>Feature sequence01 <1 1263 gene locus_tag LOCUS_00010 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024118841.1:ATP-binding protein 1260 5642 gene locus_tag LOCUS_00020 1260 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7371 5572 gene locus_tag LOCUS_00030 7371 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7406 8941 gene locus_tag LOCUS_00040 7406 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9834 9040 gene locus_tag LOCUS_00050 9834 9040 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_00050 10855 9872 gene locus_tag LOCUS_00060 10855 9872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_00060 10981 12699 gene locus_tag LOCUS_00070 10981 12699 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_00070 13871 12669 gene locus_tag LOCUS_00080 13871 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14036 14278 gene locus_tag LOCUS_00090 14036 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14413 15072 gene locus_tag LOCUS_00100 14413 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15110 16162 gene locus_tag LOCUS_00110 15110 16162 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901847.1 protein_id gnl|my_center|LOCUS_00110 16155 16889 gene locus_tag LOCUS_00120 16155 16889 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_00120 17342 16917 gene locus_tag LOCUS_00130 17342 16917 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_00130 18127 17354 gene locus_tag LOCUS_00140 18127 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19329 18124 gene locus_tag LOCUS_00150 19329 18124 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_00150 20569 19397 gene locus_tag LOCUS_00160 20569 19397 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_00160 21185 20595 gene locus_tag LOCUS_00170 21185 20595 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_00170 24000 21322 gene locus_tag LOCUS_00180 24000 21322 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_00180 25439 24090 gene locus_tag LOCUS_00190 25439 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25494 27068 gene locus_tag LOCUS_00200 25494 27068 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_00200 27278 28354 gene locus_tag LOCUS_00210 27278 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 28395 29591 gene locus_tag LOCUS_00220 28395 29591 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_00220 29737 30912 gene locus_tag LOCUS_00230 29737 30912 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421517.1 protein_id gnl|my_center|LOCUS_00230 30937 31482 gene locus_tag LOCUS_00240 gene cobU 30937 31482 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_00240 31472 32524 gene locus_tag LOCUS_00250 gene cobT 31472 32524 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015440718.1 protein_id gnl|my_center|LOCUS_00250 32579 33325 gene locus_tag LOCUS_00260 gene cobS 32579 33325 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 protein_id gnl|my_center|LOCUS_00260 33628 34953 gene locus_tag LOCUS_00270 33628 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 35075 37816 gene locus_tag LOCUS_00280 35075 37816 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_00280 37813 38703 gene locus_tag LOCUS_00290 37813 38703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_00290 38709 40583 gene locus_tag LOCUS_00300 38709 40583 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950497.1 protein_id gnl|my_center|LOCUS_00300 40588 42015 gene locus_tag LOCUS_00310 40588 42015 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082635.1 protein_id gnl|my_center|LOCUS_00310 42984 42049 gene locus_tag LOCUS_00320 42984 42049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43171 46551 gene locus_tag LOCUS_00330 43171 46551 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_00330 46574 46906 gene locus_tag LOCUS_00340 46574 46906 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_00340 46910 49936 gene locus_tag LOCUS_00350 46910 49936 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_00350 50618 49965 gene locus_tag LOCUS_00360 50618 49965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 51164 50721 gene locus_tag LOCUS_00370 51164 50721 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_00370 51405 51124 gene locus_tag LOCUS_00380 51405 51124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 51528 52970 gene locus_tag LOCUS_00390 51528 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 53991 52990 gene locus_tag LOCUS_00400 53991 52990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 54253 53951 gene locus_tag LOCUS_00410 54253 53951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 55536 54322 gene locus_tag LOCUS_00420 55536 54322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 55671 56558 gene locus_tag LOCUS_00430 55671 56558 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_00430 57953 56646 gene locus_tag LOCUS_00440 57953 56646 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_00440 58100 59317 gene locus_tag LOCUS_00450 58100 59317 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_00450 60254 59346 gene locus_tag LOCUS_00460 60254 59346 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_00460 63177 60517 gene locus_tag LOCUS_00470 63177 60517 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_00470 64514 63216 gene locus_tag LOCUS_00480 64514 63216 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_00480 68015 64593 gene locus_tag LOCUS_00490 68015 64593 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_00490 68098 69282 gene locus_tag LOCUS_00500 68098 69282 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_00500 69405 70139 gene locus_tag LOCUS_00510 69405 70139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 70191 70691 gene locus_tag LOCUS_00520 70191 70691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 71585 70716 gene locus_tag LOCUS_00530 71585 70716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_00530 72254 71610 gene locus_tag LOCUS_00540 72254 71610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 72220 72771 gene locus_tag LOCUS_00550 72220 72771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00550 72835 73170 gene locus_tag LOCUS_00560 72835 73170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00560 73228 74205 gene locus_tag LOCUS_00570 73228 74205 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_00570 74271 74468 gene locus_tag LOCUS_00580 gene cspB 74271 74468 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161732.1 protein_id gnl|my_center|LOCUS_00580 74804 74475 gene locus_tag LOCUS_00590 74804 74475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 75760 74804 gene locus_tag LOCUS_00600 75760 74804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_00600 76805 75753 gene locus_tag LOCUS_00610 76805 75753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_00610 78466 76913 gene locus_tag LOCUS_00620 78466 76913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_00620 79658 78495 gene locus_tag LOCUS_00630 79658 78495 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_00630 79854 82889 gene locus_tag LOCUS_00640 79854 82889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 84314 83031 gene locus_tag LOCUS_00650 84314 83031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 86283 84340 gene locus_tag LOCUS_00660 86283 84340 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728405.1 protein_id gnl|my_center|LOCUS_00660 86399 88219 gene locus_tag LOCUS_00670 86399 88219 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_00670 88333 89373 gene locus_tag LOCUS_00680 88333 89373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 89476 89808 gene locus_tag LOCUS_00690 89476 89808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 90681 90298 gene locus_tag LOCUS_00700 90681 90298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 91269 90991 gene locus_tag LOCUS_00710 91269 90991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 91475 92716 gene locus_tag LOCUS_00720 91475 92716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_00720 93938 92718 gene locus_tag LOCUS_00730 93938 92718 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_00730 94025 95536 gene locus_tag LOCUS_00740 gene guaB 94025 95536 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_00740 97671 95533 gene locus_tag LOCUS_00750 97671 95533 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_00750 98706 97690 gene locus_tag LOCUS_00760 98706 97690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 98952 100106 gene locus_tag LOCUS_00770 98952 100106 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 protein_id gnl|my_center|LOCUS_00770 100185 101027 gene locus_tag LOCUS_00780 100185 101027 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_00780 102038 101031 gene locus_tag LOCUS_00790 102038 101031 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729551.1 protein_id gnl|my_center|LOCUS_00790 102496 102017 gene locus_tag LOCUS_00800 102496 102017 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_00800 103587 102496 gene locus_tag LOCUS_00810 103587 102496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_00810 103825 103595 gene locus_tag LOCUS_00820 103825 103595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 104134 103847 gene locus_tag LOCUS_00830 104134 103847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 104636 104295 gene locus_tag LOCUS_00840 104636 104295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 105279 104647 gene locus_tag LOCUS_00850 gene nthA 105279 104647 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_00850 106069 105302 gene locus_tag LOCUS_00860 gene nthB 106069 105302 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_00860 106205 106855 gene locus_tag LOCUS_00870 106205 106855 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 protein_id gnl|my_center|LOCUS_00870 106865 107680 gene locus_tag LOCUS_00880 106865 107680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 108208 107687 gene locus_tag LOCUS_00890 108208 107687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 109368 108217 gene locus_tag LOCUS_00900 109368 108217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 110596 109418 gene locus_tag LOCUS_00910 110596 109418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 110629 111831 gene locus_tag LOCUS_00920 gene cysS 110629 111831 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_00920 111868 112638 gene locus_tag LOCUS_00930 111868 112638 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_00930 112685 112984 gene locus_tag LOCUS_00940 112685 112984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 113009 113884 gene locus_tag LOCUS_00950 113009 113884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00950 113979 114782 gene locus_tag LOCUS_00960 113979 114782 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_00960 114855 115733 gene locus_tag LOCUS_00970 114855 115733 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479550.1 protein_id gnl|my_center|LOCUS_00970 115847 116455 gene locus_tag LOCUS_00980 115847 116455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 116455 117411 gene locus_tag LOCUS_00990 116455 117411 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_00990 118655 117420 gene locus_tag LOCUS_01000 118655 117420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_01000 119373 118672 gene locus_tag LOCUS_01010 119373 118672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_01010 121457 119370 gene locus_tag LOCUS_01020 121457 119370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 122251 121454 gene locus_tag LOCUS_01030 122251 121454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 122507 122331 gene locus_tag LOCUS_01040 122507 122331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 122425 123324 gene locus_tag LOCUS_01050 122425 123324 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_01050 123818 124762 gene locus_tag LOCUS_01060 123818 124762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 126228 124852 gene locus_tag LOCUS_01070 126228 124852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 126452 126664 gene locus_tag LOCUS_01080 126452 126664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 126784 127152 gene locus_tag LOCUS_01090 126784 127152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 127266 130073 gene locus_tag LOCUS_01100 127266 130073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 130143 133631 gene locus_tag LOCUS_01110 130143 133631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 133628 136822 gene locus_tag LOCUS_01120 133628 136822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 137270 138094 gene locus_tag LOCUS_01130 137270 138094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 138146 138493 gene locus_tag LOCUS_01140 138146 138493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 138580 139782 gene locus_tag LOCUS_01150 138580 139782 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_01150 139819 141990 gene locus_tag LOCUS_01160 139819 141990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 143822 143028 gene locus_tag LOCUS_01170 143822 143028 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_01170 145023 143866 gene locus_tag LOCUS_01180 145023 143866 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_01180 145980 145102 gene locus_tag LOCUS_01190 145980 145102 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_01190 146576 146022 gene locus_tag LOCUS_01200 146576 146022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 146898 148454 gene locus_tag LOCUS_01210 146898 148454 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_01210 149075 148479 gene locus_tag LOCUS_01220 gene cobO 149075 148479 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_01220 149905 149072 gene locus_tag LOCUS_01230 149905 149072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_01230 150945 149902 gene locus_tag LOCUS_01240 150945 149902 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_01240 152010 150949 gene locus_tag LOCUS_01250 152010 150949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 152605 152204 gene locus_tag LOCUS_01260 152605 152204 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410246.1 protein_id gnl|my_center|LOCUS_01260 152741 154693 gene locus_tag LOCUS_01270 152741 154693 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_01270 157899 156817 gene locus_tag LOCUS_01280 157899 156817 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410103.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence02 501 1277 gene locus_tag LOCUS_01290 501 1277 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_01290 1331 2395 gene locus_tag LOCUS_01300 1331 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01300 2439 3212 gene locus_tag LOCUS_01310 2439 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_01310 3352 3627 gene locus_tag LOCUS_01320 3352 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3682 3870 gene locus_tag LOCUS_01330 3682 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3946 4413 gene locus_tag LOCUS_01340 gene phnB 3946 4413 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_01340 5889 4525 gene locus_tag LOCUS_01350 5889 4525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_01350 6016 6243 gene locus_tag LOCUS_01360 6016 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6240 6659 gene locus_tag LOCUS_01370 gene vapC26 6240 6659 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_01370 6733 12102 gene locus_tag LOCUS_01380 6733 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 12184 13986 gene locus_tag LOCUS_01390 12184 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 14564 14010 gene locus_tag LOCUS_01400 14564 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15448 15041 gene locus_tag LOCUS_01410 15448 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15738 15445 gene locus_tag LOCUS_01420 15738 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 15864 16802 gene locus_tag LOCUS_01430 15864 16802 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_01430 16799 17446 gene locus_tag LOCUS_01440 16799 17446 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399592.1 protein_id gnl|my_center|LOCUS_01440 18865 17462 gene locus_tag LOCUS_01450 18865 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 22133 18963 gene locus_tag LOCUS_01460 22133 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 26073 22138 gene locus_tag LOCUS_01470 26073 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 26286 26537 gene locus_tag LOCUS_01480 26286 26537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 27193 26657 gene locus_tag LOCUS_01490 27193 26657 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888450.1 protein_id gnl|my_center|LOCUS_01490 27380 28318 gene locus_tag LOCUS_01500 27380 28318 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243941.1 protein_id gnl|my_center|LOCUS_01500 29180 28455 gene locus_tag LOCUS_01510 29180 28455 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 protein_id gnl|my_center|LOCUS_01510 29295 30593 gene locus_tag LOCUS_01520 29295 30593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234253.1 protein_id gnl|my_center|LOCUS_01520 31504 30689 gene locus_tag LOCUS_01530 gene surE 31504 30689 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_01530 31590 32417 gene locus_tag LOCUS_01540 31590 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34432 32450 gene locus_tag LOCUS_01550 34432 32450 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_01550 35418 34501 gene locus_tag LOCUS_01560 35418 34501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 35727 37436 gene locus_tag LOCUS_01570 35727 37436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 37644 39347 gene locus_tag LOCUS_01580 37644 39347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 41055 39454 gene locus_tag LOCUS_01590 41055 39454 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_01590 42299 41103 gene locus_tag LOCUS_01600 42299 41103 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_01600 42455 43486 gene locus_tag LOCUS_01610 42455 43486 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877116.1 protein_id gnl|my_center|LOCUS_01610 43474 44472 gene locus_tag LOCUS_01620 43474 44472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 44494 51198 gene locus_tag LOCUS_01630 44494 51198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 51353 57466 gene locus_tag LOCUS_01640 51353 57466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 57238 57337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57388 57933 gene locus_tag LOCUS_01650 57388 57933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 58059 61271 gene locus_tag LOCUS_01660 58059 61271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 61360 62934 gene locus_tag LOCUS_01670 61360 62934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 65870 63027 gene locus_tag LOCUS_01680 65870 63027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01680 66369 65956 gene locus_tag LOCUS_01690 66369 65956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 66913 66464 gene locus_tag LOCUS_01700 66913 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 67182 67625 gene locus_tag LOCUS_01710 67182 67625 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_01710 68060 67701 gene locus_tag LOCUS_01720 68060 67701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 70477 68123 gene locus_tag LOCUS_01730 70477 68123 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_01730 72389 70686 gene locus_tag LOCUS_01740 72389 70686 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_01740 72465 72875 gene locus_tag LOCUS_01750 72465 72875 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_01750 73711 72926 gene locus_tag LOCUS_01760 73711 72926 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_01760 74106 73759 gene locus_tag LOCUS_01770 74106 73759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 74314 74099 gene locus_tag LOCUS_01780 74314 74099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 74466 76016 gene locus_tag LOCUS_01790 74466 76016 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_01790 76087 77337 gene locus_tag LOCUS_01800 76087 77337 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_01800 77405 78187 gene locus_tag LOCUS_01810 77405 78187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_01810 79073 78222 gene locus_tag LOCUS_01820 79073 78222 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223917.1 protein_id gnl|my_center|LOCUS_01820 80012 79134 gene locus_tag LOCUS_01830 80012 79134 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_01830 81126 80149 gene locus_tag LOCUS_01840 81126 80149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 81804 81421 gene locus_tag LOCUS_01850 81804 81421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 82188 81940 gene locus_tag LOCUS_01860 82188 81940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 82671 82222 gene locus_tag LOCUS_01870 82671 82222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 83085 82807 gene locus_tag LOCUS_01880 83085 82807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 83473 84702 gene locus_tag LOCUS_01890 83473 84702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 85380 86312 gene locus_tag LOCUS_01900 85380 86312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 86302 89313 gene locus_tag LOCUS_01910 86302 89313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 89313 90245 gene locus_tag LOCUS_01920 89313 90245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 90238 91878 gene locus_tag LOCUS_01930 gene cas1 90238 91878 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_01930 91883 92179 gene locus_tag LOCUS_01940 91883 92179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 92386 92485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92486 93535 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttggccgatcaattgatcggcccttcattgaagc 93958 93611 gene locus_tag LOCUS_01950 93958 93611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 94377 93955 gene locus_tag LOCUS_01960 94377 93955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 95062 94490 gene locus_tag LOCUS_01970 95062 94490 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 protein_id gnl|my_center|LOCUS_01970 95445 95095 gene locus_tag LOCUS_01980 95445 95095 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894879.1 protein_id gnl|my_center|LOCUS_01980 96851 95646 gene locus_tag LOCUS_01990 96851 95646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_01990 97071 98315 gene locus_tag LOCUS_02000 97071 98315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_02000 98355 99758 gene locus_tag LOCUS_02010 98355 99758 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_02010 99755 100774 gene locus_tag LOCUS_02020 99755 100774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 100771 101667 gene locus_tag LOCUS_02030 100771 101667 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_02030 101692 102903 gene locus_tag LOCUS_02040 101692 102903 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_02040 102997 103671 gene locus_tag LOCUS_02050 102997 103671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 103668 105089 gene locus_tag LOCUS_02060 103668 105089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 105182 106240 gene locus_tag LOCUS_02070 105182 106240 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_02070 106355 107725 gene locus_tag LOCUS_02080 106355 107725 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 protein_id gnl|my_center|LOCUS_02080 111273 107698 gene locus_tag LOCUS_02090 111273 107698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 114851 111273 gene locus_tag LOCUS_02100 114851 111273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 115365 114988 gene locus_tag LOCUS_02110 115365 114988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 116487 115558 gene locus_tag LOCUS_02120 116487 115558 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_02120 117838 116603 gene locus_tag LOCUS_02130 117838 116603 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 protein_id gnl|my_center|LOCUS_02130 119500 117929 gene locus_tag LOCUS_02140 119500 117929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 120332 119508 gene locus_tag LOCUS_02150 120332 119508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 120474 121352 gene locus_tag LOCUS_02160 120474 121352 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_02160 122194 121349 gene locus_tag LOCUS_02170 122194 121349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 123466 122234 gene locus_tag LOCUS_02180 123466 122234 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_02180 123615 124355 gene locus_tag LOCUS_02190 123615 124355 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_02190 124985 124398 gene locus_tag LOCUS_02200 124985 124398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 126036 125038 gene locus_tag LOCUS_02210 126036 125038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 126995 126033 gene locus_tag LOCUS_02220 126995 126033 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859004.1 protein_id gnl|my_center|LOCUS_02220 127125 128390 gene locus_tag LOCUS_02230 127125 128390 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_02230 128387 129166 gene locus_tag LOCUS_02240 gene mtnP 128387 129166 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392226.1 protein_id gnl|my_center|LOCUS_02240 129228 134141 gene locus_tag LOCUS_02250 129228 134141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 134307 135209 gene locus_tag LOCUS_02260 gene paaA 134307 135209 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_02260 135206 135808 gene locus_tag LOCUS_02270 gene paaJ 135206 135808 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_02270 135805 136077 gene locus_tag LOCUS_02280 135805 136077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 136074 136847 gene locus_tag LOCUS_02290 gene paaC 136074 136847 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_02290 138101 136947 gene locus_tag LOCUS_02300 138101 136947 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_02300 138849 138115 gene locus_tag LOCUS_02310 138849 138115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 139185 139400 gene locus_tag LOCUS_02320 139185 139400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 139410 140354 gene locus_tag LOCUS_02330 139410 140354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 140351 140602 gene locus_tag LOCUS_02340 140351 140602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 140845 141078 gene locus_tag LOCUS_02350 140845 141078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 141447 143903 gene locus_tag LOCUS_02360 141447 143903 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_02360 145219 143933 gene locus_tag LOCUS_02370 145219 143933 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_02370 145301 147136 gene locus_tag LOCUS_02380 145301 147136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975336.1 protein_id gnl|my_center|LOCUS_02380 147129 148232 gene locus_tag LOCUS_02390 gene rsgA 147129 148232 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_02390 149042 148293 gene locus_tag LOCUS_02400 149042 148293 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_02400 149998 149123 gene locus_tag LOCUS_02410 149998 149123 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_02410 150300 150599 gene locus_tag LOCUS_02420 150300 150599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 150986 150501 gene locus_tag LOCUS_02430 150986 150501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence03 1164 493 gene locus_tag LOCUS_02440 1164 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 1624 1553 gene locus_tag LOCUS_t00010 1624 1553 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1761 2339 gene locus_tag LOCUS_02450 gene dcd 1761 2339 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_02450 4554 2377 gene locus_tag LOCUS_02460 4554 2377 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_02460 5082 4651 gene locus_tag LOCUS_02470 5082 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5267 5620 gene locus_tag LOCUS_02480 gene glnB 5267 5620 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_02480 6459 5737 gene locus_tag LOCUS_02490 gene gpmA 6459 5737 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_02490 6844 8607 gene locus_tag LOCUS_02500 gene dnaK 6844 8607 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_02500 8604 9242 gene locus_tag LOCUS_02510 8604 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9252 10235 gene locus_tag LOCUS_02520 9252 10235 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_02520 10266 10667 gene locus_tag LOCUS_02530 10266 10667 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_02530 10738 13374 gene locus_tag LOCUS_02540 gene clpB 10738 13374 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727152.1 protein_id gnl|my_center|LOCUS_02540 13488 14768 gene locus_tag LOCUS_02550 13488 14768 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143270.1 protein_id gnl|my_center|LOCUS_02550 14782 16053 gene locus_tag LOCUS_02560 gene purD 14782 16053 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_02560 16160 16606 gene locus_tag LOCUS_02570 gene purE 16160 16606 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421516.1 protein_id gnl|my_center|LOCUS_02570 16596 18044 gene locus_tag LOCUS_02580 gene purB 16596 18044 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_02580 18102 19007 gene locus_tag LOCUS_02590 18102 19007 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_02590 19004 19276 gene locus_tag LOCUS_02600 gene purS 19004 19276 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_02600 19296 19994 gene locus_tag LOCUS_02610 gene purQ 19296 19994 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101895.1 protein_id gnl|my_center|LOCUS_02610 20441 20055 gene locus_tag LOCUS_02620 20441 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 20516 22837 gene locus_tag LOCUS_02630 gene purL 20516 22837 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_02630 22834 24471 gene locus_tag LOCUS_02640 gene purF 22834 24471 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_02640 24468 25565 gene locus_tag LOCUS_02650 gene purM 24468 25565 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_02650 25643 27055 gene locus_tag LOCUS_02660 25643 27055 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_02660 27290 27217 gene locus_tag LOCUS_t00020 27290 27217 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 27366 27291 gene locus_tag LOCUS_t00030 27366 27291 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28715 27447 gene locus_tag LOCUS_02670 28715 27447 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_02670 28916 28752 gene locus_tag LOCUS_02680 gene rpmG 28916 28752 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_02680 29152 28916 gene locus_tag LOCUS_02690 gene rpmB 29152 28916 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_02690 30308 29223 gene locus_tag LOCUS_02700 30308 29223 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_02700 30385 30924 gene locus_tag LOCUS_02710 30385 30924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 30988 31707 gene locus_tag LOCUS_02720 30988 31707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_02720 31704 33125 gene locus_tag LOCUS_02730 31704 33125 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 protein_id gnl|my_center|LOCUS_02730 33884 34168 gene locus_tag LOCUS_02740 33884 34168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 35263 34757 gene locus_tag LOCUS_02750 35263 34757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 35669 35593 gene locus_tag LOCUS_t00040 35669 35593 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 36170 35682 gene locus_tag LOCUS_02760 36170 35682 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_02760 36565 36227 gene locus_tag LOCUS_02770 gene clpS 36565 36227 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896307.1 protein_id gnl|my_center|LOCUS_02770 37547 36570 gene locus_tag LOCUS_02780 37547 36570 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_02780 37629 38528 gene locus_tag LOCUS_02790 37629 38528 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_02790 38710 40485 gene locus_tag LOCUS_02800 38710 40485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 40485 41105 gene locus_tag LOCUS_02810 40485 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 41113 41901 gene locus_tag LOCUS_02820 41113 41901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 41901 43091 gene locus_tag LOCUS_02830 gene coxB 41901 43091 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 protein_id gnl|my_center|LOCUS_02830 43105 45207 gene locus_tag LOCUS_02840 gene ctaD 43105 45207 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_02840 45200 45883 gene locus_tag LOCUS_02850 gene cyoC 45200 45883 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483335.1 protein_id gnl|my_center|LOCUS_02850 45895 46278 gene locus_tag LOCUS_02860 45895 46278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 46680 46309 gene locus_tag LOCUS_02870 gene dndE 46680 46309 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_02870 48670 46697 gene locus_tag LOCUS_02880 gene dndD 48670 46697 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_02880 50223 48670 gene locus_tag LOCUS_02890 gene dndC 50223 48670 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_02890 50332 51471 gene locus_tag LOCUS_02900 gene dndA 50332 51471 CDS product cysteine desulfurase DndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109917.1 protein_id gnl|my_center|LOCUS_02900 51474 52958 gene locus_tag LOCUS_02910 51474 52958 CDS product DNA phosphorothioation-associated putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109925.1 protein_id gnl|my_center|LOCUS_02910 53561 53034 gene locus_tag LOCUS_02920 53561 53034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 55659 53521 gene locus_tag LOCUS_02930 55659 53521 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_02930 55835 55656 gene locus_tag LOCUS_02940 55835 55656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 57991 55832 gene locus_tag LOCUS_02950 57991 55832 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_02950 59550 57988 gene locus_tag LOCUS_02960 59550 57988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 59994 60668 gene locus_tag LOCUS_02970 59994 60668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109928.1 protein_id gnl|my_center|LOCUS_02970 60672 62822 gene locus_tag LOCUS_02980 60672 62822 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109927.1 protein_id gnl|my_center|LOCUS_02980 64471 63200 gene locus_tag LOCUS_02990 64471 63200 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_02990 66029 64587 gene locus_tag LOCUS_03000 66029 64587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 66359 66048 gene locus_tag LOCUS_03010 66359 66048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 68194 66398 gene locus_tag LOCUS_03020 68194 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 68256 69509 gene locus_tag LOCUS_03030 gene serS 68256 69509 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_03030 69855 69526 gene locus_tag LOCUS_03040 69855 69526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 70268 69852 gene locus_tag LOCUS_03050 70268 69852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 70977 70279 gene locus_tag LOCUS_03060 70977 70279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 71901 70984 gene locus_tag LOCUS_03070 71901 70984 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_03070 72667 71927 gene locus_tag LOCUS_03080 72667 71927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 73320 72967 gene locus_tag LOCUS_03090 73320 72967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 73699 73457 gene locus_tag LOCUS_03100 73699 73457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 74873 73812 gene locus_tag LOCUS_03110 74873 73812 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189449.1 protein_id gnl|my_center|LOCUS_03110 75540 74932 gene locus_tag LOCUS_03120 gene orn 75540 74932 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_03120 75704 76399 gene locus_tag LOCUS_03130 75704 76399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 76686 76396 gene locus_tag LOCUS_03140 76686 76396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 77185 76739 gene locus_tag LOCUS_03150 gene dut 77185 76739 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_03150 77305 77231 gene locus_tag LOCUS_t00050 77305 77231 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 77386 77583 gene locus_tag LOCUS_03160 77386 77583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 78297 77611 gene locus_tag LOCUS_03170 78297 77611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 78378 78620 gene locus_tag LOCUS_03180 78378 78620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 78713 79648 gene locus_tag LOCUS_03190 78713 79648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 79721 80992 gene locus_tag LOCUS_03200 gene mshA 79721 80992 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_03200 81012 81488 gene locus_tag LOCUS_03210 81012 81488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 81650 82441 gene locus_tag LOCUS_03220 gene proC 81650 82441 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_03220 82541 83365 gene locus_tag LOCUS_03230 82541 83365 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_03230 83573 84832 gene locus_tag LOCUS_03240 gene hemA 83573 84832 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_03240 84844 85758 gene locus_tag LOCUS_03250 gene hemC 84844 85758 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 protein_id gnl|my_center|LOCUS_03250 85751 86539 gene locus_tag LOCUS_03260 85751 86539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 86511 87854 gene locus_tag LOCUS_03270 gene hemL 86511 87854 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_03270 88175 87930 gene locus_tag LOCUS_03280 88175 87930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 89415 88243 gene locus_tag LOCUS_03290 89415 88243 