus_tag LOCUS_18610 gene argF 94 1023 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 protein_id gnl|my_center|LOCUS_18610 1087 2517 gene locus_tag LOCUS_18620 gene purB 1087 2517 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_18620 2525 3238 gene locus_tag LOCUS_18630 2525 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4866 3259 gene locus_tag LOCUS_18640 gene serA 4866 3259 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_18640 6074 4890 gene locus_tag LOCUS_18650 6074 4890 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_18650 6566 6087 gene locus_tag LOCUS_18660 gene moaC 6566 6087 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_18660 6651 7334 gene locus_tag LOCUS_18670 6651 7334 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_18670 7640 7365 gene locus_tag LOCUS_18680 gene hupA 7640 7365 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_18680 9180 7774 gene locus_tag LOCUS_18690 gene rsmB 9180 7774 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_18690 10175 9177 gene locus_tag LOCUS_18700 gene fmt 10175 9177 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_18700 12554 10188 gene locus_tag LOCUS_18710 12554 10188 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938956.1 protein_id gnl|my_center|LOCUS_18710 13515 12628 gene locus_tag LOCUS_18720 13515 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 13514 15835 gene locus_tag LOCUS_18730 13514 15835 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114386.1 protein_id gnl|my_center|LOCUS_18730 15825 16619 gene locus_tag LOCUS_18740 15825 16619 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_18740 16616 17344 gene locus_tag LOCUS_18750 16616 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 19465 17345 gene locus_tag LOCUS_18760 19465 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 20763 19486 gene locus_tag LOCUS_18770 20763 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 22139 20793 gene locus_tag LOCUS_18780 gene rho 22139 20793 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_18780 22755 22177 gene locus_tag LOCUS_18790 gene yihA 22755 22177 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_18790 25254 22786 gene locus_tag LOCUS_18800 gene lon 25254 22786 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_18800 26492 25257 gene locus_tag LOCUS_18810 gene clpX 26492 25257 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_18810 27204 26614 gene locus_tag LOCUS_18820 gene clpP 27204 26614 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_18820 28564 27209 gene locus_tag LOCUS_18830 gene tig 28564 27209 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_18830 28715 28631 gene locus_tag LOCUS_t00240 28715 28631 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28803 28728 gene locus_tag LOCUS_t00250 28803 28728 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29096 28875 gene locus_tag LOCUS_18840 gene thiS 29096 28875 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_18840 29526 29074 gene locus_tag LOCUS_18850 29526 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 30116 29523 gene locus_tag LOCUS_18860 gene nadD 30116 29523 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_18860 31174 30113 gene locus_tag LOCUS_18870 gene obgE 31174 30113 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_18870 31456 31199 gene locus_tag LOCUS_18880 gene rpmA 31456 31199 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_18880 31817 31488 gene locus_tag LOCUS_18890 gene rplU 31817 31488 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_18890 33260 31959 gene locus_tag LOCUS_18900 33260 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 33365 34966 gene locus_tag LOCUS_18910 33365 34966 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_18910 34983 35948 gene locus_tag LOCUS_18920 34983 35948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_18920 35945 36982 gene locus_tag LOCUS_18930 35945 36982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 36979 38007 gene locus_tag LOCUS_18940 gene queA 36979 38007 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_18940 38729 37971 gene locus_tag LOCUS_18950 gene larB 38729 37971 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_18950 39523 38741 gene locus_tag LOCUS_18960 gene larE 39523 38741 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_18960 39971 39525 gene locus_tag LOCUS_18970 39971 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 40364 39987 gene locus_tag LOCUS_18980 gene gcvH 40364 39987 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404804.1 protein_id gnl|my_center|LOCUS_18980 41512 40382 gene locus_tag LOCUS_18990 gene gcvT 41512 40382 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404363.1 protein_id gnl|my_center|LOCUS_18990 41546 43279 gene locus_tag LOCUS_19000 41546 43279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 44569 43292 gene locus_tag LOCUS_19010 44569 43292 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_19010 45857 44559 gene locus_tag LOCUS_19020 45857 44559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 46597 45854 gene locus_tag LOCUS_19030 46597 45854 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_19030 46925 46695 gene locus_tag LOCUS_19040 46925 46695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 47304 46909 gene locus_tag LOCUS_19050 47304 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 47368 47443 gene locus_tag LOCUS_t00260 47368 47443 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48217 47462 gene locus_tag LOCUS_19060 48217 47462 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_19060 48242 49636 gene locus_tag LOCUS_19070 48242 49636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 51276 49633 gene locus_tag LOCUS_19080 51276 49633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 51632 51273 gene locus_tag LOCUS_19090 51632 51273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 52109 51666 gene locus_tag LOCUS_19100 52109 51666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 52332 52147 gene locus_tag LOCUS_19110 52332 52147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 54089 52599 gene locus_tag LOCUS_19120 54089 52599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 56946 54100 gene locus_tag LOCUS_19130 gene uvrA 56946 54100 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_19130 57494 56943 gene locus_tag LOCUS_19140 gene smpB 57494 56943 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_19140 57754 58746 gene locus_tag LOCUS_19150 gene lpxC 57754 58746 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389005.1 protein_id gnl|my_center|LOCUS_19150 58879 59493 gene locus_tag LOCUS_19160 58879 59493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 59490 61748 gene locus_tag LOCUS_19170 59490 61748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_19170 61770 63137 gene locus_tag LOCUS_19180 61770 63137 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_19180 63134 65059 gene locus_tag LOCUS_19190 gene selB 63134 65059 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_19190 65111 66136 gene locus_tag LOCUS_19200 65111 66136 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_19200 68820 66133 gene locus_tag LOCUS_19210 gene polA 68820 66133 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_19210 68849 69145 gene locus_tag LOCUS_19220 68849 69145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 69272 72415 gene locus_tag LOCUS_19230 69272 72415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 72506 73915 gene locus_tag LOCUS_19240 72506 73915 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_19240 74924 73935 gene locus_tag LOCUS_19250 gene lpxK 74924 73935 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_19250 76198 74921 gene locus_tag LOCUS_19260 gene waaA 76198 74921 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_19260 76365 77048 gene locus_tag LOCUS_19270 76365 77048 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_19270 77045 77608 gene locus_tag LOCUS_19280 77045 77608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 77605 78348 gene locus_tag LOCUS_19290 77605 78348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 78362 79600 gene locus_tag LOCUS_19300 78362 79600 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_19300 79600 81285 gene locus_tag LOCUS_19310 79600 81285 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_19310 81326 82261 gene locus_tag LOCUS_19320 81326 82261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 82258 82920 gene locus_tag LOCUS_19330 82258 82920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 82917 83498 gene locus_tag LOCUS_19340 82917 83498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 83495 84100 gene locus_tag LOCUS_19350 83495 84100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 84114 86534 gene locus_tag LOCUS_19360 84114 86534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 86531 87001 gene locus_tag LOCUS_19370 86531 87001 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_19370 87003 87452 gene locus_tag LOCUS_19380 87003 87452 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_19380 87439 88155 gene locus_tag LOCUS_19390 87439 88155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 88161 88625 gene locus_tag LOCUS_19400 gene dut 88161 88625 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_19400 89220 88630 gene locus_tag LOCUS_19410 89220 88630 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338648.1 protein_id gnl|my_center|LOCUS_19410 89383 92082 gene locus_tag LOCUS_19420 gene acnA 89383 92082 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_19420 92152 92874 gene locus_tag LOCUS_19430 gene queE 92152 92874 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_19430 93004 94269 gene locus_tag LOCUS_19440 93004 94269 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_19440 94794 94273 gene locus_tag LOCUS_19450 gene ripB 94794 94273 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_19450 95912 94791 gene locus_tag LOCUS_19460 95912 94791 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_19460 95963 97243 gene locus_tag LOCUS_19470 gene pcnB 95963 97243 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062037.1 protein_id gnl|my_center|LOCUS_19470 98776 97250 gene locus_tag LOCUS_19480 98776 97250 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_19480 99498 98773 gene locus_tag LOCUS_19490 99498 98773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 100832 99495 gene locus_tag LOCUS_19500 100832 99495 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_19500 101400 100834 gene locus_tag LOCUS_19510 gene rfbC 101400 100834 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_19510 102284 101397 gene locus_tag LOCUS_19520 gene rfbA 102284 101397 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_19520 103396 102281 gene locus_tag LOCUS_19530 gene rfbB 103396 102281 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 protein_id gnl|my_center|LOCUS_19530 104441 103419 gene locus_tag LOCUS_19540 104441 103419 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_19540 104430 105044 gene locus_tag LOCUS_19550 104430 105044 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_19550 105140 106846 gene locus_tag LOCUS_19560 105140 106846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 106859 108184 gene locus_tag LOCUS_19570 106859 108184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 107930 108029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108097 108864 gene locus_tag LOCUS_19580 108097 108864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 108861 110639 gene locus_tag LOCUS_19590 108861 110639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 110636 112651 gene locus_tag LOCUS_19600 110636 112651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 114390 113122 gene locus_tag LOCUS_19610 114390 113122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 114892 114425 gene locus_tag LOCUS_19620 114892 114425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 115135 114896 gene locus_tag LOCUS_19630 115135 114896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 116060 115221 gene locus_tag LOCUS_19640 116060 115221 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974754.1 protein_id gnl|my_center|LOCUS_19640 116938 116072 gene locus_tag LOCUS_19650 116938 116072 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_19650 118217 116931 gene locus_tag LOCUS_19660 118217 116931 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_19660 118280 119044 gene locus_tag LOCUS_19670 118280 119044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 119835 119041 gene locus_tag LOCUS_19680 119835 119041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_19680 121049 119850 gene locus_tag LOCUS_19690 121049 119850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_19690 122171 121128 gene locus_tag LOCUS_19700 122171 121128 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_19700 123053 122175 gene locus_tag LOCUS_19710 123053 122175 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_19710 125013 123064 gene locus_tag LOCUS_19720 125013 123064 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_19720 125861 125010 gene locus_tag LOCUS_19730 125861 125010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_19730 125919 127178 gene locus_tag LOCUS_19740 125919 127178 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_19740 127187 129043 gene locus_tag LOCUS_19750 127187 129043 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_19750 129188 130198 gene locus_tag LOCUS_19760 129188 130198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 130195 131634 gene locus_tag LOCUS_19770 130195 131634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 133319 132024 gene locus_tag LOCUS_19780 133319 132024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 133986 133366 gene locus_tag LOCUS_19790 gene sigR 133986 133366 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_19790 134582 134262 gene locus_tag LOCUS_19800 134582 134262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 135321 134599 gene locus_tag LOCUS_19810 gene atpB 135321 134599 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_19810 135874 135443 gene locus_tag LOCUS_19820 135874 135443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 136085 135855 gene locus_tag LOCUS_19830 136085 135855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 136691 136131 gene locus_tag LOCUS_19840 136691 136131 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_19840 137267 136698 gene locus_tag LOCUS_19850 137267 136698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 137491 139923 gene locus_tag LOCUS_19860 137491 139923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 140108 139999 gene locus_tag LOCUS_r00010 140108 139999 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence11 4193 981 gene locus_tag LOCUS_19870 4193 981 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_19870 5362 4190 gene locus_tag LOCUS_19880 gene vmeY 5362 4190 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_19880 6894 5365 gene locus_tag LOCUS_19890 6894 5365 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_19890 6960 7958 gene locus_tag LOCUS_19900 6960 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 7968 9026 gene locus_tag LOCUS_19910 7968 9026 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_19910 9844 9020 gene locus_tag LOCUS_19920 9844 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 10587 9841 gene locus_tag LOCUS_19930 10587 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10646 11782 gene locus_tag LOCUS_19940 10646 11782 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_19940 11779 12441 gene locus_tag LOCUS_19950 11779 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 13260 12460 gene locus_tag LOCUS_19960 13260 12460 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_19960 13355 14482 gene locus_tag LOCUS_19970 13355 14482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_19970 15502 14498 gene locus_tag LOCUS_19980 15502 14498 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809293.1 protein_id gnl|my_center|LOCUS_19980 16406 15570 gene locus_tag LOCUS_19990 16406 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 17352 16504 gene locus_tag LOCUS_20000 17352 16504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_20000 18626 17349 gene locus_tag LOCUS_20010 18626 17349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_20010 19763 18645 gene locus_tag LOCUS_20020 19763 18645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_20020 20875 19760 gene locus_tag LOCUS_20030 20875 19760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_20030 22014 20872 gene locus_tag LOCUS_20040 22014 20872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_20040 22064 23776 gene locus_tag LOCUS_20050 gene boxC 22064 23776 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_20050 23786 25264 gene locus_tag LOCUS_20060 gene boxB 23786 25264 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_20060 25287 26372 gene locus_tag LOCUS_20070 25287 26372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 26971 26390 gene locus_tag LOCUS_20080 gene pdxH 26971 26390 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_20080 28006 26972 gene locus_tag LOCUS_20090 28006 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 28342 28022 gene locus_tag LOCUS_20100 28342 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 29236 28352 gene locus_tag LOCUS_20110 29236 28352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 29991 29233 gene locus_tag LOCUS_20120 29991 29233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 29887 30843 gene locus_tag LOCUS_20130 29887 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 30945 31982 gene locus_tag LOCUS_20140 gene pheS 30945 31982 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_20140 31982 34525 gene locus_tag LOCUS_20150 gene pheT 31982 34525 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_20150 35279 34554 gene locus_tag LOCUS_20160 35279 34554 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_20160 35356 35847 gene locus_tag LOCUS_20170 35356 35847 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_20170 35859 36281 gene locus_tag LOCUS_20180 35859 36281 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_20180 37528 36278 gene locus_tag LOCUS_20190 gene aroC 37528 36278 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_20190 37431 38336 gene locus_tag LOCUS_20200 gene deoC 37431 38336 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_20200 38356 39861 gene locus_tag LOCUS_20210 38356 39861 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_20210 39858 40736 gene locus_tag LOCUS_20220 39858 40736 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_20220 40831 42123 gene locus_tag LOCUS_20230 40831 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 42131 42568 gene locus_tag LOCUS_20240 42131 42568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 42680 43147 gene locus_tag LOCUS_20250 42680 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 43377 49076 gene locus_tag LOCUS_20260 43377 49076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 49703 49101 gene locus_tag LOCUS_20270 49703 49101 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_20270 50993 49782 gene locus_tag LOCUS_20280 50993 49782 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830450.1 protein_id gnl|my_center|LOCUS_20280 51120 52163 gene locus_tag LOCUS_20290 51120 52163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_20290 52173 52961 gene locus_tag LOCUS_20300 52173 52961 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_20300 53272 53021 gene locus_tag LOCUS_20310 53272 53021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 53733 53269 gene locus_tag LOCUS_20320 53733 53269 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_20320 55080 53743 gene locus_tag LOCUS_20330 gene murA 55080 53743 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_20330 55230 55844 gene locus_tag LOCUS_20340 55230 55844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 55887 56837 gene locus_tag LOCUS_20350 55887 56837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_20350 56872 57333 gene locus_tag LOCUS_20360 56872 57333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 61982 57360 gene locus_tag LOCUS_20370 61982 57360 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_20370 62061 62366 gene locus_tag LOCUS_20380 62061 62366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 62374 64158 gene locus_tag LOCUS_20390 62374 64158 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_20390 64333 65253 gene locus_tag LOCUS_20400 64333 65253 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_20400 65250 69842 gene locus_tag LOCUS_20410 gene gltB 65250 69842 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_20410 69873 71393 gene locus_tag LOCUS_20420 69873 71393 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_20420 71586 74501 gene locus_tag LOCUS_20430 71586 74501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_20430 75888 74614 gene locus_tag LOCUS_20440 gene larA 75888 74614 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_20440 77264 75918 gene locus_tag LOCUS_20450 77264 75918 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_20450 77397 78470 gene locus_tag LOCUS_20460 77397 78470 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 protein_id gnl|my_center|LOCUS_20460 79516 78467 gene locus_tag LOCUS_20470 79516 78467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 80347 79553 gene locus_tag LOCUS_20480 80347 79553 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_20480 81147 80344 gene locus_tag LOCUS_20490 81147 80344 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_20490 82322 81144 gene locus_tag LOCUS_20500 82322 81144 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 protein_id gnl|my_center|LOCUS_20500 83066 82332 gene locus_tag LOCUS_20510 83066 82332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 83160 84143 gene locus_tag LOCUS_20520 gene hemB 83160 84143 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_20520 84245 85744 gene locus_tag LOCUS_20530 84245 85744 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_20530 86485 85748 gene locus_tag LOCUS_20540 86485 85748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 88527 86458 gene locus_tag LOCUS_20550 88527 86458 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_20550 88599 89396 gene locus_tag LOCUS_20560 88599 89396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 89903 89397 gene locus_tag LOCUS_20570 89903 89397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_20570 90426 89923 gene locus_tag LOCUS_20580 90426 89923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 92196 90439 gene locus_tag LOCUS_20590 92196 90439 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_20590 92280 93443 gene locus_tag LOCUS_20600 92280 93443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 93440 97066 gene locus_tag LOCUS_20610 93440 97066 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615507.1 protein_id gnl|my_center|LOCUS_20610 97063 99609 gene locus_tag LOCUS_20620 97063 99609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 99744 99998 gene locus_tag LOCUS_20630 99744 99998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 99995 100408 gene locus_tag LOCUS_20640 99995 100408 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_20640 101773 100421 gene locus_tag LOCUS_20650 101773 100421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 102371 101802 gene locus_tag LOCUS_20660 102371 101802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 104680 102374 gene locus_tag LOCUS_20670 104680 102374 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_20670 105203 104835 gene locus_tag LOCUS_20680 105203 104835 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_20680 106279 105215 gene locus_tag LOCUS_20690 106279 105215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 108434 106302 gene locus_tag LOCUS_20700 108434 106302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 109217 108456 gene locus_tag LOCUS_20710 109217 108456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_20710 110152 109214 gene locus_tag LOCUS_20720 110152 109214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_20720 112913 110262 gene locus_tag LOCUS_20730 112913 110262 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_20730 114408 112930 gene locus_tag LOCUS_20740 114408 112930 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_20740 114587 117472 gene locus_tag LOCUS_20750 114587 117472 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_20750 117538 118869 gene locus_tag LOCUS_20760 117538 118869 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_20760 118890 119699 gene locus_tag LOCUS_20770 118890 119699 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_20770 119703 120080 gene locus_tag LOCUS_20780 119703 120080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 121485 120097 gene locus_tag LOCUS_20790 121485 120097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 122888 121482 gene locus_tag LOCUS_20800 122888 121482 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_20800 123838 122915 gene locus_tag LOCUS_20810 123838 122915 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_20810 124683 123835 gene locus_tag LOCUS_20820 gene menB 124683 123835 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_20820 125503 124730 gene locus_tag LOCUS_20830 gene menH 125503 124730 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_20830 127320 125500 gene locus_tag LOCUS_20840 gene menD 127320 125500 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_20840 128819 127311 gene locus_tag LOCUS_20850 128819 127311 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554846.1 protein_id gnl|my_center|LOCUS_20850 129577 128816 gene locus_tag LOCUS_20860 gene ubiE 129577 128816 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_20860 130734 129574 gene locus_tag LOCUS_20870 gene ispB 