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03290 90297 89518 gene locus_tag LOCUS_03300 90297 89518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 90605 91039 gene locus_tag LOCUS_03310 90605 91039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 91051 91467 gene locus_tag LOCUS_03320 91051 91467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 91531 92331 gene locus_tag LOCUS_03330 91531 92331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 92359 93126 gene locus_tag LOCUS_03340 92359 93126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 93139 94026 gene locus_tag LOCUS_03350 93139 94026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 94019 95158 gene locus_tag LOCUS_03360 94019 95158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 95155 96051 gene locus_tag LOCUS_03370 95155 96051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 96121 96633 gene locus_tag LOCUS_03380 96121 96633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 96633 97343 gene locus_tag LOCUS_03390 96633 97343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 97343 97873 gene locus_tag LOCUS_03400 97343 97873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 97870 99159 gene locus_tag LOCUS_03410 97870 99159 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_03410 99221 99853 gene locus_tag LOCUS_03420 gene nuoE 99221 99853 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174268.1 protein_id gnl|my_center|LOCUS_03420 99927 101393 gene locus_tag LOCUS_03430 gene nuoF 99927 101393 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_03430 101386 103875 gene locus_tag LOCUS_03440 101386 103875 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916519.1 protein_id gnl|my_center|LOCUS_03440 103872 105149 gene locus_tag LOCUS_03450 gene nuoH 103872 105149 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_03450 105149 105832 gene locus_tag LOCUS_03460 105149 105832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 105832 106473 gene locus_tag LOCUS_03470 105832 106473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 106470 106784 gene locus_tag LOCUS_03480 gene nuoK 106470 106784 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_03480 106789 108714 gene locus_tag LOCUS_03490 gene nuoL 106789 108714 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_03490 108717 110333 gene locus_tag LOCUS_03500 108717 110333 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03500 110333 111976 gene locus_tag LOCUS_03510 110333 111976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 112061 112318 gene locus_tag LOCUS_03520 112061 112318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 112315 112737 gene locus_tag LOCUS_03530 112315 112737 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_03530 112776 112946 gene locus_tag LOCUS_03540 112776 112946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 113083 114477 gene locus_tag LOCUS_03550 113083 114477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 114911 115375 gene locus_tag LOCUS_03560 114911 115375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 115717 116121 gene locus_tag LOCUS_03570 115717 116121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 117795 116242 gene locus_tag LOCUS_03580 117795 116242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 118112 117792 gene locus_tag LOCUS_03590 118112 117792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 118942 119041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 119618 122461 gene locus_tag LOCUS_03600 119618 122461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 122585 123700 gene locus_tag LOCUS_03610 122585 123700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 123969 123697 gene locus_tag LOCUS_03620 123969 123697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 124265 123972 gene locus_tag LOCUS_03630 124265 123972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 124546 124262 gene locus_tag LOCUS_03640 124546 124262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 124655 124864 gene locus_tag LOCUS_03650 124655 124864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 125037 125216 gene locus_tag LOCUS_03660 125037 125216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 125460 125663 gene locus_tag LOCUS_03670 125460 125663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 125681 125971 gene locus_tag LOCUS_03680 125681 125971 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_03680 126483 126902 gene locus_tag LOCUS_03690 126483 126902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 126871 128487 gene locus_tag LOCUS_03700 126871 128487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 129064 129642 gene locus_tag LOCUS_03710 129064 129642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 129685 129963 gene locus_tag LOCUS_03720 129685 129963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 130362 130871 gene locus_tag LOCUS_03730 130362 130871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 132556 131534 gene locus_tag LOCUS_03740 132556 131534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_03740 132908 133399 gene locus_tag LOCUS_03750 132908 133399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 133603 133857 gene locus_tag LOCUS_03760 133603 133857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 134036 137188 gene locus_tag LOCUS_03770 134036 137188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 137404 139170 gene locus_tag LOCUS_03780 137404 139170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 139167 140099 gene locus_tag LOCUS_03790 gene pfkB 139167 140099 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_03790 140102 140779 gene locus_tag LOCUS_03800 140102 140779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 140776 142482 gene locus_tag LOCUS_03810 140776 142482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 142479 143987 gene locus_tag LOCUS_03820 142479 143987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 144195 145286 gene locus_tag LOCUS_03830 144195 145286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 145352 145804 gene locus_tag LOCUS_03840 145352 145804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 145813 146280 gene locus_tag LOCUS_03850 145813 146280 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963482.1 protein_id gnl|my_center|LOCUS_03850 146302 146565 gene locus_tag LOCUS_03860 146302 146565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 146567 146869 gene locus_tag LOCUS_03870 146567 146869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 146999 148132 gene locus_tag LOCUS_03880 146999 148132 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090007.1 protein_id gnl|my_center|LOCUS_03880 148129 150783 gene locus_tag LOCUS_03890 148129 150783 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110116.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence04 127 648 gene locus_tag LOCUS_03900 127 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 675 3959 gene locus_tag LOCUS_03910 675 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4090 4872 gene locus_tag LOCUS_03920 4090 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4936 5193 gene locus_tag LOCUS_03930 4936 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5190 5396 gene locus_tag LOCUS_03940 5190 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 6310 5390 gene locus_tag LOCUS_03950 6310 5390 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_03950 7130 6321 gene locus_tag LOCUS_03960 7130 6321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_03960 10328 7278 gene locus_tag LOCUS_03970 10328 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 10438 11094 gene locus_tag LOCUS_03980 10438 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 11224 11880 gene locus_tag LOCUS_03990 11224 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12688 11921 gene locus_tag LOCUS_04000 12688 11921 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_04000 12775 13266 gene locus_tag LOCUS_04010 12775 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 13273 13920 gene locus_tag LOCUS_04020 13273 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15265 13928 gene locus_tag LOCUS_04030 15265 13928 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064136.1 protein_id gnl|my_center|LOCUS_04030 16711 15275 gene locus_tag LOCUS_04040 16711 15275 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_04040 21501 16789 gene locus_tag LOCUS_04050 gene gltB 21501 16789 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_04050 21719 22792 gene locus_tag LOCUS_04060 gene argC 21719 22792 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_04060 22789 23754 gene locus_tag LOCUS_04070 gene argB 22789 23754 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_04070 23877 25091 gene locus_tag LOCUS_04080 23877 25091 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04080 25091 26050 gene locus_tag LOCUS_04090 gene argF 25091 26050 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_04090 26047 26508 gene locus_tag LOCUS_04100 26047 26508 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_04100 26521 28008 gene locus_tag LOCUS_04110 gene argH 26521 28008 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_04110 28011 28619 gene locus_tag LOCUS_04120 28011 28619 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_04120 28802 29299 gene locus_tag LOCUS_04130 28802 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 29331 29579 gene locus_tag LOCUS_04140 29331 29579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 29630 29854 gene locus_tag LOCUS_04150 29630 29854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 29851 30789 gene locus_tag LOCUS_04160 29851 30789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_04160 30786 31553 gene locus_tag LOCUS_04170 30786 31553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421578.1 protein_id gnl|my_center|LOCUS_04170 31608 32879 gene locus_tag LOCUS_04180 gene tyrS 31608 32879 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_04180 33375 34890 gene locus_tag LOCUS_r00010 33375 34890 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 35157 38231 gene locus_tag LOCUS_r00020 35157 38231 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 38354 38463 gene locus_tag LOCUS_r00030 38354 38463 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 38743 39594 gene locus_tag LOCUS_04190 38743 39594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408379.1 protein_id gnl|my_center|LOCUS_04190 39715 40821 gene locus_tag LOCUS_04200 39715 40821 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_04200 40967 42847 gene locus_tag LOCUS_04210 40967 42847 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_04210 42936 43955 gene locus_tag LOCUS_04220 42936 43955 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_04220 44020 44919 gene locus_tag LOCUS_04230 44020 44919 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_04230 44916 45785 gene locus_tag LOCUS_04240 44916 45785 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_04240 45785 47386 gene locus_tag LOCUS_04250 gene recN 45785 47386 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_04250 47398 48567 gene locus_tag LOCUS_04260 gene steA 47398 48567 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_04260 48581 49642 gene locus_tag LOCUS_04270 48581 49642 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058615.1 protein_id gnl|my_center|LOCUS_04270 49639 50511 gene locus_tag LOCUS_04280 49639 50511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 50508 51623 gene locus_tag LOCUS_04290 50508 51623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 53152 51635 gene locus_tag LOCUS_04300 53152 51635 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_04300 53472 53149 gene locus_tag LOCUS_04310 53472 53149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 53359 54915 gene locus_tag LOCUS_04320 53359 54915 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_04320 54918 55844 gene locus_tag LOCUS_04330 gene xerD 54918 55844 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_04330 57324 55912 gene locus_tag LOCUS_04340 57324 55912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 58463 57471 gene locus_tag LOCUS_04350 gene trpS 58463 57471 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_04350 58558 59403 gene locus_tag LOCUS_04360 58558 59403 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 protein_id gnl|my_center|LOCUS_04360 59474 60322 gene locus_tag LOCUS_04370 59474 60322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 60325 61089 gene locus_tag LOCUS_04380 60325 61089 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_04380 61263 64892 gene locus_tag LOCUS_04390 61263 64892 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730314.1 protein_id gnl|my_center|LOCUS_04390 64965 66107 gene locus_tag LOCUS_04400 64965 66107 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_04400 66104 68194 gene locus_tag LOCUS_04410 66104 68194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 68191 68877 gene locus_tag LOCUS_04420 68191 68877 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_04420 68926 71079 gene locus_tag LOCUS_04430 68926 71079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 71084 73612 gene locus_tag LOCUS_04440 71084 73612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 74108 73731 gene locus_tag LOCUS_04450 74108 73731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 74299 74105 gene locus_tag LOCUS_04460 74299 74105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 75470 74418 gene locus_tag LOCUS_04470 gene ispH 75470 74418 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_04470 75584 77227 gene locus_tag LOCUS_04480 75584 77227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 77224 78615 gene locus_tag LOCUS_04490 gene der 77224 78615 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898984.1 protein_id gnl|my_center|LOCUS_04490 78911 78988 gene locus_tag LOCUS_t00060 78911 78988 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 79003 79611 gene locus_tag LOCUS_04500 79003 79611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 79717 79926 gene locus_tag LOCUS_04510 79717 79926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 81391 80117 gene locus_tag LOCUS_04520 81391 80117 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055608.1 protein_id gnl|my_center|LOCUS_04520 81713 84187 gene locus_tag LOCUS_04530 81713 84187 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_04530 84238 85335 gene locus_tag LOCUS_04540 84238 85335 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_04540 86318 85332 gene locus_tag LOCUS_04550 gene meaB 86318 85332 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_04550 86384 86944 gene locus_tag LOCUS_04560 86384 86944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 89275 86966 gene locus_tag LOCUS_04570 gene scpA 89275 86966 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_04570 90840 89272 gene locus_tag LOCUS_04580 90840 89272 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_04580 90904 93789 gene locus_tag LOCUS_04590 gene leuS 90904 93789 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_04590 93808 95544 gene locus_tag LOCUS_04600 93808 95544 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_04600 95674 95895 gene locus_tag LOCUS_04610 95674 95895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 95888 96115 gene locus_tag LOCUS_04620 95888 96115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 96494 96195 gene locus_tag LOCUS_04630 96494 96195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 97343 96501 gene locus_tag LOCUS_04640 97343 96501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 101861 97569 gene locus_tag LOCUS_04650 101861 97569 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 protein_id gnl|my_center|LOCUS_04650 102237 102055 gene locus_tag LOCUS_04660 102237 102055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 103652 102369 gene locus_tag LOCUS_04670 103652 102369 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109056605.1 protein_id gnl|my_center|LOCUS_04670 104029 103649 gene locus_tag LOCUS_04680 104029 103649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 104261 105025 gene locus_tag LOCUS_04690 104261 105025 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_04690 105484 105080 gene locus_tag LOCUS_04700 105484 105080 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_04700 105558 106181 gene locus_tag LOCUS_04710 105558 106181 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_04710 106219 106620 gene locus_tag LOCUS_04720 gene gcvH 106219 106620 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_04720 106626 107078 gene locus_tag LOCUS_04730 106626 107078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 107075 108070 gene locus_tag LOCUS_04740 107075 108070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 108123 108647 gene locus_tag LOCUS_04750 108123 108647 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_04750 108821 109408 gene locus_tag LOCUS_04760 108821 109408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 109848 109414 gene locus_tag LOCUS_04770 gene msrB 109848 109414 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_04770 110939 109872 gene locus_tag LOCUS_04780 110939 109872 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_04780 111364 110969 gene locus_tag LOCUS_04790 111364 110969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 111473 112333 gene locus_tag LOCUS_04800 gene paaG 111473 112333 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_04800 112375 113553 gene locus_tag LOCUS_04810 112375 113553 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_04810 114669 113587 gene locus_tag LOCUS_04820 114669 113587 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_04820 115587 114706 gene locus_tag LOCUS_04830 115587 114706 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_04830 117163 115577 gene locus_tag LOCUS_04840 117163 115577 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_04840 118268 117222 gene locus_tag LOCUS_04850 118268 117222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088829.1 protein_id gnl|my_center|LOCUS_04850 119041 118361 gene locus_tag LOCUS_04860 119041 118361 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_04860 119399 119034 gene locus_tag LOCUS_04870 119399 119034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 119836 119537 gene locus_tag LOCUS_04880 119836 119537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 119856 120251 gene locus_tag LOCUS_04890 119856 120251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 120347 121651 gene locus_tag LOCUS_04900 120347 121651 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_04900 121714 123171 gene locus_tag LOCUS_04910 gene mtr 121714 123171 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_04910 124182 123205 gene locus_tag LOCUS_04920 124182 123205 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_04920 124751 124191 gene locus_tag LOCUS_04930 124751 124191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 125836 124853 gene locus_tag LOCUS_04940 gene selD 125836 124853 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_04940 126967 126041 gene locus_tag LOCUS_04950 126967 126041 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_04950 127689 126994 gene locus_tag LOCUS_04960 127689 126994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 130644 127735 gene locus_tag LOCUS_04970 gene gcvP 130644 127735 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_04970 131853 130714 gene locus_tag LOCUS_04980 gene gcvT 131853 130714 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 protein_id gnl|my_center|LOCUS_04980 132178 131873 gene locus_tag LOCUS_04990 gene arsC 132178 131873 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946009.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04990 133552 132317 gene locus_tag LOCUS_05000 gene serB 133552 132317 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_05000 133789 135546 gene locus_tag LOCUS_05010 gene ilvD 133789 135546 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 protein_id gnl|my_center|LOCUS_05010 135632 137098 gene locus_tag LOCUS_05020 135632 137098 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995765.1 protein_id gnl|my_center|LOCUS_05020 137095 137643 gene locus_tag LOCUS_05030 137095 137643 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_05030 137704 138483 gene locus_tag LOCUS_05040 137704 138483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 138814 138536 gene locus_tag LOCUS_05050 138814 138536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 139117 140238 gene locus_tag LOCUS_05060 139117 140238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 140653 140390 gene locus_tag LOCUS_05070 140653 140390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 140838 141044 gene locus_tag LOCUS_05080 140838 141044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 141260 142486 gene locus_tag LOCUS_05090 141260 142486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence05 1684 491 gene locus_tag LOCUS_05100 1684 491 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_05100 2217 1786 gene locus_tag LOCUS_05110 2217 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2811 2227 gene locus_tag LOCUS_05120 2811 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2710 2910 gene locus_tag LOCUS_05130 2710 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3601 2936 gene locus_tag LOCUS_05140 3601 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4210 3686 gene locus_tag LOCUS_05150 4210 3686 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084031.1 protein_id gnl|my_center|LOCUS_05150 5350 4214 gene locus_tag LOCUS_05160 5350 4214 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_05160 5412 5864 gene locus_tag LOCUS_05170 5412 5864 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141918.1 protein_id gnl|my_center|LOCUS_05170 6819 5869 gene locus_tag LOCUS_05180 6819 5869 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_05180 7301 6816 gene locus_tag LOCUS_05190 7301 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7947 7351 gene locus_tag LOCUS_05200 7947 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8057 11284 gene locus_tag LOCUS_05210 gene ileS 8057 11284 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407714.1 protein_id gnl|my_center|LOCUS_05210 11985 11281 gene locus_tag LOCUS_05220 11985 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 12261 12007 gene locus_tag LOCUS_05230 12261 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12810 12298 gene locus_tag LOCUS_05240 12810 12298 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053320.1 protein_id gnl|my_center|LOCUS_05240 13569 12886 gene locus_tag LOCUS_05250 13569 12886 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_05250 14008 13562 gene locus_tag LOCUS_05260 14008 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15431 14355 gene locus_tag LOCUS_05270 gene ftsZ 15431 14355 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_05270 16312 15563 gene locus_tag LOCUS_05280 16312 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 17230 16313 gene locus_tag LOCUS_05290 gene murB 17230 16313 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_05290 18704 17280 gene locus_tag LOCUS_05300 gene murC 18704 17280 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972052.1 protein_id gnl|my_center|LOCUS_05300 19882 18701 gene locus_tag LOCUS_05310 gene murG 19882 18701 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_05310 21016 19886 gene locus_tag LOCUS_05320 gene ftsW 21016 19886 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_05320 22476 21013 gene locus_tag LOCUS_05330 gene murD 22476 21013 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_05330 23613 22561 gene locus_tag LOCUS_05340 gene mraY 23613 22561 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_05340 25103 23610 gene locus_tag LOCUS_05350 25103 23610 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_05350 26727 25096 gene locus_tag LOCUS_05360 26727 25096 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_05360 27448 26996 gene locus_tag LOCUS_05370 27448 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 28432 27482 gene locus_tag LOCUS_05380 gene rsmH 28432 27482 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_05380 28929 28435 gene locus_tag LOCUS_05390 gene mraZ 28929 28435 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908012.1 protein_id gnl|my_center|LOCUS_05390 29524 29063 gene locus_tag LOCUS_05400 29524 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 30401 29766 gene locus_tag LOCUS_05410 30401 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 30992 31969 gene locus_tag LOCUS_05420 30992 31969 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_05420 31983 33176 gene locus_tag LOCUS_05430 31983 33176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 33173 35437 gene locus_tag LOCUS_05440 33173 35437 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_05440 35811 35434 gene locus_tag LOCUS_05450 35811 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 37282 35903 gene locus_tag LOCUS_05460 gene dinB 37282 35903 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_05460 37785 37279 gene locus_tag LOCUS_05470 37785 37279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 37923 38243 gene locus_tag LOCUS_05480 37923 38243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 38240 38920 gene locus_tag LOCUS_05490 38240 38920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_05490 38991 40337 gene locus_tag LOCUS_05500 38991 40337 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_05500 40406 41002 gene locus_tag LOCUS_05510 40406 41002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 42553 41003 gene locus_tag LOCUS_05520 42553 41003 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_05520 44226 42550 gene locus_tag LOCUS_05530 44226 42550 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_05530 45566 44223 gene locus_tag LOCUS_05540 gene trkA 45566 44223 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_05540 45626 47140 gene locus_tag LOCUS_05550 gene glpK 45626 47140 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_05550 48328 47144 gene locus_tag LOCUS_05560 gene alaC 48328 47144 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_05560 48806 48354 gene locus_tag LOCUS_05570 48806 48354 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_05570 50058 48946 gene locus_tag LOCUS_05580 gene pimB 50058 48946 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877983.1 protein_id gnl|my_center|LOCUS_05580 51224 50058 gene locus_tag LOCUS_05590 gene queG 51224 50058 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_05590 51329 52219 gene locus_tag LOCUS_05600 51329 52219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 52456 52223 gene locus_tag LOCUS_05610 52456 52223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 53549 52458 gene locus_tag LOCUS_05620 gene trpD 53549 52458 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533254.1 protein_id gnl|my_center|LOCUS_05620 53947 53549 gene locus_tag LOCUS_05630 53947 53549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 54016 54456 gene locus_tag LOCUS_05640 54016 54456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 55493 54897 gene locus_tag LOCUS_05650 55493 54897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 56069 55545 gene locus_tag LOCUS_05660 56069 55545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 56837 56112 gene locus_tag LOCUS_05670 56837 56112 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_05670 59202 56923 gene locus_tag LOCUS_05680 59202 56923 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_05680 59409 59981 gene locus_tag LOCUS_05690 59409 59981 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_05690 59962 61203 gene locus_tag LOCUS_05700 59962 61203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 62756 61260 gene locus_tag LOCUS_05710 62756 61260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 65032 62846 gene locus_tag LOCUS_05720 65032 62846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 65562 65053 gene locus_tag LOCUS_05730 65562 65053 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223824.1 protein_id gnl|my_center|LOCUS_05730 66848 65559 gene locus_tag LOCUS_05740 66848 65559 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_05740 67169 66915 gene locus_tag LOCUS_05750 67169 66915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 67287 67976 gene locus_tag LOCUS_05760 67287 67976 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_05760 68640 67966 gene locus_tag LOCUS_05770 68640 67966 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_05770 71078 68694 gene locus_tag LOCUS_05780 71078 68694 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728553.1 protein_id gnl|my_center|LOCUS_05780 72157 71075 gene locus_tag LOCUS_05790 72157 71075 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_05790 74635 72203 gene locus_tag LOCUS_05800 74635 72203 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_05800 74777 75943 gene locus_tag LOCUS_05810 74777 75943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_05810 76019 77641 gene locus_tag LOCUS_05820 76019 77641 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079806.1 protein_id gnl|my_center|LOCUS_05820 77660 79567 gene locus_tag LOCUS_05830 77660 79567 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_05830 80929 79607 gene locus_tag LOCUS_05840 80929 79607 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_05840 81010 81915 gene locus_tag LOCUS_05850 81010 81915 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_05850 83160 81934 gene locus_tag LOCUS_05860 83160 81934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 84545 83157 gene locus_tag LOCUS_05870 84545 83157 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975704.1 protein_id gnl|my_center|LOCUS_05870 84686 85081 gene locus_tag LOCUS_05880 84686 85081 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_05880 85089 85868 gene locus_tag LOCUS_05890 85089 85868 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_05890 85955 87703 gene locus_tag LOCUS_05900 85955 87703 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_05900 89009 87726 gene locus_tag LOCUS_05910 89009 87726 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_05910 89448 89044 gene locus_tag LOCUS_05920 89448 89044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 89637 90854 gene locus_tag LOCUS_05930 89637 90854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_05930 91666 90851 gene locus_tag LOCUS_05940 91666 90851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 93389 91824 gene locus_tag LOCUS_05950 93389 91824 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_05950 93815 94042 gene locus_tag LOCUS_05960 93815 94042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 94220 95311 gene locus_tag LOCUS_05970 94220 95311 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965454.1 protein_id gnl|my_center|LOCUS_05970 95373 96581 gene locus_tag LOCUS_05980 95373 96581 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 protein_id gnl|my_center|LOCUS_05980 96632 97159 gene locus_tag LOCUS_05990 96632 97159 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112900.1 protein_id gnl|my_center|LOCUS_05990 97190 97939 gene locus_tag LOCUS_06000 97190 97939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 protein_id gnl|my_center|LOCUS_06000 97969 99606 gene locus_tag LOCUS_06010 97969 99606 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112904.1 protein_id gnl|my_center|LOCUS_06010 99644 101149 gene locus_tag LOCUS_06020 99644 101149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 101146 103509 gene locus_tag LOCUS_06030 101146 103509 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_06030 103506 104408 gene locus_tag LOCUS_06040 103506 104408 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_06040 105424 104438 gene locus_tag LOCUS_06050 105424 104438 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038831.1 protein_id gnl|my_center|LOCUS_06050 106506 105424 gene locus_tag LOCUS_06060 106506 105424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 107297 106503 gene locus_tag LOCUS_06070 107297 106503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_06070 108955 107294 gene locus_tag LOCUS_06080 108955 107294 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_06080 109886 108999 gene locus_tag LOCUS_06090 109886 108999 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_06090 111127 109907 gene locus_tag LOCUS_06100 111127 109907 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_06100 111367 112539 gene locus_tag LOCUS_06110 111367 112539 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 protein_id gnl|my_center|LOCUS_06110 112586 113377 gene locus_tag LOCUS_06120 112586 113377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 protein_id gnl|my_center|LOCUS_06120 113522 114760 gene locus_tag LOCUS_06130 113522 114760 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_06130 114790 115020 gene locus_tag LOCUS_06140 114790 115020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 116590 115067 gene locus_tag LOCUS_06150 116590 115067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence06 <1 914 gene locus_tag LOCUS_06160 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065381.1:exonuclease SbcCD subunit D 911 3538 gene locus_tag LOCUS_06170 911 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3549 4715 gene locus_tag LOCUS_06180 3549 4715 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_06180 7457 4746 gene locus_tag LOCUS_06190 gene valS 7457 4746 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_06190 7658 8005 gene locus_tag LOCUS_06200 7658 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9244 8006 gene locus_tag LOCUS_06210 9244 8006 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894838.1 protein_id gnl|my_center|LOCUS_06210 9531 9256 gene locus_tag LOCUS_06220 9531 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 10448 9561 gene locus_tag LOCUS_06230 10448 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 10611 10829 gene locus_tag LOCUS_06240 10611 10829 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064213.1 protein_id gnl|my_center|LOCUS_06240 10860 11540 gene locus_tag LOCUS_06250 10860 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 11530 12198 gene locus_tag LOCUS_06260 11530 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12207 13034 gene locus_tag LOCUS_06270 12207 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 13031 13198 gene locus_tag LOCUS_06280 13031 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13191 13754 gene locus_tag LOCUS_06290 13191 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13751 15691 gene locus_tag LOCUS_06300 13751 15691 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_06300 15688 16362 gene locus_tag LOCUS_06310 15688 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 16457 17581 gene locus_tag LOCUS_06320 16457 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 17741 18925 gene locus_tag LOCUS_06330 17741 18925 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_06330 18922 20556 gene locus_tag LOCUS_06340 18922 20556 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_06340 22206 20596 gene locus_tag LOCUS_06350 22206 20596 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_06350 22444 22214 gene locus_tag LOCUS_06360 22444 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 23426 22488 gene locus_tag LOCUS_06370 23426 22488 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_06370 23544 24323 gene locus_tag LOCUS_06380 23544 24323 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_06380 24396 25358 gene locus_tag LOCUS_06390 24396 25358 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259384.1 protein_id gnl|my_center|LOCUS_06390 26162 25389 gene locus_tag LOCUS_06400 26162 25389 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_06400 26727 26221 gene locus_tag LOCUS_06410 26727 26221 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_06410 27437 26724 gene locus_tag LOCUS_06420 27437 26724 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_06420 27496 28146 gene locus_tag LOCUS_06430 27496 28146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 28112 28744 gene locus_tag LOCUS_06440 28112 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 30095 28911 gene locus_tag LOCUS_06450 30095 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 30214 30630 gene locus_tag LOCUS_06460 30214 30630 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_06460 30732 30660 gene locus_tag LOCUS_t00070 30732 30660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30888 32627 gene locus_tag LOCUS_06470 gene argS 30888 32627 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110123.1 protein_id gnl|my_center|LOCUS_06470 32649 34046 gene locus_tag LOCUS_06480 gene lysA 32649 34046 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_06480 34136 35479 gene locus_tag LOCUS_06490 34136 35479 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_06490 35504 36901 gene locus_tag LOCUS_06500 gene thrC 35504 36901 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532761.1 protein_id gnl|my_center|LOCUS_06500 37098 38531 gene locus_tag LOCUS_06510 37098 38531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 38599 38856 gene locus_tag LOCUS_06520 38599 38856 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_06520 38950 40017 gene locus_tag LOCUS_06530 38950 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 40051 41148 gene locus_tag LOCUS_06540 gene prfA 40051 41148 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_06540 41178 42776 gene locus_tag LOCUS_06550 41178 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 42806 43279 gene locus_tag LOCUS_06560 gene rpiB 42806 43279 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_06560 43352 44620 gene locus_tag LOCUS_06570 43352 44620 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_06570 44633 44980 gene locus_tag LOCUS_06580 44633 44980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 