130734 129574 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_20870 131405 130737 gene locus_tag LOCUS_20880 131405 130737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 132285 131407 gene locus_tag LOCUS_20890 132285 131407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 133746 132292 gene locus_tag LOCUS_20900 133746 132292 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_20900 133863 134696 gene locus_tag LOCUS_20910 133863 134696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 135264 134878 gene locus_tag LOCUS_20920 135264 134878 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_20920 135524 135261 gene locus_tag LOCUS_20930 135524 135261 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence12 <1 533 gene locus_tag LOCUS_20940 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001064927.1:cytochrome c3 family protein 505 2841 gene locus_tag LOCUS_20950 505 2841 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_20950 2838 3539 gene locus_tag LOCUS_20960 2838 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3536 4933 gene locus_tag LOCUS_20970 gene nrfD 3536 4933 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_20970 4930 5466 gene locus_tag LOCUS_20980 4930 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 8222 5550 gene locus_tag LOCUS_20990 8222 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 8643 9917 gene locus_tag LOCUS_21000 8643 9917 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_21000 10221 10403 gene locus_tag LOCUS_21010 10221 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11819 10452 gene locus_tag LOCUS_21020 11819 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 12838 11816 gene locus_tag LOCUS_21030 12838 11816 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_21030 13921 12884 gene locus_tag LOCUS_21040 13921 12884 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_21040 14146 16275 gene locus_tag LOCUS_21050 14146 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 18112 16277 gene locus_tag LOCUS_21060 18112 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 18280 19116 gene locus_tag LOCUS_21070 18280 19116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 19146 19571 gene locus_tag LOCUS_21080 19146 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 20704 19604 gene locus_tag LOCUS_21090 20704 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 21620 20922 gene locus_tag LOCUS_21100 21620 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 22444 21665 gene locus_tag LOCUS_21110 22444 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 23226 22441 gene locus_tag LOCUS_21120 23226 22441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080881.1 protein_id gnl|my_center|LOCUS_21120 24864 23278 gene locus_tag LOCUS_21130 24864 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 25528 25241 gene locus_tag LOCUS_21140 25528 25241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 25918 25598 gene locus_tag LOCUS_21150 25918 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 26125 25952 gene locus_tag LOCUS_21160 26125 25952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 26479 26162 gene locus_tag LOCUS_21170 26479 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 27097 26495 gene locus_tag LOCUS_21180 27097 26495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 27590 27087 gene locus_tag LOCUS_21190 27590 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 31616 28002 gene locus_tag LOCUS_21200 31616 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 31887 32786 gene locus_tag LOCUS_21210 31887 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 35056 32789 gene locus_tag LOCUS_21220 35056 32789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 37288 35066 gene locus_tag LOCUS_21230 37288 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 37380 38684 gene locus_tag LOCUS_21240 37380 38684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 38677 39195 gene locus_tag LOCUS_21250 38677 39195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 41405 39192 gene locus_tag LOCUS_21260 41405 39192 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_21260 42287 41454 gene locus_tag LOCUS_21270 42287 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 42371 43957 gene locus_tag LOCUS_21280 gene putP 42371 43957 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_21280 43961 44551 gene locus_tag LOCUS_21290 43961 44551 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_21290 45995 44553 gene locus_tag LOCUS_21300 45995 44553 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_21300 48050 46023 gene locus_tag LOCUS_21310 48050 46023 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_21310 49220 48054 gene locus_tag LOCUS_21320 49220 48054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_21320 50631 49261 gene locus_tag LOCUS_21330 50631 49261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 51799 50645 gene locus_tag LOCUS_21340 51799 50645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 51929 53428 gene locus_tag LOCUS_21350 51929 53428 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_21350 53442 54299 gene locus_tag LOCUS_21360 53442 54299 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_21360 55397 54324 gene locus_tag LOCUS_21370 55397 54324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 55458 56246 gene locus_tag LOCUS_21380 55458 56246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 56908 56288 gene locus_tag LOCUS_21390 56908 56288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 58205 56961 gene locus_tag LOCUS_21400 58205 56961 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_21400 59690 58236 gene locus_tag LOCUS_21410 59690 58236 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_21410 62252 59700 gene locus_tag LOCUS_21420 62252 59700 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_21420 64714 62249 gene locus_tag LOCUS_21430 64714 62249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 66105 64711 gene locus_tag LOCUS_21440 66105 64711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 67726 66308 gene locus_tag LOCUS_21450 67726 66308 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_21450 71631 67723 gene locus_tag LOCUS_21460 71631 67723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 73705 71657 gene locus_tag LOCUS_21470 73705 71657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 73819 74367 gene locus_tag LOCUS_21480 73819 74367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 74367 74888 gene locus_tag LOCUS_21490 74367 74888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 74976 76025 gene locus_tag LOCUS_21500 74976 76025 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_21500 76047 77351 gene locus_tag LOCUS_21510 76047 77351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920509.1 protein_id gnl|my_center|LOCUS_21510 78817 77366 gene locus_tag LOCUS_21520 78817 77366 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_21520 78876 80126 gene locus_tag LOCUS_21530 78876 80126 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_21530 80174 81235 gene locus_tag LOCUS_21540 80174 81235 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_21540 81269 81535 gene locus_tag LOCUS_21550 81269 81535 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414620.1 protein_id gnl|my_center|LOCUS_21550 81522 82016 gene locus_tag LOCUS_21560 81522 82016 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_21560 82750 82097 gene locus_tag LOCUS_21570 82750 82097 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_21570 83650 82784 gene locus_tag LOCUS_21580 83650 82784 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922397.1 protein_id gnl|my_center|LOCUS_21580 84065 83673 gene locus_tag LOCUS_21590 84065 83673 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_21590 84396 84052 gene locus_tag LOCUS_21600 84396 84052 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_21600 84520 84777 gene locus_tag LOCUS_21610 84520 84777 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537648.1 protein_id gnl|my_center|LOCUS_21610 85539 84901 gene locus_tag LOCUS_21620 85539 84901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 86175 85588 gene locus_tag LOCUS_21630 gene lacC 86175 85588 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_21630 87866 86172 gene locus_tag LOCUS_21640 87866 86172 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_21640 88917 87898 gene locus_tag LOCUS_21650 88917 87898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 88979 89989 gene locus_tag LOCUS_21660 88979 89989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 90770 90003 gene locus_tag LOCUS_21670 90770 90003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 92239 90770 gene locus_tag LOCUS_21680 92239 90770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_21680 92320 93861 gene locus_tag LOCUS_21690 92320 93861 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_21690 93858 95321 gene locus_tag LOCUS_21700 93858 95321 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_21700 95318 96433 gene locus_tag LOCUS_21710 95318 96433 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856704.1 protein_id gnl|my_center|LOCUS_21710 96426 99362 gene locus_tag LOCUS_21720 96426 99362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 99366 100613 gene locus_tag LOCUS_21730 99366 100613 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_21730 100627 101571 gene locus_tag LOCUS_21740 100627 101571 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_21740 102387 101587 gene locus_tag LOCUS_21750 102387 101587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 102442 103416 gene locus_tag LOCUS_21760 102442 103416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408445.1 protein_id gnl|my_center|LOCUS_21760 103474 104670 gene locus_tag LOCUS_21770 103474 104670 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_21770 105764 104673 gene locus_tag LOCUS_21780 105764 104673 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_21780 106566 105775 gene locus_tag LOCUS_21790 106566 105775 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_21790 106672 108003 gene locus_tag LOCUS_21800 106672 108003 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_21800 108064 108543 gene locus_tag LOCUS_21810 108064 108543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_21810 109261 108614 gene locus_tag LOCUS_21820 109261 108614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 109421 112885 gene locus_tag LOCUS_21830 109421 112885 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_21830 115273 112919 gene locus_tag LOCUS_21840 115273 112919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 117562 115370 gene locus_tag LOCUS_21850 117562 115370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 120460 117755 gene locus_tag LOCUS_21860 120460 117755 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 protein_id gnl|my_center|LOCUS_21860 122356 120485 gene locus_tag LOCUS_21870 122356 120485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence13 2343 1012 gene locus_tag LOCUS_21880 2343 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2686 2411 gene locus_tag LOCUS_21890 2686 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3333 2701 gene locus_tag LOCUS_21900 3333 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3432 5642 gene locus_tag LOCUS_21910 3432 5642 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_21910 5668 6825 gene locus_tag LOCUS_21920 5668 6825 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_21920 6857 7852 gene locus_tag LOCUS_21930 6857 7852 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_21930 7877 9220 gene locus_tag LOCUS_21940 gene xylA 7877 9220 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_21940 9217 10782 gene locus_tag LOCUS_21950 gene xylB 9217 10782 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_21950 11717 10788 gene locus_tag LOCUS_21960 11717 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 12985 11792 gene locus_tag LOCUS_21970 12985 11792 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_21970 13831 13001 gene locus_tag LOCUS_21980 13831 13001 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_21980 13984 14760 gene locus_tag LOCUS_21990 13984 14760 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_21990 14901 15368 gene locus_tag LOCUS_22000 14901 15368 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_22000 15443 16861 gene locus_tag LOCUS_22010 15443 16861 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_22010 16864 17205 gene locus_tag LOCUS_22020 16864 17205 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_22020 17202 17744 gene locus_tag LOCUS_22030 17202 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 19037 17766 gene locus_tag LOCUS_22040 19037 17766 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_22040 21910 19064 gene locus_tag LOCUS_22050 21910 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 22595 21927 gene locus_tag LOCUS_22060 gene nth 22595 21927 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_22060 23930 22596 gene locus_tag LOCUS_22070 23930 22596 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 protein_id gnl|my_center|LOCUS_22070 25132 23933 gene locus_tag LOCUS_22080 25132 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 25398 25586 gene locus_tag LOCUS_22090 25398 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 25596 26063 gene locus_tag LOCUS_22100 25596 26063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 27060 26077 gene locus_tag LOCUS_22110 27060 26077 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059575.1 protein_id gnl|my_center|LOCUS_22110 27174 27617 gene locus_tag LOCUS_22120 27174 27617 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_22120 27652 30681 gene locus_tag LOCUS_22130 27652 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 31879 30701 gene locus_tag LOCUS_22140 gene pepQ 31879 30701 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_22140 31998 33191 gene locus_tag LOCUS_22150 31998 33191 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_22150 33218 34270 gene locus_tag LOCUS_22160 33218 34270 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_22160 35111 34281 gene locus_tag LOCUS_22170 35111 34281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 36468 35122 gene locus_tag LOCUS_22180 36468 35122 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_22180 37766 36483 gene locus_tag LOCUS_22190 37766 36483 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_22190 39090 37744 gene locus_tag LOCUS_22200 39090 37744 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_22200 40645 39224 gene locus_tag LOCUS_22210 gene glnA 40645 39224 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141054.1 protein_id gnl|my_center|LOCUS_22210 42279 40954 gene locus_tag LOCUS_22220 42279 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 44705 42288 gene locus_tag LOCUS_22230 44705 42288 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_22230 45664 44702 gene locus_tag LOCUS_22240 45664 44702 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_22240 46562 45711 gene locus_tag LOCUS_22250 46562 45711 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_22250 47049 46621 gene locus_tag LOCUS_22260 gene tsaE 47049 46621 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_22260 48593 47046 gene locus_tag LOCUS_22270 48593 47046 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_22270 49258 48590 gene locus_tag LOCUS_22280 49258 48590 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_22280 49476 49255 gene locus_tag LOCUS_22290 49476 49255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 49937 49473 gene locus_tag LOCUS_22300 49937 49473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 51772 50000 gene locus_tag LOCUS_22310 51772 50000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 52663 51842 gene locus_tag LOCUS_22320 gene thiD 52663 51842 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_22320 53436 52636 gene locus_tag LOCUS_22330 gene lgt 53436 52636 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820749.1 protein_id gnl|my_center|LOCUS_22330 53482 54522 gene locus_tag LOCUS_22340 53482 54522 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_22340 56104 54539 gene locus_tag LOCUS_22350 gene guaA 56104 54539 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_22350 57162 56101 gene locus_tag LOCUS_22360 57162 56101 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_22360 57812 57159 gene locus_tag LOCUS_22370 gene plsY 57812 57159 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_22370 59131 57809 gene locus_tag LOCUS_22380 59131 57809 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_22380 60371 59178 gene locus_tag LOCUS_22390 60371 59178 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869768.1 protein_id gnl|my_center|LOCUS_22390 61297 60458 gene locus_tag LOCUS_22400 61297 60458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 61434 61619 gene locus_tag LOCUS_22410 61434 61619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 61737 61661 gene locus_tag LOCUS_t00270 61737 61661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62326 61793 gene locus_tag LOCUS_22420 62326 61793 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_22420 63035 62346 gene locus_tag LOCUS_22430 63035 62346 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_22430 63814 63032 gene locus_tag LOCUS_22440 gene surE 63814 63032 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_22440 64650 63811 gene locus_tag LOCUS_22450 gene mtnP 64650 63811 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_22450 65639 64701 gene locus_tag LOCUS_22460 65639 64701 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_22460 66516 65704 gene locus_tag LOCUS_22470 gene lpxA 66516 65704 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_22470 67027 66542 gene locus_tag LOCUS_22480 67027 66542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 68115 67024 gene locus_tag LOCUS_22490 gene lpxD 68115 67024 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_22490 68192 69577 gene locus_tag LOCUS_22500 68192 69577 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_22500 70139 69588 gene locus_tag LOCUS_22510 70139 69588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 72621 70162 gene locus_tag LOCUS_22520 gene bamA 72621 70162 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_22520 75076 72608 gene locus_tag LOCUS_22530 75076 72608 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_22530 75761 75087 gene locus_tag LOCUS_22540 75761 75087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_22540 76975 75758 gene locus_tag LOCUS_22550 76975 75758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 77527 76988 gene locus_tag LOCUS_22560 gene hpt 77527 76988 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_22560 77543 78463 gene locus_tag LOCUS_22570 77543 78463 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_22570 78467 79954 gene locus_tag LOCUS_22580 gene lysS 78467 79954 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_22580 80993 80004 gene locus_tag LOCUS_22590 80993 80004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 81582 80998 gene locus_tag LOCUS_22600 81582 80998 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_22600 82766 81597 gene locus_tag LOCUS_22610 gene ribD 82766 81597 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_22610 83749 82763 gene locus_tag LOCUS_22620 gene ftsY 83749 82763 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_22620 84915 83746 gene locus_tag LOCUS_22630 84915 83746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 86695 84935 gene locus_tag LOCUS_22640 gene aspS 86695 84935 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_22640 88036 86750 gene locus_tag LOCUS_22650 gene hisS 88036 86750 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_22650 88102 89235 gene locus_tag LOCUS_22660 88102 89235 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_22660 92824 89243 gene locus_tag LOCUS_22670 92824 89243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 96144 92821 gene locus_tag LOCUS_22680 96144 92821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 97517 96141 gene locus_tag LOCUS_22690 97517 96141 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_22690 97951 97568 gene locus_tag LOCUS_22700 97951 97568 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_22700 98133 97996 gene locus_tag LOCUS_22710 98133 97996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 99004 98147 gene locus_tag LOCUS_22720 99004 98147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 99050 100561 gene locus_tag LOCUS_22730 99050 100561 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_22730 100590 101357 gene locus_tag LOCUS_22740 100590 101357 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_22740 102980 101499 gene locus_tag LOCUS_22750 102980 101499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 103197 104183 gene locus_tag LOCUS_22760 103197 104183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 104180 107713 gene locus_tag LOCUS_22770 104180 107713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 107710 108783 gene locus_tag LOCUS_22780 107710 108783 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_22780 108809 111991 gene locus_tag LOCUS_22790 108809 111991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence14 3143 558 gene locus_tag LOCUS_22800 3143 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3243 5168 gene locus_tag LOCUS_22810 3243 5168 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_22810 5214 5858 gene locus_tag LOCUS_22820 5214 5858 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 protein_id gnl|my_center|LOCUS_22820 6341 5931 gene locus_tag LOCUS_22830 6341 5931 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_22830 6603 6355 gene locus_tag LOCUS_22840 6603 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 8467 6677 gene locus_tag LOCUS_22850 gene lepA 8467 6677 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_22850 8521 9426 gene locus_tag LOCUS_22860 gene rocF 8521 9426 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_22860 9452 9934 gene locus_tag LOCUS_22870 9452 9934 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_22870 10114 10431 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgccacttccgatgtcgatg 11347 11916 gene locus_tag LOCUS_22880 gene efp 11347 11916 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_22880 11924 12910 gene locus_tag LOCUS_22890 gene epmA 11924 12910 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_22890 13494 12859 gene locus_tag LOCUS_22900 13494 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 14645 13506 gene locus_tag LOCUS_22910 gene rnd 14645 13506 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267099.1 protein_id gnl|my_center|LOCUS_22910 14790 15725 gene locus_tag LOCUS_22920 14790 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 15722 17062 gene locus_tag LOCUS_22930 15722 17062 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_22930 18424 17165 gene locus_tag LOCUS_22940 18424 17165 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_22940 19601 18429 gene locus_tag LOCUS_22950 19601 18429 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_22950 21228 19642 gene locus_tag LOCUS_22960 21228 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 22126 21239 gene locus_tag LOCUS_22970 22126 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 22181 23041 gene locus_tag LOCUS_22980 gene fabI 22181 23041 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971127.1 protein_id gnl|my_center|LOCUS_22980 23239 23910 gene locus_tag LOCUS_22990 23239 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 25139 23922 gene locus_tag LOCUS_23000 gene sndA 25139 23922 CDS product S-alkyl-N-acetyl-metabolite deacetylase SndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229395.1 protein_id gnl|my_center|LOCUS_23000 27805 25136 gene locus_tag LOCUS_23010 27805 25136 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_23010 30129 27802 gene locus_tag LOCUS_23020 gene aceA 30129 27802 CDS product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409584.1 protein_id gnl|my_center|LOCUS_23020 30255 31955 gene locus_tag LOCUS_23030 30255 31955 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_23030 32074 32769 gene locus_tag LOCUS_23040 32074 32769 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640560.1 protein_id gnl|my_center|LOCUS_23040 32780 35230 gene locus_tag LOCUS_23050 32780 35230 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_23050 35280 36284 gene locus_tag LOCUS_23060 35280 36284 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_23060 36291 37109 gene locus_tag LOCUS_23070 36291 37109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 37251 38432 gene locus_tag LOCUS_23080 37251 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 38436 39128 gene locus_tag LOCUS_23090 38436 39128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 39197 39433 gene locus_tag LOCUS_23100 39197 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 39430 39831 gene locus_tag LOCUS_23110 39430 39831 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_23110 43088 39858 gene locus_tag LOCUS_23120 43088 39858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 44649 43093 gene locus_tag LOCUS_23130 44649 43093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 45600 44722 gene locus_tag LOCUS_23140 45600 44722 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_23140 47485 45956 gene locus_tag LOCUS_23150 47485 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 47760 49655 gene locus_tag LOCUS_23160 47760 49655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 49693 50661 gene locus_tag LOCUS_23170 49693 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 51702 50665 gene locus_tag LOCUS_23180 51702 50665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 51815 52297 gene locus_tag LOCUS_23190 51815 52297 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_23190 