44977 45414 gene locus_tag LOCUS_06590 44977 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 45411 46223 gene locus_tag LOCUS_06600 gene atpB 45411 46223 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775944.1 protein_id gnl|my_center|LOCUS_06600 46333 46584 gene locus_tag LOCUS_06610 46333 46584 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_06610 46594 47118 gene locus_tag LOCUS_06620 46594 47118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 47222 47749 gene locus_tag LOCUS_06630 47222 47749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 47746 49317 gene locus_tag LOCUS_06640 gene atpA 47746 49317 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084634.1 protein_id gnl|my_center|LOCUS_06640 49410 50303 gene locus_tag LOCUS_06650 49410 50303 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_06650 50350 51810 gene locus_tag LOCUS_06660 gene atpD 50350 51810 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229522.1 protein_id gnl|my_center|LOCUS_06660 51839 52222 gene locus_tag LOCUS_06670 51839 52222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 52361 53632 gene locus_tag LOCUS_06680 gene amt 52361 53632 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_06680 54106 53687 gene locus_tag LOCUS_06690 54106 53687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 55150 54110 gene locus_tag LOCUS_06700 gene glpX 55150 54110 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_06700 55340 56506 gene locus_tag LOCUS_06710 gene lhgO 55340 56506 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_06710 57110 56532 gene locus_tag LOCUS_06720 57110 56532 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727220.1 protein_id gnl|my_center|LOCUS_06720 58738 57152 gene locus_tag LOCUS_06730 58738 57152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 58827 60113 gene locus_tag LOCUS_06740 gene murA 58827 60113 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406845.1 protein_id gnl|my_center|LOCUS_06740 60156 61121 gene locus_tag LOCUS_06750 gene meaB 60156 61121 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_06750 62348 61191 gene locus_tag LOCUS_06760 62348 61191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 62609 63676 gene locus_tag LOCUS_06770 62609 63676 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_06770 63751 64770 gene locus_tag LOCUS_06780 gene mnmA 63751 64770 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_06780 64767 65222 gene locus_tag LOCUS_06790 64767 65222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 67597 65219 gene locus_tag LOCUS_06800 gene ligA 67597 65219 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_06800 67648 68544 gene locus_tag LOCUS_06810 67648 68544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 68592 68882 gene locus_tag LOCUS_06820 gene gatC 68592 68882 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_06820 68913 70448 gene locus_tag LOCUS_06830 gene gatA 68913 70448 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_06830 70448 71902 gene locus_tag LOCUS_06840 gene gatB 70448 71902 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 protein_id gnl|my_center|LOCUS_06840 72089 72319 gene locus_tag LOCUS_06850 72089 72319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 72541 72804 gene locus_tag LOCUS_06860 72541 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 72987 74360 gene locus_tag LOCUS_06870 72987 74360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 74988 74335 gene locus_tag LOCUS_06880 74988 74335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 75346 75540 gene locus_tag LOCUS_06890 75346 75540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 77153 75543 gene locus_tag LOCUS_06900 77153 75543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 77097 77336 gene locus_tag LOCUS_06910 77097 77336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 77349 80063 gene locus_tag LOCUS_06920 77349 80063 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_06920 80073 81293 gene locus_tag LOCUS_06930 80073 81293 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_06930 82613 81303 gene locus_tag LOCUS_06940 82613 81303 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_06940 83985 82648 gene locus_tag LOCUS_06950 83985 82648 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_06950 84254 86008 gene locus_tag LOCUS_06960 84254 86008 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_06960 86005 86574 gene locus_tag LOCUS_06970 gene ilvN 86005 86574 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_06970 86621 87658 gene locus_tag LOCUS_06980 gene ilvC 86621 87658 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_06980 87738 88361 gene locus_tag LOCUS_06990 87738 88361 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_06990 88480 88995 gene locus_tag LOCUS_07000 88480 88995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 90171 89023 gene locus_tag LOCUS_07010 gene serC 90171 89023 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908729.1 protein_id gnl|my_center|LOCUS_07010 90309 91502 gene locus_tag LOCUS_07020 90309 91502 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_07020 91504 92445 gene locus_tag LOCUS_07030 91504 92445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 93804 92497 gene locus_tag LOCUS_07040 93804 92497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 94897 93911 gene locus_tag LOCUS_07050 94897 93911 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038831.1 protein_id gnl|my_center|LOCUS_07050 95400 94897 gene locus_tag LOCUS_07060 95400 94897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 95892 96548 gene locus_tag LOCUS_07070 95892 96548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 96697 98508 gene locus_tag LOCUS_07080 96697 98508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 98505 100133 gene locus_tag LOCUS_07090 98505 100133 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_07090 100006 100015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100130 101038 gene locus_tag LOCUS_07100 100130 101038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 101035 101913 gene locus_tag LOCUS_07110 101035 101913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 101927 102412 gene locus_tag LOCUS_07120 101927 102412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 102475 102948 gene locus_tag LOCUS_07130 102475 102948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 102974 103831 gene locus_tag LOCUS_07140 102974 103831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 103828 104322 gene locus_tag LOCUS_07150 103828 104322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 104783 107560 gene locus_tag LOCUS_07160 104783 107560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 107622 109202 gene locus_tag LOCUS_07170 107622 109202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 109189 110355 gene locus_tag LOCUS_07180 109189 110355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139574.1 protein_id gnl|my_center|LOCUS_07180 110372 111223 gene locus_tag LOCUS_07190 110372 111223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_07190 111220 112110 gene locus_tag LOCUS_07200 111220 112110 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897907.1 protein_id gnl|my_center|LOCUS_07200 112141 112908 gene locus_tag LOCUS_07210 112141 112908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897909.1 protein_id gnl|my_center|LOCUS_07210 113004 114050 gene locus_tag LOCUS_07220 113004 114050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 114239 114733 gene locus_tag LOCUS_07230 114239 114733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 115782 115240 gene locus_tag LOCUS_07240 115782 115240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 115993 116466 gene locus_tag LOCUS_07250 115993 116466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence07 324 749 gene locus_tag LOCUS_07260 324 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1676 1323 gene locus_tag LOCUS_07270 1676 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1790 2077 gene locus_tag LOCUS_07280 1790 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3659 2628 gene locus_tag LOCUS_07290 3659 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3801 4790 gene locus_tag LOCUS_07300 3801 4790 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066799.1 protein_id gnl|my_center|LOCUS_07300 7228 4886 gene locus_tag LOCUS_07310 7228 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7478 8077 gene locus_tag LOCUS_07320 7478 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8080 8931 gene locus_tag LOCUS_07330 gene ctaG 8080 8931 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_07330 11720 9081 gene locus_tag LOCUS_07340 11720 9081 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_07340 11946 12911 gene locus_tag LOCUS_07350 11946 12911 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_07350 14620 12908 gene locus_tag LOCUS_07360 14620 12908 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_07360 14755 16176 gene locus_tag LOCUS_07370 14755 16176 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_07370 16180 17301 gene locus_tag LOCUS_07380 16180 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 19090 17357 gene locus_tag LOCUS_07390 19090 17357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 20514 19375 gene locus_tag LOCUS_07400 20514 19375 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_07400 20641 21774 gene locus_tag LOCUS_07410 gene ychF 20641 21774 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_07410 21777 22112 gene locus_tag LOCUS_07420 21777 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 22109 22966 gene locus_tag LOCUS_07430 gene rsmI 22109 22966 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_07430 23026 24525 gene locus_tag LOCUS_07440 gene metG 23026 24525 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_07440 24550 25359 gene locus_tag LOCUS_07450 24550 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 25356 26249 gene locus_tag LOCUS_07460 gene rsmA 25356 26249 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_07460 26158 27129 gene locus_tag LOCUS_07470 26158 27129 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_07470 27371 27444 gene locus_tag LOCUS_t00080 27371 27444 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27487 28248 gene locus_tag LOCUS_07480 27487 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 28434 29417 gene locus_tag LOCUS_07490 28434 29417 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_07490 29487 30149 gene locus_tag LOCUS_07500 29487 30149 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_07500 30158 30799 gene locus_tag LOCUS_07510 gene pth 30158 30799 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_07510 30796 34395 gene locus_tag LOCUS_07520 gene mfd 30796 34395 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_07520 34519 35568 gene locus_tag LOCUS_07530 34519 35568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 35593 36078 gene locus_tag LOCUS_07540 35593 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 36168 37463 gene locus_tag LOCUS_07550 gene eno 36168 37463 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037423149.1 protein_id gnl|my_center|LOCUS_07550 37592 37909 gene locus_tag LOCUS_07560 37592 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 38504 37977 gene locus_tag LOCUS_07570 38504 37977 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_07570 38730 39200 gene locus_tag LOCUS_07580 38730 39200 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_07580 39214 40041 gene locus_tag LOCUS_07590 39214 40041 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_07590 40844 40101 gene locus_tag LOCUS_07600 40844 40101 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 protein_id gnl|my_center|LOCUS_07600 40986 45626 gene locus_tag LOCUS_07610 40986 45626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 45623 49399 gene locus_tag LOCUS_07620 45623 49399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 49816 49511 gene locus_tag LOCUS_07630 49816 49511 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_07630 50130 49813 gene locus_tag LOCUS_07640 50130 49813 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_07640 50240 51253 gene locus_tag LOCUS_07650 50240 51253 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_07650 51383 52348 gene locus_tag LOCUS_07660 51383 52348 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_07660 52424 53251 gene locus_tag LOCUS_07670 52424 53251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 53386 55053 gene locus_tag LOCUS_07680 53386 55053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484458.1 protein_id gnl|my_center|LOCUS_07680 55076 55990 gene locus_tag LOCUS_07690 55076 55990 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_07690 56069 57241 gene locus_tag LOCUS_07700 56069 57241 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_07700 57317 57634 gene locus_tag LOCUS_07710 57317 57634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07710 57631 58422 gene locus_tag LOCUS_07720 57631 58422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07720 58456 59622 gene locus_tag LOCUS_07730 58456 59622 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_07730 59645 60211 gene locus_tag LOCUS_07740 59645 60211 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240487.1 protein_id gnl|my_center|LOCUS_07740 60202 60891 gene locus_tag LOCUS_07750 60202 60891 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_07750 60978 61478 gene locus_tag LOCUS_07760 60978 61478 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930194.1 protein_id gnl|my_center|LOCUS_07760 61468 62544 gene locus_tag LOCUS_07770 61468 62544 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_07770 62567 63202 gene locus_tag LOCUS_07780 62567 63202 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_07780 64209 63250 gene locus_tag LOCUS_07790 64209 63250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 64288 64767 gene locus_tag LOCUS_07800 64288 64767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 64840 64927 gene locus_tag LOCUS_t00090 64840 64927 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 65397 65077 gene locus_tag LOCUS_07810 65397 65077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 65396 65848 gene locus_tag LOCUS_07820 65396 65848 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929167.1 protein_id gnl|my_center|LOCUS_07820 67039 65999 gene locus_tag LOCUS_07830 67039 65999 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_07830 67134 68402 gene locus_tag LOCUS_07840 67134 68402 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_07840 68460 69761 gene locus_tag LOCUS_07850 68460 69761 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_07850 69874 70485 gene locus_tag LOCUS_07860 69874 70485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 70557 71519 gene locus_tag LOCUS_07870 70557 71519 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_07870 72247 71561 gene locus_tag LOCUS_07880 72247 71561 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 protein_id gnl|my_center|LOCUS_07880 74374 72332 gene locus_tag LOCUS_07890 74374 72332 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_07890 74560 74967 gene locus_tag LOCUS_07900 74560 74967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 74964 76166 gene locus_tag LOCUS_07910 74964 76166 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_07910 76166 77146 gene locus_tag LOCUS_07920 76166 77146 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_07920 77146 78021 gene locus_tag LOCUS_07930 77146 78021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_07930 78090 78911 gene locus_tag LOCUS_07940 gene ppk2 78090 78911 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_07940 80566 78923 gene locus_tag LOCUS_07950 80566 78923 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_07950 81404 80661 gene locus_tag LOCUS_07960 81404 80661 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_07960 82601 81534 gene locus_tag LOCUS_07970 82601 81534 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_07970 83660 82647 gene locus_tag LOCUS_07980 83660 82647 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_07980 83772 85019 gene locus_tag LOCUS_07990 83772 85019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_07990 85080 86402 gene locus_tag LOCUS_08000 gene hmgA 85080 86402 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967448.1 protein_id gnl|my_center|LOCUS_08000 86469 87242 gene locus_tag LOCUS_08010 86469 87242 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_08010 88694 87312 gene locus_tag LOCUS_08020 88694 87312 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877503.1 protein_id gnl|my_center|LOCUS_08020 89498 88737 gene locus_tag LOCUS_08030 89498 88737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776621.1 protein_id gnl|my_center|LOCUS_08030 90268 89495 gene locus_tag LOCUS_08040 90268 89495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930031.1 protein_id gnl|my_center|LOCUS_08040 90467 93538 gene locus_tag LOCUS_08050 90467 93538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 93566 94480 gene locus_tag LOCUS_08060 93566 94480 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_08060 94511 95287 gene locus_tag LOCUS_08070 94511 95287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_08070 95339 96484 gene locus_tag LOCUS_08080 95339 96484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:95783..95785,aa:Sec) note codon on position 149 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08080 96568 97869 gene locus_tag LOCUS_08090 96568 97869 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_08090 97961 101494 gene locus_tag LOCUS_08100 97961 101494 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_08100 101764 101934 gene locus_tag LOCUS_08110 101764 101934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 104014 102137 gene locus_tag LOCUS_08120 104014 102137 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_08120 104532 105479 gene locus_tag LOCUS_08130 104532 105479 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930702.1 protein_id gnl|my_center|LOCUS_08130 105900 105541 gene locus_tag LOCUS_08140 105900 105541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 106489 105944 gene locus_tag LOCUS_08150 106489 105944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 106541 107914 gene locus_tag LOCUS_08160 106541 107914 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_08160 107914 109098 gene locus_tag LOCUS_08170 107914 109098 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_08170 109191 110387 gene locus_tag LOCUS_08180 109191 110387 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_08180 110437 111195 gene locus_tag LOCUS_08190 110437 111195 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_08190 111281 113080 gene locus_tag LOCUS_08200 111281 113080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 114390 113095 gene locus_tag LOCUS_08210 114390 113095 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_08210 <115455 114398 gene locus_tag LOCUS_08220 <115455 114398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728601.1:LLM class F420-dependent oxidoreductase >Feature sequence08 662 369 gene locus_tag LOCUS_08230 662 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 882 1325 gene locus_tag LOCUS_08240 882 1325 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409417.1 protein_id gnl|my_center|LOCUS_08240 1778 1341 gene locus_tag LOCUS_08250 1778 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1857 2297 gene locus_tag LOCUS_08260 1857 2297 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_08260 2349 4565 gene locus_tag LOCUS_08270 gene katG 2349 4565 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_08270 4614 5447 gene locus_tag LOCUS_08280 4614 5447 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 protein_id gnl|my_center|LOCUS_08280 5471 6496 gene locus_tag LOCUS_08290 5471 6496 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086613.1 protein_id gnl|my_center|LOCUS_08290 7452 6532 gene locus_tag LOCUS_08300 7452 6532 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_08300 8333 7449 gene locus_tag LOCUS_08310 8333 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8630 8373 gene locus_tag LOCUS_08320 8630 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8657 10948 gene locus_tag LOCUS_08330 8657 10948 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_08330 12209 10998 gene locus_tag LOCUS_08340 12209 10998 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083717.1 protein_id gnl|my_center|LOCUS_08340 13016 12273 gene locus_tag LOCUS_08350 13016 12273 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_08350 14387 13200 gene locus_tag LOCUS_08360 14387 13200 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_08360 14522 15262 gene locus_tag LOCUS_08370 14522 15262 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_08370 15278 16648 gene locus_tag LOCUS_08380 15278 16648 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 protein_id gnl|my_center|LOCUS_08380 16651 17175 gene locus_tag LOCUS_08390 16651 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 17210 17986 gene locus_tag LOCUS_08400 17210 17986 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112326.1 protein_id gnl|my_center|LOCUS_08400 19226 17988 gene locus_tag LOCUS_08410 19226 17988 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_08410 21226 19325 gene locus_tag LOCUS_08420 21226 19325 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965832.1 protein_id gnl|my_center|LOCUS_08420 21361 22206 gene locus_tag LOCUS_08430 21361 22206 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_08430 22228 22617 gene locus_tag LOCUS_08440 22228 22617 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_08440 23626 22664 gene locus_tag LOCUS_08450 23626 22664 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_08450 24279 23647 gene locus_tag LOCUS_08460 24279 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 24438 25325 gene locus_tag LOCUS_08470 24438 25325 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_08470 25348 25767 gene locus_tag LOCUS_08480 25348 25767 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_08480 25867 26808 gene locus_tag LOCUS_08490 25867 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 27856 26792 gene locus_tag LOCUS_08500 27856 26792 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_08500 27800 28381 gene locus_tag LOCUS_08510 27800 28381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 28440 28928 gene locus_tag LOCUS_08520 28440 28928 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_08520 29030 29461 gene locus_tag LOCUS_08530 29030 29461 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230341.1 protein_id gnl|my_center|LOCUS_08530 29469 30473 gene locus_tag LOCUS_08540 29469 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 32801 30498 gene locus_tag LOCUS_08550 32801 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 33005 33826 gene locus_tag LOCUS_08560 33005 33826 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_08560 33876 36158 gene locus_tag LOCUS_08570 33876 36158 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_08570 36170 36724 gene locus_tag LOCUS_08580 36170 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 36721 37629 gene locus_tag LOCUS_08590 36721 37629 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_08590 37680 39149 gene locus_tag LOCUS_08600 37680 39149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_08600 39146 40534 gene locus_tag LOCUS_08610 39146 40534 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_08610 42316 40571 gene locus_tag LOCUS_08620 42316 40571 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_08620 42575 42991 gene locus_tag LOCUS_08630 42575 42991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 43067 43729 gene locus_tag LOCUS_08640 43067 43729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 43785 44108 gene locus_tag LOCUS_08650 43785 44108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 44092 44472 gene locus_tag LOCUS_08660 44092 44472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 44601 44900 gene locus_tag LOCUS_08670 44601 44900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 45684 45127 gene locus_tag LOCUS_08680 45684 45127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 50106 45838 gene locus_tag LOCUS_08690 50106 45838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 49924 49933 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50674 50255 gene locus_tag LOCUS_08700 50674 50255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 51171 50698 gene locus_tag LOCUS_08710 51171 50698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 51590 52564 gene locus_tag LOCUS_08720 51590 52564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 52649 53668 gene locus_tag LOCUS_08730 52649 53668 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_08730 53665 54795 gene locus_tag LOCUS_08740 53665 54795 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969921.1 protein_id gnl|my_center|LOCUS_08740 54839 56344 gene locus_tag LOCUS_08750 54839 56344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 56509 57375 gene locus_tag LOCUS_08760 56509 57375 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_08760 57377 58468 gene locus_tag LOCUS_08770 57377 58468 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969915.1 protein_id gnl|my_center|LOCUS_08770 58472 59548 gene locus_tag LOCUS_08780 58472 59548 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170557.1 protein_id gnl|my_center|LOCUS_08780 59548 60723 gene locus_tag LOCUS_08790 59548 60723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_08790 60720 61763 gene locus_tag LOCUS_08800 60720 61763 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 protein_id gnl|my_center|LOCUS_08800 62595 61783 gene locus_tag LOCUS_08810 62595 61783 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035607.1 protein_id gnl|my_center|LOCUS_08810 63149 62703 gene locus_tag LOCUS_08820 63149 62703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 63667 63146 gene locus_tag LOCUS_08830 63667 63146 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_08830 66009 63664 gene locus_tag LOCUS_08840 66009 63664 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_08840 66897 66127 gene locus_tag LOCUS_08850 66897 66127 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_08850 67014 68222 gene locus_tag LOCUS_08860 67014 68222 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385060.1 protein_id gnl|my_center|LOCUS_08860 68244 69287 gene locus_tag LOCUS_08870 68244 69287 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857626.1 protein_id gnl|my_center|LOCUS_08870 69343 69804 gene locus_tag LOCUS_08880 69343 69804 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111489.1 protein_id gnl|my_center|LOCUS_08880 69876 70559 gene locus_tag LOCUS_08890 69876 70559 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_08890 70560 72641 gene locus_tag LOCUS_08900 70560 72641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 72638 73504 gene locus_tag LOCUS_08910 72638 73504 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_08910 73504 73995 gene locus_tag LOCUS_08920 73504 73995 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_08920 73992 76268 gene locus_tag LOCUS_08930 73992 76268 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533164.1 protein_id gnl|my_center|LOCUS_08930 76265 77884 gene locus_tag LOCUS_08940 76265 77884 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_08940 77881 78870 gene locus_tag LOCUS_08950 gene mer 77881 78870 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_08950 80022 78952 gene locus_tag LOCUS_08960 80022 78952 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311988.1 protein_id gnl|my_center|LOCUS_08960 81548 80109 gene locus_tag LOCUS_08970 81548 80109 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173762.1 protein_id gnl|my_center|LOCUS_08970 82586 81558 gene locus_tag LOCUS_08980 82586 81558 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528548.1 protein_id gnl|my_center|LOCUS_08980 83868 82579 gene locus_tag LOCUS_08990 83868 82579 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528549.1 protein_id gnl|my_center|LOCUS_08990 84794 83922 gene locus_tag LOCUS_09000 84794 83922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 84888 85859 gene locus_tag LOCUS_09010 84888 85859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 85856 86254 gene locus_tag LOCUS_09020 85856 86254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 86251 87306 gene locus_tag LOCUS_09030 86251 87306 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_09030 88395 87364 gene locus_tag LOCUS_09040 gene mer 88395 87364 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_09040 88466 90037 gene locus_tag LOCUS_09050 88466 90037 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_09050 92770 90077 gene locus_tag LOCUS_09060 92770 90077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 92903 94198 gene locus_tag LOCUS_09070 92903 94198 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_09070 94195 95121 gene locus_tag LOCUS_09080 94195 95121 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_09080 95216 97807 gene locus_tag LOCUS_09090 gene xdh 95216 97807 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_09090 99943 97808 gene locus_tag LOCUS_09100 99943 97808 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_09100 101162 99987 gene locus_tag LOCUS_09110 101162 99987 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_09110 102803 101229 gene locus_tag LOCUS_09120 102803 101229 CDS product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976304.1 protein_id gnl|my_center|LOCUS_09120 103185 102886 gene locus_tag LOCUS_09130 103185 102886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 103482 103192 gene locus_tag LOCUS_09140 103482 103192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 103714 103436 gene locus_tag LOCUS_09150 103714 103436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 105039 103711 gene locus_tag LOCUS_09160 105039 103711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 105432 105235 gene locus_tag LOCUS_09170 105432 105235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 106465 105980 gene locus_tag LOCUS_09180 106465 105980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 106727 107665 gene locus_tag LOCUS_09190 106727 107665 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence09 908 42 gene locus_tag LOCUS_09200 908 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 942 1232 gene locus_tag LOCUS_09210 942 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1229 1624 gene locus_tag LOCUS_09220 1229 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4895 1656 gene locus_tag LOCUS_09230 4895 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4962 5141 gene locus_tag LOCUS_09240 4962 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5138 5584 gene locus_tag LOCUS_09250 5138 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5747 6025 gene locus_tag LOCUS_09260 5747 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6114 6392 gene locus_tag LOCUS_09270 6114 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6389 6706 gene locus_tag LOCUS_09280 6389 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9800 6750 gene locus_tag LOCUS_09290 9800 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 12075 9814 gene locus_tag LOCUS_09300 12075 9814 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_09300 13055 12072 gene locus_tag LOCUS_09310 13055 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14112 13039 gene locus_tag LOCUS_09320 14112 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 14801 14538 gene locus_tag LOCUS_09330 14801 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 14917 15198 gene locus_tag LOCUS_09340 14917 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 15241 16182 gene locus_tag LOCUS_09350 15241 16182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19421 16203 gene locus_tag LOCUS_09360 19421 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 19489 19623 gene locus_tag LOCUS_09370 19489 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19697 20758 gene locus_tag LOCUS_09380 19697 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 20821 21942 gene locus_tag LOCUS_09390 20821 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 22014 22113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22303 22488 gene locus_tag LOCUS_09400 22303 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 22864 22529 gene locus_tag LOCUS_09410 22864 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 23034 23405 gene locus_tag LOCUS_09420 23034 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 23458 26517 gene locus_tag LOCUS_09430 23458 26517 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 protein_id gnl|my_center|LOCUS_09430 26531 29302 gene locus_tag LOCUS_09440 26531 29302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 29500 29976 gene locus_tag LOCUS_09450 29500 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 30745 30005 gene locus_tag LOCUS_09460 30745 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 32530 30866 gene locus_tag LOCUS_09470 32530 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 32876 33292 gene locus_tag LOCUS_09480 32876 33292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 34088 33504 gene locus_tag LOCUS_09490 34088 33504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 36936 34081 gene locus_tag LOCUS_09500 36936 34081 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_09500 37312 37004 gene locus_tag LOCUS_09510 37312 37004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 38575 37361 gene locus_tag LOCUS_09520 38575 37361 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_09520 38754 39650 gene locus_tag LOCUS_09530 38754 39650 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897067.1 protein_id gnl|my_center|LOCUS_09530 40307 39870 gene locus_tag LOCUS_09540 40307 39870 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_09540 40597 40304 gene locus_tag LOCUS_09550 gene vapB33 40597 40304 CDS product type II toxin-antitoxin system antitoxin VapB33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406302.1 protein_id gnl|my_center|LOCUS_09550 43986 40783 gene locus_tag LOCUS_09560 43986 40783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 46906 43979 gene locus_tag LOCUS_09570 46906 43979 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_09570 47330 46899 gene locus_tag LOCUS_09580 47330 46899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 50593 47327 gene locus_tag LOCUS_09590 50593 47327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 50804 51376 gene locus_tag LOCUS_09600 50804 51376 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_09600 51418 51702 gene locus_tag LOCUS_09610 51418 51702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 52260 51736 gene locus_tag LOCUS_09620 52260 51736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 53272 52343 gene locus_tag LOCUS_09630 53272 52343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 53484 54197 gene locus_tag LOCUS_09640 53484 54197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 54213 54599 gene locus_tag LOCUS_09650 54213 54599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 56450 54651 gene locus_tag LOCUS_09660 56450 54651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 57090 56554 gene locus_tag LOCUS_09670 57090 56554 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_09670 57543 59222 gene locus_tag LOCUS_09680 57543 59222 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225052.1 protein_id gnl|my_center|LOCUS_09680 59231 60232 gene locus_tag LOCUS_09690 59231 60232 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_09690 60345 61787 gene locus_tag LOCUS_09700 60345 61787 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384638.1 protein_id gnl|my_center|LOCUS_09700 61954 63576 gene locus_tag LOCUS_09710 61954 63576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 63569 64564 gene locus_tag LOCUS_09720 63569 64564 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_09720 64570 65493 gene locus_tag LOCUS_09730 64570 65493 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_09730 65490 66653 gene locus_tag LOCUS_09740 65490 66653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 66682 67752 gene locus_tag LOCUS_09750 66682 67752 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_09750 68963 67803 gene locus_tag LOCUS_09760 68963 67803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_09760 69062 69823 gene locus_tag LOCUS_09770 69062 69823 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_09770 69878 71692 gene locus_tag LOCUS_09780 69878 71692 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_09780 71751 72509 gene locus_tag LOCUS_09790 71751 72509 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_09790 72666 73652 gene locus_tag LOCUS_09800 72666 73652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 74010 75068 gene locus_tag LOCUS_09810 74010 75068 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217921400.1 protein_id gnl|my_center|LOCUS_09810 75105 76715 gene locus_tag LOCUS_09820 75105 76715 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_09820 77522 76749 gene locus_tag LOCUS_09830 77522 76749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 77712 78890 gene locus_tag LOCUS_09840 77712 78890 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_09840 79369 78887 gene locus_tag LOCUS_09850 79369 78887 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_09850 80660 79425 gene locus_tag LOCUS_09860 80660 79425 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_09860 80764 81552 gene locus_tag LOCUS_09870 80764 81552 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 protein_id gnl|my_center|LOCUS_09870 81624 83045 gene locus_tag LOCUS_09880 81624 83045 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_09880 83067 83558 gene locus_tag LOCUS_09890 83067 83558 