52405 54639 gene locus_tag LOCUS_23200 52405 54639 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_23200 54680 55789 gene locus_tag LOCUS_23210 54680 55789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 57207 55765 gene locus_tag LOCUS_23220 57207 55765 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_23220 58315 57212 gene locus_tag LOCUS_23230 58315 57212 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_23230 58413 60335 gene locus_tag LOCUS_23240 58413 60335 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_23240 60375 63143 gene locus_tag LOCUS_23250 60375 63143 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_23250 63865 63140 gene locus_tag LOCUS_23260 63865 63140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 67164 63889 gene locus_tag LOCUS_23270 67164 63889 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_23270 68426 67161 gene locus_tag LOCUS_23280 68426 67161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 69948 68440 gene locus_tag LOCUS_23290 69948 68440 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_23290 72282 70015 gene locus_tag LOCUS_23300 72282 70015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 73477 72317 gene locus_tag LOCUS_23310 73477 72317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 74145 73570 gene locus_tag LOCUS_23320 74145 73570 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_23320 75881 74172 gene locus_tag LOCUS_23330 gene murJ 75881 74172 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_23330 77293 75878 gene locus_tag LOCUS_23340 77293 75878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 78722 77355 gene locus_tag LOCUS_23350 78722 77355 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_23350 79512 78739 gene locus_tag LOCUS_23360 79512 78739 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_23360 79976 79509 gene locus_tag LOCUS_23370 79976 79509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 80989 79985 gene locus_tag LOCUS_23380 80989 79985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 81115 82425 gene locus_tag LOCUS_23390 81115 82425 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_23390 83450 82434 gene locus_tag LOCUS_23400 gene trpS 83450 82434 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_23400 84969 83464 gene locus_tag LOCUS_23410 gene putP 84969 83464 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 protein_id gnl|my_center|LOCUS_23410 85325 84966 gene locus_tag LOCUS_23420 85325 84966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 85421 86569 gene locus_tag LOCUS_23430 85421 86569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 86566 88491 gene locus_tag LOCUS_23440 86566 88491 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_23440 88720 90801 gene locus_tag LOCUS_23450 88720 90801 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271989.1 protein_id gnl|my_center|LOCUS_23450 90887 91546 gene locus_tag LOCUS_23460 90887 91546 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851111.1 protein_id gnl|my_center|LOCUS_23460 91566 92390 gene locus_tag LOCUS_23470 91566 92390 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_23470 92428 93399 gene locus_tag LOCUS_23480 92428 93399 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_23480 93475 95082 gene locus_tag LOCUS_23490 93475 95082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 96289 95060 gene locus_tag LOCUS_23500 96289 95060 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_23500 97708 96374 gene locus_tag LOCUS_23510 97708 96374 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_23510 97808 98788 gene locus_tag LOCUS_23520 97808 98788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_23520 98791 99858 gene locus_tag LOCUS_23530 98791 99858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 99894 102788 gene locus_tag LOCUS_23540 99894 102788 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence15 588 4664 gene locus_tag LOCUS_23550 588 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4919 5434 gene locus_tag LOCUS_23560 4919 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6510 5440 gene locus_tag LOCUS_23570 gene leuB 6510 5440 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_23570 7086 6574 gene locus_tag LOCUS_23580 7086 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8033 7665 gene locus_tag LOCUS_23590 8033 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 8687 8064 gene locus_tag LOCUS_23600 gene leuD 8687 8064 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_23600 10123 8684 gene locus_tag LOCUS_23610 gene leuC 10123 8684 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_23610 11739 10120 gene locus_tag LOCUS_23620 11739 10120 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256076.1 protein_id gnl|my_center|LOCUS_23620 12743 11742 gene locus_tag LOCUS_23630 gene ilvC 12743 11742 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_23630 13327 12782 gene locus_tag LOCUS_23640 gene ilvN 13327 12782 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_23640 15250 13358 gene locus_tag LOCUS_23650 gene ilvB 15250 13358 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_23650 16222 15266 gene locus_tag LOCUS_23660 16222 15266 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_23660 17546 16449 gene locus_tag LOCUS_23670 17546 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 17604 20543 gene locus_tag LOCUS_23680 17604 20543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 20569 22128 gene locus_tag LOCUS_23690 gene cimA 20569 22128 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_23690 25090 22145 gene locus_tag LOCUS_23700 gene gcvP 25090 22145 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_23700 26043 25087 gene locus_tag LOCUS_23710 26043 25087 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_23710 27531 26080 gene locus_tag LOCUS_23720 27531 26080 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_23720 28515 27613 gene locus_tag LOCUS_23730 gene fdhD 28515 27613 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_23730 30722 28512 gene locus_tag LOCUS_23740 30722 28512 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_23740 30751 32553 gene locus_tag LOCUS_23750 30751 32553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 32575 34977 gene locus_tag LOCUS_23760 32575 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 38481 35002 gene locus_tag LOCUS_23770 gene dnaE2 38481 35002 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_23770 38550 38870 gene locus_tag LOCUS_23780 38550 38870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 40587 38881 gene locus_tag LOCUS_23790 40587 38881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 40980 40606 gene locus_tag LOCUS_23800 40980 40606 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922062.1 protein_id gnl|my_center|LOCUS_23800 41024 41401 gene locus_tag LOCUS_23810 41024 41401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_23810 43038 41452 gene locus_tag LOCUS_23820 43038 41452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 43861 43028 gene locus_tag LOCUS_23830 43861 43028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 44383 43952 gene locus_tag LOCUS_23840 44383 43952 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939741.1 protein_id gnl|my_center|LOCUS_23840 45054 44380 gene locus_tag LOCUS_23850 45054 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 46313 45051 gene locus_tag LOCUS_23860 46313 45051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 47119 46310 gene locus_tag LOCUS_23870 47119 46310 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902331.1 protein_id gnl|my_center|LOCUS_23870 48643 47144 gene locus_tag LOCUS_23880 48643 47144 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929823.1 protein_id gnl|my_center|LOCUS_23880 48867 50156 gene locus_tag LOCUS_23890 48867 50156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 51161 50271 gene locus_tag LOCUS_23900 51161 50271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 52029 51187 gene locus_tag LOCUS_23910 52029 51187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 52096 54390 gene locus_tag LOCUS_23920 52096 54390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 54407 55105 gene locus_tag LOCUS_23930 54407 55105 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_23930 55102 56031 gene locus_tag LOCUS_23940 55102 56031 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_23940 56021 57316 gene locus_tag LOCUS_23950 56021 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145058669.1 protein_id gnl|my_center|LOCUS_23950 57313 58134 gene locus_tag LOCUS_23960 57313 58134 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_23960 59022 58147 gene locus_tag LOCUS_23970 59022 58147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 59393 59019 gene locus_tag LOCUS_23980 59393 59019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 59530 60381 gene locus_tag LOCUS_23990 59530 60381 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_23990 60465 61646 gene locus_tag LOCUS_24000 60465 61646 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_24000 61643 62446 gene locus_tag LOCUS_24010 61643 62446 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_24010 63373 62456 gene locus_tag LOCUS_24020 63373 62456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_24020 64566 63391 gene locus_tag LOCUS_24030 64566 63391 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_24030 64632 66074 gene locus_tag LOCUS_24040 64632 66074 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_24040 66299 66081 gene locus_tag LOCUS_24050 66299 66081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 67301 66312 gene locus_tag LOCUS_24060 67301 66312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 67806 67369 gene locus_tag LOCUS_24070 67806 67369 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_24070 68636 67842 gene locus_tag LOCUS_24080 68636 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_24080 68748 69590 gene locus_tag LOCUS_24090 68748 69590 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_24090 69894 69580 gene locus_tag LOCUS_24100 69894 69580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 70888 69860 gene locus_tag LOCUS_24110 70888 69860 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_24110 72555 70912 gene locus_tag LOCUS_24120 72555 70912 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_24120 73295 72552 gene locus_tag LOCUS_24130 73295 72552 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_24130 73325 74269 gene locus_tag LOCUS_24140 73325 74269 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_24140 74282 76432 gene locus_tag LOCUS_24150 74282 76432 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_24150 76441 76782 gene locus_tag LOCUS_24160 76441 76782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 76782 77951 gene locus_tag LOCUS_24170 76782 77951 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_24170 78499 77954 gene locus_tag LOCUS_24180 gene folK 78499 77954 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_24180 79728 78496 gene locus_tag LOCUS_24190 79728 78496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 79846 81483 gene locus_tag LOCUS_24200 79846 81483 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_24200 81501 82940 gene locus_tag LOCUS_24210 81501 82940 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_24210 82942 84474 gene locus_tag LOCUS_24220 82942 84474 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857632.1 protein_id gnl|my_center|LOCUS_24220 85910 84468 gene locus_tag LOCUS_24230 85910 84468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 86007 86492 gene locus_tag LOCUS_24240 86007 86492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 86489 88672 gene locus_tag LOCUS_24250 86489 88672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 88669 90492 gene locus_tag LOCUS_24260 88669 90492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 90534 93068 gene locus_tag LOCUS_24270 90534 93068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 95254 93077 gene locus_tag LOCUS_24280 95254 93077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 97544 95322 gene locus_tag LOCUS_24290 97544 95322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 98739 97591 gene locus_tag LOCUS_24300 98739 97591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 99262 102129 gene locus_tag LOCUS_24310 99262 102129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence16 <1 567 gene locus_tag LOCUS_24320 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640166.1:sulfatase-like hydrolase/transferase 867 586 gene locus_tag LOCUS_24330 867 586 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 protein_id gnl|my_center|LOCUS_24330 1117 854 gene locus_tag LOCUS_24340 gene dinJ 1117 854 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729709.1 protein_id gnl|my_center|LOCUS_24340 2389 1232 gene locus_tag LOCUS_24350 2389 1232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_24350 2439 3353 gene locus_tag LOCUS_24360 gene tauD 2439 3353 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_24360 3357 4427 gene locus_tag LOCUS_24370 3357 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 6119 4437 gene locus_tag LOCUS_24380 6119 4437 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_24380 6967 6116 gene locus_tag LOCUS_24390 6967 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 9255 6964 gene locus_tag LOCUS_24400 9255 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11033 9267 gene locus_tag LOCUS_24410 11033 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 12200 11049 gene locus_tag LOCUS_24420 12200 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 13329 12241 gene locus_tag LOCUS_24430 13329 12241 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_24430 13494 16928 gene locus_tag LOCUS_24440 13494 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 17031 19613 gene locus_tag LOCUS_24450 17031 19613 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036948.1 protein_id gnl|my_center|LOCUS_24450 19630 21261 gene locus_tag LOCUS_24460 19630 21261 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_24460 23843 21258 gene locus_tag LOCUS_24470 23843 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 23884 24528 gene locus_tag LOCUS_24480 23884 24528 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083342.1 protein_id gnl|my_center|LOCUS_24480 24560 24850 gene locus_tag LOCUS_24490 24560 24850 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_24490 24847 25290 gene locus_tag LOCUS_24500 24847 25290 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_24500 25298 26791 gene locus_tag LOCUS_24510 25298 26791 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_24510 27754 26843 gene locus_tag LOCUS_24520 27754 26843 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_24520 29235 27751 gene locus_tag LOCUS_24530 gene hpaE 29235 27751 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_24530 30005 29232 gene locus_tag LOCUS_24540 30005 29232 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_24540 30823 30020 gene locus_tag LOCUS_24550 30823 30020 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_24550 31613 30837 gene locus_tag LOCUS_24560 31613 30837 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 protein_id gnl|my_center|LOCUS_24560 32860 31610 gene locus_tag LOCUS_24570 32860 31610 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_24570 34188 32872 gene locus_tag LOCUS_24580 gene glnA 34188 32872 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906377.1 protein_id gnl|my_center|LOCUS_24580 35661 34216 gene locus_tag LOCUS_24590 35661 34216 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_24590 38444 35658 gene locus_tag LOCUS_24600 38444 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 40179 38434 gene locus_tag LOCUS_24610 40179 38434 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_24610 41950 40169 gene locus_tag LOCUS_24620 41950 40169 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_24620 44446 41957 gene locus_tag LOCUS_24630 44446 41957 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090108.1 protein_id gnl|my_center|LOCUS_24630 44526 45824 gene locus_tag LOCUS_24640 44526 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 47024 45849 gene locus_tag LOCUS_24650 47024 45849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_24650 48916 47021 gene locus_tag LOCUS_24660 48916 47021 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_24660 49683 48919 gene locus_tag LOCUS_24670 49683 48919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_24670 50445 49684 gene locus_tag LOCUS_24680 50445 49684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_24680 51518 50442 gene locus_tag LOCUS_24690 51518 50442 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_24690 52309 51536 gene locus_tag LOCUS_24700 52309 51536 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_24700 53707 52472 gene locus_tag LOCUS_24710 53707 52472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(53243..53245),aa:Sec) note codon on position 155 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_24710 53808 55310 gene locus_tag LOCUS_24720 gene gabD 53808 55310 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_24720 56684 55356 gene locus_tag LOCUS_24730 56684 55356 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_24730 58020 56809 gene locus_tag LOCUS_24740 58020 56809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_24740 59291 58092 gene locus_tag LOCUS_24750 59291 58092 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_24750 59755 59423 gene locus_tag LOCUS_24760 59755 59423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 60078 60290 gene locus_tag LOCUS_24770 60078 60290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 60703 60278 gene locus_tag LOCUS_24780 60703 60278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 61620 60718 gene locus_tag LOCUS_24790 61620 60718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 61964 61620 gene locus_tag LOCUS_24800 61964 61620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 protein_id gnl|my_center|LOCUS_24800 62347 61961 gene locus_tag LOCUS_24810 62347 61961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 62728 62375 gene locus_tag LOCUS_24820 62728 62375 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_24820 62836 63846 gene locus_tag LOCUS_24830 62836 63846 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_24830 63971 64465 gene locus_tag LOCUS_24840 63971 64465 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803706.1 protein_id gnl|my_center|LOCUS_24840 64462 64935 gene locus_tag LOCUS_24850 64462 64935 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_24850 64935 66203 gene locus_tag LOCUS_24860 64935 66203 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_24860 66206 67108 gene locus_tag LOCUS_24870 66206 67108 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228893.1 protein_id gnl|my_center|LOCUS_24870 67715 67116 gene locus_tag LOCUS_24880 67715 67116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 70913 67731 gene locus_tag LOCUS_24890 70913 67731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 70966 72645 gene locus_tag LOCUS_24900 70966 72645 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_24900 72666 74216 gene locus_tag LOCUS_24910 72666 74216 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_24910 74446 74829 gene locus_tag LOCUS_24920 74446 74829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 75268 74855 gene locus_tag LOCUS_24930 75268 74855 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_24930 75342 75974 gene locus_tag LOCUS_24940 75342 75974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 76353 76024 gene locus_tag LOCUS_24950 76353 76024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 77116 76415 gene locus_tag LOCUS_24960 77116 76415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 77322 77113 gene locus_tag LOCUS_24970 77322 77113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 77371 77565 gene locus_tag LOCUS_24980 77371 77565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 77570 77749 gene locus_tag LOCUS_24990 77570 77749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 78199 77756 gene locus_tag LOCUS_25000 78199 77756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 78591 78196 gene locus_tag LOCUS_25010 78591 78196 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_25010 78899 78588 gene locus_tag LOCUS_25020 78899 78588 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_25020 79302 80684 gene locus_tag LOCUS_25030 79302 80684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 80760 81353 gene locus_tag LOCUS_25040 80760 81353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 81587 81781 gene locus_tag LOCUS_25050 81587 81781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 81973 84345 gene locus_tag LOCUS_25060 81973 84345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 84477 84854 gene locus_tag LOCUS_25070 84477 84854 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039801.1 protein_id gnl|my_center|LOCUS_25070 84851 85273 gene locus_tag LOCUS_25080 84851 85273 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224367.1 protein_id gnl|my_center|LOCUS_25080 85270 86253 gene locus_tag LOCUS_25090 85270 86253 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_25090 86250 86408 gene locus_tag LOCUS_25100 86250 86408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 87470 86655 gene locus_tag LOCUS_25110 87470 86655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 87752 88444 gene locus_tag LOCUS_25120 87752 88444 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_25120 88499 88726 gene locus_tag LOCUS_25130 88499 88726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 89239 89487 gene locus_tag LOCUS_25140 89239 89487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 89462 89893 gene locus_tag LOCUS_25150 89462 89893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 89894 90652 gene locus_tag LOCUS_25160 89894 90652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25160 90649 91032 gene locus_tag LOCUS_25170 90649 91032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 93700 91322 gene locus_tag LOCUS_25180 93700 91322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 93718 93885 gene locus_tag LOCUS_25190 93718 93885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 95428 94013 gene locus_tag LOCUS_25200 95428 94013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 97186 95555 gene locus_tag LOCUS_25210 97186 95555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 98247 97204 gene locus_tag LOCUS_25220 98247 97204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 99737 98244 gene locus_tag LOCUS_25230 99737 98244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 100182 99742 gene locus_tag LOCUS_25240 100182 99742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 101228 100179 gene locus_tag LOCUS_25250 101228 100179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence17 2445 1567 gene locus_tag LOCUS_25260 2445 1567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_25260 2565 3269 gene locus_tag LOCUS_25270 2565 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3324 3641 gene locus_tag LOCUS_25280 3324 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 4942 3701 gene locus_tag LOCUS_25290 4942 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6153 4939 gene locus_tag LOCUS_25300 6153 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 7520 6216 gene locus_tag LOCUS_25310 7520 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 7574 8566 gene locus_tag LOCUS_25320 7574 8566 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_25320 8611 10686 gene locus_tag LOCUS_25330 8611 10686 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491174.1 protein_id gnl|my_center|LOCUS_25330 10838 11719 gene locus_tag LOCUS_25340 10838 11719 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_25340 11747 12787 gene locus_tag LOCUS_25350 11747 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 12784 13209 gene locus_tag LOCUS_25360 12784 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 14234 13338 gene locus_tag LOCUS_25370 14234 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 14164 14346 gene locus_tag LOCUS_25380 14164 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 15655 14414 gene locus_tag LOCUS_25390 15655 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 17311 15740 gene locus_tag LOCUS_25400 17311 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 17546 18319 gene locus_tag LOCUS_25410 17546 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 18322 19938 gene locus_tag LOCUS_25420 18322 19938 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_25420 19957 21339 gene locus_tag LOCUS_25430 19957 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 21422 22168 gene locus_tag LOCUS_25440 21422 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 22195 23358 gene locus_tag LOCUS_25450 22195 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 23358 24137 gene locus_tag LOCUS_25460 23358 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 25015 24167 gene locus_tag LOCUS_25470 25015 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 25342 25623 gene locus_tag LOCUS_25480 25342 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 25620 26051 gene locus_tag LOCUS_25490 25620 26051 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_25490 26128 27702 gene locus_tag LOCUS_25500 26128 27702 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_25500 27716 28633 gene locus_tag LOCUS_25510 27716 28633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_25510 28626 29465 gene locus_tag LOCUS_25520 28626 29465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 protein_id gnl|my_center|LOCUS_25520 29465 30565 gene locus_tag LOCUS_25530 gene rsgA 29465 30565 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_25530 31318 30581 gene locus_tag LOCUS_25540 31318 30581 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_25540 32757 31324 gene locus_tag LOCUS_25550 32757 31324 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_25550 33914 32817 gene locus_tag LOCUS_25560 33914 32817 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_25560 33936 36515 gene locus_tag LOCUS_25570 33936 36515 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_25570 36528 38039 gene locus_tag LOCUS_25580 36528 38039 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_25580 38036 39700 gene locus_tag LOCUS_25590 38036 39700 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_25590 39697 41211 gene locus_tag LOCUS_25600 39697 41211 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_25600 41241 41777 gene locus_tag LOCUS_25610 41241 41777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_25610 41774 42715 gene locus_tag LOCUS_25620 41774 42715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 43142 42693 gene locus_tag LOCUS_25630 43142 42693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 43717 43139 gene locus_tag LOCUS_25640 43717 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 45097 43745 gene locus_tag LOCUS_25650 45097 43745 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_25650 45692 45288 gene locus_tag LOCUS_25660 45692 45288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 46720 45815 gene locus_tag LOCUS_25670 46720 45815 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_25670 46762 48324 gene locus_tag LOCUS_25680 46762 48324 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_25680 49737 48334 gene locus_tag LOCUS_25690 49737 48334 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_25690 49803 50933 gene locus_tag LOCUS_25700 49803 50933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 51033 51296 gene locus_tag LOCUS_25710 51033 51296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 54017 51375 gene locus_tag LOCUS_25720 gene lon 54017 51375 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228447.1 protein_id gnl|my_center|LOCUS_25720 54999 54127 gene locus_tag LOCUS_25730 54999 54127 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_25730 55868 54996 gene locus_tag LOCUS_25740 55868 54996 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_25740 56250 55885 gene locus_tag LOCUS_25750 56250 55885 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_25750 56346 57467 gene locus_tag LOCUS_25760 56346 57467 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 protein_id gnl|my_center|LOCUS_25760 57540 58919 gene locus_tag LOCUS_25770 57540 58919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 59096 60370 gene locus_tag LOCUS_25780 59096 60370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 61288 60419 gene locus_tag LOCUS_25790 61288 60419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 62419 61430 gene locus_tag LOCUS_25800 62419 61430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 63264 62479 gene locus_tag LOCUS_25810 63264 62479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067690.1 protein_id gnl|my_center|LOCUS_25810 63725 64624 gene locus_tag LOCUS_25820 63725 64624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 65682 65194 gene locus_tag LOCUS_25830 65682 65194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 65866 71832 gene locus_tag LOCUS_25840 65866 71832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 72103 72957 gene locus_tag LOCUS_25850 72103 72957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 74146 78876 gene locus_tag LOCUS_25860 74146 78876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 79158 80024 gene locus_tag LOCUS_25870 79158 80024 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224475.1 protein_id gnl|my_center|LOCUS_25870 81042 80026 gene locus_tag LOCUS_25880 81042 80026 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_25880 82378 81065 gene locus_tag LOCUS_25890 82378 81065 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_25890 82473 83888 gene locus_tag LOCUS_25900 82473 83888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 84900 83905 gene locus_tag LOCUS_25910 84900 83905 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_25910 86058 84958 gene locus_tag LOCUS_25920 86058 84958 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_25920 86218 87864 gene locus_tag LOCUS_25930 86218 87864 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_25930 87861 89621 gene locus_tag LOCUS_25940 87861 89621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 89624 90394 gene locus_tag LOCUS_25950 89624 90394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_25950 90817 90410 gene locus_tag LOCUS_25960 90817 90410 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_25960 91670 90855 gene locus_tag LOCUS_25970 91670 90855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 95000 91683 gene locus_tag LOCUS_25980 95000 91683 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_25980 95060 96019 gene locus_tag LOCUS_25990 95060 96019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 96052 97008 gene locus_tag LOCUS_26000 96052 97008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 97629 97021 gene locus_tag LOCUS_26010 97629 97021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 97764 99086 gene locus_tag LOCUS_26020 97764 99086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence18 1730 3460 gene locus_tag LOCUS_26030 1730 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3678 3385 gene locus_tag LOCUS_26040 3678 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3637 4305 gene locus_tag LOCUS_26050 3637 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 5894 4353 gene locus_tag LOCUS_26060 5894 4353 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_26060 7143 5899 gene locus_tag LOCUS_26070 7143 5899 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_26070 8333 7140 gene locus_tag LOCUS_26080 8333 7140 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_26080 9229 8330 gene locus_tag LOCUS_26090 9229 8330 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_26090 10320 9238 gene locus_tag LOCUS_26100 gene argC 10320 9238 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_26100 11207 10317 gene locus_tag LOCUS_26110 gene lysX 11207 10317 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_26110 11407 11222 gene locus_tag LOCUS_26120 gene lysW 11407 11222 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_26120 12066 11656 gene locus_tag LOCUS_26130 12066 11656 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_26130 12653 12072 gene locus_tag LOCUS_26140 12653 12072 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_26140 14439 12643 gene locus_tag LOCUS_26150 14439 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 15179 14460 gene locus_tag LOCUS_26160 15179 14460 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274445.1 protein_id gnl|my_center|LOCUS_26160 15286 15909 gene locus_tag LOCUS_26170 15286 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 15926 16378 gene locus_tag LOCUS_26180 15926 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 16483 17805 gene locus_tag LOCUS_26190 16483 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 17889 20339 gene locus_tag LOCUS_26200 17889 20339 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_26200 20342 21610 gene locus_tag LOCUS_26210 20342 21610 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_26210 22941 21643 gene locus_tag LOCUS_26220 gene rifK 22941 21643 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_26220 23874 22951 gene locus_tag LOCUS_26230 gene rbsK 23874 22951 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 protein_id gnl|my_center|LOCUS_26230 25159 23879 gene locus_tag LOCUS_26240 25159 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 26032 25178 gene locus_tag LOCUS_26250 26032 25178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_26250 26789 26121 gene locus_tag LOCUS_26260 26789 26121 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_26260 27171 26818 gene locus_tag LOCUS_26270 27171 26818 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_26270 28672 27227 gene locus_tag LOCUS_26280 28672 27227 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_26280 29987 28743 gene locus_tag LOCUS_26290 29987 28743 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_26290 30580 29990 gene locus_tag LOCUS_26300 30580 29990 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_26300 33237 30580 gene locus_tag LOCUS_26310 33237 30580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 34841 33282 gene locus_tag LOCUS_26320 34841 33282 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_26320 35901 34852 gene locus_tag LOCUS_26330 gene lpxD 35901 34852 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_26330 36925 35927 gene locus_tag LOCUS_26340 36925 35927 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_26340 37754 36990 gene locus_tag LOCUS_26350 gene gloB 37754 36990 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527442.1 protein_id gnl|my_center|LOCUS_26350 38278 37772 gene locus_tag LOCUS_26360 38278 37772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 39175 38342 gene locus_tag LOCUS_26370 39175 38342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 40935 39175 gene locus_tag LOCUS_26380 40935 39175 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_26380 41070 42185 gene locus_tag LOCUS_26390 41070 42185 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_26390 44268 42193 gene locus_tag LOCUS_26400 44268 42193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 46671 44407 gene locus_tag LOCUS_26410 46671 44407 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_26410 49132 47168 gene locus_tag LOCUS_26420 49132 47168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 49555 51252 gene locus_tag LOCUS_26430 gene hflX 49555 51252 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_26430 51269 51787 gene locus_tag LOCUS_26440 51269 51787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 51800 52264 gene locus_tag LOCUS_26450 51800 52264 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111846.1 protein_id gnl|my_center|LOCUS_26450 52279 53067 gene locus_tag LOCUS_26460 52279 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 53100 53585 gene locus_tag LOCUS_26470 53100 53585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 53582 54067 gene locus_tag LOCUS_26480 53582 54067 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 protein_id gnl|my_center|LOCUS_26480 54151 56127 gene locus_tag LOCUS_26490 54151 56127 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_26490 56137 58062 gene locus_tag LOCUS_26500 56137 58062 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_26500 58104 59138 gene locus_tag LOCUS_26510 58104 59138 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_26510 61268 59166 gene locus_tag LOCUS_26520 61268 59166 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_26520 61383 62363 gene locus_tag LOCUS_26530 61383 62363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 63984 62395 gene locus_tag LOCUS_26540 63984 62395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 66057 64000 gene locus_tag LOCUS_26550 66057 64000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 68075 66087 gene locus_tag LOCUS_26560 68075 66087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 70347 68134 gene locus_tag LOCUS_26570 70347 68134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 71241 70489 gene locus_tag LOCUS_26580 71241 70489 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_26580 73333 71294 gene locus_tag LOCUS_26590 73333 71294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 75380 73341 gene locus_tag LOCUS_26600 75380 73341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 75379 76329 gene locus_tag LOCUS_26610 75379 76329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_26610 76337 77233 gene locus_tag LOCUS_26620 76337 77233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_26620 77238 79001 gene locus_tag LOCUS_26630 77238 79001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 79007 79999 gene locus_tag LOCUS_26640 79007 79999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_26640 79999 81018 gene locus_tag LOCUS_26650 79999 81018 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_26650 81060 82340 gene locus_tag LOCUS_26660 81060 82340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 82372 83370 gene locus_tag LOCUS_26670 82372 83370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 83438 84244 gene locus_tag LOCUS_26680 83438 84244 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_26680 85935 84298 gene locus_tag LOCUS_26690 gene groL 85935 84298 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_26690 86245 85958 gene locus_tag LOCUS_26700 gene groES 86245 85958 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975851.1 protein_id gnl|my_center|LOCUS_26700 86533 88311 gene locus_tag LOCUS_26710 86533 88311 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_26710 88308 89831 gene locus_tag LOCUS_26720 88308 89831 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_26720 89866 91227 gene locus_tag LOCUS_26730 89866 91227 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_26730 91610 91239 gene locus_tag LOCUS_26740 91610 91239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 91837 91607 gene locus_tag LOCUS_26750 91837 91607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 91925 92611 gene locus_tag LOCUS_26760 91925 92611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 93936 92686 gene locus_tag LOCUS_26770 gene fabF 93936 92686 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_26770 96806 93966 gene locus_tag LOCUS_26780 96806 93966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 96724 96978 gene locus_tag LOCUS_26790 96724 96978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence19 1745 699 gene locus_tag LOCUS_26800 1745 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1855 1779 gene locus_tag LOCUS_t00280 1855 1779 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2250 1879 gene locus_tag LOCUS_26810 2250 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3007 2318 gene locus_tag LOCUS_26820 3007 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3259 3104 gene locus_tag LOCUS_26830 gene rpmG 3259 3104 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_26830 3385 3309 gene locus_tag LOCUS_t00290 3385 3309 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3535 3461 gene locus_tag LOCUS_t00300 3535 3461 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3683 4282 gene locus_tag LOCUS_26840 gene sodA 3683 4282 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_26840 6015 4219 gene locus_tag LOCUS_26850 6015 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 6916 6068 gene locus_tag LOCUS_26860 6916 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26860 7196 6900 gene locus_tag LOCUS_26870 7196 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 7743 7249 gene locus_tag LOCUS_26880 7743 7249 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522192.1 protein_id gnl|my_center|LOCUS_26880 8793 7762 gene locus_tag LOCUS_26890 8793 7762 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_26890 9626 8790 gene locus_tag LOCUS_26900 gene kdsA 9626 8790 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870024.1 protein_id gnl|my_center|LOCUS_26900 11316 9634 gene locus_tag LOCUS_26910 11316 9634 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_26910 12002 11340 gene locus_tag LOCUS_26920 gene kdsB 12002 11340 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_26920 12212 13093 gene locus_tag LOCUS_26930 12212 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 15459 13090 gene locus_tag LOCUS_26940 15459 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 16109 15465 gene locus_tag LOCUS_26950 16109 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 17680 16109 gene locus_tag LOCUS_26960 gene purH 17680 16109 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_26960 21206 17718 gene locus_tag LOCUS_26970 21206 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 21402 21477 gene locus_tag LOCUS_t00310 21402 21477 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 22571 23539 gene locus_tag LOCUS_26980 22571 23539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 24228 23536 gene locus_tag LOCUS_26990 gene aat 24228 23536 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_26990 25303 24239 gene locus_tag LOCUS_27000 gene ychF 25303 24239 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_27000 26494 25316 gene locus_tag LOCUS_27010 26494 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 26638 28011 gene locus_tag LOCUS_27020 26638 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 28044 29513 gene locus_tag LOCUS_27030 28044 29513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 30235 29534 gene locus_tag LOCUS_27040 30235 29534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189933225.1 protein_id gnl|my_center|LOCUS_27040 30296 31360 gene locus_tag LOCUS_27050 30296 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 31357 33690 gene locus_tag LOCUS_27060 31357 33690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 35074 33698 gene locus_tag LOCUS_27070 35074 33698 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_27070 36922 35102 gene locus_tag LOCUS_27080 36922 35102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 37019 38365 gene locus_tag LOCUS_27090 37019 38365 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_27090 38382 38457 gene locus_tag LOCUS_t00320 38382 38457 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38489 39868 gene locus_tag LOCUS_27100 38489 39868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 39940 41103 gene locus_tag LOCUS_27110 39940 41103 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_27110 41184 43199 gene locus_tag LOCUS_27120 41184 43199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 43268 44416 gene locus_tag LOCUS_27130 43268 44416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_27130 46491 44449 gene locus_tag LOCUS_27140 gene tkt 46491 44449 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_27140 47401 46580 gene locus_tag LOCUS_27150 47401 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 47961 47440 gene locus_tag LOCUS_27160 47961 47440 CDS product sulfur transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_27160 48302 47961 gene locus_tag LOCUS_27170 48302 47961 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_27170 48784 48332 gene locus_tag LOCUS_27180 48784 48332 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_27180 50094 48811 gene locus_tag LOCUS_27190 50094 48811 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_27190 51460 50099 gene locus_tag LOCUS_27200 gene sufD 51460 50099 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_27200 52220 51465 gene locus_tag LOCUS_27210 gene sufC 52220 51465 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_27210 53736 52288 gene locus_tag LOCUS_27220 gene sufB 53736 52288 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_27220 54287 53736 gene locus_tag LOCUS_27230 54287 53736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 54271 55044 gene locus_tag LOCUS_27240 54271 55044 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_27240 56157 55054 gene locus_tag LOCUS_27250 56157 55054 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_27250 58105 56162 gene locus_tag LOCUS_27260 gene acs 58105 56162 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_27260 59714 58125 gene locus_tag LOCUS_27270 gene pckA 59714 58125 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404573.1 protein_id gnl|my_center|LOCUS_27270 59855 59781 gene locus_tag LOCUS_t00330 59855 59781 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 61671 59947 gene locus_tag LOCUS_27280 gene rpoD 61671 59947 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_27280 63486 61681 gene locus_tag LOCUS_27290 63486 61681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 66191 63687 gene locus_tag LOCUS_27300 66191 63687 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_27300 66457 66248 gene locus_tag LOCUS_27310 gene rpsU 66457 66248 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546110.1 protein_id gnl|my_center|LOCUS_27310 67376 66585 gene locus_tag LOCUS_27320 67376 66585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 67499 67572 gene locus_tag LOCUS_t00340 67499 67572 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67630 68370 gene locus_tag LOCUS_27330 67630 68370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 68415 69089 gene locus_tag LOCUS_27340 68415 69089 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338538.1 protein_id gnl|my_center|LOCUS_27340 69185 70963 gene locus_tag LOCUS_27350 69185 70963 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_27350 71270 70956 gene locus_tag LOCUS_27360 71270 70956 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_27360 72607 71267 gene locus_tag LOCUS_27370 72607 71267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_27370 73409 72609 gene locus_tag LOCUS_27380 73409 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 75642 73423 gene locus_tag LOCUS_27390 75642 73423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 77123 75639 gene locus_tag LOCUS_27400 gene rng 77123 75639 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_27400 78268 77153 gene locus_tag LOCUS_27410 gene rodA 78268 77153 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_27410 80045 78249 gene locus_tag LOCUS_27420 gene mrdA 80045 78249 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938087.1 protein_id gnl|my_center|LOCUS_27420 80574 80062 gene locus_tag LOCUS_27430 80574 80062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 81397 80558 gene locus_tag LOCUS_27440 81397 80558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 82429 81413 gene locus_tag LOCUS_27450 82429 81413 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_27450 82531 84483 gene locus_tag LOCUS_27460 82531 84483 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_27460 84509 85126 gene locus_tag LOCUS_27470 gene ruvA 84509 85126 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_27470 86475 85444 gene locus_tag LOCUS_27480 gene ruvB 86475 85444 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_27480 86792 89335 gene locus_tag LOCUS_27490 gene thrA 86792 89335 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403462.1 protein_id gnl|my_center|LOCUS_27490 89332 90423 gene locus_tag LOCUS_27500 gene asd 89332 90423 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_27500 90432 91403 gene locus_tag LOCUS_27510 90432 91403 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence20 1750 119 gene locus_tag LOCUS_27520 1750 119 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_27520 3420 1819 gene locus_tag LOCUS_27530 gene lbuL 3420 1819 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_27530 3475 4464 gene locus_tag LOCUS_27540 3475 4464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461738.1 protein_id gnl|my_center|LOCUS_27540 4746 4486 gene locus_tag LOCUS_27550 4746 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 5331 4771 gene locus_tag LOCUS_27560 5331 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 5710 5336 gene locus_tag LOCUS_27570 5710 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 5994 5707 gene locus_tag LOCUS_27580 5994 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 6969 6010 gene locus_tag LOCUS_27590 6969 6010 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_27590 7012 8460 gene locus_tag LOCUS_27600 7012 8460 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_27600 9240 8473 gene locus_tag LOCUS_27610 9240 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 10487 9258 gene locus_tag LOCUS_27620 10487 9258 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_27620 11487 10480 gene locus_tag LOCUS_27630 11487 10480 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_27630 11959 11510 gene locus_tag LOCUS_27640 11959 11510 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_27640 13047 11956 gene locus_tag LOCUS_27650 13047 11956 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_27650 14255 13044 gene locus_tag LOCUS_27660 14255 13044 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_27660 16735 14321 gene locus_tag LOCUS_27670 16735 14321 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_27670 18207 16834 gene locus_tag LOCUS_27680 18207 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 18304 20262 gene locus_tag LOCUS_27690 18304 20262 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_27690 20278 21759 gene locus_tag LOCUS_27700 20278 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 21756 22658 gene locus_tag LOCUS_27710 21756 22658 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_27710 22659 24128 gene locus_tag LOCUS_27720 22659 24128 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_27720 24125 25678 gene locus_tag LOCUS_27730 24125 25678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 26624 25683 gene locus_tag LOCUS_27740 26624 25683 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132545545.1 protein_id gnl|my_center|LOCUS_27740 26884 28869 gene locus_tag LOCUS_27750 gene shc 26884 28869 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144045.1 protein_id gnl|my_center|LOCUS_27750 28866 30875 gene locus_tag LOCUS_27760 28866 30875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 30889 32031 gene locus_tag LOCUS_27770 30889 32031 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_27770 33948 32047 gene locus_tag LOCUS_27780 gene btuB 33948 32047 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_27780 34277 37552 gene locus_tag LOCUS_27790 gene recC 34277 37552 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_27790 37549 41331 gene locus_tag LOCUS_27800 gene recB 37549 41331 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_27800 41328 43088 gene locus_tag LOCUS_27810 gene recD 41328 43088 