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_09890 83551 84333 gene locus_tag LOCUS_09900 83551 84333 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_09900 84628 85374 gene locus_tag LOCUS_09910 84628 85374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_09910 85462 86103 gene locus_tag LOCUS_09920 85462 86103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 86200 86964 gene locus_tag LOCUS_09930 86200 86964 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_09930 87009 87407 gene locus_tag LOCUS_09940 87009 87407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 87421 87792 gene locus_tag LOCUS_09950 87421 87792 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_09950 87846 88409 gene locus_tag LOCUS_09960 87846 88409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 89560 88487 gene locus_tag LOCUS_09970 89560 88487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 89775 90308 gene locus_tag LOCUS_09980 89775 90308 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_09980 90725 90345 gene locus_tag LOCUS_09990 90725 90345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 91368 90745 gene locus_tag LOCUS_10000 91368 90745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 91587 91877 gene locus_tag LOCUS_10010 91587 91877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 91953 93503 gene locus_tag LOCUS_10020 gene betC 91953 93503 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_10020 94879 93566 gene locus_tag LOCUS_10030 94879 93566 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_10030 95094 94906 gene locus_tag LOCUS_10040 95094 94906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 96489 95269 gene locus_tag LOCUS_10050 96489 95269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 97404 96607 gene locus_tag LOCUS_10060 97404 96607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 98384 97386 gene locus_tag LOCUS_10070 98384 97386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 98443 98598 gene locus_tag LOCUS_10080 98443 98598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 98688 99047 gene locus_tag LOCUS_10090 98688 99047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 99322 99645 gene locus_tag LOCUS_10100 99322 99645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 99875 99666 gene locus_tag LOCUS_10110 99875 99666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 100005 101567 gene locus_tag LOCUS_10120 100005 101567 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726984.1 protein_id gnl|my_center|LOCUS_10120 101633 102814 gene locus_tag LOCUS_10130 101633 102814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 102814 103158 gene locus_tag LOCUS_10140 102814 103158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence10 871 2733 gene locus_tag LOCUS_10150 871 2733 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528004.1 protein_id gnl|my_center|LOCUS_10150 2776 3729 gene locus_tag LOCUS_10160 2776 3729 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 protein_id gnl|my_center|LOCUS_10160 5257 3791 gene locus_tag LOCUS_10170 5257 3791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_10170 5300 7396 gene locus_tag LOCUS_10180 5300 7396 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731555.1 protein_id gnl|my_center|LOCUS_10180 7409 8911 gene locus_tag LOCUS_10190 7409 8911 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064659.1 protein_id gnl|my_center|LOCUS_10190 8983 9909 gene locus_tag LOCUS_10200 8983 9909 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_10200 9879 10055 gene locus_tag LOCUS_10210 9879 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11452 10172 gene locus_tag LOCUS_10220 11452 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 13005 11608 gene locus_tag LOCUS_10230 13005 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 15951 13006 gene locus_tag LOCUS_10240 15951 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 16279 16010 gene locus_tag LOCUS_10250 16279 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 16414 16677 gene locus_tag LOCUS_10260 16414 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 16732 17517 gene locus_tag LOCUS_10270 16732 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_10270 17618 18169 gene locus_tag LOCUS_10280 17618 18169 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_10280 18166 19092 gene locus_tag LOCUS_10290 18166 19092 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_10290 20696 19203 gene locus_tag LOCUS_10300 20696 19203 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_10300 20802 21482 gene locus_tag LOCUS_10310 20802 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 21479 22504 gene locus_tag LOCUS_10320 gene speB 21479 22504 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_10320 22588 23655 gene locus_tag LOCUS_10330 22588 23655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_10330 23655 24620 gene locus_tag LOCUS_10340 23655 24620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_10340 24617 25453 gene locus_tag LOCUS_10350 24617 25453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_10350 25483 26622 gene locus_tag LOCUS_10360 25483 26622 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_10360 27893 26664 gene locus_tag LOCUS_10370 27893 26664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_10370 28818 27973 gene locus_tag LOCUS_10380 gene paaG 28818 27973 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_10380 29154 28930 gene locus_tag LOCUS_10390 gene infA 29154 28930 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 protein_id gnl|my_center|LOCUS_10390 29044 29304 gene locus_tag LOCUS_10400 29044 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 29818 29291 gene locus_tag LOCUS_10410 gene feR 29818 29291 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_10410 29968 31641 gene locus_tag LOCUS_10420 29968 31641 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_10420 31723 32727 gene locus_tag LOCUS_10430 gene ltaE 31723 32727 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_10430 34871 32742 gene locus_tag LOCUS_10440 34871 32742 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509311.1 protein_id gnl|my_center|LOCUS_10440 35484 34984 gene locus_tag LOCUS_10450 35484 34984 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731373.1 protein_id gnl|my_center|LOCUS_10450 35549 35899 gene locus_tag LOCUS_10460 35549 35899 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013664.1 protein_id gnl|my_center|LOCUS_10460 36189 35902 gene locus_tag LOCUS_10470 36189 35902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 36390 36262 gene locus_tag LOCUS_10480 36390 36262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 36520 37653 gene locus_tag LOCUS_10490 36520 37653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 37693 38826 gene locus_tag LOCUS_10500 37693 38826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 38957 38883 gene locus_tag LOCUS_t00100 38957 38883 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39785 38979 gene locus_tag LOCUS_10510 39785 38979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 39918 40487 gene locus_tag LOCUS_10520 39918 40487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 41696 40542 gene locus_tag LOCUS_10530 41696 40542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_10530 43405 41693 gene locus_tag LOCUS_10540 43405 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 44291 43461 gene locus_tag LOCUS_10550 44291 43461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10550 45423 44284 gene locus_tag LOCUS_10560 45423 44284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008042.1 protein_id gnl|my_center|LOCUS_10560 47412 45472 gene locus_tag LOCUS_10570 47412 45472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 49394 47439 gene locus_tag LOCUS_10580 49394 47439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 49625 49698 gene locus_tag LOCUS_t00110 49625 49698 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50109 49657 gene locus_tag LOCUS_10590 gene hicB 50109 49657 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_10590 50312 50106 gene locus_tag LOCUS_10600 50312 50106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 50533 50606 gene locus_tag LOCUS_t00120 50533 50606 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 53631 50644 gene locus_tag LOCUS_10610 53631 50644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 55767 53725 gene locus_tag LOCUS_10620 55767 53725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 57392 55845 gene locus_tag LOCUS_10630 57392 55845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 58918 57461 gene locus_tag LOCUS_10640 58918 57461 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_10640 58899 59333 gene locus_tag LOCUS_10650 58899 59333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 60113 59397 gene locus_tag LOCUS_10660 gene recO 60113 59397 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060357.1 protein_id gnl|my_center|LOCUS_10660 60913 60215 gene locus_tag LOCUS_10670 60913 60215 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067194.1 protein_id gnl|my_center|LOCUS_10670 61001 62944 gene locus_tag LOCUS_10680 61001 62944 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089963.1 protein_id gnl|my_center|LOCUS_10680 63839 62958 gene locus_tag LOCUS_10690 gene era 63839 62958 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_10690 65200 63854 gene locus_tag LOCUS_10700 65200 63854 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_10700 65685 65185 gene locus_tag LOCUS_10710 65685 65185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 66652 65690 gene locus_tag LOCUS_10720 66652 65690 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_10720 67112 66798 gene locus_tag LOCUS_10730 67112 66798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 67259 69556 gene locus_tag LOCUS_10740 67259 69556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 72419 69579 gene locus_tag LOCUS_10750 72419 69579 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_10750 72649 73377 gene locus_tag LOCUS_10760 72649 73377 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_10760 73518 74174 gene locus_tag LOCUS_10770 gene lexA 73518 74174 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_10770 74260 75081 gene locus_tag LOCUS_10780 gene nudC 74260 75081 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_10780 76521 75082 gene locus_tag LOCUS_10790 gene cysS 76521 75082 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_10790 77381 76590 gene locus_tag LOCUS_10800 77381 76590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 77698 77393 gene locus_tag LOCUS_10810 77698 77393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 78083 78643 gene locus_tag LOCUS_10820 78083 78643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 78640 79932 gene locus_tag LOCUS_10830 78640 79932 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_10830 79929 80786 gene locus_tag LOCUS_10840 79929 80786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 80783 81508 gene locus_tag LOCUS_10850 80783 81508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 81531 81806 gene locus_tag LOCUS_10860 81531 81806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 81803 82219 gene locus_tag LOCUS_10870 81803 82219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 82216 82680 gene locus_tag LOCUS_10880 82216 82680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 82646 83113 gene locus_tag LOCUS_10890 82646 83113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 84210 83119 gene locus_tag LOCUS_10900 gene hemW 84210 83119 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_10900 84507 84217 gene locus_tag LOCUS_10910 84507 84217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 85714 84509 gene locus_tag LOCUS_10920 gene dnaJ 85714 84509 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_10920 86808 85726 gene locus_tag LOCUS_10930 gene hrcA 86808 85726 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_10930 88758 86884 gene locus_tag LOCUS_10940 gene lepA 88758 86884 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900516.1 protein_id gnl|my_center|LOCUS_10940 88765 89022 gene locus_tag LOCUS_10950 gene rpsT 88765 89022 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_10950 90072 89101 gene locus_tag LOCUS_10960 90072 89101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 91916 90048 gene locus_tag LOCUS_10970 91916 90048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 92562 91903 gene locus_tag LOCUS_10980 92562 91903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 93730 92573 gene locus_tag LOCUS_10990 93730 92573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 93822 94868 gene locus_tag LOCUS_11000 93822 94868 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_11000 94886 95899 gene locus_tag LOCUS_11010 94886 95899 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_11010 96383 95970 gene locus_tag LOCUS_11020 96383 95970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 96457 96531 gene locus_tag LOCUS_t00130 96457 96531 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 96595 97356 gene locus_tag LOCUS_11030 96595 97356 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284646.1 protein_id gnl|my_center|LOCUS_11030 97353 98576 gene locus_tag LOCUS_11040 97353 98576 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085563.1 protein_id gnl|my_center|LOCUS_11040 98858 98613 gene locus_tag LOCUS_11050 98858 98613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 99135 101465 gene locus_tag LOCUS_11060 99135 101465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 101621 102205 gene locus_tag LOCUS_11070 101621 102205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 102202 103053 gene locus_tag LOCUS_11080 102202 103053 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203660628.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence11 120 1121 gene locus_tag LOCUS_11090 120 1121 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_11090 1118 2170 gene locus_tag LOCUS_11100 1118 2170 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_11100 2185 3729 gene locus_tag LOCUS_11110 2185 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4941 3778 gene locus_tag LOCUS_11120 4941 3778 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_11120 5521 4964 gene locus_tag LOCUS_11130 5521 4964 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098519.1 protein_id gnl|my_center|LOCUS_11130 7515 5650 gene locus_tag LOCUS_11140 7515 5650 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_11140 7619 8266 gene locus_tag LOCUS_11150 gene thrH 7619 8266 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_11150 8341 8823 gene locus_tag LOCUS_11160 8341 8823 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390805.1 protein_id gnl|my_center|LOCUS_11160 8906 9952 gene locus_tag LOCUS_11170 8906 9952 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_11170 9794 9893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10035 11507 gene locus_tag LOCUS_11180 10035 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11518 12141 gene locus_tag LOCUS_11190 11518 12141 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_11190 12149 12529 gene locus_tag LOCUS_11200 12149 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 12522 12767 gene locus_tag LOCUS_11210 12522 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 12781 13026 gene locus_tag LOCUS_11220 12781 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 13023 13883 gene locus_tag LOCUS_11230 13023 13883 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_11230 13964 14785 gene locus_tag LOCUS_11240 13964 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15070 14837 gene locus_tag LOCUS_11250 15070 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 15245 17008 gene locus_tag LOCUS_11260 gene arc 15245 17008 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_11260 17082 18590 gene locus_tag LOCUS_11270 gene dop 17082 18590 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_11270 18676 18867 gene locus_tag LOCUS_11280 18676 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 18864 19754 gene locus_tag LOCUS_11290 gene prcB 18864 19754 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_11290 19766 20473 gene locus_tag LOCUS_11300 gene prcA 19766 20473 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_11300 20486 21853 gene locus_tag LOCUS_11310 gene pafA 20486 21853 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_11310 21904 23025 gene locus_tag LOCUS_11320 21904 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 23097 23624 gene locus_tag LOCUS_11330 gene lepB 23097 23624 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_11330 24403 23657 gene locus_tag LOCUS_11340 24403 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 24428 24706 gene locus_tag LOCUS_11350 24428 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 24786 25097 gene locus_tag LOCUS_11360 24786 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 25133 25939 gene locus_tag LOCUS_11370 gene tatC 25133 25939 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_11370 25936 28332 gene locus_tag LOCUS_11380 25936 28332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 28524 28958 gene locus_tag LOCUS_11390 28524 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 29060 30679 gene locus_tag LOCUS_11400 29060 30679 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_11400 30710 31234 gene locus_tag LOCUS_11410 30710 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 31269 31634 gene locus_tag LOCUS_11420 31269 31634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 33158 31587 gene locus_tag LOCUS_11430 33158 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 33779 33878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33881 36058 gene locus_tag LOCUS_11440 33881 36058 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_11440 36055 38142 gene locus_tag LOCUS_11450 36055 38142 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_11450 39145 38291 gene locus_tag LOCUS_11460 39145 38291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 39321 41057 gene locus_tag LOCUS_11470 39321 41057 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_11470 41069 41782 gene locus_tag LOCUS_11480 41069 41782 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_11480 41786 43399 gene locus_tag LOCUS_11490 41786 43399 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153412267.1 protein_id gnl|my_center|LOCUS_11490 43868 43455 gene locus_tag LOCUS_11500 43868 43455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 47491 43865 gene locus_tag LOCUS_11510 47491 43865 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_11510 47721 49433 gene locus_tag LOCUS_11520 47721 49433 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_11520 49674 50396 gene locus_tag LOCUS_11530 49674 50396 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_11530 50548 51246 gene locus_tag LOCUS_11540 50548 51246 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530684.1 protein_id gnl|my_center|LOCUS_11540 51243 52172 gene locus_tag LOCUS_11550 51243 52172 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_11550 52105 54297 gene locus_tag LOCUS_11560 52105 54297 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 protein_id gnl|my_center|LOCUS_11560 54399 55826 gene locus_tag LOCUS_11570 54399 55826 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_11570 56670 55846 gene locus_tag LOCUS_11580 56670 55846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 58009 56693 gene locus_tag LOCUS_11590 58009 56693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_11590 59005 58079 gene locus_tag LOCUS_11600 59005 58079 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_11600 60795 59002 gene locus_tag LOCUS_11610 60795 59002 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_11610 62482 60779 gene locus_tag LOCUS_11620 62482 60779 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11620 62824 62513 gene locus_tag LOCUS_11630 62824 62513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11630 63027 63791 gene locus_tag LOCUS_11640 63027 63791 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_11640 63863 65737 gene locus_tag LOCUS_11650 63863 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 65667 69107 gene locus_tag LOCUS_11660 65667 69107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 69256 69477 gene locus_tag LOCUS_11670 69256 69477 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_11670 69873 69496 gene locus_tag LOCUS_11680 69873 69496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 70542 69883 gene locus_tag LOCUS_11690 70542 69883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 71682 70636 gene locus_tag LOCUS_11700 71682 70636 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_11700 72461 71679 gene locus_tag LOCUS_11710 72461 71679 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 protein_id gnl|my_center|LOCUS_11710 74994 72472 gene locus_tag LOCUS_11720 74994 72472 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_11720 75213 76937 gene locus_tag LOCUS_11730 75213 76937 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_11730 76947 77810 gene locus_tag LOCUS_11740 76947 77810 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_11740 77828 78499 gene locus_tag LOCUS_11750 77828 78499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 79735 78461 gene locus_tag LOCUS_11760 79735 78461 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 protein_id gnl|my_center|LOCUS_11760 80983 79769 gene locus_tag LOCUS_11770 80983 79769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 82106 81147 gene locus_tag LOCUS_11780 82106 81147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529749.1 protein_id gnl|my_center|LOCUS_11780 82490 82167 gene locus_tag LOCUS_11790 82490 82167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 82571 83761 gene locus_tag LOCUS_11800 82571 83761 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_11800 84943 83804 gene locus_tag LOCUS_11810 84943 83804 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_11810 84914 85084 gene locus_tag LOCUS_11820 84914 85084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 85208 86113 gene locus_tag LOCUS_11830 gene thpD 85208 86113 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_11830 86159 87730 gene locus_tag LOCUS_11840 86159 87730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 88232 87777 gene locus_tag LOCUS_11850 88232 87777 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_11850 88585 88229 gene locus_tag LOCUS_11860 88585 88229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 88484 89569 gene locus_tag LOCUS_11870 88484 89569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 91121 89589 gene locus_tag LOCUS_11880 91121 89589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 91610 91155 gene locus_tag LOCUS_11890 91610 91155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 91789 92685 gene locus_tag LOCUS_11900 91789 92685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_11900 92692 94467 gene locus_tag LOCUS_11910 92692 94467 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_11910 94464 95207 gene locus_tag LOCUS_11920 94464 95207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 protein_id gnl|my_center|LOCUS_11920 95717 96226 gene locus_tag LOCUS_11930 95717 96226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 96915 98333 gene locus_tag LOCUS_11940 96915 98333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 98357 98662 gene locus_tag LOCUS_11950 98357 98662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 99305 99036 gene locus_tag LOCUS_11960 99305 99036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 99804 99271 gene locus_tag LOCUS_11970 99804 99271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11970 100209 99967 gene locus_tag LOCUS_11980 100209 99967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence12 255 545 gene locus_tag LOCUS_11990 255 545 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_11990 542 709 gene locus_tag LOCUS_12000 542 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1082 684 gene locus_tag LOCUS_12010 1082 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1289 3940 gene locus_tag LOCUS_12020 1289 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4059 4910 gene locus_tag LOCUS_12030 gene chbG 4059 4910 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593496.1 protein_id gnl|my_center|LOCUS_12030 5019 5510 gene locus_tag LOCUS_12040 5019 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5507 6136 gene locus_tag LOCUS_12050 5507 6136 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_12050 6133 6861 gene locus_tag LOCUS_12060 6133 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7256 6903 gene locus_tag LOCUS_12070 7256 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8110 7253 gene locus_tag LOCUS_12080 gene mca 8110 7253 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_12080 9322 8117 gene locus_tag LOCUS_12090 9322 8117 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_12090 10754 9525 gene locus_tag LOCUS_12100 10754 9525 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_12100 11613 10942 gene locus_tag LOCUS_12110 11613 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 12766 11675 gene locus_tag LOCUS_12120 12766 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13545 12763 gene locus_tag LOCUS_12130 gene nagB 13545 12763 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 protein_id gnl|my_center|LOCUS_12130 14375 13542 gene locus_tag LOCUS_12140 14375 13542 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894143.1 protein_id gnl|my_center|LOCUS_12140 15151 14372 gene locus_tag LOCUS_12150 15151 14372 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223492.1 protein_id gnl|my_center|LOCUS_12150 16356 15148 gene locus_tag LOCUS_12160 16356 15148 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798928.1 protein_id gnl|my_center|LOCUS_12160 17329 16358 gene locus_tag LOCUS_12170 17329 16358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768132.1 protein_id gnl|my_center|LOCUS_12170 18643 17429 gene locus_tag LOCUS_12180 18643 17429 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_12180 19953 18664 gene locus_tag LOCUS_12190 19953 18664 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_12190 21140 19950 gene locus_tag LOCUS_12200 21140 19950 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_12200 21257 22294 gene locus_tag LOCUS_12210 21257 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 25816 22322 gene locus_tag LOCUS_12220 25816 22322 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136193899.1 protein_id gnl|my_center|LOCUS_12220 25956 27440 gene locus_tag LOCUS_12230 25956 27440 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 protein_id gnl|my_center|LOCUS_12230 27476 28990 gene locus_tag LOCUS_12240 27476 28990 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_12240 29001 29510 gene locus_tag LOCUS_12250 29001 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 29580 30458 gene locus_tag LOCUS_12260 29580 30458 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_12260 30737 32026 gene locus_tag LOCUS_12270 30737 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 33514 32030 gene locus_tag LOCUS_12280 33514 32030 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900042.1 protein_id gnl|my_center|LOCUS_12280 34382 33573 gene locus_tag LOCUS_12290 34382 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 34885 34583 gene locus_tag LOCUS_12300 34885 34583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 35206 34961 gene locus_tag LOCUS_12310 35206 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 35341 36624 gene locus_tag LOCUS_12320 35341 36624 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_12320 36635 37486 gene locus_tag LOCUS_12330 36635 37486 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_12330 38633 37509 gene locus_tag LOCUS_12340 38633 37509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_12340 39870 38647 gene locus_tag LOCUS_12350 39870 38647 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_12350 40169 41143 gene locus_tag LOCUS_12360 40169 41143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 42303 41140 gene locus_tag LOCUS_12370 42303 41140 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_12370 43270 42374 gene locus_tag LOCUS_12380 43270 42374 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_12380 44085 43378 gene locus_tag LOCUS_12390 44085 43378 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_12390 46610 44130 gene locus_tag LOCUS_12400 46610 44130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 46718 47407 gene locus_tag LOCUS_12410 46718 47407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 47397 48140 gene locus_tag LOCUS_12420 47397 48140 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_12420 49739 48147 gene locus_tag LOCUS_12430 49739 48147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 50486 49755 gene locus_tag LOCUS_12440 50486 49755 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_12440 50522 51328 gene locus_tag LOCUS_12450 50522 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 52384 51338 gene locus_tag LOCUS_12460 52384 51338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 53334 52381 gene locus_tag LOCUS_12470 53334 52381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 55830 53452 gene locus_tag LOCUS_12480 55830 53452 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_12480 57365 55827 gene locus_tag LOCUS_12490 57365 55827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 59111 57438 gene locus_tag LOCUS_12500 59111 57438 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_12500 59284 59211 gene locus_tag LOCUS_t00140 59284 59211 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 60775 59333 gene locus_tag LOCUS_12510 60775 59333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 60705 61004 gene locus_tag LOCUS_12520 60705 61004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 61056 61934 gene locus_tag LOCUS_12530 61056 61934 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063715.1 protein_id gnl|my_center|LOCUS_12530 63136 61970 gene locus_tag LOCUS_12540 63136 61970 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_12540 63187 64368 gene locus_tag LOCUS_12550 63187 64368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 64538 64547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66422 64722 gene locus_tag LOCUS_12560 66422 64722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 67873 66539 gene locus_tag LOCUS_12570 67873 66539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 68814 67870 gene locus_tag LOCUS_12580 68814 67870 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456655.1 protein_id gnl|my_center|LOCUS_12580 70720 68894 gene locus_tag LOCUS_12590 70720 68894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 71808 70750 gene locus_tag LOCUS_12600 71808 70750 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859004.1 protein_id gnl|my_center|LOCUS_12600 72544 71831 gene locus_tag LOCUS_12610 72544 71831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_12610 73302 72541 gene locus_tag LOCUS_12620 73302 72541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_12620 73465 73392 gene locus_tag LOCUS_t00150 73465 73392 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 74825 73509 gene locus_tag LOCUS_12630 gene gltX 74825 73509 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_12630 75514 74819 gene locus_tag LOCUS_12640 75514 74819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 76043 75522 gene locus_tag LOCUS_12650 76043 75522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 77776 76106 gene locus_tag LOCUS_12660 gene cimA 77776 76106 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_12660 78782 77784 gene locus_tag LOCUS_12670 78782 77784 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 protein_id gnl|my_center|LOCUS_12670 78848 79327 gene locus_tag LOCUS_12680 gene greA 78848 79327 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_12680 79390 80811 gene locus_tag LOCUS_12690 gene leuC 79390 80811 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_12690 80831 81421 gene locus_tag LOCUS_12700 gene leuD 80831 81421 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_12700 82207 81440 gene locus_tag LOCUS_12710 82207 81440 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_12710 83327 82215 gene locus_tag LOCUS_12720 83327 82215 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729370.1 protein_id gnl|my_center|LOCUS_12720 83624 84790 gene locus_tag LOCUS_12730 83624 84790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 84910 85296 gene locus_tag LOCUS_12740 84910 85296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 85182 85191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 85239 86756 gene locus_tag LOCUS_12750 85239 86756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384572.1 protein_id gnl|my_center|LOCUS_12750 86824 87807 gene locus_tag LOCUS_12760 86824 87807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_12760 87800 88741 gene locus_tag LOCUS_12770 87800 88741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968090.1 protein_id gnl|my_center|LOCUS_12770 88738 89667 gene locus_tag LOCUS_12780 88738 89667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12780 89664 90590 gene locus_tag LOCUS_12790 89664 90590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12790 90587 92299 gene locus_tag LOCUS_12800 90587 92299 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 protein_id gnl|my_center|LOCUS_12800 92858 92334 gene locus_tag LOCUS_12810 92858 92334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 93373 92936 gene locus_tag LOCUS_12820 93373 92936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence13 1059 52 gene locus_tag LOCUS_12830 gene tsaD 1059 52 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_12830 1604 1056 gene locus_tag LOCUS_12840 gene rimI 1604 1056 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_12840 2380 1682 gene locus_tag LOCUS_12850 gene tsaB 2380 1682 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_12850 2941 2438 gene locus_tag LOCUS_12860 gene tsaE 2941 2438 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_12860 4195 2954 gene locus_tag LOCUS_12870 gene alr 4195 2954 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817433.1 protein_id gnl|my_center|LOCUS_12870 5646 4192 gene locus_tag LOCUS_12880 5646 4192 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 protein_id gnl|my_center|LOCUS_12880 6030 5662 gene locus_tag LOCUS_12890 6030 5662 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_12890 9750 6043 gene locus_tag LOCUS_12900 9750 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11233 9785 gene locus_tag LOCUS_12910 gene glmM 11233 9785 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_12910 11716 11324 gene locus_tag LOCUS_12920 gene rpsI 11716 11324 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_12920 12222 11776 gene locus_tag LOCUS_12930 gene rplM 12222 11776 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_12930 14061 12340 gene locus_tag LOCUS_12940 14061 12340 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_12940 14334 14930 gene locus_tag LOCUS_12950 14334 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 15035 15430 gene locus_tag LOCUS_12960 15035 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 15526 16383 gene locus_tag LOCUS_12970 gene truA 15526 16383 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_12970 16921 16469 gene locus_tag LOCUS_12980 16921 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 20239 17210 gene locus_tag LOCUS_12990 20239 17210 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_12990 20456 21073 gene locus_tag LOCUS_13000 20456 21073 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_13000 21145 22086 gene locus_tag LOCUS_13010 21145 22086 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_13010 22360 22136 gene locus_tag LOCUS_13020 22360 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 22763 23029 gene locus_tag LOCUS_13030 22763 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 23139 23432 gene locus_tag LOCUS_13040 23139 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 23501 23836 gene locus_tag LOCUS_13050 gene vapC26 23501 23836 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_13050 23977 24915 gene locus_tag LOCUS_13060 23977 24915 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_13060 25658 24957 gene locus_tag LOCUS_13070 25658 24957 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_13070 26032 25679 gene locus_tag LOCUS_13080 26032 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 27078 26035 gene locus_tag LOCUS_13090 27078 26035 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_13090 27725 27108 gene locus_tag LOCUS_13100 gene rpsD 27725 27108 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_13100 28122 27727 gene locus_tag LOCUS_13110 gene rpsK 28122 27727 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_13110 28525 28148 gene locus_tag LOCUS_13120 gene rpsM 28525 28148 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_13120 29324 28764 gene locus_tag LOCUS_13130 29324 28764 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055741.1 protein_id gnl|my_center|LOCUS_13130 30652 29324 gene locus_tag LOCUS_13140 gene secY 30652 29324 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_13140 31153 30662 gene locus_tag LOCUS_13150 gene rplO 31153 30662 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_13150 31409 31137 gene locus_tag LOCUS_13160 31409 31137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 32098 31406 gene locus_tag LOCUS_13170 gene rpsE 32098 31406 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_13170 32462 32109 gene locus_tag LOCUS_13180 gene rplR 32462 32109 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_13180 33040 32459 gene locus_tag LOCUS_13190 gene rplF 33040 32459 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_13190 33454 33050 gene locus_tag LOCUS_13200 gene rpsH 33454 33050 