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_27810 44650 43241 gene locus_tag LOCUS_27820 44650 43241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 45990 44752 gene locus_tag LOCUS_27830 gene kynU 45990 44752 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_27830 46070 47926 gene locus_tag LOCUS_27840 46070 47926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 48238 49821 gene locus_tag LOCUS_27850 48238 49821 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_27850 49831 51027 gene locus_tag LOCUS_27860 49831 51027 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_27860 51045 52577 gene locus_tag LOCUS_27870 51045 52577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27870 52574 53782 gene locus_tag LOCUS_27880 52574 53782 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_27880 53831 54085 gene locus_tag LOCUS_27890 53831 54085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 54105 54962 gene locus_tag LOCUS_27900 54105 54962 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_27900 55438 54959 gene locus_tag LOCUS_27910 55438 54959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 55431 57794 gene locus_tag LOCUS_27920 55431 57794 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_27920 58069 59079 gene locus_tag LOCUS_27930 58069 59079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 59347 60483 gene locus_tag LOCUS_27940 59347 60483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 60528 61709 gene locus_tag LOCUS_27950 60528 61709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 62709 61765 gene locus_tag LOCUS_27960 62709 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 64271 63579 gene locus_tag LOCUS_27970 64271 63579 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_27970 65030 64293 gene locus_tag LOCUS_27980 65030 64293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 65363 66013 gene locus_tag LOCUS_27990 65363 66013 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_27990 66079 67047 gene locus_tag LOCUS_28000 66079 67047 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368575.1 protein_id gnl|my_center|LOCUS_28000 67280 67891 gene locus_tag LOCUS_28010 67280 67891 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_28010 69565 67937 gene locus_tag LOCUS_28020 69565 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_28020 69504 69749 gene locus_tag LOCUS_28030 69504 69749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 70191 73406 gene locus_tag LOCUS_28040 70191 73406 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_28040 73480 74934 gene locus_tag LOCUS_28050 73480 74934 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419754.1 protein_id gnl|my_center|LOCUS_28050 75081 75968 gene locus_tag LOCUS_28060 75081 75968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 76132 75902 gene locus_tag LOCUS_28070 76132 75902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 76059 76226 gene locus_tag LOCUS_28080 76059 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 78490 76223 gene locus_tag LOCUS_28090 78490 76223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 78790 79455 gene locus_tag LOCUS_28100 78790 79455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_28100 79452 80069 gene locus_tag LOCUS_28110 79452 80069 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_28110 80077 83286 gene locus_tag LOCUS_28120 80077 83286 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_28120 84462 83305 gene locus_tag LOCUS_28130 84462 83305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 87751 84620 gene locus_tag LOCUS_28140 87751 84620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28140 <89705 87748 gene locus_tag LOCUS_28150 <89705 87748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein note possible pseudo, internal stop codon, frameshifted 87757 87766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence21 <1 3137 gene locus_tag LOCUS_28160 <1 3137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein 3295 4452 gene locus_tag LOCUS_28170 3295 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7680 4471 gene locus_tag LOCUS_28180 7680 4471 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_28180 8305 7688 gene locus_tag LOCUS_28190 8305 7688 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_28190 8967 8302 gene locus_tag LOCUS_28200 8967 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_28200 9267 11534 gene locus_tag LOCUS_28210 9267 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 11698 11531 gene locus_tag LOCUS_28220 11698 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 11625 11855 gene locus_tag LOCUS_28230 11625 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 12676 11789 gene locus_tag LOCUS_28240 12676 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 14277 12823 gene locus_tag LOCUS_28250 14277 12823 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419754.1 protein_id gnl|my_center|LOCUS_28250 17566 14351 gene locus_tag LOCUS_28260 17566 14351 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_28260 18253 18008 gene locus_tag LOCUS_28270 18253 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 18192 19820 gene locus_tag LOCUS_28280 18192 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_28280 20477 19866 gene locus_tag LOCUS_28290 20477 19866 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_28290 21678 20710 gene locus_tag LOCUS_28300 21678 20710 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368575.1 protein_id gnl|my_center|LOCUS_28300 22394 21744 gene locus_tag LOCUS_28310 22394 21744 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_28310 22727 23464 gene locus_tag LOCUS_28320 22727 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 23486 24178 gene locus_tag LOCUS_28330 23486 24178 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_28330 25048 25992 gene locus_tag LOCUS_28340 25048 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 27229 26048 gene locus_tag LOCUS_28350 27229 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 28410 27274 gene locus_tag LOCUS_28360 28410 27274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 29688 28678 gene locus_tag LOCUS_28370 29688 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 32326 29963 gene locus_tag LOCUS_28380 32326 29963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_28380 32319 32798 gene locus_tag LOCUS_28390 32319 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 33652 32795 gene locus_tag LOCUS_28400 33652 32795 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_28400 33926 33672 gene locus_tag LOCUS_28410 33926 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 35183 33975 gene locus_tag LOCUS_28420 35183 33975 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_28420 36712 35180 gene locus_tag LOCUS_28430 36712 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28430 37926 36730 gene locus_tag LOCUS_28440 37926 36730 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_28440 39519 37936 gene locus_tag LOCUS_28450 39519 37936 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_28450 39567 40484 gene locus_tag LOCUS_28460 39567 40484 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_28460 41688 40486 gene locus_tag LOCUS_28470 41688 40486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 41768 43006 gene locus_tag LOCUS_28480 gene kynU 41768 43006 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_28480 43108 44517 gene locus_tag LOCUS_28490 43108 44517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 46430 44670 gene locus_tag LOCUS_28500 gene recD 46430 44670 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_28500 50209 46427 gene locus_tag LOCUS_28510 gene recB 50209 46427 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_28510 53481 50206 gene locus_tag LOCUS_28520 gene recC 53481 50206 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_28520 53810 55711 gene locus_tag LOCUS_28530 gene btuB 53810 55711 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_28530 56869 55727 gene locus_tag LOCUS_28540 56869 55727 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_28540 58892 56883 gene locus_tag LOCUS_28550 58892 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 60874 58889 gene locus_tag LOCUS_28560 gene shc 60874 58889 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144045.1 protein_id gnl|my_center|LOCUS_28560 61134 62075 gene locus_tag LOCUS_28570 61134 62075 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132545545.1 protein_id gnl|my_center|LOCUS_28570 63633 62080 gene locus_tag LOCUS_28580 63633 62080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 65099 63630 gene locus_tag LOCUS_28590 65099 63630 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_28590 66002 65100 gene locus_tag LOCUS_28600 66002 65100 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_28600 67480 65999 gene locus_tag LOCUS_28610 67480 65999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 69454 67496 gene locus_tag LOCUS_28620 69454 67496 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_28620 69551 70924 gene locus_tag LOCUS_28630 69551 70924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 71023 73437 gene locus_tag LOCUS_28640 71023 73437 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_28640 73503 74714 gene locus_tag LOCUS_28650 73503 74714 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_28650 74711 75802 gene locus_tag LOCUS_28660 74711 75802 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_28660 75799 76248 gene locus_tag LOCUS_28670 75799 76248 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_28670 76271 77278 gene locus_tag LOCUS_28680 76271 77278 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_28680 77271 78500 gene locus_tag LOCUS_28690 77271 78500 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_28690 78518 79285 gene locus_tag LOCUS_28700 78518 79285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 80746 79298 gene locus_tag LOCUS_28710 80746 79298 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_28710 80789 81748 gene locus_tag LOCUS_28720 80789 81748 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_28720 81764 82051 gene locus_tag LOCUS_28730 81764 82051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 82048 82422 gene locus_tag LOCUS_28740 82048 82422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 82427 82987 gene locus_tag LOCUS_28750 82427 82987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 83012 83272 gene locus_tag LOCUS_28760 83012 83272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 84283 83294 gene locus_tag LOCUS_28770 84283 83294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461738.1 protein_id gnl|my_center|LOCUS_28770 84338 85939 gene locus_tag LOCUS_28780 gene lbuL 84338 85939 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_28780 86008 87639 gene locus_tag LOCUS_28790 86008 87639 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence22 2313 1147 gene locus_tag LOCUS_28800 2313 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3240 2461 gene locus_tag LOCUS_28810 3240 2461 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_28810 3290 4027 gene locus_tag LOCUS_28820 gene fkpA 3290 4027 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417197.1 protein_id gnl|my_center|LOCUS_28820 4754 4038 gene locus_tag LOCUS_28830 4754 4038 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_28830 5893 4751 gene locus_tag LOCUS_28840 5893 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 5947 6816 gene locus_tag LOCUS_28850 5947 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 7684 6851 gene locus_tag LOCUS_28860 7684 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 8099 7731 gene locus_tag LOCUS_28870 8099 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 10567 8198 gene locus_tag LOCUS_28880 10567 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 11021 10539 gene locus_tag LOCUS_28890 11021 10539 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_28890 11953 11039 gene locus_tag LOCUS_28900 11953 11039 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_28900 12054 13376 gene locus_tag LOCUS_28910 12054 13376 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_28910 13457 14212 gene locus_tag LOCUS_28920 13457 14212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_28920 16483 14258 gene locus_tag LOCUS_28930 16483 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 17013 16480 gene locus_tag LOCUS_28940 17013 16480 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721332.1 protein_id gnl|my_center|LOCUS_28940 19343 17256 gene locus_tag LOCUS_28950 19343 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 19566 19763 gene locus_tag LOCUS_28960 19566 19763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 20039 21364 gene locus_tag LOCUS_28970 20039 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 22220 21681 gene locus_tag LOCUS_28980 22220 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 22562 23455 gene locus_tag LOCUS_28990 22562 23455 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_28990 24055 23486 gene locus_tag LOCUS_29000 24055 23486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 24314 23988 gene locus_tag LOCUS_29010 24314 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 24751 24422 gene locus_tag LOCUS_29020 24751 24422 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_29020 25077 24814 gene locus_tag LOCUS_29030 25077 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 25186 25680 gene locus_tag LOCUS_29040 25186 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 25688 26023 gene locus_tag LOCUS_29050 25688 26023 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_29050 26010 26144 gene locus_tag LOCUS_29060 26010 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 30229 27458 gene locus_tag LOCUS_29070 30229 27458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 protein_id gnl|my_center|LOCUS_29070 32625 30280 gene locus_tag LOCUS_29080 32625 30280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 33427 32651 gene locus_tag LOCUS_29090 33427 32651 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_29090 34252 33470 gene locus_tag LOCUS_29100 34252 33470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_29100 35277 34261 gene locus_tag LOCUS_29110 35277 34261 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_29110 35351 36724 gene locus_tag LOCUS_29120 35351 36724 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_29120 36815 38197 gene locus_tag LOCUS_29130 36815 38197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 39458 38283 gene locus_tag LOCUS_29140 39458 38283 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_29140 40893 39496 gene locus_tag LOCUS_29150 40893 39496 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_29150 42348 40990 gene locus_tag LOCUS_29160 42348 40990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 43076 42507 gene locus_tag LOCUS_29170 43076 42507 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_29170 44554 43097 gene locus_tag LOCUS_29180 44554 43097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 44666 44944 gene locus_tag LOCUS_29190 44666 44944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 44966 45181 gene locus_tag LOCUS_29200 44966 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 45282 46283 gene locus_tag LOCUS_29210 45282 46283 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_29210 46395 47027 gene locus_tag LOCUS_29220 46395 47027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 47047 47514 gene locus_tag LOCUS_29230 47047 47514 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_29230 47516 49861 gene locus_tag LOCUS_29240 47516 49861 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_29240 49926 50774 gene locus_tag LOCUS_29250 49926 50774 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_29250 51110 51688 gene locus_tag LOCUS_29260 51110 51688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 53106 51928 gene locus_tag LOCUS_29270 53106 51928 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_29270 54588 53137 gene locus_tag LOCUS_29280 gene pyk 54588 53137 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_29280 55630 54614 gene locus_tag LOCUS_29290 gene gap 55630 54614 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403953.1 protein_id gnl|my_center|LOCUS_29290 56727 55627 gene locus_tag LOCUS_29300 gene gap 56727 55627 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057792.1 protein_id gnl|my_center|LOCUS_29300 57997 56696 gene locus_tag LOCUS_29310 gene glcF 57997 56696 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_29310 59693 58053 gene locus_tag LOCUS_29320 gene aceB 59693 58053 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_29320 59825 63211 gene locus_tag LOCUS_29330 59825 63211 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_29330 63227 64597 gene locus_tag LOCUS_29340 63227 64597 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_29340 64660 66816 gene locus_tag LOCUS_29350 64660 66816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 66845 67369 gene locus_tag LOCUS_29360 66845 67369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 67778 67380 gene locus_tag LOCUS_29370 67778 67380 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_29370 68057 67791 gene locus_tag LOCUS_29380 68057 67791 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_29380 68177 70831 gene locus_tag LOCUS_29390 68177 70831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 72602 70845 gene locus_tag LOCUS_29400 72602 70845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 74478 72610 gene locus_tag LOCUS_29410 74478 72610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_29410 76262 74475 gene locus_tag LOCUS_29420 76262 74475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_29420 76334 76942 gene locus_tag LOCUS_29430 76334 76942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 76942 78429 gene locus_tag LOCUS_29440 76942 78429 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_29440 78437 79387 gene locus_tag LOCUS_29450 78437 79387 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_29450 79380 80609 gene locus_tag LOCUS_29460 79380 80609 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_29460 <81517 80560 gene locus_tag LOCUS_29470 <81517 80560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994093.1:nucleoside hydrolase >Feature sequence23 1131 133 gene locus_tag LOCUS_29480 1131 133 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_29480 1727 1140 gene locus_tag LOCUS_29490 1727 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3121 1724 gene locus_tag LOCUS_29500 3121 1724 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_29500 3796 3140 gene locus_tag LOCUS_29510 gene fsa 3796 3140 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_29510 6361 3815 gene locus_tag LOCUS_29520 gene gyrA 6361 3815 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_29520 8816 6372 gene locus_tag LOCUS_29530 gene gyrB 8816 6372 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072072.1 protein_id gnl|my_center|LOCUS_29530 10070 8958 gene locus_tag LOCUS_29540 gene dnaN 10070 8958 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_29540 11717 10380 gene locus_tag LOCUS_29550 gene dnaA 11717 10380 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_29550 12127 13230 gene locus_tag LOCUS_29560 gene mutY 12127 13230 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_29560 13227 14432 gene locus_tag LOCUS_29570 13227 14432 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_29570 14437 15723 gene locus_tag LOCUS_29580 14437 15723 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_29580 16658 16071 gene locus_tag LOCUS_29590 gene recR 16658 16071 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458897.1 protein_id gnl|my_center|LOCUS_29590 16951 16658 gene locus_tag LOCUS_29600 16951 16658 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869751.1 protein_id gnl|my_center|LOCUS_29600 18709 16985 gene locus_tag LOCUS_29610 gene dnaX 18709 16985 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_29610 18964 19419 gene locus_tag LOCUS_29620 18964 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 19410 19499 gene locus_tag LOCUS_t00350 19410 19499 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19546 19635 gene locus_tag LOCUS_t00360 19546 19635 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19880 20299 gene locus_tag LOCUS_29630 19880 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 20296 20553 gene locus_tag LOCUS_29640 gene yidD 20296 20553 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307474.1 protein_id gnl|my_center|LOCUS_29640 20563 22305 gene locus_tag LOCUS_29650 gene yidC 20563 22305 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_29650 22322 23134 gene locus_tag LOCUS_29660 22322 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 23638 24285 gene locus_tag LOCUS_29670 23638 24285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 24278 25036 gene locus_tag LOCUS_29680 24278 25036 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_29680 25036 25911 gene locus_tag LOCUS_29690 25036 25911 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_29690 25935 26375 gene locus_tag LOCUS_29700 25935 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 28052 26403 gene locus_tag LOCUS_29710 28052 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 28131 28916 gene locus_tag LOCUS_29720 28131 28916 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_29720 28913 29857 gene locus_tag LOCUS_29730 28913 29857 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_29730 29854 30549 gene locus_tag LOCUS_29740 gene pyrF 29854 30549 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_29740 31199 30552 gene locus_tag LOCUS_29750 gene lepB 31199 30552 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_29750 31944 31213 gene locus_tag LOCUS_29760 gene lepB 31944 31213 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_29760 32440 32775 gene locus_tag LOCUS_29770 32440 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 32798 33427 gene locus_tag LOCUS_29780 32798 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 33448 34479 gene locus_tag LOCUS_29790 gene mtnA 33448 34479 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937395.1 protein_id gnl|my_center|LOCUS_29790 36204 34495 gene locus_tag LOCUS_29800 36204 34495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 36203 37324 gene locus_tag LOCUS_29810 36203 37324 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575380.1 protein_id gnl|my_center|LOCUS_29810 39914 37308 gene locus_tag LOCUS_29820 39914 37308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_29820 40324 39978 gene locus_tag LOCUS_tm00010 40324 39978 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 40942 40364 gene locus_tag LOCUS_29830 40942 40364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 43161 40978 gene locus_tag LOCUS_29840 43161 40978 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_29840 43739 43341 gene locus_tag LOCUS_29850 43739 43341 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_29850 44076 43753 gene locus_tag LOCUS_29860 44076 43753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 44549 44076 gene locus_tag LOCUS_29870 44549 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 45565 44573 gene locus_tag LOCUS_29880 gene dusB 45565 44573 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_29880 45459 45659 gene locus_tag LOCUS_29890 45459 45659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 45671 47362 gene locus_tag LOCUS_29900 gene bshC 45671 47362 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479890.1 protein_id gnl|my_center|LOCUS_29900 47374 48555 gene locus_tag LOCUS_29910 gene bshA 47374 48555 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_29910 48552 48947 gene locus_tag LOCUS_29920 48552 48947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 49010 49288 gene locus_tag LOCUS_29930 49010 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 49291 49635 gene locus_tag LOCUS_29940 49291 49635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 50316 49603 gene locus_tag LOCUS_29950 50316 49603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 50370 50915 gene locus_tag LOCUS_29960 gene ppiA 50370 50915 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_29960 51062 50978 gene locus_tag LOCUS_t00370 51062 50978 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51481 51086 gene locus_tag LOCUS_29970 51481 51086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 52313 51537 gene locus_tag LOCUS_29980 gene tpiA 52313 51537 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_29980 53530 52310 gene locus_tag LOCUS_29990 53530 52310 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_29990 53597 54721 gene locus_tag LOCUS_30000 gene tsaD 53597 54721 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904802.1 protein_id gnl|my_center|LOCUS_30000 55550 54762 gene locus_tag LOCUS_30010 55550 54762 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_30010 56211 55561 gene locus_tag LOCUS_30020 56211 55561 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_30020 56542 56452 gene locus_tag LOCUS_t00380 56542 56452 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 57211 57287 gene locus_tag LOCUS_t00390 57211 57287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57297 58169 gene locus_tag LOCUS_30030 gene yghU 57297 58169 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_30030 58852 58178 gene locus_tag LOCUS_30040 58852 58178 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730121.1 protein_id gnl|my_center|LOCUS_30040 58980 60080 gene locus_tag LOCUS_30050 58980 60080 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_30050 60077 61321 gene locus_tag LOCUS_30060 60077 61321 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_30060 61318 63120 gene locus_tag LOCUS_30070 61318 63120 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_30070 63117 64193 gene locus_tag LOCUS_30080 63117 64193 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_30080 64207 65466 gene locus_tag LOCUS_30090 64207 65466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 64758 64767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66341 65463 gene locus_tag LOCUS_30100 66341 65463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 67421 66354 gene locus_tag LOCUS_30110 67421 66354 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_30110 68133 67441 gene locus_tag LOCUS_30120 68133 67441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 68276 69529 gene locus_tag LOCUS_30130 68276 69529 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_30130 69555 71144 gene locus_tag LOCUS_30140 69555 71144 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_30140 71141 71527 gene locus_tag LOCUS_30150 71141 71527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 73011 71524 gene locus_tag LOCUS_30160 gene mmsA 73011 71524 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_30160 73168 73500 gene locus_tag LOCUS_30170 73168 73500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 74115 73519 gene locus_tag LOCUS_30180 74115 73519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 74148 75218 gene locus_tag LOCUS_30190 74148 75218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 76401 75283 gene locus_tag LOCUS_30200 76401 75283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_30200 77173 76412 gene locus_tag LOCUS_30210 77173 76412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_30210 78146 77190 gene locus_tag LOCUS_30220 78146 77190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 78824 78180 gene locus_tag LOCUS_30230 78824 78180 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 protein_id gnl|my_center|LOCUS_30230 78992 79363 gene locus_tag LOCUS_30240 78992 79363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 80210 79467 gene locus_tag LOCUS_30250 80210 79467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence24 56 928 gene locus_tag LOCUS_30260 56 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1467 889 gene locus_tag LOCUS_30270 1467 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3328 1481 gene locus_tag LOCUS_30280 3328 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4346 3321 gene locus_tag LOCUS_30290 4346 3321 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_30290 5056 4361 gene locus_tag LOCUS_30300 5056 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 5113 6933 gene locus_tag LOCUS_30310 5113 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 6899 8224 gene locus_tag LOCUS_30320 6899 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 8243 10639 gene locus_tag LOCUS_30330 8243 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 10639 11787 gene locus_tag LOCUS_30340 gene thiO 10639 11787 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_30340 11872 12123 gene locus_tag LOCUS_30350 11872 12123 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_30350 12285 13265 gene locus_tag LOCUS_30360 12285 13265 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_30360 13295 15943 gene locus_tag LOCUS_30370 gene clpB 13295 15943 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_30370 15983 17239 gene locus_tag LOCUS_30380 15983 17239 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_30380 17484 17245 gene locus_tag LOCUS_30390 17484 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 19160 17511 gene locus_tag LOCUS_30400 19160 17511 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_30400 19241 20131 gene locus_tag LOCUS_30410 gene xerD 19241 20131 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_30410 20924 20232 gene locus_tag LOCUS_30420 20924 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 22997 20934 gene locus_tag LOCUS_30430 22997 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 23137 25002 gene locus_tag LOCUS_30440 23137 25002 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_30440 25004 26068 gene locus_tag LOCUS_30450 25004 26068 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_30450 26082 27770 gene locus_tag LOCUS_30460 26082 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 28277 27795 gene locus_tag LOCUS_30470 gene coaD 28277 27795 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_30470 30565 28274 gene locus_tag LOCUS_30480 30565 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 32412 30562 gene locus_tag LOCUS_30490 32412 30562 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_30490 33042 32455 gene locus_tag LOCUS_30500 33042 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 34786 33071 gene locus_tag LOCUS_30510 gene recN 34786 33071 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_30510 35643 34795 gene locus_tag LOCUS_30520 gene proC 35643 34795 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_30520 36685 35708 gene locus_tag LOCUS_30530 36685 35708 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_30530 37628 36696 gene locus_tag LOCUS_30540 gene lipA 37628 36696 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_30540 38401 37634 gene locus_tag LOCUS_30550 gene lipB 38401 37634 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_30550 38494 39645 gene locus_tag LOCUS_30560 38494 39645 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838133.1 protein_id gnl|my_center|LOCUS_30560 40693 39632 gene locus_tag LOCUS_30570 40693 39632 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_30570 41352 40774 gene locus_tag LOCUS_30580 41352 40774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 43064 41349 gene locus_tag LOCUS_30590 43064 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 44710 43061 gene locus_tag LOCUS_30600 44710 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 45701 44694 gene locus_tag LOCUS_30610 45701 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 47288 45816 gene locus_tag LOCUS_30620 gene lnt 47288 45816 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_30620 47935 47396 gene locus_tag LOCUS_30630 47935 47396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 48711 47932 gene locus_tag LOCUS_30640 48711 47932 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_30640 50122 48740 gene locus_tag LOCUS_30650 50122 48740 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_30650 50236 50160 gene locus_tag LOCUS_t00400 50236 50160 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51081 50305 gene locus_tag LOCUS_30660 51081 50305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 51589 51056 gene locus_tag LOCUS_30670 51589 51056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 51470 53284 gene locus_tag LOCUS_30680 51470 53284 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873253.1 protein_id gnl|my_center|LOCUS_30680 53420 53755 gene locus_tag LOCUS_30690 gene gatC 53420 53755 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_30690 53755 55212 gene locus_tag LOCUS_30700 gene gatA 53755 55212 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_30700 55209 56999 gene locus_tag LOCUS_30710 55209 56999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 57737 57033 gene locus_tag LOCUS_30720 gene lexA 57737 57033 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_30720 57752 59044 gene locus_tag LOCUS_30730 57752 59044 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_30730 59041 60426 gene locus_tag LOCUS_30740 59041 60426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 60493 62589 gene locus_tag LOCUS_30750 gene fusA 60493 62589 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_30750 63519 63157 gene locus_tag LOCUS_30760 gene rplQ 63519 63157 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583372.1 protein_id gnl|my_center|LOCUS_30760 64549 63563 gene locus_tag LOCUS_30770 64549 63563 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_30770 65002 64628 gene locus_tag LOCUS_30780 gene rpsK 65002 64628 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_30780 65412 65032 gene locus_tag LOCUS_30790 gene rpsM 65412 65032 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_30790 65833 65588 gene locus_tag LOCUS_30800 gene infA 65833 65588 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_30800 66424 65852 gene locus_tag LOCUS_30810 66424 65852 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_30810 67802 66417 gene locus_tag LOCUS_30820 gene secY 67802 66417 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_30820 68248 67814 gene locus_tag LOCUS_30830 gene rplO 68248 67814 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_30830 68450 68250 gene locus_tag LOCUS_30840 gene rpmD 68450 68250 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722524.1 protein_id gnl|my_center|LOCUS_30840 68979 68368 gene locus_tag LOCUS_30850 gene rpsE 68979 68368 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_30850 69402 69016 gene locus_tag LOCUS_30860 gene rplR 69402 69016 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_30860 69928 69413 gene locus_tag LOCUS_30870 gene rplF 69928 69413 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_30870 70360 69962 gene locus_tag LOCUS_30880 gene rpsH 70360 69962 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_30880 70952 70410 gene locus_tag LOCUS_30890 gene rplE 70952 70410 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_30890 71293 70952 gene locus_tag LOCUS_30900 gene rplX 71293 70952 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_30900 71645 71295 gene locus_tag LOCUS_30910 gene rplN 71645 71295 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_30910 71956 71672 gene locus_tag LOCUS_30920 gene rpsQ 71956 71672 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_30920 72141 71953 gene locus_tag LOCUS_30930 gene rpmC 72141 71953 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_30930 72574 72155 gene locus_tag LOCUS_30940 gene rplP 72574 72155 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_30940 73260 72610 gene locus_tag LOCUS_30950 gene rpsC 73260 72610 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_30950 73631 73269 gene locus_tag LOCUS_30960 gene rplV 73631 73269 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_30960 73952 73665 gene locus_tag LOCUS_30970 gene rpsS 73952 73665 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_30970 74813 73983 gene locus_tag LOCUS_30980 gene rplB 74813 73983 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_30980 75106 74825 gene locus_tag LOCUS_30990 75106 74825 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_30990 75783 75109 gene locus_tag LOCUS_31000 gene rplD 75783 75109 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_31000 76427 75783 gene locus_tag LOCUS_31010 gene rplC 76427 75783 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_31010 76800 76468 gene locus_tag LOCUS_31020 gene rpsJ 76800 76468 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence25 3250 203 gene locus_tag LOCUS_31030 3250 203 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_31030 3799 3299 gene locus_tag LOCUS_31040 3799 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 5038 3821 gene locus_tag LOCUS_31050 5038 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 8224 5162 gene locus_tag LOCUS_31060 8224 5162 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_31060 8269 9018 gene locus_tag LOCUS_31070 8269 9018 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809109.1 protein_id gnl|my_center|LOCUS_31070 10033 9035 gene locus_tag LOCUS_31080 10033 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 10104 12131 gene locus_tag LOCUS_31090 10104 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 12146 13624 gene locus_tag LOCUS_31100 12146 13624 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_31100 13677 14360 gene locus_tag LOCUS_31110 gene radC 13677 14360 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_31110 14357 17269 gene locus_tag LOCUS_31120 14357 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 17290 19284 gene locus_tag LOCUS_31130 17290 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 19288 22155 gene locus_tag LOCUS_31140 19288 22155 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_31140 22155 22562 gene locus_tag LOCUS_31150 22155 22562 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522187.1 protein_id gnl|my_center|LOCUS_31150 22883 22635 gene locus_tag LOCUS_31160 22883 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 23468 22983 gene locus_tag LOCUS_31170 23468 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 23903 23496 gene locus_tag LOCUS_31180 23903 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 24172 23918 gene locus_tag LOCUS_31190 24172 23918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 26016 24427 gene locus_tag LOCUS_31200 26016 24427 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_31200 27057 26050 gene locus_tag LOCUS_31210 27057 26050 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_31210 27184 28398 gene locus_tag LOCUS_31220 27184 28398 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_31220 28398 30296 gene locus_tag LOCUS_31230 28398 30296 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_31230 31410 30310 gene locus_tag LOCUS_31240 31410 30310 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925262.1 protein_id gnl|my_center|LOCUS_31240 32988 31537 gene locus_tag LOCUS_31250 32988 31537 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_31250 34177 33047 gene locus_tag LOCUS_31260 34177 33047 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_31260 34332 35288 gene locus_tag LOCUS_31270 34332 35288 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_31270 35388 35807 gene locus_tag LOCUS_31280 35388 35807 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_31280 35858 36961 gene locus_tag LOCUS_31290 35858 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 36988 38355 gene locus_tag LOCUS_31300 36988 38355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 38392 39831 gene locus_tag LOCUS_31310 38392 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 39838 41070 gene locus_tag LOCUS_31320 39838 41070 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_31320 41099 42271 gene locus_tag LOCUS_31330 41099 42271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 42284 43669 gene locus_tag LOCUS_31340 42284 43669 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_31340 46072 43685 gene locus_tag LOCUS_31350 46072 43685 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_31350 46230 47531 gene locus_tag LOCUS_31360 46230 47531 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_31360 47556 47804 gene locus_tag LOCUS_31370 47556 47804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 47801 49258 gene locus_tag LOCUS_31380 47801 49258 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_31380 49255 50619 gene locus_tag LOCUS_31390 49255 50619 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_31390 50612 51313 gene locus_tag LOCUS_31400 gene lolD 50612 51313 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_31400 51345 54743 gene locus_tag LOCUS_31410 51345 54743 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_31410 57285 54781 gene locus_tag LOCUS_31420 57285 54781 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 protein_id gnl|my_center|LOCUS_31420 58366 57290 gene locus_tag LOCUS_31430 58366 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 58437 59870 gene locus_tag LOCUS_31440 58437 59870 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_31440 59867 60565 gene locus_tag LOCUS_31450 gene rpoE 59867 60565 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_31450 60565 61023 gene locus_tag LOCUS_31460 60565 61023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 61023 61610 gene locus_tag LOCUS_31470 61023 61610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 61634 64882 gene locus_tag LOCUS_31480 61634 64882 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_31480 64879 66420 gene locus_tag LOCUS_31490 64879 66420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 66455 69778 gene locus_tag LOCUS_31500 66455 69778 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_31500 72124 69824 gene locus_tag LOCUS_31510 72124 69824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence26 388 1317 gene locus_tag LOCUS_31520 388 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1327 2004 gene locus_tag LOCUS_31530 1327 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2704 2021 gene locus_tag LOCUS_31540 2704 2021 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_31540 2768 3718 gene locus_tag LOCUS_31550 2768 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4097 3696 gene locus_tag LOCUS_31560 4097 3696 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_31560 4441 4094 gene locus_tag LOCUS_31570 4441 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 6552 4735 gene locus_tag LOCUS_31580 6552 4735 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_31580 6961 6596 gene locus_tag LOCUS_31590 6961 6596 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 protein_id gnl|my_center|LOCUS_31590 8807 6975 gene locus_tag LOCUS_31600 gene lpdA 8807 6975 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_31600 10102 8804 gene locus_tag LOCUS_31610 gene aceF 10102 8804 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31610 12801 10099 gene locus_tag LOCUS_31620 gene aceE 12801 10099 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039835.1 protein_id gnl|my_center|LOCUS_31620 13006 14910 gene locus_tag LOCUS_31630 gene thiC 13006 14910 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_31630 13159 13080 gene locus_tag LOCUS_t00410 13159 13080 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14940 15998 gene locus_tag LOCUS_31640 14940 15998 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_31640 16037 17335 gene locus_tag LOCUS_31650 16037 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 17332 18090 gene locus_tag LOCUS_31660 17332 18090 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_31660 18109 20109 gene locus_tag LOCUS_31670 18109 20109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 protein_id gnl|my_center|LOCUS_31670 20857 20102 gene locus_tag LOCUS_31680 20857 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 20959 21552 gene locus_tag LOCUS_31690 20959 21552 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_31690 21567 23006 gene locus_tag LOCUS_31700 21567 23006 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_31700 23592 23062 gene locus_tag LOCUS_31710 23592 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 23949 23668 gene locus_tag LOCUS_31720 23949 23668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 25193 23952 gene locus_tag LOCUS_31730 gene ispG 25193 23952 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615358.1 protein_id gnl|my_center|LOCUS_31730 25875 25690 gene locus_tag LOCUS_31740 25875 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 25783 28995 gene locus_tag LOCUS_31750 25783 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 29103 32141 gene locus_tag LOCUS_31760 29103 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 32153 34618 gene locus_tag LOCUS_31770 32153 34618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 36032 34593 gene locus_tag LOCUS_31780 36032 34593 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_31780 37276 36047 gene locus_tag LOCUS_31790 gene hutI 37276 36047 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_31790 37342 38703 gene locus_tag LOCUS_31800 gene hutF 37342 38703 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394609.1 protein_id gnl|my_center|LOCUS_31800 38718 40394 gene locus_tag LOCUS_31810 38718 40394 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918841.1 protein_id gnl|my_center|LOCUS_31810 40391 41911 gene locus_tag LOCUS_31820 gene hutH 40391 41911 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902906.1 protein_id gnl|my_center|LOCUS_31820 41948 43816 gene locus_tag LOCUS_31830 41948 43816 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_31830 44118 45614 gene locus_tag LOCUS_31840 44118 45614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 45626 46690 gene locus_tag LOCUS_31850 45626 46690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 46687 47748 gene locus_tag LOCUS_31860 46687 47748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 47797 49524 gene locus_tag LOCUS_31870 47797 49524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 49527 51329 gene locus_tag LOCUS_31880 49527 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 51751 51326 gene locus_tag LOCUS_31890 51751 51326 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 protein_id gnl|my_center|LOCUS_31890 54237 51769 gene locus_tag LOCUS_31900 54237 51769 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727995.1 protein_id gnl|my_center|LOCUS_31900 54261 55592 gene locus_tag LOCUS_31910 54261 55592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 55644 56876 gene locus_tag LOCUS_31920 55644 56876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 56967 57731 gene locus_tag LOCUS_31930 56967 57731 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_31930 59473 57683 gene locus_tag LOCUS_31940 59473 57683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 60374 59487 gene locus_tag LOCUS_31950 60374 59487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 60422 62200 gene locus_tag LOCUS_31960 60422 62200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence27 <1 1039 gene locus_tag LOCUS_31970 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383906.1:aminotransferase 1762 1067 gene locus_tag LOCUS_31980 1762 1067 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_31980 2188 1787 gene locus_tag LOCUS_31990 2188 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2235 3227 gene locus_tag LOCUS_32000 2235 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3266 4006 gene locus_tag LOCUS_32010 3266 4006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 protein_id gnl|my_center|LOCUS_32010 5207 3999 gene locus_tag LOCUS_32020 5207 3999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_32020 7804 5207 gene locus_tag LOCUS_32030 7804 5207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972487.1 protein_id gnl|my_center|LOCUS_32030 8529 7801 gene locus_tag LOCUS_32040 8529 7801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_32040 9209 8526 gene locus_tag LOCUS_32050 9209 8526 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_32050 9260 10027 gene locus_tag LOCUS_32060 9260 10027 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_32060 10030 12300 gene locus_tag LOCUS_32070 10030 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 13137 12358 gene locus_tag LOCUS_32080 13137 12358 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_32080 14543 13137 gene locus_tag LOCUS_32090 14543 13137 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_32090 15843 14629 gene locus_tag LOCUS_32100 15843 14629 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_32100 17514 15862 gene locus_tag LOCUS_32110 17514 15862 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_32110 17942 17541 gene locus_tag LOCUS_32120 17942 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 19587 17953 gene locus_tag LOCUS_32130 19587 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 19693 22209 gene locus_tag LOCUS_32140 19693 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 22253 23086 gene locus_tag LOCUS_32150 22253 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 23737 23129 gene locus_tag LOCUS_32160 23737 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 24897 23734 gene locus_tag LOCUS_32170 24897 23734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_32170 25852 24968 gene locus_tag LOCUS_32180 25852 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 26434 25991 gene locus_tag LOCUS_32190 26434 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 26820 26431 gene locus_tag LOCUS_32200 26820 26431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 26729 27013 gene locus_tag LOCUS_32210 26729 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 28911 27175 gene locus_tag LOCUS_32220 28911 27175 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197709.1 protein_id gnl|my_center|LOCUS_32220 29029 30471 gene locus_tag LOCUS_32230 29029 30471 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066453.1 protein_id gnl|my_center|LOCUS_32230 30468 31097 gene locus_tag LOCUS_32240 30468 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 31581 31084 gene locus_tag LOCUS_32250 31581 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 31651 35097 gene locus_tag LOCUS_32260 31651 35097 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101675310.1 protein_id gnl|my_center|LOCUS_32260 35687 36430 gene locus_tag LOCUS_32270 35687 36430 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_32270 38060 36456 gene locus_tag LOCUS_32280 gene ppx 38060 36456 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_32280 38011 39045 gene locus_tag LOCUS_32290 gene ltaE 38011 39045 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_32290 39038 39493 gene locus_tag LOCUS_32300 39038 39493 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965056.1 protein_id gnl|my_center|LOCUS_32300 40303 39503 gene locus_tag LOCUS_32310 40303 39503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 41358 40300 gene locus_tag LOCUS_32320 gene btuC 41358 40300 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_32320 42416 41355 gene locus_tag LOCUS_32330 42416 41355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 42476 42961 gene locus_tag LOCUS_32340 42476 42961 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_32340 42993 43952 gene locus_tag LOCUS_32350 gene coaA 42993 43952 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_32350 45458 43959 gene locus_tag LOCUS_32360 45458 43959 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_32360 46465 45560 gene locus_tag LOCUS_32370 46465 45560 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_32370 47126 46665 gene locus_tag LOCUS_32380 47126 46665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 49419 47167 gene