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_13200 33653 33468 gene locus_tag LOCUS_13210 33653 33468 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 protein_id gnl|my_center|LOCUS_13210 34322 33699 gene locus_tag LOCUS_13220 gene rplE 34322 33699 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_13220 34657 34319 gene locus_tag LOCUS_13230 gene rplX 34657 34319 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_13230 35039 34671 gene locus_tag LOCUS_13240 gene rplN 35039 34671 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_13240 35327 35058 gene locus_tag LOCUS_13250 gene rpsQ 35327 35058 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_13250 35680 35324 gene locus_tag LOCUS_13260 35680 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 36096 35680 gene locus_tag LOCUS_13270 gene rplP 36096 35680 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403592.1 protein_id gnl|my_center|LOCUS_13270 36983 36096 gene locus_tag LOCUS_13280 gene rpsC 36983 36096 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_13280 37618 36986 gene locus_tag LOCUS_13290 37618 36986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 38023 37745 gene locus_tag LOCUS_13300 gene rpsS 38023 37745 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_13300 38864 38028 gene locus_tag LOCUS_13310 gene rplB 38864 38028 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 protein_id gnl|my_center|LOCUS_13310 39165 38875 gene locus_tag LOCUS_13320 gene rplW 39165 38875 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_13320 39824 39162 gene locus_tag LOCUS_13330 gene rplD 39824 39162 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727671.1 protein_id gnl|my_center|LOCUS_13330 40510 39836 gene locus_tag LOCUS_13340 gene rplC 40510 39836 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 protein_id gnl|my_center|LOCUS_13340 41210 40752 gene locus_tag LOCUS_13350 41210 40752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 42337 41207 gene locus_tag LOCUS_13360 42337 41207 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_13360 44070 42361 gene locus_tag LOCUS_13370 44070 42361 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_13370 45032 44067 gene locus_tag LOCUS_13380 45032 44067 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_13380 46115 45090 gene locus_tag LOCUS_13390 46115 45090 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_13390 46377 47255 gene locus_tag LOCUS_13400 46377 47255 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_13400 47255 47734 gene locus_tag LOCUS_13410 47255 47734 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_13410 47786 50059 gene locus_tag LOCUS_13420 47786 50059 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_13420 50102 50353 gene locus_tag LOCUS_13430 50102 50353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 50767 50453 gene locus_tag LOCUS_13440 gene rpsJ 50767 50453 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_13440 51984 50800 gene locus_tag LOCUS_13450 gene tuf 51984 50800 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028672.1 protein_id gnl|my_center|LOCUS_13450 54257 52173 gene locus_tag LOCUS_13460 gene fusA 54257 52173 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_13460 54795 54325 gene locus_tag LOCUS_13470 gene rpsG 54795 54325 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_13470 55168 54797 gene locus_tag LOCUS_13480 gene rpsL 55168 54797 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_13480 59280 55339 gene locus_tag LOCUS_13490 59280 55339 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892756.1 protein_id gnl|my_center|LOCUS_13490 63033 59371 gene locus_tag LOCUS_13500 gene rpoB 63033 59371 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_13500 63679 63287 gene locus_tag LOCUS_13510 gene rplL 63679 63287 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112006.1 protein_id gnl|my_center|LOCUS_13510 64410 63676 gene locus_tag LOCUS_13520 64410 63676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 65394 64708 gene locus_tag LOCUS_13530 gene rplA 65394 64708 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_13530 65859 65407 gene locus_tag LOCUS_13540 gene rplK 65859 65407 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_13540 66675 65905 gene locus_tag LOCUS_13550 66675 65905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 67005 66697 gene locus_tag LOCUS_13560 gene secE 67005 66697 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 protein_id gnl|my_center|LOCUS_13560 67174 67100 gene locus_tag LOCUS_t00160 67174 67100 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 67375 67299 gene locus_tag LOCUS_t00170 67375 67299 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67511 67438 gene locus_tag LOCUS_t00180 67511 67438 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 67564 68109 gene locus_tag LOCUS_13570 67564 68109 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_13570 69053 68139 gene locus_tag LOCUS_13580 69053 68139 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_13580 69248 70126 gene locus_tag LOCUS_13590 69248 70126 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_13590 71561 70293 gene locus_tag LOCUS_13600 71561 70293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 72352 71705 gene locus_tag LOCUS_13610 72352 71705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064789.1 protein_id gnl|my_center|LOCUS_13610 73815 72436 gene locus_tag LOCUS_13620 gene glnT 73815 72436 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_13620 74001 74900 gene locus_tag LOCUS_13630 74001 74900 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 protein_id gnl|my_center|LOCUS_13630 74909 75628 gene locus_tag LOCUS_13640 74909 75628 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_13640 75625 77010 gene locus_tag LOCUS_13650 75625 77010 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_13650 78465 77053 gene locus_tag LOCUS_13660 78465 77053 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_13660 78565 78795 gene locus_tag LOCUS_13670 78565 78795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 protein_id gnl|my_center|LOCUS_13670 79210 79653 gene locus_tag LOCUS_13680 79210 79653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 81448 79673 gene locus_tag LOCUS_13690 81448 79673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 82722 81445 gene locus_tag LOCUS_13700 82722 81445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 83093 82719 gene locus_tag LOCUS_13710 83093 82719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 83371 83090 gene locus_tag LOCUS_13720 83371 83090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 85732 83492 gene locus_tag LOCUS_13730 85732 83492 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_13730 86376 86759 gene locus_tag LOCUS_13740 86376 86759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 87575 86799 gene locus_tag LOCUS_13750 87575 86799 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_13750 87659 89320 gene locus_tag LOCUS_13760 87659 89320 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_13760 89934 89359 gene locus_tag LOCUS_13770 89934 89359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 90786 90013 gene locus_tag LOCUS_13780 90786 90013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 91219 91025 gene locus_tag LOCUS_13790 91219 91025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 91236 91763 gene locus_tag LOCUS_13800 91236 91763 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950627.1 protein_id gnl|my_center|LOCUS_13800 92063 91776 gene locus_tag LOCUS_13810 92063 91776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 92948 92094 gene locus_tag LOCUS_13820 92948 92094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence14 479 928 gene locus_tag LOCUS_13830 479 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 925 1413 gene locus_tag LOCUS_13840 925 1413 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807630.1 protein_id gnl|my_center|LOCUS_13840 1410 3773 gene locus_tag LOCUS_13850 1410 3773 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_13850 5212 3806 gene locus_tag LOCUS_13860 5212 3806 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_13860 6517 5216 gene locus_tag LOCUS_13870 6517 5216 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 protein_id gnl|my_center|LOCUS_13870 6655 7497 gene locus_tag LOCUS_13880 6655 7497 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_13880 8190 7576 gene locus_tag LOCUS_13890 8190 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8277 9242 gene locus_tag LOCUS_13900 8277 9242 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_13900 9242 10258 gene locus_tag LOCUS_13910 9242 10258 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067686.1 protein_id gnl|my_center|LOCUS_13910 10251 11090 gene locus_tag LOCUS_13920 10251 11090 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_13920 11226 11141 gene locus_tag LOCUS_t00190 11226 11141 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12146 11307 gene locus_tag LOCUS_13930 12146 11307 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_13930 12413 12186 gene locus_tag LOCUS_13940 12413 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 14055 12469 gene locus_tag LOCUS_13950 14055 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 15075 14122 gene locus_tag LOCUS_13960 15075 14122 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_13960 16336 15185 gene locus_tag LOCUS_13970 16336 15185 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259104.1 protein_id gnl|my_center|LOCUS_13970 16762 16382 gene locus_tag LOCUS_13980 16762 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 17028 17636 gene locus_tag LOCUS_13990 17028 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 17850 18905 gene locus_tag LOCUS_14000 17850 18905 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899402.1 protein_id gnl|my_center|LOCUS_14000 20507 18912 gene locus_tag LOCUS_14010 20507 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 20903 20514 gene locus_tag LOCUS_14020 20903 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 21181 20903 gene locus_tag LOCUS_14030 21181 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 22042 21269 gene locus_tag LOCUS_14040 gene tpiA 22042 21269 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_14040 23280 22063 gene locus_tag LOCUS_14050 23280 22063 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_14050 24323 23313 gene locus_tag LOCUS_14060 gene gap 24323 23313 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_14060 25327 24413 gene locus_tag LOCUS_14070 gene rapZ 25327 24413 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_14070 27237 25363 gene locus_tag LOCUS_14080 gene uvrC 27237 25363 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_14080 27402 27737 gene locus_tag LOCUS_14090 27402 27737 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_14090 27746 28918 gene locus_tag LOCUS_14100 27746 28918 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_14100 28915 29343 gene locus_tag LOCUS_14110 28915 29343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176702.1 protein_id gnl|my_center|LOCUS_14110 29357 30625 gene locus_tag LOCUS_14120 29357 30625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_14120 30622 32877 gene locus_tag LOCUS_14130 30622 32877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 33456 32878 gene locus_tag LOCUS_14140 33456 32878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 36349 33497 gene locus_tag LOCUS_14150 gene uvrA 36349 33497 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_14150 36480 37571 gene locus_tag LOCUS_14160 36480 37571 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_14160 39535 37568 gene locus_tag LOCUS_14170 gene uvrB 39535 37568 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_14170 39931 40467 gene locus_tag LOCUS_14180 39931 40467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 41095 40472 gene locus_tag LOCUS_14190 41095 40472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 42711 41161 gene locus_tag LOCUS_14200 gene rpsA 42711 41161 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_14200 45527 42792 gene locus_tag LOCUS_14210 gene polA 45527 42792 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_14210 46172 45597 gene locus_tag LOCUS_14220 46172 45597 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408045.1 protein_id gnl|my_center|LOCUS_14220 46336 46253 gene locus_tag LOCUS_t00200 46336 46253 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46544 47728 gene locus_tag LOCUS_14230 gene fabD 46544 47728 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_14230 47758 48723 gene locus_tag LOCUS_14240 47758 48723 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_14240 48749 49483 gene locus_tag LOCUS_14250 gene fabG 48749 49483 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_14250 49650 49883 gene locus_tag LOCUS_14260 49650 49883 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259257.1 protein_id gnl|my_center|LOCUS_14260 49894 51069 gene locus_tag LOCUS_14270 gene fabF 49894 51069 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_14270 52250 51084 gene locus_tag LOCUS_14280 52250 51084 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_14280 52673 53665 gene locus_tag LOCUS_14290 52673 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 56112 53671 gene locus_tag LOCUS_14300 56112 53671 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_14300 56284 56751 gene locus_tag LOCUS_14310 56284 56751 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_14310 57145 56777 gene locus_tag LOCUS_14320 57145 56777 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230896.1 protein_id gnl|my_center|LOCUS_14320 57949 57161 gene locus_tag LOCUS_14330 57949 57161 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_14330 58295 57972 gene locus_tag LOCUS_14340 58295 57972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 58795 58346 gene locus_tag LOCUS_14350 58795 58346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 59126 58833 gene locus_tag LOCUS_14360 59126 58833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 59870 59133 gene locus_tag LOCUS_14370 59870 59133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 61780 59894 gene locus_tag LOCUS_14380 61780 59894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 62681 61794 gene locus_tag LOCUS_14390 62681 61794 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533158.1 protein_id gnl|my_center|LOCUS_14390 63451 62678 gene locus_tag LOCUS_14400 63451 62678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_14400 64701 63472 gene locus_tag LOCUS_14410 64701 63472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 64805 66109 gene locus_tag LOCUS_14420 gene glnA 64805 66109 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122880.1 protein_id gnl|my_center|LOCUS_14420 67510 66128 gene locus_tag LOCUS_14430 67510 66128 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414579.1 protein_id gnl|my_center|LOCUS_14430 67626 68921 gene locus_tag LOCUS_14440 67626 68921 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_14440 68926 70218 gene locus_tag LOCUS_14450 gene cyp124 68926 70218 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_14450 70215 70913 gene locus_tag LOCUS_14460 70215 70913 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_14460 71490 71188 gene locus_tag LOCUS_14470 71490 71188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 71893 73002 gene locus_tag LOCUS_14480 71893 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 73155 73622 gene locus_tag LOCUS_14490 73155 73622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 74649 73765 gene locus_tag LOCUS_14500 74649 73765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_14500 74809 75603 gene locus_tag LOCUS_14510 74809 75603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_14510 75737 76357 gene locus_tag LOCUS_14520 75737 76357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 76477 76737 gene locus_tag LOCUS_14530 76477 76737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence15 674 12 gene locus_tag LOCUS_14540 674 12 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_14540 749 1972 gene locus_tag LOCUS_14550 749 1972 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_14550 3357 2014 gene locus_tag LOCUS_14560 3357 2014 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_14560 3302 4513 gene locus_tag LOCUS_14570 3302 4513 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_14570 4580 5416 gene locus_tag LOCUS_14580 4580 5416 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_14580 6269 5439 gene locus_tag LOCUS_14590 6269 5439 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_14590 7478 6387 gene locus_tag LOCUS_14600 7478 6387 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_14600 7605 8402 gene locus_tag LOCUS_14610 7605 8402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_14610 8407 9342 gene locus_tag LOCUS_14620 8407 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9404 10327 gene locus_tag LOCUS_14630 9404 10327 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040427.1 protein_id gnl|my_center|LOCUS_14630 10449 11480 gene locus_tag LOCUS_14640 10449 11480 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742137.1 protein_id gnl|my_center|LOCUS_14640 12525 11521 gene locus_tag LOCUS_14650 gene iolG 12525 11521 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_14650 14453 12522 gene locus_tag LOCUS_14660 gene iolD 14453 12522 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_14660 15747 14518 gene locus_tag LOCUS_14670 15747 14518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_14670 16532 15756 gene locus_tag LOCUS_14680 16532 15756 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_14680 18823 16529 gene locus_tag LOCUS_14690 18823 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 19854 18832 gene locus_tag LOCUS_14700 19854 18832 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_14700 20809 19916 gene locus_tag LOCUS_14710 20809 19916 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_14710 21949 20996 gene locus_tag LOCUS_14720 21949 20996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_14720 22075 23313 gene locus_tag LOCUS_14730 22075 23313 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_14730 25740 23341 gene locus_tag LOCUS_14740 25740 23341 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_14740 26388 25756 gene locus_tag LOCUS_14750 26388 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 26601 28214 gene locus_tag LOCUS_14760 26601 28214 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_14760 28222 28896 gene locus_tag LOCUS_14770 28222 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_14770 28989 29852 gene locus_tag LOCUS_14780 gene dapA 28989 29852 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_14780 29987 31588 gene locus_tag LOCUS_14790 29987 31588 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_14790 32859 31627 gene locus_tag LOCUS_14800 32859 31627 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_14800 33639 32863 gene locus_tag LOCUS_14810 gene dapB 33639 32863 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_14810 36235 33713 gene locus_tag LOCUS_14820 36235 33713 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_14820 36460 36269 gene locus_tag LOCUS_14830 36460 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 37671 36727 gene locus_tag LOCUS_14840 gene ribF 37671 36727 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_14840 38572 37709 gene locus_tag LOCUS_14850 gene truB 38572 37709 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_14850 38973 38578 gene locus_tag LOCUS_14860 38973 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 40725 38989 gene locus_tag LOCUS_14870 40725 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 40970 40710 gene locus_tag LOCUS_14880 40970 40710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 40860 41318 gene locus_tag LOCUS_14890 40860 41318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 43233 41974 gene locus_tag LOCUS_14900 gene nusA 43233 41974 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_14900 43892 43230 gene locus_tag LOCUS_14910 43892 43230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 45220 44009 gene locus_tag LOCUS_14920 gene ispG 45220 44009 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_14920 46475 45234 gene locus_tag LOCUS_14930 46475 45234 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_14930 47626 46472 gene locus_tag LOCUS_14940 47626 46472 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_14940 49070 47631 gene locus_tag LOCUS_14950 49070 47631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 49657 49091 gene locus_tag LOCUS_14960 gene frr 49657 49091 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_14960 50471 49701 gene locus_tag LOCUS_14970 gene pyrH 50471 49701 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_14970 51286 50480 gene locus_tag LOCUS_14980 gene tsf 51286 50480 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_14980 52352 51288 gene locus_tag LOCUS_14990 52352 51288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 53037 52543 gene locus_tag LOCUS_15000 53037 52543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 54101 53121 gene locus_tag LOCUS_15010 54101 53121 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_15010 55289 54117 gene locus_tag LOCUS_15020 gene dprA 55289 54117 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_15020 56812 55286 gene locus_tag LOCUS_15030 56812 55286 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_15030 56914 57168 gene locus_tag LOCUS_15040 56914 57168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 57744 57400 gene locus_tag LOCUS_15050 57744 57400 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_15050 58032 57772 gene locus_tag LOCUS_15060 58032 57772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 57967 58164 gene locus_tag LOCUS_15070 57967 58164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 58971 58168 gene locus_tag LOCUS_15080 gene trmD 58971 58168 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_15080 59458 58949 gene locus_tag LOCUS_15090 gene rimM 59458 58949 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_15090 59752 59480 gene locus_tag LOCUS_15100 59752 59480 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_15100 60219 59749 gene locus_tag LOCUS_15110 60219 59749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 61842 60361 gene locus_tag LOCUS_15120 gene ffh 61842 60361 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_15120 62958 61846 gene locus_tag LOCUS_15130 gene ftsY 62958 61846 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_15130 66125 62970 gene locus_tag LOCUS_15140 66125 62970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 66983 66153 gene locus_tag LOCUS_15150 66983 66153 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 protein_id gnl|my_center|LOCUS_15150 67740 66976 gene locus_tag LOCUS_15160 gene rnc 67740 66976 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_15160 68041 67742 gene locus_tag LOCUS_15170 68041 67742 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081111.1 protein_id gnl|my_center|LOCUS_15170 69038 68046 gene locus_tag LOCUS_15180 gene plsX 69038 68046 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124312.1 protein_id gnl|my_center|LOCUS_15180 69900 69340 gene locus_tag LOCUS_15190 69900 69340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 70670 69897 gene locus_tag LOCUS_15200 70670 69897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 71158 70667 gene locus_tag LOCUS_15210 gene coaD 71158 70667 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_15210 71472 71269 gene locus_tag LOCUS_15220 71472 71269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 71551 72168 gene locus_tag LOCUS_15230 71551 72168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 72187 72762 gene locus_tag LOCUS_15240 gene rsmD 72187 72762 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_15240 73246 72788 gene locus_tag LOCUS_15250 73246 72788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 73358 76564 gene locus_tag LOCUS_15260 73358 76564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence16 1259 279 gene locus_tag LOCUS_15270 1259 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2815 1550 gene locus_tag LOCUS_15280 2815 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5641 3191 gene locus_tag LOCUS_15290 5641 3191 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_15290 5921 5712 gene locus_tag LOCUS_15300 5921 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6042 6806 gene locus_tag LOCUS_15310 6042 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6828 7658 gene locus_tag LOCUS_15320 6828 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 8437 7655 gene locus_tag LOCUS_15330 8437 7655 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038823.1 protein_id gnl|my_center|LOCUS_15330 8564 9583 gene locus_tag LOCUS_15340 8564 9583 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_15340 11177 9633 gene locus_tag LOCUS_15350 11177 9633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_15350 12161 11337 gene locus_tag LOCUS_15360 12161 11337 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_15360 13283 12189 gene locus_tag LOCUS_15370 13283 12189 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_15370 14723 13371 gene locus_tag LOCUS_15380 14723 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 17008 14783 gene locus_tag LOCUS_15390 17008 14783 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_15390 17134 17442 gene locus_tag LOCUS_15400 17134 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 17469 18362 gene locus_tag LOCUS_15410 17469 18362 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_15410 18449 19567 gene locus_tag LOCUS_15420 18449 19567 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_15420 19595 19879 gene locus_tag LOCUS_15430 19595 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 19890 20339 gene locus_tag LOCUS_15440 19890 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 20867 20505 gene locus_tag LOCUS_15450 20867 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 21154 20864 gene locus_tag LOCUS_15460 21154 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 21434 21156 gene locus_tag LOCUS_15470 21434 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 21674 21447 gene locus_tag LOCUS_15480 21674 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 21937 21686 gene locus_tag LOCUS_15490 21937 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 22532 21948 gene locus_tag LOCUS_15500 22532 21948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 23491 22532 gene locus_tag LOCUS_15510 23491 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 25902 23491 gene locus_tag LOCUS_15520 25902 23491 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_15520 26434 25871 gene locus_tag LOCUS_15530 26434 25871 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_15530 27311 26436 gene locus_tag LOCUS_15540 27311 26436 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_15540 27569 27315 gene locus_tag LOCUS_15550 27569 27315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 27717 28223 gene locus_tag LOCUS_15560 27717 28223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 29690 28242 gene locus_tag LOCUS_15570 29690 28242 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_15570 29915 31015 gene locus_tag LOCUS_15580 29915 31015 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_15580 31012 31800 gene locus_tag LOCUS_15590 31012 31800 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_15590 32573 32214 gene locus_tag LOCUS_15600 32573 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 32669 33169 gene locus_tag LOCUS_15610 32669 33169 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_15610 33151 33315 gene locus_tag LOCUS_15620 33151 33315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 34737 33388 gene locus_tag LOCUS_15630 34737 33388 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788087.1 protein_id gnl|my_center|LOCUS_15630 34890 36617 gene locus_tag LOCUS_15640 34890 36617 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567362.1 protein_id gnl|my_center|LOCUS_15640 36786 37841 gene locus_tag LOCUS_15650 36786 37841 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_15650 37876 38148 gene locus_tag LOCUS_15660 37876 38148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 38145 38360 gene locus_tag LOCUS_15670 38145 38360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 38466 42635 gene locus_tag LOCUS_15680 38466 42635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 42995 42654 gene locus_tag LOCUS_15690 42995 42654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 43434 43099 gene locus_tag LOCUS_15700 43434 43099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 43641 43934 gene locus_tag LOCUS_15710 43641 43934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 43927 44184 gene locus_tag LOCUS_15720 43927 44184 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_15720 44156 45394 gene locus_tag LOCUS_15730 44156 45394 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_15730 45430 46629 gene locus_tag LOCUS_15740 45430 46629 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_15740 48373 46691 gene locus_tag LOCUS_15750 48373 46691 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810780.1 protein_id gnl|my_center|LOCUS_15750 49073 48489 gene locus_tag LOCUS_15760 49073 48489 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_15760 49724 49140 gene locus_tag LOCUS_15770 49724 49140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 50637 49786 gene locus_tag LOCUS_15780 50637 49786 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_15780 52284 50674 gene locus_tag LOCUS_15790 52284 50674 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_15790 52366 53403 gene locus_tag LOCUS_15800 52366 53403 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_15800 53475 54623 gene locus_tag LOCUS_15810 53475 54623 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_15810 55312 54758 gene locus_tag LOCUS_15820 55312 54758 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_15820 57148 55565 gene locus_tag LOCUS_15830 57148 55565 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324066.1 protein_id gnl|my_center|LOCUS_15830 59643 57145 gene locus_tag LOCUS_15840 59643 57145 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_15840 62274 59794 gene locus_tag LOCUS_15850 62274 59794 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_15850 63625 62387 gene locus_tag LOCUS_15860 gene lldD 63625 62387 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 protein_id gnl|my_center|LOCUS_15860 63650 64939 gene locus_tag LOCUS_15870 63650 64939 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_15870 66188 64989 gene locus_tag LOCUS_15880 66188 64989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 66521 66850 gene locus_tag LOCUS_15890 66521 66850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence17 183 37 gene locus_tag LOCUS_15900 183 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1733 207 gene locus_tag LOCUS_15910 gene hpaB 1733 207 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095447.1 protein_id gnl|my_center|LOCUS_15910 2810 1983 gene locus_tag LOCUS_15920 2810 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3419 2889 gene locus_tag LOCUS_15930 3419 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4840 3467 gene locus_tag LOCUS_15940 4840 3467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_15940 6003 5176 gene locus_tag LOCUS_15950 6003 5176 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_15950 7554 6067 gene locus_tag LOCUS_15960 7554 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8576 7554 gene locus_tag LOCUS_15970 8576 7554 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_15970 9424 8573 gene locus_tag LOCUS_15980 9424 8573 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_15980 9909 9499 gene locus_tag LOCUS_15990 9909 9499 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_15990 13645 9965 gene locus_tag LOCUS_16000 13645 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 16283 13698 gene locus_tag LOCUS_16010 16283 13698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_16010 18884 16302 gene locus_tag LOCUS_16020 18884 16302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_16020 19634 18888 gene locus_tag LOCUS_16030 19634 18888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_16030 19931 20647 gene locus_tag LOCUS_16040 19931 20647 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_16040 21640 20654 gene locus_tag LOCUS_16050 21640 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 21837 22709 gene locus_tag LOCUS_16060 21837 22709 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_16060 22702 23190 gene locus_tag LOCUS_16070 22702 23190 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_16070 23180 25558 gene locus_tag LOCUS_16080 23180 25558 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086134.1 protein_id gnl|my_center|LOCUS_16080 25555 27012 gene locus_tag LOCUS_16090 25555 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 27024 27365 gene locus_tag LOCUS_16100 27024 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 27371 28231 gene locus_tag LOCUS_16110 27371 28231 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495971.1 protein_id gnl|my_center|LOCUS_16110 28228 29157 gene locus_tag LOCUS_16120 28228 29157 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731606.1 protein_id gnl|my_center|LOCUS_16120 29154 29954 gene locus_tag LOCUS_16130 29154 29954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 29944 30678 gene locus_tag LOCUS_16140 29944 30678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898300.1 protein_id gnl|my_center|LOCUS_16140 30708 32048 gene locus_tag LOCUS_16150 30708 32048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199255502.1 protein_id gnl|my_center|LOCUS_16150 32267 33706 gene locus_tag LOCUS_16160 32267 33706 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_16160 33716 34426 gene locus_tag LOCUS_16170 33716 34426 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969980.1 protein_id gnl|my_center|LOCUS_16170 34423 35088 gene locus_tag LOCUS_16180 34423 35088 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_16180 35183 36436 gene locus_tag LOCUS_16190 35183 36436 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967499.1 protein_id gnl|my_center|LOCUS_16190 36985 36638 gene locus_tag LOCUS_16200 36985 36638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 37480 37001 gene locus_tag LOCUS_16210 37480 37001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 42420 37528 gene locus_tag LOCUS_16220 42420 37528 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_16220 42952 42749 gene locus_tag LOCUS_16230 42952 42749 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015000940.1 protein_id gnl|my_center|LOCUS_16230 45239 42945 gene locus_tag LOCUS_16240 45239 42945 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_16240 46710 45256 gene locus_tag LOCUS_16250 gene lnt 46710 45256 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 protein_id gnl|my_center|LOCUS_16250 48320 46707 gene locus_tag LOCUS_16260 gene hemG 48320 46707 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_16260 49487 48393 gene locus_tag LOCUS_16270 gene hemE 49487 48393 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_16270 49659 51008 gene locus_tag LOCUS_16280 49659 51008 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_16280 51008 51790 gene locus_tag LOCUS_16290 51008 51790 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_16290 51780 52805 gene locus_tag LOCUS_16300 51780 52805 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_16300 53415 52786 gene locus_tag LOCUS_16310 53415 52786 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_16310 53843 53412 gene locus_tag LOCUS_16320 53843 53412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 54448 53945 gene locus_tag LOCUS_16330 54448 53945 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_16330 54952 54503 gene locus_tag LOCUS_16340 54952 54503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 55001 55864 gene locus_tag LOCUS_16350 55001 55864 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411060.1 protein_id gnl|my_center|LOCUS_16350 58244 55899 gene locus_tag LOCUS_16360 58244 55899 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_16360 58756 58241 gene locus_tag LOCUS_16370 58756 58241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 59568 58753 gene locus_tag LOCUS_16380 gene larE 59568 58753 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_16380 61457 59613 gene locus_tag LOCUS_16390 61457 59613 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_16390 61797 62999 gene locus_tag LOCUS_16400 61797 62999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 62996 64006 gene locus_tag LOCUS_16410 62996 64006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_16410 65554 64067 gene locus_tag LOCUS_16420 65554 64067 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234063.