locus_tag LOCUS_32390 49419 47167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 49735 49463 gene locus_tag LOCUS_32400 49735 49463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 50093 50296 gene locus_tag LOCUS_32410 50093 50296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 50327 52024 gene locus_tag LOCUS_32420 50327 52024 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 protein_id gnl|my_center|LOCUS_32420 54222 52021 gene locus_tag LOCUS_32430 54222 52021 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_32430 54362 55006 gene locus_tag LOCUS_32440 54362 55006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 54934 56961 gene locus_tag LOCUS_32450 54934 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 57031 57480 gene locus_tag LOCUS_32460 57031 57480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 57497 58675 gene locus_tag LOCUS_32470 gene galK 57497 58675 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_32470 58708 59433 gene locus_tag LOCUS_32480 58708 59433 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_32480 59560 60390 gene locus_tag LOCUS_32490 59560 60390 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_32490 <61064 60393 gene locus_tag LOCUS_32500 <61064 60393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225314.1:amidohydrolase family protein >Feature sequence28 488 1495 gene locus_tag LOCUS_32510 gene miaA 488 1495 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_32510 1492 2487 gene locus_tag LOCUS_32520 1492 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2499 3152 gene locus_tag LOCUS_32530 2499 3152 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_32530 3191 3835 gene locus_tag LOCUS_32540 3191 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3946 4761 gene locus_tag LOCUS_32550 3946 4761 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_32550 4813 7131 gene locus_tag LOCUS_32560 4813 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 7128 8147 gene locus_tag LOCUS_32570 7128 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_32570 8144 10909 gene locus_tag LOCUS_32580 8144 10909 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_32580 10906 11724 gene locus_tag LOCUS_32590 10906 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 11769 12839 gene locus_tag LOCUS_32600 11769 12839 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_32600 12856 13749 gene locus_tag LOCUS_32610 12856 13749 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_32610 13757 15922 gene locus_tag LOCUS_32620 13757 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 15936 19598 gene locus_tag LOCUS_32630 15936 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 20911 19685 gene locus_tag LOCUS_32640 20911 19685 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_32640 22026 20911 gene locus_tag LOCUS_32650 22026 20911 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 protein_id gnl|my_center|LOCUS_32650 22856 22104 gene locus_tag LOCUS_32660 22856 22104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_32660 23005 23796 gene locus_tag LOCUS_32670 23005 23796 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_32670 25174 23846 gene locus_tag LOCUS_32680 25174 23846 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_32680 26084 25242 gene locus_tag LOCUS_32690 26084 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 26316 27683 gene locus_tag LOCUS_32700 gene gorA 26316 27683 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 protein_id gnl|my_center|LOCUS_32700 28641 27688 gene locus_tag LOCUS_32710 gene gshB 28641 27688 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_32710 28765 29328 gene locus_tag LOCUS_32720 28765 29328 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640440.1 protein_id gnl|my_center|LOCUS_32720 31035 29404 gene locus_tag LOCUS_32730 31035 29404 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_32730 33749 31116 gene locus_tag LOCUS_32740 33749 31116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 33846 35399 gene locus_tag LOCUS_32750 33846 35399 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_32750 35420 36241 gene locus_tag LOCUS_32760 35420 36241 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_32760 36264 37439 gene locus_tag LOCUS_32770 36264 37439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 39834 37432 gene locus_tag LOCUS_32780 gene clpA 39834 37432 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_32780 40257 39865 gene locus_tag LOCUS_32790 40257 39865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 41487 40291 gene locus_tag LOCUS_32800 41487 40291 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_32800 43115 41526 gene locus_tag LOCUS_32810 gene ggt 43115 41526 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_32810 45294 43168 gene locus_tag LOCUS_32820 45294 43168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 48608 45408 gene locus_tag LOCUS_32830 48608 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32830 48640 49545 gene locus_tag LOCUS_32840 48640 49545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 51189 49558 gene locus_tag LOCUS_32850 51189 49558 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_32850 51203 52375 gene locus_tag LOCUS_32860 51203 52375 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence29 293 637 gene locus_tag LOCUS_32870 293 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 695 1903 gene locus_tag LOCUS_32880 695 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3772 2045 gene locus_tag LOCUS_32890 3772 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3880 5997 gene locus_tag LOCUS_32900 3880 5997 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_32900 6404 6069 gene locus_tag LOCUS_32910 6404 6069 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_32910 7416 6427 gene locus_tag LOCUS_32920 7416 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 7558 8733 gene locus_tag LOCUS_32930 7558 8733 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_32930 9137 10333 gene locus_tag LOCUS_32940 9137 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 10550 11644 gene locus_tag LOCUS_32950 10550 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 11663 12688 gene locus_tag LOCUS_32960 11663 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 12822 13886 gene locus_tag LOCUS_32970 12822 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 16968 13870 gene locus_tag LOCUS_32980 16968 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 17082 17375 gene locus_tag LOCUS_32990 17082 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 17372 17797 gene locus_tag LOCUS_33000 17372 17797 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875325.1 protein_id gnl|my_center|LOCUS_33000 17825 18616 gene locus_tag LOCUS_33010 17825 18616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 18613 19659 gene locus_tag LOCUS_33020 18613 19659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 19656 20960 gene locus_tag LOCUS_33030 19656 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 21030 21557 gene locus_tag LOCUS_33040 21030 21557 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_33040 21558 21974 gene locus_tag LOCUS_33050 21558 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 21986 23239 gene locus_tag LOCUS_33060 21986 23239 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_33060 23323 24510 gene locus_tag LOCUS_33070 23323 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 25108 24518 gene locus_tag LOCUS_33080 25108 24518 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_33080 27669 25105 gene locus_tag LOCUS_33090 27669 25105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 30245 27666 gene locus_tag LOCUS_33100 30245 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 30384 31547 gene locus_tag LOCUS_33110 30384 31547 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_33110 31544 32626 gene locus_tag LOCUS_33120 gene mnmA 31544 32626 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_33120 32707 33354 gene locus_tag LOCUS_33130 32707 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 34095 33367 gene locus_tag LOCUS_33140 34095 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 36341 34092 gene locus_tag LOCUS_33150 36341 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 36440 37525 gene locus_tag LOCUS_33160 gene prfA 36440 37525 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_33160 37531 38391 gene locus_tag LOCUS_33170 gene prmC 37531 38391 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_33170 40734 38392 gene locus_tag LOCUS_33180 40734 38392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 40836 42083 gene locus_tag LOCUS_33190 40836 42083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 42197 42694 gene locus_tag LOCUS_33200 42197 42694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 42854 44275 gene locus_tag LOCUS_33210 gene hydA 42854 44275 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence30 1477 401 gene locus_tag LOCUS_33220 1477 401 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_33220 1504 2079 gene locus_tag LOCUS_33230 1504 2079 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085497.1 protein_id gnl|my_center|LOCUS_33230 2076 2891 gene locus_tag LOCUS_33240 2076 2891 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_33240 2939 3478 gene locus_tag LOCUS_33250 2939 3478 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085497.1 protein_id gnl|my_center|LOCUS_33250 3673 4524 gene locus_tag LOCUS_33260 3673 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4821 4510 gene locus_tag LOCUS_33270 4821 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5031 5288 gene locus_tag LOCUS_33280 5031 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 5306 5707 gene locus_tag LOCUS_33290 5306 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 7195 6311 gene locus_tag LOCUS_33300 7195 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 8024 7185 gene locus_tag LOCUS_33310 8024 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 8100 8405 gene locus_tag LOCUS_33320 8100 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 8587 9306 gene locus_tag LOCUS_33330 8587 9306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_33330 9303 10751 gene locus_tag LOCUS_33340 9303 10751 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141303.1 protein_id gnl|my_center|LOCUS_33340 10748 12145 gene locus_tag LOCUS_33350 10748 12145 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_33350 12175 14346 gene locus_tag LOCUS_33360 12175 14346 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_33360 16489 14360 gene locus_tag LOCUS_33370 16489 14360 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_33370 16773 16540 gene locus_tag LOCUS_33380 16773 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 16718 17227 gene locus_tag LOCUS_33390 16718 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 17290 18489 gene locus_tag LOCUS_33400 17290 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 18621 20153 gene locus_tag LOCUS_33410 18621 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 20164 23250 gene locus_tag LOCUS_33420 20164 23250 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_33420 23247 25016 gene locus_tag LOCUS_33430 23247 25016 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_33430 25141 25977 gene locus_tag LOCUS_33440 25141 25977 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_33440 26045 27193 gene locus_tag LOCUS_33450 26045 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 27292 28500 gene locus_tag LOCUS_33460 27292 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 29612 28497 gene locus_tag LOCUS_33470 29612 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 31087 29645 gene locus_tag LOCUS_33480 31087 29645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 32310 31084 gene locus_tag LOCUS_33490 32310 31084 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_33490 33383 32331 gene locus_tag LOCUS_33500 33383 32331 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_33500 33462 34433 gene locus_tag LOCUS_33510 33462 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 34444 35787 gene locus_tag LOCUS_33520 34444 35787 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_33520 36864 35965 gene locus_tag LOCUS_33530 36864 35965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 36938 37750 gene locus_tag LOCUS_33540 36938 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 38574 37804 gene locus_tag LOCUS_33550 38574 37804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 39595 38567 gene locus_tag LOCUS_33560 39595 38567 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_33560 40500 39592 gene locus_tag LOCUS_33570 40500 39592 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_33570 41490 40522 gene locus_tag LOCUS_33580 41490 40522 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_33580 42243 41512 gene locus_tag LOCUS_33590 42243 41512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence31 <1 1159 gene locus_tag LOCUS_33600 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407998.1:TonB-dependent receptor 2993 1185 gene locus_tag LOCUS_33610 2993 1185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_33610 4135 2990 gene locus_tag LOCUS_33620 4135 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 5443 4148 gene locus_tag LOCUS_33630 5443 4148 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 protein_id gnl|my_center|LOCUS_33630 10163 5502 gene locus_tag LOCUS_33640 10163 5502 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 protein_id gnl|my_center|LOCUS_33640 11197 10262 gene locus_tag LOCUS_33650 11197 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 12618 11521 gene locus_tag LOCUS_33660 12618 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 13358 12615 gene locus_tag LOCUS_33670 13358 12615 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_33670 13624 14469 gene locus_tag LOCUS_33680 gene aroE 13624 14469 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_33680 15795 14713 gene locus_tag LOCUS_33690 15795 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 16286 15939 gene locus_tag LOCUS_33700 16286 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 17771 16374 gene locus_tag LOCUS_33710 17771 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 19302 17764 gene locus_tag LOCUS_33720 19302 17764 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 protein_id gnl|my_center|LOCUS_33720 20279 19326 gene locus_tag LOCUS_33730 20279 19326 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 protein_id gnl|my_center|LOCUS_33730 20346 22235 gene locus_tag LOCUS_33740 20346 22235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040762.1 protein_id gnl|my_center|LOCUS_33740 22232 23614 gene locus_tag LOCUS_33750 22232 23614 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 protein_id gnl|my_center|LOCUS_33750 24487 23636 gene locus_tag LOCUS_33760 24487 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 24544 24897 gene locus_tag LOCUS_33770 24544 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 26013 25138 gene locus_tag LOCUS_33780 26013 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(25540..25542),aa:Sec) note codon on position 158 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_33780 26070 26531 gene locus_tag LOCUS_33790 26070 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 26536 28149 gene locus_tag LOCUS_33800 26536 28149 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_33800 28214 28543 gene locus_tag LOCUS_33810 28214 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 29280 28552 gene locus_tag LOCUS_33820 29280 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 29370 30758 gene locus_tag LOCUS_33830 29370 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 30818 32083 gene locus_tag LOCUS_33840 30818 32083 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33840 32088 33710 gene locus_tag LOCUS_33850 32088 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 34412 33720 gene locus_tag LOCUS_33860 34412 33720 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_33860 34496 35242 gene locus_tag LOCUS_33870 34496 35242 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_33870 35255 36742 gene locus_tag LOCUS_33880 gene glpK 35255 36742 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_33880 36792 37619 gene locus_tag LOCUS_33890 36792 37619 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_33890 <39084 37644 gene locus_tag LOCUS_33900 <39084 37644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870306.1:polyphosphate kinase 1 >Feature sequence32 133 708 gene locus_tag LOCUS_33910 133 708 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_33910 1299 709 gene locus_tag LOCUS_33920 gene coaE 1299 709 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_33920 1511 1990 gene locus_tag LOCUS_33930 gene rplM 1511 1990 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_33930 1987 2376 gene locus_tag LOCUS_33940 gene rpsI 1987 2376 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_33940 2405 3418 gene locus_tag LOCUS_33950 2405 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3509 4153 gene locus_tag LOCUS_33960 gene tsf 3509 4153 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_33960 4165 4878 gene locus_tag LOCUS_33970 gene pyrH 4165 4878 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_33970 4920 5474 gene locus_tag LOCUS_33980 gene frr 4920 5474 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_33980 5515 6714 gene locus_tag LOCUS_33990 5515 6714 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_33990 6729 7493 gene locus_tag LOCUS_34000 gene rlmB 6729 7493 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036704.1 protein_id gnl|my_center|LOCUS_34000 7534 7608 gene locus_tag LOCUS_t00420 7534 7608 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7623 7709 gene locus_tag LOCUS_t00430 7623 7709 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7731 7805 gene locus_tag LOCUS_t00440 7731 7805 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8355 7885 gene locus_tag LOCUS_34010 8355 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 8461 9489 gene locus_tag LOCUS_34020 8461 9489 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_34020 11030 9486 gene locus_tag LOCUS_34030 11030 9486 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_34030 11105 12247 gene locus_tag LOCUS_34040 11105 12247 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_34040 12257 13162 gene locus_tag LOCUS_34050 12257 13162 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_34050 13195 15471 gene locus_tag LOCUS_34060 13195 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 15791 15459 gene locus_tag LOCUS_34070 15791 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 16516 16109 gene locus_tag LOCUS_34080 16516 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 16654 17385 gene locus_tag LOCUS_34090 16654 17385 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_34090 17434 18645 gene locus_tag LOCUS_34100 17434 18645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_34100 18670 19917 gene locus_tag LOCUS_34110 18670 19917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_34110 19919 20611 gene locus_tag LOCUS_34120 19919 20611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_34120 20616 21869 gene locus_tag LOCUS_34130 20616 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 21959 22852 gene locus_tag LOCUS_34140 21959 22852 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_34140 22907 23860 gene locus_tag LOCUS_34150 22907 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 23870 24739 gene locus_tag LOCUS_34160 gene pstA 23870 24739 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_34160 24736 25521 gene locus_tag LOCUS_34170 gene pstB 24736 25521 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 protein_id gnl|my_center|LOCUS_34170 25518 26321 gene locus_tag LOCUS_34180 gene pstB 25518 26321 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722628.1 protein_id gnl|my_center|LOCUS_34180 26883 26344 gene locus_tag LOCUS_34190 26883 26344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 28246 26876 gene locus_tag LOCUS_34200 28246 26876 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226195.1 protein_id gnl|my_center|LOCUS_34200 28422 29726 gene locus_tag LOCUS_34210 28422 29726 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229564.1 protein_id gnl|my_center|LOCUS_34210 29785 30996 gene locus_tag LOCUS_34220 29785 30996 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_34220 31067 32377 gene locus_tag LOCUS_34230 31067 32377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_34230 32422 34356 gene locus_tag LOCUS_34240 32422 34356 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_34240 35518 34376 gene locus_tag LOCUS_34250 35518 34376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 35704 36399 gene locus_tag LOCUS_34260 gene phoB 35704 36399 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_34260 36469 37848 gene locus_tag LOCUS_34270 36469 37848 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_34270 37926 38582 gene locus_tag LOCUS_34280 gene phoU 37926 38582 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_34280 38755 38829 gene locus_tag LOCUS_t00450 38755 38829 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 <1 1223 gene locus_tag LOCUS_34290 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265979.1:CaiB/BaiF CoA-transferase family protein 1278 2258 gene locus_tag LOCUS_34300 1278 2258 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_34300 2255 3685 gene locus_tag LOCUS_34310 2255 3685 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_34310 3703 7479 gene locus_tag LOCUS_34320 3703 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 7557 10088 gene locus_tag LOCUS_34330 7557 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 10091 13786 gene locus_tag LOCUS_34340 10091 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 15213 13801 gene locus_tag LOCUS_34350 gene noeA 15213 13801 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_34350 15428 15213 gene locus_tag LOCUS_34360 15428 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 15762 17504 gene locus_tag LOCUS_34370 15762 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 17583 21329 gene locus_tag LOCUS_34380 17583 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 21406 22242 gene locus_tag LOCUS_34390 21406 22242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_34390 22244 22948 gene locus_tag LOCUS_34400 22244 22948 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_34400 23005 26562 gene locus_tag LOCUS_34410 23005 26562 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_34410 26591 27409 gene locus_tag LOCUS_34420 26591 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 30067 27419 gene locus_tag LOCUS_34430 30067 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 31179 30058 gene locus_tag LOCUS_34440 31179 30058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 33175 31205 gene locus_tag LOCUS_34450 33175 31205 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491174.1 protein_id gnl|my_center|LOCUS_34450 33247 34542 gene locus_tag LOCUS_34460 33247 34542 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_34460 34599 34940 gene locus_tag LOCUS_34470 34599 34940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 34959 35474 gene locus_tag LOCUS_34480 34959 35474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 <37306 35482 gene locus_tag LOCUS_34490 <37306 35482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063907.1:DUF3604 domain-containing protein >Feature sequence34 323 886 gene locus_tag LOCUS_34500 323 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1007 2173 gene locus_tag LOCUS_34510 1007 2173 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_34510 3266 2175 gene locus_tag LOCUS_34520 3266 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 3354 4052 gene locus_tag LOCUS_34530 3354 4052 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_34530 5622 4072 gene locus_tag LOCUS_34540 5622 4072 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 protein_id gnl|my_center|LOCUS_34540 6717 5641 gene locus_tag LOCUS_34550 6717 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 7708 6701 gene locus_tag LOCUS_34560 7708 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 8295 7708 gene locus_tag LOCUS_34570 8295 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 11556 8359 gene locus_tag LOCUS_34580 11556 8359 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_34580 11036 11135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11576 12169 gene locus_tag LOCUS_34590 11576 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 13357 12290 gene locus_tag LOCUS_34600 13357 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 14187 13372 gene locus_tag LOCUS_34610 14187 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 16335 14215 gene locus_tag LOCUS_34620 16335 14215 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_34620 16334 17341 gene locus_tag LOCUS_34630 16334 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 17419 18411 gene locus_tag LOCUS_34640 17419 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 18408 19085 gene locus_tag LOCUS_34650 18408 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 19101 19466 gene locus_tag LOCUS_34660 19101 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 21356 19725 gene locus_tag LOCUS_34670 21356 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 22896 21340 gene locus_tag LOCUS_34680 22896 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 23997 22915 gene locus_tag LOCUS_34690 23997 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 24173 25771 gene locus_tag LOCUS_34700 24173 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 26227 25799 gene locus_tag LOCUS_34710 26227 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 26379 26861 gene locus_tag LOCUS_34720 26379 26861 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_34720 26864 29278 gene locus_tag LOCUS_34730 26864 29278 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_34730 30182 29313 gene locus_tag LOCUS_34740 30182 29313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 30600 30217 gene locus_tag LOCUS_34750 30600 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 30735 32126 gene locus_tag LOCUS_34760 30735 32126 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_34760 32127 33524 gene locus_tag LOCUS_34770 32127 33524 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_34770 33554 35200 gene locus_tag LOCUS_34780 33554 35200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141929.