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence18 41 208 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggcagacccttagggaatggtcggctgccaaaac 1242 214 gene locus_tag LOCUS_16430 gene mltG 1242 214 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_16430 2041 1625 gene locus_tag LOCUS_16440 gene ruvX 2041 1625 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_16440 4671 2059 gene locus_tag LOCUS_16450 gene alaS 4671 2059 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_16450 5065 4763 gene locus_tag LOCUS_16460 5065 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 5450 5067 gene locus_tag LOCUS_16470 5450 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 7321 5447 gene locus_tag LOCUS_16480 gene aspS 7321 5447 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_16480 8553 7321 gene locus_tag LOCUS_16490 gene hisS 8553 7321 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_16490 11046 8740 gene locus_tag LOCUS_16500 gene relA 11046 8740 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_16500 12262 11153 gene locus_tag LOCUS_16510 gene secF 12262 11153 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_16510 13722 12259 gene locus_tag LOCUS_16520 gene secD 13722 12259 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869961.1 protein_id gnl|my_center|LOCUS_16520 14088 13768 gene locus_tag LOCUS_16530 gene yajC 14088 13768 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_16530 15393 14155 gene locus_tag LOCUS_16540 gene tgt 15393 14155 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971793.1 protein_id gnl|my_center|LOCUS_16540 16588 15404 gene locus_tag LOCUS_16550 gene queA 16588 15404 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280526.1 protein_id gnl|my_center|LOCUS_16550 17778 16582 gene locus_tag LOCUS_16560 gene ruvB 17778 16582 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093599.1 protein_id gnl|my_center|LOCUS_16560 18392 17775 gene locus_tag LOCUS_16570 gene ruvA 18392 17775 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_16570 18949 18389 gene locus_tag LOCUS_16580 gene ruvC 18949 18389 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_16580 19794 19009 gene locus_tag LOCUS_16590 19794 19009 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_16590 20502 19861 gene locus_tag LOCUS_16600 gene pdxT 20502 19861 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_16600 21384 20524 gene locus_tag LOCUS_16610 gene pdxS 21384 20524 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_16610 22287 21472 gene locus_tag LOCUS_16620 22287 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 23446 22361 gene locus_tag LOCUS_16630 23446 22361 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_16630 24498 23599 gene locus_tag LOCUS_16640 24498 23599 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_16640 25160 24567 gene locus_tag LOCUS_16650 25160 24567 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 protein_id gnl|my_center|LOCUS_16650 25738 25163 gene locus_tag LOCUS_16660 25738 25163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 26889 25771 gene locus_tag LOCUS_16670 gene cysS 26889 25771 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_16670 27786 26944 gene locus_tag LOCUS_16680 27786 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 27949 28728 gene locus_tag LOCUS_16690 gene fabI 27949 28728 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_16690 30382 28772 gene locus_tag LOCUS_16700 gene lysS 30382 28772 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_16700 31568 30444 gene locus_tag LOCUS_16710 31568 30444 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_16710 32985 31639 gene locus_tag LOCUS_16720 32985 31639 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877770.1 protein_id gnl|my_center|LOCUS_16720 33066 35006 gene locus_tag LOCUS_16730 33066 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 35000 37207 gene locus_tag LOCUS_16740 35000 37207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16740 37280 38059 gene locus_tag LOCUS_16750 37280 38059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415944.1 protein_id gnl|my_center|LOCUS_16750 38140 38613 gene locus_tag LOCUS_16760 38140 38613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 38620 39327 gene locus_tag LOCUS_16770 38620 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 40693 39299 gene locus_tag LOCUS_16780 40693 39299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 42043 40766 gene locus_tag LOCUS_16790 42043 40766 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_16790 42563 42102 gene locus_tag LOCUS_16800 42563 42102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 43503 42556 gene locus_tag LOCUS_16810 43503 42556 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_16810 44413 43532 gene locus_tag LOCUS_16820 44413 43532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 45036 44410 gene locus_tag LOCUS_16830 gene coaE 45036 44410 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_16830 45874 45095 gene locus_tag LOCUS_16840 45874 45095 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726856.1 protein_id gnl|my_center|LOCUS_16840 45973 48078 gene locus_tag LOCUS_16850 45973 48078 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_16850 48203 48589 gene locus_tag LOCUS_16860 48203 48589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 50263 48605 gene locus_tag LOCUS_16870 50263 48605 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_16870 51425 50292 gene locus_tag LOCUS_16880 51425 50292 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_16880 52638 51571 gene locus_tag LOCUS_16890 52638 51571 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_16890 53914 52712 gene locus_tag LOCUS_16900 53914 52712 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_16900 57832 54056 gene locus_tag LOCUS_16910 57832 54056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 60697 57848 gene locus_tag LOCUS_16920 60697 57848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 60579 60788 gene locus_tag LOCUS_16930 60579 60788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 61017 60941 gene locus_tag LOCUS_t00210 61017 60941 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 61167 61096 gene locus_tag LOCUS_t00220 61167 61096 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 61406 62575 gene locus_tag LOCUS_16940 61406 62575 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027167.1 protein_id gnl|my_center|LOCUS_16940 62685 63923 gene locus_tag LOCUS_16950 62685 63923 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_16950 63920 64129 gene locus_tag LOCUS_16960 63920 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 64143 64367 gene locus_tag LOCUS_16970 64143 64367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 64442 64518 gene locus_tag LOCUS_t00230 64442 64518 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64544 65503 gene locus_tag LOCUS_16980 64544 65503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence19 965 1312 gene locus_tag LOCUS_16990 965 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1385 2530 gene locus_tag LOCUS_17000 1385 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2634 3566 gene locus_tag LOCUS_17010 2634 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3563 4840 gene locus_tag LOCUS_17020 3563 4840 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156528645.1 protein_id gnl|my_center|LOCUS_17020 4847 5740 gene locus_tag LOCUS_17030 4847 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5737 6567 gene locus_tag LOCUS_17040 5737 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 6564 7061 gene locus_tag LOCUS_17050 6564 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 7689 7108 gene locus_tag LOCUS_17060 7689 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 8060 7803 gene locus_tag LOCUS_17070 8060 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 7966 8640 gene locus_tag LOCUS_17080 7966 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8653 9639 gene locus_tag LOCUS_17090 8653 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9636 10136 gene locus_tag LOCUS_17100 9636 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 10193 10657 gene locus_tag LOCUS_17110 10193 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 11121 10720 gene locus_tag LOCUS_17120 11121 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 11755 11156 gene locus_tag LOCUS_17130 gene raiA 11755 11156 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583763.1 protein_id gnl|my_center|LOCUS_17130 12468 11821 gene locus_tag LOCUS_17140 12468 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 14003 12537 gene locus_tag LOCUS_17150 gene ahcY 14003 12537 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_17150 15131 14040 gene locus_tag LOCUS_17160 15131 14040 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_17160 15430 15128 gene locus_tag LOCUS_17170 15430 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 16686 15427 gene locus_tag LOCUS_17180 16686 15427 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_17180 17219 18496 gene locus_tag LOCUS_17190 17219 18496 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_17190 21825 18487 gene locus_tag LOCUS_17200 21825 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 21959 23893 gene locus_tag LOCUS_17210 gene ftsH 21959 23893 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_17210 24309 23890 gene locus_tag LOCUS_17220 24309 23890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 25981 24317 gene locus_tag LOCUS_17230 25981 24317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 29244 25978 gene locus_tag LOCUS_17240 29244 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 31451 29271 gene locus_tag LOCUS_17250 31451 29271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 32560 31580 gene locus_tag LOCUS_17260 gene gmd 32560 31580 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_17260 32709 34328 gene locus_tag LOCUS_17270 32709 34328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 34325 35296 gene locus_tag LOCUS_17280 gene cofD 34325 35296 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_17280 35293 36003 gene locus_tag LOCUS_17290 gene cofE 35293 36003 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_17290 37046 36000 gene locus_tag LOCUS_17300 37046 36000 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_17300 37867 37043 gene locus_tag LOCUS_17310 37867 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 39302 37929 gene locus_tag LOCUS_17320 39302 37929 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_17320 40897 39299 gene locus_tag LOCUS_17330 40897 39299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 42261 40894 gene locus_tag LOCUS_17340 42261 40894 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_17340 43488 42325 gene locus_tag LOCUS_17350 gene moeB 43488 42325 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_17350 44326 43583 gene locus_tag LOCUS_17360 44326 43583 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_17360 44554 45282 gene locus_tag LOCUS_17370 44554 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 46786 45290 gene locus_tag LOCUS_17380 46786 45290 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775677.1 protein_id gnl|my_center|LOCUS_17380 47809 46913 gene locus_tag LOCUS_17390 47809 46913 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_17390 47891 49669 gene locus_tag LOCUS_17400 gene accC 47891 49669 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_17400 50695 49709 gene locus_tag LOCUS_17410 50695 49709 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_17410 50786 50795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51739 50939 gene locus_tag LOCUS_17420 51739 50939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 52644 51736 gene locus_tag LOCUS_17430 52644 51736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_17430 53708 52770 gene locus_tag LOCUS_17440 53708 52770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_17440 54170 54261 gene locus_tag LOCUS_t00240 54170 54261 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 56093 54708 gene locus_tag LOCUS_17450 56093 54708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 56211 57035 gene locus_tag LOCUS_17460 56211 57035 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_17460 57908 57057 gene locus_tag LOCUS_17470 57908 57057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence20 1960 749 gene locus_tag LOCUS_17480 1960 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3263 2109 gene locus_tag LOCUS_17490 3263 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3492 4505 gene locus_tag LOCUS_17500 3492 4505 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_17500 4505 5134 gene locus_tag LOCUS_17510 4505 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5348 5420 gene locus_tag LOCUS_t00250 5348 5420 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6776 5457 gene locus_tag LOCUS_17520 6776 5457 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776597.1 protein_id gnl|my_center|LOCUS_17520 7521 6787 gene locus_tag LOCUS_17530 gene tmk 7521 6787 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776596.1 protein_id gnl|my_center|LOCUS_17530 8996 7518 gene locus_tag LOCUS_17540 8996 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 11850 9049 gene locus_tag LOCUS_17550 gene topA 11850 9049 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_17550 12856 11960 gene locus_tag LOCUS_17560 12856 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 13067 13447 gene locus_tag LOCUS_17570 13067 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 13835 14035 gene locus_tag LOCUS_17580 13835 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 14046 14321 gene locus_tag LOCUS_17590 14046 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_17590 14362 14598 gene locus_tag LOCUS_17600 14362 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 16478 15105 gene locus_tag LOCUS_17610 16478 15105 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_17610 18226 16670 gene locus_tag LOCUS_17620 gene betC 18226 16670 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_17620 18380 20080 gene locus_tag LOCUS_17630 gene betA 18380 20080 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_17630 20731 20093 gene locus_tag LOCUS_17640 20731 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 22251 20815 gene locus_tag LOCUS_17650 22251 20815 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_17650 24868 22145 gene locus_tag LOCUS_17660 24868 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 25075 25392 gene locus_tag LOCUS_17670 25075 25392 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388057.1 protein_id gnl|my_center|LOCUS_17670 25455 26264 gene locus_tag LOCUS_17680 25455 26264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 26312 26623 gene locus_tag LOCUS_17690 26312 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 26623 27021 gene locus_tag LOCUS_17700 26623 27021 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_17700 29197 27089 gene locus_tag LOCUS_17710 29197 27089 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_17710 30674 29307 gene locus_tag LOCUS_17720 gene nhaA 30674 29307 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_17720 31117 30752 gene locus_tag LOCUS_17730 31117 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 32284 31178 gene locus_tag LOCUS_17740 32284 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 32455 33162 gene locus_tag LOCUS_17750 32455 33162 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 protein_id gnl|my_center|LOCUS_17750 35215 33182 gene locus_tag LOCUS_17760 35215 33182 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_17760 36853 35315 gene locus_tag LOCUS_17770 36853 35315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_17770 37057 38304 gene locus_tag LOCUS_17780 37057 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 38470 39309 gene locus_tag LOCUS_17790 38470 39309 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_17790 39368 41281 gene locus_tag LOCUS_17800 39368 41281 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_17800 41278 42078 gene locus_tag LOCUS_17810 41278 42078 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_17810 42291 44621 gene locus_tag LOCUS_17820 42291 44621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 45653 44775 gene locus_tag LOCUS_17830 45653 44775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 45841 45671 gene locus_tag LOCUS_17840 45841 45671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 46263 45838 gene locus_tag LOCUS_17850 46263 45838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 46544 46260 gene locus_tag LOCUS_17860 46544 46260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 46968 46567 gene locus_tag LOCUS_17870 46968 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 47905 47192 gene locus_tag LOCUS_17880 47905 47192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 48836 48441 gene locus_tag LOCUS_17890 48836 48441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 49446 49039 gene locus_tag LOCUS_17900 49446 49039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 49636 49436 gene locus_tag LOCUS_17910 49636 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 53220 49795 gene locus_tag LOCUS_17920 53220 49795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 56555 53220 gene locus_tag LOCUS_17930 56555 53220 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_17930 57095 56652 gene locus_tag LOCUS_17940 57095 56652 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_17940 57370 57101 gene locus_tag LOCUS_17950 57370 57101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 57657 57421 gene locus_tag LOCUS_17960 57657 57421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence21 554 222 gene locus_tag LOCUS_17970 554 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1459 551 gene locus_tag LOCUS_17980 gene cas1 1459 551 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_17980 4610 1464 gene locus_tag LOCUS_17990 4610 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5994 4885 gene locus_tag LOCUS_18000 5994 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_18000 6839 5997 gene locus_tag LOCUS_18010 6839 5997 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 protein_id gnl|my_center|LOCUS_18010 6983 7984 gene locus_tag LOCUS_18020 gene aroE 6983 7984 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102190.1 protein_id gnl|my_center|LOCUS_18020 8057 8782 gene locus_tag LOCUS_18030 8057 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 8806 9864 gene locus_tag LOCUS_18040 8806 9864 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_18040 9873 10358 gene locus_tag LOCUS_18050 gene aroQ 9873 10358 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393049.1 protein_id gnl|my_center|LOCUS_18050 10440 11006 gene locus_tag LOCUS_18060 gene efp 10440 11006 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_18060 11045 11467 gene locus_tag LOCUS_18070 gene nusB 11045 11467 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_18070 11755 13713 gene locus_tag LOCUS_18080 11755 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 13710 16121 gene locus_tag LOCUS_18090 13710 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 16118 16897 gene locus_tag LOCUS_18100 16118 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 16901 18976 gene locus_tag LOCUS_18110 16901 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 18970 19746 gene locus_tag LOCUS_18120 18970 19746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 19743 20510 gene locus_tag LOCUS_18130 19743 20510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 20586 20789 gene locus_tag LOCUS_18140 20586 20789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 20921 21337 gene locus_tag LOCUS_18150 20921 21337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 21371 21793 gene locus_tag LOCUS_18160 21371 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 21790 22158 gene locus_tag LOCUS_18170 21790 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 22584 22168 gene locus_tag LOCUS_18180 gene vapC26 22584 22168 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_18180 22787 22581 gene locus_tag LOCUS_18190 gene vapB26 22787 22581 CDS product type II toxin-antitoxin system antitoxin VapB26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403039.1 protein_id gnl|my_center|LOCUS_18190 22950 23516 gene locus_tag LOCUS_18200 gene pyrR 22950 23516 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_18200 23513 24547 gene locus_tag LOCUS_18210 23513 24547 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_18210 24540 26015 gene locus_tag LOCUS_18220 24540 26015 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_18220 26012 27175 gene locus_tag LOCUS_18230 gene carA 26012 27175 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_18230 27175 30543 gene locus_tag LOCUS_18240 gene carB 27175 30543 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_18240 30581 31507 gene locus_tag LOCUS_18250 30581 31507 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18250 31606 32250 gene locus_tag LOCUS_18260 gene pyrF 31606 32250 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642610.1 protein_id gnl|my_center|LOCUS_18260 32314 32649 gene locus_tag LOCUS_18270 gene mihF 32314 32649 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_18270 32660 33280 gene locus_tag LOCUS_18280 gene gmk 32660 33280 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051382910.1 protein_id gnl|my_center|LOCUS_18280 33294 33632 gene locus_tag LOCUS_18290 33294 33632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 33634 34893 gene locus_tag LOCUS_18300 gene coaBC 33634 34893 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831608.1 protein_id gnl|my_center|LOCUS_18300 35019 36179 gene locus_tag LOCUS_18310 gene metK 35019 36179 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_18310 36298 38139 gene locus_tag LOCUS_18320 36298 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 38262 38831 gene locus_tag LOCUS_18330 gene def 38262 38831 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_18330 38906 39796 gene locus_tag LOCUS_18340 gene fmt 38906 39796 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_18340 39910 40482 gene locus_tag LOCUS_18350 39910 40482 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_18350 40591 41604 gene locus_tag LOCUS_18360 40591 41604 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_18360 42371 41601 gene locus_tag LOCUS_18370 42371 41601 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242998.1 protein_id gnl|my_center|LOCUS_18370 43228 42368 gene locus_tag LOCUS_18380 43228 42368 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_18380 43350 44603 gene locus_tag LOCUS_18390 43350 44603 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 protein_id gnl|my_center|LOCUS_18390 45056 44628 gene locus_tag LOCUS_18400 45056 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 46295 45132 gene locus_tag LOCUS_18410 46295 45132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 46483 46932 gene locus_tag LOCUS_18420 46483 46932 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_18420 46932 48065 gene locus_tag LOCUS_18430 gene ribD 46932 48065 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931219.1 protein_id gnl|my_center|LOCUS_18430 48246 48866 gene locus_tag LOCUS_18440 48246 48866 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_18440 48859 50157 gene locus_tag LOCUS_18450 48859 50157 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_18450 51029 50154 gene locus_tag LOCUS_18460 gene hisG 51029 50154 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_18460 51611 51135 gene locus_tag LOCUS_18470 51611 51135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 51779 52387 gene locus_tag LOCUS_18480 gene infC 51779 52387 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901217.1 protein_id gnl|my_center|LOCUS_18480 52530 52724 gene locus_tag LOCUS_18490 gene rpmI 52530 52724 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_18490 52789 53157 gene locus_tag LOCUS_18500 gene rplT 52789 53157 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 protein_id gnl|my_center|LOCUS_18500 53217 53993 gene locus_tag LOCUS_18510 53217 53993 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084642168.1 protein_id gnl|my_center|LOCUS_18510 54007 55140 gene locus_tag LOCUS_18520 gene pheS 54007 55140 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_18520 55178 57601 gene locus_tag LOCUS_18530 gene pheT 55178 57601 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence22 565 1668 gene locus_tag LOCUS_18540 gene ilvE 565 1668 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243977.1 protein_id gnl|my_center|LOCUS_18540 1683 2276 gene locus_tag LOCUS_18550 1683 2276 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729004.1 protein_id gnl|my_center|LOCUS_18550 2914 2312 gene locus_tag LOCUS_18560 2914 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 6816 2977 gene locus_tag LOCUS_18570 6816 2977 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538150.1 protein_id gnl|my_center|LOCUS_18570 6869 7354 gene locus_tag LOCUS_18580 gene ribE 6869 7354 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_18580 8360 7371 gene locus_tag LOCUS_18590 8360 7371 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_18590 8533 9675 gene locus_tag LOCUS_18600 8533 9675 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026178447.1 protein_id gnl|my_center|LOCUS_18600 10658 9807 gene locus_tag LOCUS_18610 10658 9807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_18610 10741 11463 gene locus_tag LOCUS_18620 10741 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11892 12719 gene locus_tag LOCUS_18630 gene fabG 11892 12719 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_18630 14025 12820 gene locus_tag LOCUS_18640 gene proX 14025 12820 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216531.1 protein_id gnl|my_center|LOCUS_18640 16859 14217 gene locus_tag LOCUS_18650 16859 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 18100 16856 gene locus_tag LOCUS_18660 18100 16856 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 protein_id gnl|my_center|LOCUS_18660 18237 19550 gene locus_tag LOCUS_18670 18237 19550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 19619 22459 gene locus_tag LOCUS_18680 19619 22459 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_18680 23222 22470 gene locus_tag LOCUS_18690 23222 22470 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_18690 23240 24154 gene locus_tag LOCUS_18700 23240 24154 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259466.1 protein_id gnl|my_center|LOCUS_18700 24945 24109 gene locus_tag LOCUS_18710 24945 24109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_18710 26366 24951 gene locus_tag LOCUS_18720 gene boxB 26366 24951 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_18720 28076 26400 gene locus_tag LOCUS_18730 gene boxC 28076 26400 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_18730 28190 29686 gene locus_tag LOCUS_18740 28190 29686 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_18740 31346 29724 gene locus_tag LOCUS_18750 31346 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 31382 32164 gene locus_tag LOCUS_18760 31382 32164 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_18760 32266 32793 gene locus_tag LOCUS_18770 32266 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 33107 32805 gene locus_tag LOCUS_18780 33107 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 34829 33180 gene locus_tag LOCUS_18790 34829 33180 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_18790 36048 34891 gene locus_tag LOCUS_18800 36048 34891 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_18800 36359 36751 gene locus_tag LOCUS_18810 36359 36751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 36753 36923 gene locus_tag LOCUS_18820 36753 36923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 37114 37314 gene locus_tag LOCUS_18830 37114 37314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 37641 38033 gene locus_tag LOCUS_18840 37641 38033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 38177 39085 gene locus_tag LOCUS_18850 38177 39085 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063715.1 protein_id gnl|my_center|LOCUS_18850 39123 40250 gene locus_tag LOCUS_18860 gene hisC 39123 40250 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_18860 41777 40317 gene locus_tag LOCUS_18870 41777 40317 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_18870 41864 42922 gene locus_tag LOCUS_18880 41864 42922 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_18880 42943 43608 gene locus_tag LOCUS_18890 42943 43608 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_18890 44258 43635 gene locus_tag LOCUS_18900 44258 43635 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_18900 46703 44304 gene locus_tag LOCUS_18910 46703 44304 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_18910 46773 48791 gene locus_tag LOCUS_18920 46773 48791 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_18920 48818 49384 gene locus_tag LOCUS_18930 48818 49384 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_18930 51115 49298 gene locus_tag LOCUS_18940 51115 49298 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567362.1 protein_id gnl|my_center|LOCUS_18940 51422 52009 gene locus_tag LOCUS_18950 51422 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 53667 52216 gene locus_tag LOCUS_18960 53667 52216 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_18960 53615 54916 gene locus_tag LOCUS_18970 53615 54916 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_18970 54926 55399 gene locus_tag LOCUS_18980 54926 55399 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_18980 55528 57411 gene locus_tag LOCUS_18990 55528 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence23 857 1606 gene locus_tag LOCUS_19000 857 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1858 3198 gene locus_tag LOCUS_19010 1858 3198 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804254.1 protein_id gnl|my_center|LOCUS_19010 3389 4549 gene locus_tag LOCUS_19020 3389 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4574 4972 gene locus_tag LOCUS_19030 4574 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5110 8373 gene locus_tag LOCUS_19040 5110 8373 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_19040 8500 9006 gene locus_tag LOCUS_19050 8500 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 9168 8944 gene locus_tag LOCUS_19060 9168 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9212 9697 gene locus_tag LOCUS_19070 9212 9697 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 protein_id gnl|my_center|LOCUS_19070 9697 10686 gene locus_tag LOCUS_19080 9697 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 10843 12270 gene locus_tag LOCUS_19090 10843 12270 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 protein_id gnl|my_center|LOCUS_19090 13108 12305 gene locus_tag LOCUS_19100 13108 12305 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_19100 13291 15477 gene locus_tag LOCUS_19110 13291 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 15528 17876 gene locus_tag LOCUS_19120 15528 17876 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_19120 17920 19215 gene locus_tag LOCUS_19130 17920 19215 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_19130 19220 20050 gene locus_tag LOCUS_19140 19220 20050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_19140 20134 20673 gene locus_tag LOCUS_19150 20134 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 20688 21110 gene locus_tag LOCUS_19160 20688 21110 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_19160 22399 21143 gene locus_tag LOCUS_19170 22399 21143 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_19170 22544 23092 gene locus_tag LOCUS_19180 22544 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19180 23575 23132 gene locus_tag LOCUS_19190 23575 23132 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223509.1 protein_id gnl|my_center|LOCUS_19190 24003 23593 gene locus_tag LOCUS_19200 24003 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 24874 24059 gene locus_tag LOCUS_19210 24874 24059 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_19210 25026 25808 gene locus_tag LOCUS_19220 25026 25808 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_19220 25885 26817 gene locus_tag LOCUS_19230 25885 26817 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_19230 26932 29256 gene locus_tag LOCUS_19240 26932 29256 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_19240 29305 30264 gene locus_tag LOCUS_19250 29305 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 31102 30242 gene locus_tag LOCUS_19260 31102 30242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533082.1 protein_id gnl|my_center|LOCUS_19260 32382 31099 gene locus_tag LOCUS_19270 32382 31099 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_19270 33752 32430 gene locus_tag LOCUS_19280 33752 32430 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172947.1 protein_id gnl|my_center|LOCUS_19280 34975 33827 gene locus_tag LOCUS_19290 34975 33827 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228920.1 protein_id gnl|my_center|LOCUS_19290 35063 36427 gene locus_tag LOCUS_19300 35063 36427 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_19300 37096 36473 gene locus_tag LOCUS_19310 37096 36473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 37348 39066 gene locus_tag LOCUS_19320 37348 39066 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_19320 39229 39687 gene locus_tag LOCUS_19330 39229 39687 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_19330 39790 40608 gene locus_tag LOCUS_19340 39790 40608 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_19340 40687 42327 gene locus_tag LOCUS_19350 40687 42327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 42324 43130 gene locus_tag LOCUS_19360 gene hisN 42324 43130 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_19360 43063 44295 gene locus_tag LOCUS_19370 43063 44295 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_19370 44969 44286 gene locus_tag LOCUS_19380 44969 44286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 45108 45383 gene locus_tag LOCUS_19390 45108 45383 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_19390 46035 45346 gene locus_tag LOCUS_19400 46035 45346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_19400 46179 47969 gene locus_tag LOCUS_19410 46179 47969 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_19410 48639 48100 gene locus_tag LOCUS_19420 48639 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 48772 49620 gene locus_tag LOCUS_19430 48772 49620 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_19430 49633 50580 gene locus_tag LOCUS_19440 49633 50580 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_19440 53506 50690 gene locus_tag LOCUS_19450 53506 50690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 53946 54110 gene locus_tag LOCUS_19460 53946 54110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 54083 54322 gene locus_tag LOCUS_19470 54083 54322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 54488 54730 gene locus_tag LOCUS_19480 54488 54730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 54711 55382 gene locus_tag LOCUS_19490 54711 55382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence24 <1 949 gene locus_tag LOCUS_19500 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064432.1:CaiB/BaiF CoA-transferase family protein 1841 1071 gene locus_tag LOCUS_19510 1841 1071 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_19510 2909 1881 gene locus_tag LOCUS_19520 2909 1881 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_19520 3022 4653 gene locus_tag LOCUS_19530 3022 4653 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_19530 5998 4664 gene locus_tag LOCUS_19540 5998 4664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_19540 6169 6540 gene locus_tag LOCUS_19550 6169 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 6752 6537 gene locus_tag LOCUS_19560 6752 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6866 7123 gene locus_tag LOCUS_19570 6866 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 7539 7273 gene locus_tag LOCUS_19580 7539 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 9839 7551 gene locus_tag LOCUS_19590 gene pknB 9839 7551 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776674.1 protein_id gnl|my_center|LOCUS_19590 11173 9905 gene locus_tag LOCUS_19600 11173 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 12498 11170 gene locus_tag LOCUS_19610 12498 11170 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_19610 13385 12546 gene locus_tag LOCUS_19620 13385 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 13902 13435 gene locus_tag LOCUS_19630 13902 13435 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064443.1 protein_id gnl|my_center|LOCUS_19630 14180 13902 gene locus_tag LOCUS_19640 14180 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 14231 14315 gene locus_tag LOCUS_t00260 14231 14315 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15056 14346 gene locus_tag LOCUS_19650 15056 14346 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_19650 15596 15105 gene locus_tag LOCUS_19660 15596 15105 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_19660 17192 15666 gene locus_tag LOCUS_19670 17192 15666 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 protein_id gnl|my_center|LOCUS_19670 18706 17306 gene locus_tag LOCUS_19680 18706 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 20112 18940 gene locus_tag LOCUS_19690 20112 18940 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_19690 20204 20962 gene locus_tag LOCUS_19700 20204 20962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_19700 20962 21792 gene locus_tag LOCUS_19710 20962 21792 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_19710 21946 24513 gene locus_tag LOCUS_19720 21946 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 25327 24581 gene locus_tag LOCUS_19730 25327 24581 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_19730 27000 25327 gene locus_tag LOCUS_19740 27000 25327 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_19740 27124 27033 gene locus_tag LOCUS_t00270 27124 27033 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27239 27326 gene locus_tag LOCUS_t00280 27239 27326 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27490 27350 gene locus_tag LOCUS_19750 27490 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 27861 27487 gene locus_tag LOCUS_19760 27861 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 29165 27936 gene locus_tag LOCUS_19770 29165 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 29192 29572 gene locus_tag LOCUS_19780 29192 29572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 29726 29968 gene locus_tag LOCUS_19790 29726 29968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 31091 30354 gene locus_tag LOCUS_19800 31091 30354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 31398 31153 gene locus_tag LOCUS_19810 31398 31153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 31575 42044 gene locus_tag LOCUS_19820 31575 42044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 42959 42054 gene locus_tag LOCUS_19830 42959 42054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 44745 43003 gene locus_tag LOCUS_19840 44745 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 44878 45891 gene locus_tag LOCUS_19850 44878 45891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 46509 46042 gene locus_tag LOCUS_19860 46509 46042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 47768 46572 gene locus_tag LOCUS_19870 47768 46572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 47996 47817 gene locus_tag LOCUS_19880 47996 47817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 48693 47917 gene locus_tag LOCUS_19890 48693 47917 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_19890 49896 48703 gene locus_tag LOCUS_19900 49896 48703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 49798 50568 gene locus_tag LOCUS_19910 gene larB 49798 50568 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_19910 50565 51845 gene locus_tag LOCUS_19920 gene larC 50565 51845 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_19920 51893 51968 gene locus_tag LOCUS_t00290 51893 51968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52440 51979 gene locus_tag LOCUS_19930 52440 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 53075 52437 gene locus_tag LOCUS_19940 53075 52437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence25 553 1860 gene locus_tag LOCUS_19950 553 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2436 2008 gene locus_tag LOCUS_19960 2436 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2425 2988 gene locus_tag LOCUS_19970 2425 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3624 2995 gene locus_tag LOCUS_19980 3624 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3782 5134 gene locus_tag LOCUS_19990 3782 5134 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_19990 5215 6399 gene locus_tag LOCUS_20000 gene proX 5215 6399 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331286.1 protein_id gnl|my_center|LOCUS_20000 6665 6420 gene locus_tag LOCUS_20010 6665 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6601 7347 gene locus_tag LOCUS_20020 6601 7347 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940908.1 protein_id gnl|my_center|LOCUS_20020 7831 7376 gene locus_tag LOCUS_20030 7831 7376 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_20030 7974 8771 gene locus_tag LOCUS_20040 7974 8771 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085247.1 protein_id gnl|my_center|LOCUS_20040 8859 9683 gene locus_tag LOCUS_20050 8859 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 9697 10590 gene locus_tag LOCUS_20060 9697 10590 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090985.1 protein_id gnl|my_center|LOCUS_20060 10867 11865 gene locus_tag LOCUS_20070 10867 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 11984 12766 gene locus_tag LOCUS_20080 11984 12766 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_20080 13137 12776 gene locus_tag LOCUS_tm00010 13137 12776 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13253 14173 gene locus_tag LOCUS_20090 gene prmA 13253 14173 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_20090 14970 14179 gene locus_tag LOCUS_20100 14970 14179 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066682.1 protein_id gnl|my_center|LOCUS_20100 15011 16075 gene locus_tag LOCUS_20110 15011 16075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_20110 17250 16072 gene locus_tag LOCUS_20120 17250 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 18643 17267 gene locus_tag LOCUS_20130 18643 17267 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122769.1 protein_id gnl|my_center|LOCUS_20130 19067 18678 gene locus_tag LOCUS_20140 19067 18678 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966633.1 protein_id gnl|my_center|LOCUS_20140 19183 20865 gene locus_tag LOCUS_20150 19183 20865 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_20150 21328 20885 gene locus_tag LOCUS_20160 21328 20885 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_20160 21457 22338 gene locus_tag LOCUS_20170 21457 22338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_20170 23475 22363 gene locus_tag LOCUS_20180 23475 22363 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_20180 23594 27766 gene locus_tag LOCUS_20190 23594 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 28595 27789 gene locus_tag LOCUS_20200 28595 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 28658 29641 gene locus_tag LOCUS_20210 28658 29641 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_20210 30961 29690 gene locus_tag LOCUS_20220 30961 29690 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_20220 32362 31025 gene locus_tag LOCUS_20230 32362 31025 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_20230 33290 32373 gene locus_tag LOCUS_20240 33290 32373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 35860 33581 gene locus_tag LOCUS_20250 35860 33581 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_20250 36043 37836 gene locus_tag LOCUS_20260 36043 37836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 38903 37818 gene locus_tag LOCUS_20270 38903 37818 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_20270 39850 38951 gene locus_tag LOCUS_20280 39850 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 41717 39828 gene locus_tag LOCUS_20290 41717 39828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_20290 42751 41771 gene locus_tag LOCUS_20300 42751 41771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 44330 42741 gene locus_tag LOCUS_20310 44330 42741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 46705 44327 gene locus_tag LOCUS_20320 46705 44327 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_20320 47808 46768 gene locus_tag LOCUS_20330 47808 46768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 48943 47819 gene locus_tag LOCUS_20340 48943 47819 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_20340 50640 49009 gene locus_tag LOCUS_20350 50640 49009 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_20350 51389 50691 gene locus_tag LOCUS_20360 51389 50691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence26 478 212 gene locus_tag LOCUS_20370 478 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1843 482 gene locus_tag LOCUS_20380 gene dnaB 1843 482 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_20380 2453 2004 gene locus_tag LOCUS_20390 gene rplI 2453 2004 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_20390 2896 2450 gene locus_tag LOCUS_20400 2896 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3360 2896 gene locus_tag LOCUS_20410 3360 2896 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_20410 3707 3372 gene locus_tag LOCUS_20420 gene rpsF 3707 3372 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721667.1 protein_id gnl|my_center|LOCUS_20420 5579 3936 gene locus_tag LOCUS_20430 5579 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5730 7001 gene locus_tag LOCUS_20440 5730 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 7015 7437 gene locus_tag LOCUS_20450 7015 7437 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296823.1 protein_id gnl|my_center|LOCUS_20450 7534 8016 gene locus_tag LOCUS_20460 7534 8016 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_20460 8040 9809 gene locus_tag LOCUS_20470 gene murJ 8040 9809 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_20470 9816 10667 gene locus_tag LOCUS_20480 9816 10667 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_20480 10664 12169 gene locus_tag LOCUS_20490 10664 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 12324 12653 gene locus_tag LOCUS_20500 12324 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 12608 13621 gene locus_tag LOCUS_20510 gene trxB 12608 13621 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_20510 13696 14019 gene locus_tag LOCUS_20520 gene trxA 13696 14019 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_20520 14301 14981 gene locus_tag LOCUS_20530 14301 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 16059 15169 gene locus_tag LOCUS_20540 16059 15169 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_20540 16937 16056 gene locus_tag LOCUS_20550 gene soj 16937 16056 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_20550 17550 16966 gene locus_tag LOCUS_20560 17550 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 18160 17678 gene locus_tag LOCUS_20570 18160 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 19414 18371 gene locus_tag LOCUS_20580 19414 18371 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_20580 19581 21623 gene locus_tag LOCUS_20590 19581 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 21873 21586 gene locus_tag LOCUS_20600 21873 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 23212 22010 gene locus_tag LOCUS_20610 23212 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 23762 23493 gene locus_tag LOCUS_20620 23762 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 24558 26072 gene locus_tag LOCUS_20630 24558 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 26396 27505 gene locus_tag LOCUS_20640 gene dnaN 26396 27505 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_20640 27502 28584 gene locus_tag LOCUS_20650 gene recF 27502 28584 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_20650 28581 28919 gene locus_tag LOCUS_20660 28581 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 28995 31001 gene locus_tag LOCUS_20670 gene gyrB 28995 31001 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_20670 31036 33573 gene locus_tag LOCUS_20680 gene gyrA 31036 33573 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_20680 33676 34101 gene locus_tag LOCUS_20690 33676 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 34530 34850 gene locus_tag LOCUS_20700 34530 34850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 34882 34956 gene locus_tag LOCUS_t00300 34882 34956 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 35142 36128 gene locus_tag LOCUS_20710 35142 36128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 36910 36173 gene locus_tag LOCUS_20720 36910 36173 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_20720 36962 37867 gene locus_tag LOCUS_20730 gene lgt 36962 37867 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_20730 38686 37790 gene locus_tag LOCUS_20740 38686 37790 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_20740 39652 38750 gene locus_tag LOCUS_20750 39652 38750 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_20750 40746 39709 gene locus_tag LOCUS_20760 40746 39709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 42002 40794 gene locus_tag LOCUS_20770 42002 40794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189020.1 protein_id gnl|my_center|LOCUS_20770 42050 43792 gene locus_tag LOCUS_20780 42050 43792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 43883 44182 gene locus_tag LOCUS_20790 43883 44182 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_20790 44256 44332 gene locus_tag LOCUS_t00310 44256 44332 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 44332 44748 gene locus_tag LOCUS_20800 44332 44748 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531184.1 protein_id gnl|my_center|LOCUS_20800 46096 44801 gene locus_tag LOCUS_20810 46096 44801 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084112.1 protein_id gnl|my_center|LOCUS_20810 47143 46145 gene locus_tag LOCUS_20820 47143 46145 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_20820 47768 47196 gene locus_tag LOCUS_20830 47768 47196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 48074 47790 gene locus_tag LOCUS_20840 48074 47790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 49150 48071 gene locus_tag LOCUS_20850 49150 48071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_20850 50197 49202 gene locus_tag LOCUS_20860 gene bmt 50197 49202 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_20860 50685 51644 gene locus_tag LOCUS_20870 50685 51644 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence27 82 1041 gene locus_tag LOCUS_20880 82 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1172 1957 gene locus_tag LOCUS_20890 1172 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2121 3059 gene locus_tag LOCUS_20900 2121 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3802 3185 gene locus_tag LOCUS_20910 3802 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3756 4157 gene locus_tag LOCUS_20920 3756 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4247 5614 gene locus_tag LOCUS_20930 4247 5614 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_20930 5800 7179 gene locus_tag LOCUS_20940 5800 7179 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_20940 7255 8172 gene locus_tag LOCUS_20950 7255 8172 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_20950 8261 9220 gene locus_tag LOCUS_20960 8261 9220 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_20960 9213 9968 gene locus_tag LOCUS_20970 9213 9968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_20970 9968 10678 gene locus_tag LOCUS_20980 9968 10678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_20980 10776 12401 gene locus_tag LOCUS_20990 10776 12401 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225218.1 protein_id gnl|my_center|LOCUS_20990 12423 13235 gene locus_tag LOCUS_21000 12423 13235 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228730.1 protein_id gnl|my_center|LOCUS_21000 15615 13261 gene locus_tag LOCUS_21010 15615 13261 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_21010 15781 16491 gene locus_tag LOCUS_21020 15781 16491 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228733.1 protein_id gnl|my_center|LOCUS_21020 16488 17312 gene locus_tag LOCUS_21030 16488 17312 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_21030 17362 17769 gene locus_tag LOCUS_21040 17362 17769 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_21040 17878 18138 gene locus_tag LOCUS_21050 17878 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21050 18151 18600 gene locus_tag LOCUS_21060 18151 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21060 19113 18568 gene locus_tag LOCUS_21070 19113 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 19562 19116 gene locus_tag LOCUS_21080 19562 19116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 23038 19664 gene locus_tag LOCUS_21090 23038 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 23137 24369 gene locus_tag LOCUS_21100 23137 24369 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_21100 26390 24492 gene locus_tag LOCUS_21110 26390 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 27913 26303 gene locus_tag LOCUS_21120 27913 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 28634 27936 gene locus_tag LOCUS_21130 28634 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 28752 32492 gene locus_tag LOCUS_21140 28752 32492 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_21140 32485 33699 gene locus_tag LOCUS_21150 32485 33699 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_21150 33796 36093 gene locus_tag LOCUS_21160 33796 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 36142 37068 gene locus_tag LOCUS_21170 gene parJ 36142 37068 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_21170 37143 38246 gene locus_tag LOCUS_21180 gene aroC 37143 38246 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_21180 38257 38997 gene locus_tag LOCUS_21190 38257 38997 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_21190 39030 40184 gene locus_tag LOCUS_21200 39030 40184 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230022.1 protein_id gnl|my_center|LOCUS_21200 41144 40308 gene locus_tag LOCUS_21210 41144 40308 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_21210 41244 42167 gene locus_tag LOCUS_21220 41244 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036226.1 protein_id gnl|my_center|LOCUS_21220 42202 42945 gene locus_tag LOCUS_21230 42202 42945 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_21230 44956 43019 gene locus_tag LOCUS_21240 44956 43019 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_21240 45481 45239 gene locus_tag LOCUS_21250 45481 45239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 46882 45488 gene locus_tag LOCUS_21260 gene xseA 46882 45488 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_21260 46990 47079 gene locus_tag LOCUS_t00320 46990 47079 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47568 47122 gene locus_tag LOCUS_21270 gene tadA 47568 47122 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_21270 48609 47611 gene locus_tag LOCUS_21280 48609 47611 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970000.1 protein_id gnl|my_center|LOCUS_21280 48717 48628 gene locus_tag LOCUS_t00330 48717 48628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48978 50720 gene locus_tag LOCUS_21290 48978 50720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 50755 51351 gene locus_tag LOCUS_21300 gene recR 50755 51351 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence28 875 3772 gene locus_tag LOCUS_21310 875 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4869 3793 gene locus_tag LOCUS_21320 4869 3793 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_21320 5504 4866 gene locus_tag LOCUS_21330 gene darT 5504 4866 CDS product toxin-antitoxin system toxin DarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400548.1 protein_id gnl|my_center|LOCUS_21330 6959 5733 gene locus_tag LOCUS_21340 6959 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7278 7589 gene locus_tag LOCUS_21350 7278 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 8529 7612 gene locus_tag LOCUS_21360 8529 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 8617 9027 gene locus_tag LOCUS_21370 8617 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 9058 10218 gene locus_tag LOCUS_21380 9058 10218 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969753.1 protein_id gnl|my_center|LOCUS_21380 10602 10237 gene locus_tag LOCUS_21390 10602 10237 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920799.1 protein_id gnl|my_center|LOCUS_21390 10486 10695 gene locus_tag LOCUS_21400 10486 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 10749 11483 gene locus_tag LOCUS_21410 10749 11483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_21410 11535 12743 gene locus_tag LOCUS_21420 11535 12743 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969230.1 protein_id gnl|my_center|LOCUS_21420 12747 14069 gene locus_tag LOCUS_21430 12747 14069 CDS product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_21430 14164 14925 gene locus_tag LOCUS_21440 14164 14925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818730.1 protein_id gnl|my_center|LOCUS_21440 14926 15771 gene locus_tag LOCUS_21450 14926 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 15819 16685 gene locus_tag LOCUS_21460 15819 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 18113 16791 gene locus_tag LOCUS_21470 18113 16791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234253.1 protein_id gnl|my_center|LOCUS_21470 18271 19149 gene locus_tag LOCUS_21480 18271 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 19669 19187 gene locus_tag LOCUS_21490 19669 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20472 19678 gene locus_tag LOCUS_21500 20472 19678 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038823.1 protein_id gnl|my_center|LOCUS_21500 21597 20521 gene locus_tag LOCUS_21510 21597 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 22946 21780 gene locus_tag LOCUS_21520 22946 21780 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 protein_id gnl|my_center|LOCUS_21520 24133 22943 gene locus_tag LOCUS_21530 24133 22943 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 protein_id gnl|my_center|LOCUS_21530 24253 26118 gene locus_tag LOCUS_21540 24253 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 26152 27255 gene locus_tag LOCUS_21550 26152 27255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_21550 27317 28732 gene locus_tag LOCUS_21560 27317 28732 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064643.1 protein_id gnl|my_center|LOCUS_21560 28832 29137 gene locus_tag LOCUS_21570 28832 29137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 29217 29696 gene locus_tag LOCUS_21580 29217 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 29716 30576 gene locus_tag LOCUS_21590 29716 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 30609 31574 gene locus_tag LOCUS_21600 30609 31574 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_21600 31975 31580 gene locus_tag LOCUS_21610 31975 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 32088 32990 gene locus_tag LOCUS_21620 32088 32990 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_21620 32987 33553 gene locus_tag LOCUS_21630 32987 33553 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_21630 33546 35159 gene locus_tag LOCUS_21640 33546 35159 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112322.1 protein_id gnl|my_center|LOCUS_21640 36503 35175 gene locus_tag LOCUS_21650 36503 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 36936 37379 gene locus_tag LOCUS_21660 36936 37379 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_21660 37381 38124 gene locus_tag LOCUS_21670 37381 38124 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_21670 38823 38197 gene locus_tag LOCUS_21680 38823 38197 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973888.1 protein_id gnl|my_center|LOCUS_21680 38953 39567 gene locus_tag LOCUS_21690 38953 39567 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_21690 39651 40202 gene locus_tag LOCUS_21700 39651 40202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 40752 40162 gene locus_tag LOCUS_21710 40752 40162 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_21710 40864 41760 gene locus_tag LOCUS_21720 40864 41760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_21720 41753 42481 gene locus_tag LOCUS_21730 41753 42481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 47435 42510 gene locus_tag LOCUS_21740 47435 42510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 47746 47588 gene locus_tag LOCUS_21750 47746 47588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 47884 48258 gene locus_tag LOCUS_21760 47884 48258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 48601 48281 gene locus_tag LOCUS_21770 48601 48281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 48937 48614 gene locus_tag LOCUS_21780 48937 48614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 48988 49740 gene locus_tag LOCUS_21790 48988 49740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 50853 50107 gene locus_tag LOCUS_21800 50853 50107 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence29 <1 612 gene locus_tag LOCUS_21810 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530045.1:NAD(P)-dependent oxidoreductase 1739 768 gene locus_tag LOCUS_21820 1739 768 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_21820 3019 1847 gene locus_tag LOCUS_21830 3019 1847 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_21830 3303 4232 gene locus_tag LOCUS_21840 3303 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4289 4996 gene locus_tag LOCUS_21850 gene aat 4289 4996 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 protein_id gnl|my_center|LOCUS_21850 5010 6977 gene locus_tag LOCUS_21860 5010 6977 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_21860 7049 7591 gene locus_tag LOCUS_21870 7049 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7595 8956 gene locus_tag LOCUS_21880 7595 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 10253 9102 gene locus_tag LOCUS_21890 10253 9102 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_21890 10515 10321 gene locus_tag LOCUS_21900 10515 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 12083 10542 gene locus_tag LOCUS_21910 12083 10542 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_21910 12177 12536 gene locus_tag LOCUS_21920 12177 12536 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_21920 13469 12570 gene locus_tag LOCUS_21930 13469 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 13542 14024 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgctcaacgaagggagggggaatattccccctccaag 14445 14155 gene locus_tag LOCUS_21940 14445 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 15461 14448 gene locus_tag LOCUS_21950 gene cas1c 15461 14448 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_21950 16063 15458 gene locus_tag LOCUS_21960 gene cas4 16063 15458 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102934575.1 protein_id gnl|my_center|LOCUS_21960 16980 16063 gene locus_tag LOCUS_21970 16980 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 19739 16980 gene locus_tag LOCUS_21980 gene cas3u 19739 16980 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_21980 21195 19753 gene locus_tag LOCUS_21990 21195 19753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 22394 21195 gene locus_tag LOCUS_22000 22394 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 22691 22413 gene locus_tag LOCUS_22010 22691 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 23100 23876 gene locus_tag LOCUS_22020 23100 23876 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259475.1 protein_id gnl|my_center|LOCUS_22020 24490 23840 gene locus_tag LOCUS_22030 24490 23840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 24603 26141 gene locus_tag LOCUS_22040 24603 26141 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_22040 27655 26138 gene locus_tag LOCUS_22050 27655 26138 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_22050 28376 27774 gene locus_tag LOCUS_22060 28376 27774 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384669.1 protein_id gnl|my_center|LOCUS_22060 28430 30493 gene locus_tag LOCUS_22070 28430 30493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 30502 31065 gene locus_tag LOCUS_22080 30502 31065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22080 31212 32315 gene locus_tag LOCUS_22090 31212 32315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 32306 33121 gene locus_tag LOCUS_22100 gene menH 32306 33121 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_22100 33352 33567 gene locus_tag LOCUS_22110 33352 33567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 34094 34486 gene locus_tag LOCUS_22120 34094 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 35891 34458 gene locus_tag LOCUS_22130 35891 34458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 36423 36028 gene locus_tag LOCUS_22140 36423 36028 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877157.1 protein_id gnl|my_center|LOCUS_22140 36496 37536 gene locus_tag LOCUS_22150 36496 37536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 38777 37683 gene locus_tag LOCUS_22160 gene menE 38777 37683 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_22160 39000 38794 gene locus_tag LOCUS_22170 39000 38794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 39092 40225 gene locus_tag LOCUS_22180 gene mtnA 39092 40225 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_22180 40219 42273 gene locus_tag LOCUS_22190 40219 42273 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_22190 43922 42270 gene locus_tag LOCUS_22200 gene nupO 43922 42270 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_22200 44920 43922 gene locus_tag LOCUS_22210 44920 43922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_22210 46134 44980 gene locus_tag LOCUS_22220 46134 44980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_22220 47276 46197 gene locus_tag LOCUS_22230 47276 46197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 47856 47422 gene locus_tag LOCUS_22240 gene mce 47856 47422 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_22240 49223 47853 gene locus_tag LOCUS_22250 gene ccrA 49223 47853 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_22250 49384 50580 gene locus_tag LOCUS_22260 49384 50580 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_22260 51031 50642 gene locus_tag LOCUS_22270 51031 50642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence30 4798 83 gene locus_tag LOCUS_22280 4798 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6287 4938 gene locus_tag LOCUS_22290 6287 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6359 6538 gene locus_tag LOCUS_22300 6359 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6573 7292 gene locus_tag LOCUS_22310 6573 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7686 8738 gene locus_tag LOCUS_22320 7686 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 8906 8706 gene locus_tag LOCUS_22330 8906 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8982 9081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10444 9212 gene locus_tag LOCUS_22340 10444 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11501 10542 gene locus_tag LOCUS_22350 11501 10542 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_22350 12084 11536 gene locus_tag LOCUS_22360 12084 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12554 12081 gene locus_tag LOCUS_22370 12554 12081 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_22370 13489 12551 gene locus_tag LOCUS_22380 13489 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 13600 14760 gene locus_tag LOCUS_22390 13600 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 16086 14812 gene locus_tag LOCUS_22400 16086 14812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_22400 16829 16101 gene locus_tag LOCUS_22410 gene regX 16829 16101 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_22410 18085 16826 gene locus_tag LOCUS_22420 18085 16826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_22420 18786 18079 gene locus_tag LOCUS_22430 gene phoU 18786 18079 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_22430 19747 18806 gene locus_tag LOCUS_22440 gene pstB 19747 18806 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_22440 20717 19791 gene locus_tag LOCUS_22450 gene pstA 20717 19791 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256173.1 protein_id gnl|my_center|LOCUS_22450 21658 20732 gene locus_tag LOCUS_22460 gene pstC 21658 20732 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878854.1 protein_id gnl|my_center|LOCUS_22460 22741 21707 gene locus_tag LOCUS_22470 22741 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 23157 22879 gene locus_tag LOCUS_22480 23157 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 23267 23569 gene locus_tag LOCUS_22490 23267 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 23779 23585 gene locus_tag LOCUS_22500 23779 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 24241 23963 gene locus_tag LOCUS_22510 24241 23963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 24697 24386 gene locus_tag LOCUS_22520 24697 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 25059 24808 gene locus_tag LOCUS_22530 25059 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 25795 25103 gene locus_tag LOCUS_22540 25795 25103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 26430 25792 gene locus_tag LOCUS_22550 26430 25792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 27556 26468 gene locus_tag LOCUS_22560 27556 26468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 28206 27574 gene locus_tag LOCUS_22570 28206 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 28376 28471 gene locus_tag LOCUS_t00340 28376 28471 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 29566 28688 gene locus_tag LOCUS_22580 29566 28688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 30514 29579 gene locus_tag LOCUS_22590 30514 29579 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_22590 30647 32401 gene locus_tag LOCUS_22600 30647 32401 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039823.1 protein_id gnl|my_center|LOCUS_22600 32511 32520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33689 32676 gene locus_tag LOCUS_22610 33689 32676 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_22610 33933 35396 gene locus_tag LOCUS_22620 gene glnA 33933 35396 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 protein_id gnl|my_center|LOCUS_22620 35402 36112 gene locus_tag LOCUS_22630 35402 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 36271 36116 gene locus_tag LOCUS_22640 36271 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 36640 36293 gene locus_tag LOCUS_22650 36640 36293 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_22650 37115 36660 gene locus_tag LOCUS_22660 37115 36660 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_22660 37267 37276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38956 37436 gene locus_tag LOCUS_22670 38956 37436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 39426 39091 gene locus_tag LOCUS_22680 39426 39091 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_22680 39553 40719 gene locus_tag LOCUS_22690 39553 40719 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_22690 41522 40728 gene locus_tag LOCUS_22700 41522 40728 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_22700 41814 43112 gene locus_tag LOCUS_22710 gene selA 41814 43112 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_22710 43168 44892 gene locus_tag LOCUS_22720 gene selB 43168 44892 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_22720 45171 44905 gene locus_tag LOCUS_22730 45171 44905 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222241.1 protein_id gnl|my_center|LOCUS_22730 46676 45237 gene locus_tag LOCUS_22740 46676 45237 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_22740 46830 47225 gene locus_tag LOCUS_22750 46830 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 47333 47407 gene locus_tag LOCUS_t00350 47333 47407 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence31 302 1603 gene locus_tag LOCUS_22760 302 1603 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_22760 2048 1605 gene locus_tag LOCUS_22770 gene fabZ 2048 1605 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829953.1 protein_id gnl|my_center|LOCUS_22770 2495 2085 gene locus_tag LOCUS_22780 2495 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2890 2492 gene locus_tag LOCUS_22790 2890 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3700 2894 gene locus_tag LOCUS_22800 gene trpA 3700 2894 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_22800 4896 3697 gene locus_tag LOCUS_22810 gene trpB 4896 3697 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_22810 5628 4954 gene locus_tag LOCUS_22820 5628 4954 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_22820 6017 5703 gene locus_tag LOCUS_22830 6017 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 7076 6180 gene locus_tag LOCUS_22840 7076 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 9280 7061 gene locus_tag LOCUS_22850 9280 7061 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396108.1 protein_id gnl|my_center|LOCUS_22850 9791 9324 gene locus_tag LOCUS_22860 9791 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 9673 10554 gene locus_tag LOCUS_22870 9673 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 12123 10567 gene locus_tag LOCUS_22880 12123 10567 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_22880 12976 12194 gene locus_tag LOCUS_22890 gene hisF 12976 12194 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_22890 13820 13008 gene locus_tag LOCUS_22900 gene hisA 13820 13008 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_22900 14449 13808 gene locus_tag LOCUS_22910 gene hisH 14449 13808 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176026.1 protein_id gnl|my_center|LOCUS_22910 15032 14460 gene locus_tag LOCUS_22920 gene hisB 15032 14460 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_22920 16208 15135 gene locus_tag LOCUS_22930 16208 15135 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_22930 17521 16205 gene locus_tag LOCUS_22940 gene hisD 17521 16205 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_22940 17581 17787 gene locus_tag LOCUS_22950 17581 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 18762 17845 gene locus_tag LOCUS_22960 18762 17845 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_22960 19458 18817 gene locus_tag LOCUS_22970 gene nth 19458 18817 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_22970 20559 19468 gene locus_tag LOCUS_22980 gene rlmN 20559 19468 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_22980 21332 20574 gene locus_tag LOCUS_22990 21332 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 21413 21850 gene locus_tag LOCUS_23000 21413 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 21847 22542 gene locus_tag LOCUS_23010 gene ubiE 21847 22542 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_23010 23045 22539 gene locus_tag LOCUS_23020 23045 22539 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027714.1 protein_id gnl|my_center|LOCUS_23020 23984 23106 gene locus_tag LOCUS_23030 23984 23106 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_23030 24832 23981 gene locus_tag LOCUS_23040 24832 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 25704 24844 gene locus_tag LOCUS_23050 25704 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 26043 25735 gene locus_tag LOCUS_23060 26043 25735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 26331 26065 gene locus_tag LOCUS_23070 26331 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 26509 27600 gene locus_tag LOCUS_23080 26509 27600 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_23080 27644 28768 gene locus_tag LOCUS_23090 27644 28768 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_23090 29736 28813 gene locus_tag LOCUS_23100 29736 28813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 29819 30622 gene locus_tag LOCUS_23110 gene modA 29819 30622 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 protein_id gnl|my_center|LOCUS_23110 30619 31458 gene locus_tag LOCUS_23120 30619 