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence35 3012 430 gene locus_tag LOCUS_34790 3012 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 5865 3046 gene locus_tag LOCUS_34800 5865 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 6647 5871 gene locus_tag LOCUS_34810 6647 5871 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_34810 7693 6644 gene locus_tag LOCUS_34820 7693 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 7823 10777 gene locus_tag LOCUS_34830 7823 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 10958 12016 gene locus_tag LOCUS_34840 10958 12016 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_34840 12033 13247 gene locus_tag LOCUS_34850 12033 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 14614 13244 gene locus_tag LOCUS_34860 14614 13244 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_34860 14626 16518 gene locus_tag LOCUS_34870 14626 16518 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_34870 16522 17598 gene locus_tag LOCUS_34880 16522 17598 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_34880 17595 18623 gene locus_tag LOCUS_34890 17595 18623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_34890 18620 20197 gene locus_tag LOCUS_34900 18620 20197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_34900 20197 21561 gene locus_tag LOCUS_34910 20197 21561 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_34910 21628 24204 gene locus_tag LOCUS_34920 21628 24204 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_34920 25549 24188 gene locus_tag LOCUS_34930 25549 24188 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_34930 25678 26163 gene locus_tag LOCUS_34940 25678 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 26309 26554 gene locus_tag LOCUS_34950 26309 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 26972 26544 gene locus_tag LOCUS_34960 26972 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 26998 27798 gene locus_tag LOCUS_34970 26998 27798 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390144.1 protein_id gnl|my_center|LOCUS_34970 27957 30722 gene locus_tag LOCUS_34980 27957 30722 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_34980 30736 32295 gene locus_tag LOCUS_34990 30736 32295 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_34990 32478 33893 gene locus_tag LOCUS_35000 32478 33893 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_35000 >Feature sequence36 1104 1364 gene locus_tag LOCUS_35010 1104 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 1559 1468 gene locus_tag LOCUS_t00460 1559 1468 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2009 1605 gene locus_tag LOCUS_35020 2009 1605 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_35020 3554 2046 gene locus_tag LOCUS_35030 gene atpD 3554 2046 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_35030 4474 3575 gene locus_tag LOCUS_35040 4474 3575 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_35040 6052 4514 gene locus_tag LOCUS_35050 gene atpA 6052 4514 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_35050 6678 6115 gene locus_tag LOCUS_35060 gene atpH 6678 6115 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_35060 7292 6675 gene locus_tag LOCUS_35070 7292 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 7711 7289 gene locus_tag LOCUS_35080 7711 7289 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_35080 7931 9070 gene locus_tag LOCUS_35090 7931 9070 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_35090 9927 9094 gene locus_tag LOCUS_35100 9927 9094 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_35100 10728 9970 gene locus_tag LOCUS_35110 10728 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 10836 11717 gene locus_tag LOCUS_35120 gene ftcD 10836 11717 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_35120 13079 11667 gene locus_tag LOCUS_35130 13079 11667 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_35130 13840 13088 gene locus_tag LOCUS_35140 gene rph 13840 13088 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_35140 14754 13921 gene locus_tag LOCUS_35150 gene murI 14754 13921 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_35150 15372 14758 gene locus_tag LOCUS_35160 15372 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 17135 15369 gene locus_tag LOCUS_35170 17135 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 17280 17205 gene locus_tag LOCUS_t00470 17280 17205 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18163 17324 gene locus_tag LOCUS_35180 18163 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393975.1 protein_id gnl|my_center|LOCUS_35180 19711 18185 gene locus_tag LOCUS_35190 19711 18185 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_35190 19779 20750 gene locus_tag LOCUS_35200 19779 20750 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_35200 20769 22418 gene locus_tag LOCUS_35210 20769 22418 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 protein_id gnl|my_center|LOCUS_35210 22427 23356 gene locus_tag LOCUS_35220 22427 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 23576 23379 gene locus_tag LOCUS_35230 23576 23379 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_35230 25174 23573 gene locus_tag LOCUS_35240 25174 23573 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_35240 26121 25171 gene locus_tag LOCUS_35250 26121 25171 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_35250 27464 26121 gene locus_tag LOCUS_35260 gene hmgA 27464 26121 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970302.1 protein_id gnl|my_center|LOCUS_35260 28211 27522 gene locus_tag LOCUS_35270 28211 27522 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_35270 30085 28208 gene locus_tag LOCUS_35280 30085 28208 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_35280 30785 30138 gene locus_tag LOCUS_35290 30785 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 31352 31005 gene locus_tag LOCUS_35300 31352 31005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 32245 31385 gene locus_tag LOCUS_35310 32245 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence37 2175 730 gene locus_tag LOCUS_35320 2175 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 3038 2265 gene locus_tag LOCUS_35330 3038 2265 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249272.1 protein_id gnl|my_center|LOCUS_35330 3958 3038 gene locus_tag LOCUS_35340 3958 3038 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_35340 4857 4027 gene locus_tag LOCUS_35350 4857 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 5429 4893 gene locus_tag LOCUS_35360 5429 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 6616 5426 gene locus_tag LOCUS_35370 gene rocD 6616 5426 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_35370 8552 6672 gene locus_tag LOCUS_35380 8552 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 8778 10205 gene locus_tag LOCUS_35390 8778 10205 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_35390 11370 11065 gene locus_tag LOCUS_35400 11370 11065 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_35400 11666 11385 gene locus_tag LOCUS_35410 11666 11385 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_35410 13307 11682 gene locus_tag LOCUS_35420 gene pruA 13307 11682 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_35420 13808 13428 gene locus_tag LOCUS_35430 13808 13428 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 protein_id gnl|my_center|LOCUS_35430 13882 15009 gene locus_tag LOCUS_35440 13882 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 16263 14986 gene locus_tag LOCUS_35450 16263 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 16701 17717 gene locus_tag LOCUS_35460 16701 17717 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_35460 17714 18763 gene locus_tag LOCUS_35470 17714 18763 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_35470 18876 20084 gene locus_tag LOCUS_35480 gene pheA 18876 20084 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_35480 20092 21300 gene locus_tag LOCUS_35490 gene lhgO 20092 21300 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_35490 21297 21974 gene locus_tag LOCUS_35500 21297 21974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_35500 22493 22002 gene locus_tag LOCUS_35510 22493 22002 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_35510 23647 22493 gene locus_tag LOCUS_35520 23647 22493 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_35520 23998 26124 gene locus_tag LOCUS_35530 23998 26124 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_35530 26140 26556 gene locus_tag LOCUS_35540 26140 26556 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100764.1 protein_id gnl|my_center|LOCUS_35540 26616 27182 gene locus_tag LOCUS_35550 26616 27182 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_35550 27355 28503 gene locus_tag LOCUS_35560 27355 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence38 1 762 gene locus_tag LOCUS_35570 1 762 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_35570 1905 778 gene locus_tag LOCUS_35580 gene menC 1905 778 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_35580 2759 1902 gene locus_tag LOCUS_35590 2759 1902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351130.1 protein_id gnl|my_center|LOCUS_35590 4246 2816 gene locus_tag LOCUS_35600 4246 2816 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_35600 4344 4907 gene locus_tag LOCUS_35610 4344 4907 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_35610 4910 6625 gene locus_tag LOCUS_35620 4910 6625 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_35620 6725 7819 gene locus_tag LOCUS_35630 6725 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_35630 8438 7830 gene locus_tag LOCUS_35640 8438 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 8536 10662 gene locus_tag LOCUS_35650 8536 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 10659 12659 gene locus_tag LOCUS_35660 10659 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 12697 12891 gene locus_tag LOCUS_35670 12697 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 12910 13776 gene locus_tag LOCUS_35680 12910 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 13773 14474 gene locus_tag LOCUS_35690 13773 14474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_35690 14471 14920 gene locus_tag LOCUS_35700 14471 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 15687 14917 gene locus_tag LOCUS_35710 15687 14917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_35710 16509 15766 gene locus_tag LOCUS_35720 16509 15766 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_35720 16549 16797 gene locus_tag LOCUS_35730 16549 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 16794 18041 gene locus_tag LOCUS_35740 16794 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 18106 19188 gene locus_tag LOCUS_35750 18106 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 19918 19193 gene locus_tag LOCUS_35760 19918 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 20866 19967 gene locus_tag LOCUS_35770 20866 19967 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_35770 20915 21592 gene locus_tag LOCUS_35780 20915 21592 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_35780 23749 21596 gene locus_tag LOCUS_35790 23749 21596 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_35790 23769 24605 gene locus_tag LOCUS_35800 23769 24605 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_35800 24614 26509 gene locus_tag LOCUS_35810 24614 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 26660 27328 gene locus_tag LOCUS_35820 26660 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence39 979 11 gene locus_tag LOCUS_35830 979 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2811 976 gene locus_tag LOCUS_35840 2811 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 2860 3672 gene locus_tag LOCUS_35850 2860 3672 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_35850 3679 4515 gene locus_tag LOCUS_35860 3679 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 4532 5998 gene locus_tag LOCUS_35870 4532 5998 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_35870 7522 6602 gene locus_tag LOCUS_35880 7522 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 8867 7515 gene locus_tag LOCUS_35890 8867 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 9487 9789 gene locus_tag LOCUS_35900 9487 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 9792 11033 gene locus_tag LOCUS_35910 9792 11033 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_35910 11030 12094 gene locus_tag LOCUS_35920 11030 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 13211 12102 gene locus_tag LOCUS_35930 13211 12102 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_35930 14953 13208 gene locus_tag LOCUS_35940 14953 13208 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_35940 17150 14970 gene locus_tag LOCUS_35950 17150 14970 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_35950 18576 17161 gene locus_tag LOCUS_35960 18576 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 18892 20022 gene locus_tag LOCUS_35970 18892 20022 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_35970 20019 21071 gene locus_tag LOCUS_35980 20019 21071 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence40 553 1275 gene locus_tag LOCUS_35990 gene ybgF 553 1275 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 protein_id gnl|my_center|LOCUS_35990 1354 1653 gene locus_tag LOCUS_36000 gene rpsT 1354 1653 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_36000 2224 1673 gene locus_tag LOCUS_36010 2224 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 2674 2246 gene locus_tag LOCUS_36020 2674 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3210 2743 gene locus_tag LOCUS_36030 gene ribE 3210 2743 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_36030 3308 3232 gene locus_tag LOCUS_t00480 3308 3232 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3904 3401 gene locus_tag LOCUS_36040 3904 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 5312 3975 gene locus_tag LOCUS_36050 gene der 5312 3975 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_36050 5782 5333 gene locus_tag LOCUS_36060 5782 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 5922 6008 gene locus_tag LOCUS_t00490 5922 6008 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6589 6017 gene locus_tag LOCUS_36070 gene rsmD 6589 6017 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_36070 8301 6586 gene locus_tag LOCUS_36080 8301 6586 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_36080 10094 8301 gene locus_tag LOCUS_36090 10094 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 11710 10172 gene locus_tag LOCUS_36100 gene ahcY 11710 10172 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_36100 12791 11763 gene locus_tag LOCUS_36110 12791 11763 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_36110 13676 12792 gene locus_tag LOCUS_36120 13676 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 13697 15481 gene locus_tag LOCUS_36130 13697 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 16467 15478 gene locus_tag LOCUS_36140 16467 15478 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970486.1 protein_id gnl|my_center|LOCUS_36140 17499 16576 gene locus_tag LOCUS_36150 17499 16576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061838.1 protein_id gnl|my_center|LOCUS_36150 18260 17526 gene locus_tag LOCUS_36160 18260 17526 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083940.1 protein_id gnl|my_center|LOCUS_36160 <19634 18278 gene locus_tag LOCUS_36170 <19634 18278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119625.1:divalent metal cation transporter >Feature sequence41 116 1042 gene locus_tag LOCUS_36180 116 1042 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116577.1 protein_id gnl|my_center|LOCUS_36180 1090 2064 gene locus_tag LOCUS_36190 1090 2064 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_36190 2124 3695 gene locus_tag LOCUS_36200 2124 3695 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 protein_id gnl|my_center|LOCUS_36200 3703 4203 gene locus_tag LOCUS_36210 3703 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4200 5564 gene locus_tag LOCUS_36220 4200 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 6778 5561 gene locus_tag LOCUS_36230 6778 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_36230 7550 6795 gene locus_tag LOCUS_36240 7550 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 7609 7923 gene locus_tag LOCUS_36250 7609 7923 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256664.1 protein_id gnl|my_center|LOCUS_36250 7942 8664 gene locus_tag LOCUS_36260 7942 8664 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256663.1 protein_id gnl|my_center|LOCUS_36260 8661 9272 gene locus_tag LOCUS_36270 8661 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 9269 10474 gene locus_tag LOCUS_36280 gene manA 9269 10474 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 protein_id gnl|my_center|LOCUS_36280 11017 10574 gene locus_tag LOCUS_36290 11017 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 11613 11020 gene locus_tag LOCUS_36300 11613 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 13016 11610 gene locus_tag LOCUS_36310 13016 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 13084 13608 gene locus_tag LOCUS_36320 13084 13608 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_36320 14666 13605 gene locus_tag LOCUS_36330 14666 13605 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965522.1 protein_id gnl|my_center|LOCUS_36330 16324 14663 gene locus_tag LOCUS_36340 16324 14663 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence42 2169 115 gene locus_tag LOCUS_36350 gene fusA 2169 115 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_36350 2880 2407 gene locus_tag LOCUS_36360 gene rpsG 2880 2407 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 protein_id gnl|my_center|LOCUS_36360 3272 2898 gene locus_tag LOCUS_36370 gene rpsL 3272 2898 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142358.1 protein_id gnl|my_center|LOCUS_36370 7773 3544 gene locus_tag LOCUS_36380 gene rpoC 7773 3544 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_36380 12055 7784 gene locus_tag LOCUS_36390 gene rpoB 12055 7784 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_36390 12588 12208 gene locus_tag LOCUS_36400 gene rplL 12588 12208 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_36400 13203 12661 gene locus_tag LOCUS_36410 gene rplJ 13203 12661 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_36410 13941 13237 gene locus_tag LOCUS_36420 gene rplA 13941 13237 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_36420 14426 13986 gene locus_tag LOCUS_36430 gene rplK 14426 13986 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 protein_id gnl|my_center|LOCUS_36430 15130 14498 gene locus_tag LOCUS_36440 gene nusG 15130 14498 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_36440 15368 15162 gene locus_tag LOCUS_36450 15368 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 15542 15467 gene locus_tag LOCUS_t00500 15542 15467 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence43 2 90 gene locus_tag LOCUS_t00510 2 90 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5318 4167 gene locus_tag LOCUS_36460 5318 4167 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731366.1 protein_id gnl|my_center|LOCUS_36460 5539 6066 gene locus_tag LOCUS_36470 5539 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 6151 7293 gene locus_tag LOCUS_36480 6151 7293 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_36480 7397 8824 gene locus_tag LOCUS_36490 7397 8824 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_36490 9033 9608 gene locus_tag LOCUS_36500 9033 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 9621 9764 gene locus_tag LOCUS_36510 9621 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 11060 9999 gene locus_tag LOCUS_36520 gene recA 11060 9999 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_36520 11281 12282 gene locus_tag LOCUS_36530 gene murB 11281 12282 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_36530 12345 15284 gene locus_tag LOCUS_36540 12345 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence44 <1 821 gene locus_tag LOCUS_36550 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958200.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase 827 2575 gene locus_tag LOCUS_36560 827 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 2666 4081 gene locus_tag LOCUS_36570 gene lpdA 2666 4081 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_36570 4094 6211 gene locus_tag LOCUS_36580 4094 6211 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_36580 6243 7406 gene locus_tag LOCUS_36590 6243 7406 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839763.1 protein_id gnl|my_center|LOCUS_36590 7403 8866 gene locus_tag LOCUS_36600 7403 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 8863 9876 gene locus_tag LOCUS_36610 8863 9876 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_36610 9902 10807 gene locus_tag LOCUS_36620 9902 10807 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582648.1 protein_id gnl|my_center|LOCUS_36620 10807 12516 gene locus_tag LOCUS_36630 10807 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 12516 15140 gene locus_tag LOCUS_36640 12516 15140 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence45 3462 1000 gene locus_tag LOCUS_36650 3462 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4241 3573 gene locus_tag LOCUS_36660 4241 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 6150 4246 gene locus_tag LOCUS_36670 gene msbA 6150 4246 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_36670 6210 8243 gene locus_tag LOCUS_36680 gene ligA 6210 8243 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_36680 8625 8269 gene locus_tag LOCUS_36690 8625 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 8727 10112 gene locus_tag LOCUS_36700 8727 10112 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_36700 10117 10833 gene locus_tag LOCUS_36710 10117 10833 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_36710 12230 10830 gene locus_tag LOCUS_36720 gene glmM 12230 10830 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_36720 12952 12227 gene locus_tag LOCUS_36730 12952 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 13763 13038 gene locus_tag LOCUS_36740 gene cdaA 13763 13038 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_36740 <15094 13826 gene locus_tag LOCUS_36750 <15094 13826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545429.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence46 79 1755 gene locus_tag LOCUS_36760 gene ilvD 79 1755 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_36760 2622 2002 gene locus_tag LOCUS_36770 2622 2002 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_36770 5065 2861 gene locus_tag LOCUS_36780 5065 2861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775952.1 protein_id gnl|my_center|LOCUS_36780 <5664 5069 gene locus_tag LOCUS_36790 <5664 5069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390103.1:class I SAM-dependent methyltransferase >Feature sequence47 <5281 1204 gene locus_tag LOCUS_36800 <5281 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein note possible pseudo, internal stop codon 1297 1306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence48 859 68 gene locus_tag LOCUS_36810 859 68 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_36810 951 2003 gene locus_tag LOCUS_36820 951 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4101 2008 gene locus_tag LOCUS_36830 4101 2008 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_36830 >Feature sequence49 2339 1170 gene locus_tag LOCUS_36840 2339 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4116 2431 gene locus_tag LOCUS_36850 4116 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence50 >Feature sequence51 618 7 gene locus_tag LOCUS_36860 618 7 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_36860 1418 615 gene locus_tag LOCUS_36870 1418 615 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_36870 3453 1450 gene locus_tag LOCUS_36880 3453 1450 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence52 994 116 gene locus_tag LOCUS_36890 994 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 1682 981 gene locus_tag LOCUS_36900 1682 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3175 1679 gene locus_tag LOCUS_36910 3175 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence53 1559 1568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2272 2281 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence54 470 51 gene locus_tag LOCUS_36920 470 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 548 1525 gene locus_tag LOCUS_36930 548 1525 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_36930 1525 2205 gene locus_tag LOCUS_36940 1525 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 2202 2951 gene locus_tag LOCUS_36950 2202 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence55 >Feature sequence56 <1 2736 gene locus_tag LOCUS_36960 <1 2736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001138082.1:Tn3 family transposase >Feature sequence57 <1 561 gene locus_tag LOCUS_36970 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012028485.1:DAK2 domain-containing protein 622 1470 gene locus_tag LOCUS_36980 622 1470 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_36980