31458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_23120 31469 32647 gene locus_tag LOCUS_23130 31469 32647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_23130 33811 32678 gene locus_tag LOCUS_23140 33811 32678 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_23140 33926 34624 gene locus_tag LOCUS_23150 33926 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 36922 34646 gene locus_tag LOCUS_23160 36922 34646 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063786.1 protein_id gnl|my_center|LOCUS_23160 37383 36976 gene locus_tag LOCUS_23170 37383 36976 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_23170 37552 39939 gene locus_tag LOCUS_23180 37552 39939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 41484 39928 gene locus_tag LOCUS_23190 41484 39928 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_23190 41571 43193 gene locus_tag LOCUS_23200 41571 43193 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_23200 43229 44380 gene locus_tag LOCUS_23210 43229 44380 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082971.1 protein_id gnl|my_center|LOCUS_23210 44442 45563 gene locus_tag LOCUS_23220 44442 45563 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_23220 45888 47252 gene locus_tag LOCUS_23230 45888 47252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence32 1218 49 gene locus_tag LOCUS_23240 gene rodA 1218 49 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_23240 3473 1215 gene locus_tag LOCUS_23250 gene mrdA 3473 1215 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815201.1 protein_id gnl|my_center|LOCUS_23250 4002 3466 gene locus_tag LOCUS_23260 4002 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4899 4030 gene locus_tag LOCUS_23270 gene mreC 4899 4030 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_23270 6011 4953 gene locus_tag LOCUS_23280 6011 4953 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_23280 6499 6011 gene locus_tag LOCUS_23290 gene ndk 6499 6011 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_23290 7905 6562 gene locus_tag LOCUS_23300 7905 6562 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_23300 9248 7983 gene locus_tag LOCUS_23310 gene clpX 9248 7983 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_23310 9462 11021 gene locus_tag LOCUS_23320 gene tig 9462 11021 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_23320 11018 11710 gene locus_tag LOCUS_23330 gene clpP 11018 11710 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_23330 11998 11926 gene locus_tag LOCUS_t00360 11998 11926 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13183 12047 gene locus_tag LOCUS_23340 13183 12047 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_23340 14205 13252 gene locus_tag LOCUS_23350 14205 13252 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_23350 14802 14209 gene locus_tag LOCUS_23360 14802 14209 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_23360 14885 16381 gene locus_tag LOCUS_23370 gene mmsA 14885 16381 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_23370 17138 16521 gene locus_tag LOCUS_23380 17138 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 17544 18584 gene locus_tag LOCUS_23390 17544 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 18991 18608 gene locus_tag LOCUS_23400 18991 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 19553 18984 gene locus_tag LOCUS_23410 19553 18984 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_23410 19700 19626 gene locus_tag LOCUS_t00370 19700 19626 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19968 19777 gene locus_tag LOCUS_23420 19968 19777 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228992.1 protein_id gnl|my_center|LOCUS_23420 20242 20042 gene locus_tag LOCUS_23430 20242 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 20202 21044 gene locus_tag LOCUS_23440 20202 21044 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039612.1 protein_id gnl|my_center|LOCUS_23440 21241 21050 gene locus_tag LOCUS_23450 21241 21050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 21170 21778 gene locus_tag LOCUS_23460 21170 21778 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_23460 24567 21775 gene locus_tag LOCUS_23470 24567 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 25358 24690 gene locus_tag LOCUS_23480 gene folE 25358 24690 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_23480 25512 26534 gene locus_tag LOCUS_23490 25512 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 26649 26575 gene locus_tag LOCUS_t00380 26649 26575 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26786 27259 gene locus_tag LOCUS_23500 26786 27259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 28259 27309 gene locus_tag LOCUS_23510 28259 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 29384 28311 gene locus_tag LOCUS_23520 29384 28311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(28821..28823),aa:Sec) note codon on position 188 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23520 29438 29513 gene locus_tag LOCUS_t00390 29438 29513 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29568 29644 gene locus_tag LOCUS_t00400 29568 29644 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29691 30236 gene locus_tag LOCUS_23530 29691 30236 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_23530 30873 30304 gene locus_tag LOCUS_23540 30873 30304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 31003 31572 gene locus_tag LOCUS_23550 31003 31572 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_23550 32759 31569 gene locus_tag LOCUS_23560 32759 31569 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_23560 32974 33405 gene locus_tag LOCUS_23570 32974 33405 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_23570 33446 33712 gene locus_tag LOCUS_23580 33446 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 33709 34116 gene locus_tag LOCUS_23590 33709 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 35207 34197 gene locus_tag LOCUS_23600 35207 34197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 35531 35208 gene locus_tag LOCUS_23610 35531 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 36767 35655 gene locus_tag LOCUS_23620 gene ald 36767 35655 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_23620 36766 38568 gene locus_tag LOCUS_23630 36766 38568 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930084.1 protein_id gnl|my_center|LOCUS_23630 39574 38588 gene locus_tag LOCUS_23640 39574 38588 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_23640 39737 40765 gene locus_tag LOCUS_23650 39737 40765 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_23650 43202 40797 gene locus_tag LOCUS_23660 43202 40797 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_23660 43986 43306 gene locus_tag LOCUS_23670 43986 43306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 44170 45624 gene locus_tag LOCUS_23680 44170 45624 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284768.1 protein_id gnl|my_center|LOCUS_23680 45691 46854 gene locus_tag LOCUS_23690 45691 46854 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence33 1221 148 gene locus_tag LOCUS_23700 1221 148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_23700 1394 4438 gene locus_tag LOCUS_23710 1394 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 6744 4549 gene locus_tag LOCUS_23720 6744 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 8447 6822 gene locus_tag LOCUS_23730 8447 6822 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_23730 8944 8516 gene locus_tag LOCUS_23740 8944 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 9141 8941 gene locus_tag LOCUS_23750 9141 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 9277 9483 gene locus_tag LOCUS_23760 9277 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9494 10291 gene locus_tag LOCUS_23770 9494 10291 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102100637.1 protein_id gnl|my_center|LOCUS_23770 10353 11501 gene locus_tag LOCUS_23780 10353 11501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_23780 11498 12430 gene locus_tag LOCUS_23790 11498 12430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_23790 12607 13707 gene locus_tag LOCUS_23800 12607 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 13790 15370 gene locus_tag LOCUS_23810 13790 15370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_23810 15451 16617 gene locus_tag LOCUS_23820 15451 16617 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_23820 17541 16849 gene locus_tag LOCUS_23830 17541 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 18298 17876 gene locus_tag LOCUS_23840 18298 17876 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_23840 20040 18289 gene locus_tag LOCUS_23850 20040 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 20130 20807 gene locus_tag LOCUS_23860 20130 20807 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_23860 21300 20836 gene locus_tag LOCUS_23870 21300 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 21005 21014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22435 21545 gene locus_tag LOCUS_23880 22435 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 22639 23274 gene locus_tag LOCUS_23890 22639 23274 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_23890 23271 24548 gene locus_tag LOCUS_23900 23271 24548 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_23900 24548 25786 gene locus_tag LOCUS_23910 24548 25786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 26619 25876 gene locus_tag LOCUS_23920 26619 25876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 26740 27852 gene locus_tag LOCUS_23930 26740 27852 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_23930 28413 27925 gene locus_tag LOCUS_23940 28413 27925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 28638 28417 gene locus_tag LOCUS_23950 28638 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 28730 30310 gene locus_tag LOCUS_23960 28730 30310 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039293.1 protein_id gnl|my_center|LOCUS_23960 30373 32379 gene locus_tag LOCUS_23970 30373 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 32534 33235 gene locus_tag LOCUS_23980 gene mubX 32534 33235 CDS product mutanobactin A system ABC transporter ATP-binding subunit MubX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263277.1 protein_id gnl|my_center|LOCUS_23980 33245 35692 gene locus_tag LOCUS_23990 33245 35692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 36946 35735 gene locus_tag LOCUS_24000 36946 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 37120 36965 gene locus_tag LOCUS_24010 37120 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 37119 38642 gene locus_tag LOCUS_24020 37119 38642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776875.1 protein_id gnl|my_center|LOCUS_24020 38661 39821 gene locus_tag LOCUS_24030 38661 39821 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_24030 40969 39827 gene locus_tag LOCUS_24040 40969 39827 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_24040 41097 42395 gene locus_tag LOCUS_24050 gene paaF 41097 42395 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527791.1 protein_id gnl|my_center|LOCUS_24050 42448 42756 gene locus_tag LOCUS_24060 42448 42756 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397896.1 protein_id gnl|my_center|LOCUS_24060 42767 43570 gene locus_tag LOCUS_24070 42767 43570 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_24070 43658 44806 gene locus_tag LOCUS_24080 43658 44806 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_24080 46471 44891 gene locus_tag LOCUS_24090 46471 44891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence34 6151 5900 gene locus_tag LOCUS_24100 6151 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 6378 6178 gene locus_tag LOCUS_24110 6378 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 14142 6460 gene locus_tag LOCUS_24120 14142 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 17182 14063 gene locus_tag LOCUS_24130 17182 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14644 14743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17474 17863 gene locus_tag LOCUS_24140 17474 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 18784 17900 gene locus_tag LOCUS_24150 gene htdY 18784 17900 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_24150 19754 18837 gene locus_tag LOCUS_24160 19754 18837 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_24160 20150 19827 gene locus_tag LOCUS_24170 20150 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 20176 22131 gene locus_tag LOCUS_24180 20176 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 22136 23404 gene locus_tag LOCUS_24190 22136 23404 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_24190 23409 24368 gene locus_tag LOCUS_24200 gene coaA 23409 24368 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 protein_id gnl|my_center|LOCUS_24200 24431 24874 gene locus_tag LOCUS_24210 24431 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 24886 25683 gene locus_tag LOCUS_24220 24886 25683 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040639.1 protein_id gnl|my_center|LOCUS_24220 25713 26960 gene locus_tag LOCUS_24230 25713 26960 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_24230 27085 28026 gene locus_tag LOCUS_24240 gene map 27085 28026 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_24240 28030 28389 gene locus_tag LOCUS_24250 28030 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 28431 28832 gene locus_tag LOCUS_24260 28431 28832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 28832 29416 gene locus_tag LOCUS_24270 28832 29416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 29650 29426 gene locus_tag LOCUS_24280 29650 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 29840 30835 gene locus_tag LOCUS_24290 29840 30835 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_24290 31515 30862 gene locus_tag LOCUS_24300 gene msrA 31515 30862 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_24300 31566 32057 gene locus_tag LOCUS_24310 31566 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 32068 32511 gene locus_tag LOCUS_24320 32068 32511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24320 32531 33442 gene locus_tag LOCUS_24330 32531 33442 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_24330 33545 34333 gene locus_tag LOCUS_24340 33545 34333 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085614.1 protein_id gnl|my_center|LOCUS_24340 34391 34813 gene locus_tag LOCUS_24350 34391 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 36367 34850 gene locus_tag LOCUS_24360 36367 34850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24360 37646 36441 gene locus_tag LOCUS_24370 37646 36441 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_24370 37783 38706 gene locus_tag LOCUS_24380 37783 38706 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_24380 38738 39025 gene locus_tag LOCUS_24390 38738 39025 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_24390 39068 39454 gene locus_tag LOCUS_24400 39068 39454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 40315 39503 gene locus_tag LOCUS_24410 40315 39503 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 protein_id gnl|my_center|LOCUS_24410 41727 40411 gene locus_tag LOCUS_24420 41727 40411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 42450 41809 gene locus_tag LOCUS_24430 42450 41809 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_24430 42598 43284 gene locus_tag LOCUS_24440 42598 43284 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 protein_id gnl|my_center|LOCUS_24440 43453 44613 gene locus_tag LOCUS_24450 43453 44613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 <45896 44683 gene locus_tag LOCUS_24460 <45896 44683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727557.1:HNH endonuclease domain-containing protein >Feature sequence35 389 1723 gene locus_tag LOCUS_24470 389 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1890 3395 gene locus_tag LOCUS_24480 1890 3395 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_24480 4261 3380 gene locus_tag LOCUS_24490 4261 3380 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_24490 6337 4349 gene locus_tag LOCUS_24500 6337 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 6760 6392 gene locus_tag LOCUS_24510 6760 6392 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_24510 7887 6796 gene locus_tag LOCUS_24520 7887 6796 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389711.1 protein_id gnl|my_center|LOCUS_24520 7904 8626 gene locus_tag LOCUS_24530 7904 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 10385 8673 gene locus_tag LOCUS_24540 10385 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 11341 10409 gene locus_tag LOCUS_24550 11341 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11453 12592 gene locus_tag LOCUS_24560 11453 12592 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225711.1 protein_id gnl|my_center|LOCUS_24560 12625 13341 gene locus_tag LOCUS_24570 12625 13341 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_24570 13413 15929 gene locus_tag LOCUS_24580 13413 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 16759 17325 gene locus_tag LOCUS_24590 16759 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 17982 17482 gene locus_tag LOCUS_24600 17982 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 18620 17979 gene locus_tag LOCUS_24610 18620 17979 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_24610 18785 20458 gene locus_tag LOCUS_24620 18785 20458 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034475911.1 protein_id gnl|my_center|LOCUS_24620 20446 21360 gene locus_tag LOCUS_24630 20446 21360 CDS product XamI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040059.1 protein_id gnl|my_center|LOCUS_24630 21464 21766 gene locus_tag LOCUS_24640 21464 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 21717 22040 gene locus_tag LOCUS_24650 21717 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 22165 22626 gene locus_tag LOCUS_24660 22165 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 25351 22778 gene locus_tag LOCUS_24670 25351 22778 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_24670 25365 26510 gene locus_tag LOCUS_24680 25365 26510 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_24680 26507 26926 gene locus_tag LOCUS_24690 26507 26926 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807885.1 protein_id gnl|my_center|LOCUS_24690 27367 26930 gene locus_tag LOCUS_24700 gene dtd 27367 26930 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_24700 27782 27372 gene locus_tag LOCUS_24710 27782 27372 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_24710 30248 27822 gene locus_tag LOCUS_24720 30248 27822 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_24720 30542 32236 gene locus_tag LOCUS_24730 30542 32236 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_24730 32303 33289 gene locus_tag LOCUS_24740 gene appB 32303 33289 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_24740 33276 34151 gene locus_tag LOCUS_24750 33276 34151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_24750 34284 34562 gene locus_tag LOCUS_24760 34284 34562 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214112.1 protein_id gnl|my_center|LOCUS_24760 36054 34615 gene locus_tag LOCUS_24770 36054 34615 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_24770 37202 35985 gene locus_tag LOCUS_24780 37202 35985 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 protein_id gnl|my_center|LOCUS_24780 37335 40637 gene locus_tag LOCUS_24790 37335 40637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 40811 41533 gene locus_tag LOCUS_24800 40811 41533 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 protein_id gnl|my_center|LOCUS_24800 41570 42589 gene locus_tag LOCUS_24810 41570 42589 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807522.1 protein_id gnl|my_center|LOCUS_24810 42635 42838 gene locus_tag LOCUS_24820 42635 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 42848 43120 gene locus_tag LOCUS_24830 42848 43120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence36 447 43 gene locus_tag LOCUS_24840 447 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1482 454 gene locus_tag LOCUS_24850 1482 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2612 1479 gene locus_tag LOCUS_24860 2612 1479 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_24860 2801 3484 gene locus_tag LOCUS_24870 2801 3484 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530097.1 protein_id gnl|my_center|LOCUS_24870 3608 4615 gene locus_tag LOCUS_24880 3608 4615 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_24880 4612 5634 gene locus_tag LOCUS_24890 4612 5634 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_24890 6279 5644 gene locus_tag LOCUS_24900 6279 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7556 6369 gene locus_tag LOCUS_24910 7556 6369 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227992.1 protein_id gnl|my_center|LOCUS_24910 8217 7537 gene locus_tag LOCUS_24920 8217 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 8337 9125 gene locus_tag LOCUS_24930 8337 9125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031343.1 protein_id gnl|my_center|LOCUS_24930 9178 9621 gene locus_tag LOCUS_24940 9178 9621 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_24940 9954 9535 gene locus_tag LOCUS_24950 9954 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 10732 9968 gene locus_tag LOCUS_24960 10732 9968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 protein_id gnl|my_center|LOCUS_24960 11741 10740 gene locus_tag LOCUS_24970 11741 10740 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804086.1 protein_id gnl|my_center|LOCUS_24970 12852 11773 gene locus_tag LOCUS_24980 12852 11773 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804087.1 protein_id gnl|my_center|LOCUS_24980 12971 13555 gene locus_tag LOCUS_24990 gene mog 12971 13555 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_24990 13652 14422 gene locus_tag LOCUS_25000 gene udp 13652 14422 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 protein_id gnl|my_center|LOCUS_25000 15218 14424 gene locus_tag LOCUS_25010 15218 14424 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223448.1 protein_id gnl|my_center|LOCUS_25010 16319 15330 gene locus_tag LOCUS_25020 16319 15330 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_25020 17010 16708 gene locus_tag LOCUS_25030 17010 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 17228 17076 gene locus_tag LOCUS_25040 17228 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 17341 20220 gene locus_tag LOCUS_25050 17341 20220 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_25050 20707 20312 gene locus_tag LOCUS_25060 20707 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 21528 20863 gene locus_tag LOCUS_25070 21528 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 22941 21583 gene locus_tag LOCUS_25080 22941 21583 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104315.1 protein_id gnl|my_center|LOCUS_25080 23358 22960 gene locus_tag LOCUS_25090 23358 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 23600 23355 gene locus_tag LOCUS_25100 23600 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 24090 23686 gene locus_tag LOCUS_25110 24090 23686 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_25110 25348 24170 gene locus_tag LOCUS_25120 25348 24170 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728134.1 protein_id gnl|my_center|LOCUS_25120 25465 26265 gene locus_tag LOCUS_25130 25465 26265 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_25130 26360 27277 gene locus_tag LOCUS_25140 26360 27277 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_25140 27473 27733 gene locus_tag LOCUS_25150 27473 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 27739 28149 gene locus_tag LOCUS_25160 27739 28149 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_25160 28810 28208 gene locus_tag LOCUS_25170 gene cysC 28810 28208 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_25170 30675 28807 gene locus_tag LOCUS_25180 gene cysN 30675 28807 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_25180 31598 30675 gene locus_tag LOCUS_25190 gene cysD 31598 30675 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_25190 33907 31595 gene locus_tag LOCUS_25200 33907 31595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 35128 33932 gene locus_tag LOCUS_25210 35128 33932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 35917 35168 gene locus_tag LOCUS_25220 35917 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 36941 35967 gene locus_tag LOCUS_25230 36941 35967 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_25230 37101 37526 gene locus_tag LOCUS_25240 37101 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 37526 37915 gene locus_tag LOCUS_25250 37526 37915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 37931 39061 gene locus_tag LOCUS_25260 37931 39061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 39152 39574 gene locus_tag LOCUS_25270 39152 39574 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_25270 39623 39994 gene locus_tag LOCUS_25280 gene cadR 39623 39994 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_25280 40045 42216 gene locus_tag LOCUS_25290 40045 42216 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228662.1 protein_id gnl|my_center|LOCUS_25290 42221 42784 gene locus_tag LOCUS_25300 42221 42784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence37 1006 305 gene locus_tag LOCUS_25310 1006 305 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287595.1 protein_id gnl|my_center|LOCUS_25310 1843 1016 gene locus_tag LOCUS_25320 gene fdhD 1843 1016 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_25320 3613 1994 gene locus_tag LOCUS_25330 gene groL 3613 1994 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_25330 4762 3728 gene locus_tag LOCUS_25340 4762 3728 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_25340 5399 4776 gene locus_tag LOCUS_25350 5399 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 5507 6151 gene locus_tag LOCUS_25360 gene upp 5507 6151 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417245.1 protein_id gnl|my_center|LOCUS_25360 7222 6275 gene locus_tag LOCUS_25370 gene rbsK 7222 6275 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_25370 8592 7219 gene locus_tag LOCUS_25380 8592 7219 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_25380 9688 8612 gene locus_tag LOCUS_25390 9688 8612 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_25390 10898 9759 gene locus_tag LOCUS_25400 gene hisC 10898 9759 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_25400 10952 13405 gene locus_tag LOCUS_25410 10952 13405 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_25410 13420 14496 gene locus_tag LOCUS_25420 13420 14496 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_25420 14596 14523 gene locus_tag LOCUS_t00410 14596 14523 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15403 14630 gene locus_tag LOCUS_25430 gene rlmB 15403 14630 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_25430 16095 15553 gene locus_tag LOCUS_25440 gene ispF 16095 15553 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_25440 16712 16107 gene locus_tag LOCUS_25450 gene ispD 16712 16107 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_25450 17207 16851 gene locus_tag LOCUS_25460 17207 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 17455 17204 gene locus_tag LOCUS_25470 17455 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 19412 17805 gene locus_tag LOCUS_25480 19412 17805 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_25480 20440 19511 gene locus_tag LOCUS_25490 20440 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 21246 20437 gene locus_tag LOCUS_25500 21246 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 23264 21243 gene locus_tag LOCUS_25510 23264 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 24478 23267 gene locus_tag LOCUS_25520 24478 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 25680 24856 gene locus_tag LOCUS_25530 25680 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 28184 25683 gene locus_tag LOCUS_25540 gene clpC1 28184 25683 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 protein_id gnl|my_center|LOCUS_25540 28306 29337 gene locus_tag LOCUS_25550 28306 29337 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 protein_id gnl|my_center|LOCUS_25550 29334 30233 gene locus_tag LOCUS_25560 29334 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 31601 30282 gene locus_tag LOCUS_25570 31601 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 32765 31611 gene locus_tag LOCUS_25580 32765 31611 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_25580 32864 33565 gene locus_tag LOCUS_25590 32864 33565 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_25590 34080 33598 gene locus_tag LOCUS_25600 gene folK 34080 33598 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_25600 34563 34108 gene locus_tag LOCUS_25610 34563 34108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 35090 34572 gene locus_tag LOCUS_25620 35090 34572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 35770 35171 gene locus_tag LOCUS_25630 gene hpt 35770 35171 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_25630 36759 35782 gene locus_tag LOCUS_25640 gene tilS 36759 35782 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731045.1 protein_id gnl|my_center|LOCUS_25640 37903 36743 gene locus_tag LOCUS_25650 37903 36743 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_25650 38183 37911 gene locus_tag LOCUS_25660 38183 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 38591 40381 gene locus_tag LOCUS_25670 38591 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 41279 40422 gene locus_tag LOCUS_25680 41279 40422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence38 2717 897 gene locus_tag LOCUS_25690 2717 897 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_25690 3588 2743 gene locus_tag LOCUS_25700 3588 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 5299 3665 gene locus_tag LOCUS_25710 5299 3665 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_25710 6115 5357 gene locus_tag LOCUS_25720 gene fabG 6115 5357 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_25720 7228 6176 gene locus_tag LOCUS_25730 7228 6176 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_25730 7372 8748 gene locus_tag LOCUS_25740 7372 8748 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_25740 8823 9971 gene locus_tag LOCUS_25750 8823 9971 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080139337.1 protein_id gnl|my_center|LOCUS_25750 11314 10004 gene locus_tag LOCUS_25760 11314 10004 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013726.1 protein_id gnl|my_center|LOCUS_25760 11382 11457 gene locus_tag LOCUS_t00420 11382 11457 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12349 11429 gene locus_tag LOCUS_25770 12349 11429 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_25770 13143 12370 gene locus_tag LOCUS_25780 13143 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 14004 13225 gene locus_tag LOCUS_25790 14004 13225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_25790 15413 14004 gene locus_tag LOCUS_25800 15413 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 16189 15410 gene locus_tag LOCUS_25810 16189 15410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226152.1 protein_id gnl|my_center|LOCUS_25810 17522 16296 gene locus_tag LOCUS_25820 17522 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 17640 18614 gene locus_tag LOCUS_25830 17640 18614 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_25830 20335 18611 gene locus_tag LOCUS_25840 20335 18611 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_25840 20217 20432 gene locus_tag LOCUS_25850 20217 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 20524 21579 gene locus_tag LOCUS_25860 20524 21579 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_25860 21579 22262 gene locus_tag LOCUS_25870 21579 22262 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_25870 22259 23371 gene locus_tag LOCUS_25880 22259 23371 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_25880 23368 24243 gene locus_tag LOCUS_25890 23368 24243 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_25890 24253 25425 gene locus_tag LOCUS_25900 gene pobA 24253 25425 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976283.1 protein_id gnl|my_center|LOCUS_25900 26352 25459 gene locus_tag LOCUS_25910 26352 25459 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_25910 26768 26349 gene locus_tag LOCUS_25920 26768 26349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 26900 27844 gene locus_tag LOCUS_25930 26900 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 27943 29430 gene locus_tag LOCUS_25940 27943 29430 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_25940 29427 30419 gene locus_tag LOCUS_25950 29427 30419 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919475.1 protein_id gnl|my_center|LOCUS_25950 30416 31399 gene locus_tag LOCUS_25960 30416 31399 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_25960 32917 31412 gene locus_tag LOCUS_25970 32917 31412 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091631.1 protein_id gnl|my_center|LOCUS_25970 32998 34389 gene locus_tag LOCUS_25980 32998 34389 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_25980 34393 35781 gene locus_tag LOCUS_25990 34393 35781 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_25990 35652 35751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35796 36086 gene locus_tag LOCUS_26000 35796 36086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 36162 36527 gene locus_tag LOCUS_26010 36162 36527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 36484 37908 gene locus_tag LOCUS_26020 36484 37908 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090311.1 protein_id gnl|my_center|LOCUS_26020 39981 37978 gene locus_tag LOCUS_26030 39981 37978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 40447 40546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40589 41359 gene locus_tag LOCUS_26040 40589 41359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence39 1621 1319 gene locus_tag LOCUS_26050 1621 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1909 1766 gene locus_tag LOCUS_26060 1909 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2050 2958 gene locus_tag LOCUS_26070 2050 2958 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_26070 2963 3898 gene locus_tag LOCUS_26080 2963 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_26080 4062 4697 gene locus_tag LOCUS_26090 4062 4697 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389679.1 protein_id gnl|my_center|LOCUS_26090 5150 4713 gene locus_tag LOCUS_26100 5150 4713 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_26100 5593 6201 gene locus_tag LOCUS_26110 5593 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 6435 6190 gene locus_tag LOCUS_26120 6435 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 7635 6544 gene locus_tag LOCUS_26130 7635 6544 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_26130 7993 7661 gene locus_tag LOCUS_26140 7993 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 8115 9203 gene locus_tag LOCUS_26150 8115 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 9348 9866 gene locus_tag LOCUS_26160 9348 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 11220 10033 gene locus_tag LOCUS_26170 11220 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 11399 12175 gene locus_tag LOCUS_26180 11399 12175 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_26180 13883 12474 gene locus_tag LOCUS_26190 13883 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 14631 13903 gene locus_tag LOCUS_26200 14631 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 14752 16449 gene locus_tag LOCUS_26210 14752 16449 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194903824.1 protein_id gnl|my_center|LOCUS_26210 16572 18842 gene locus_tag LOCUS_26220 16572 18842 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_26220 20105 18942 gene locus_tag LOCUS_26230 20105 18942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 protein_id gnl|my_center|LOCUS_26230 21553 20288 gene locus_tag LOCUS_26240 21553 20288 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_26240 22722 21571 gene locus_tag LOCUS_26250 22722 21571 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_26250 23825 22854 gene locus_tag LOCUS_26260 23825 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 24355 23822 gene locus_tag LOCUS_26270 24355 23822 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_26270 24495 25265 gene locus_tag LOCUS_26280 24495 25265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_26280 25306 26628 gene locus_tag LOCUS_26290 25306 26628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 26742 29579 gene locus_tag LOCUS_26300 26742 29579 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_26300 30603 29656 gene locus_tag LOCUS_26310 30603 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 32459 30693 gene locus_tag LOCUS_26320 32459 30693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 34192 32432 gene locus_tag LOCUS_26330 34192 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 36880 34364 gene locus_tag LOCUS_26340 36880 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 39408 37009 gene locus_tag LOCUS_26350 39408 37009 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_26350 40239 39472 gene locus_tag LOCUS_26360 40239 39472 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 protein_id gnl|my_center|LOCUS_26360 40391 41080 gene locus_tag LOCUS_26370 40391 41080 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_26370 41322 41552 gene locus_tag LOCUS_26380 41322 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence40 <1 503 gene locus_tag LOCUS_26390 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225685.1:HNH endonuclease signature motif containing protein 1422 703 gene locus_tag LOCUS_26400 1422 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2104 4815 gene locus_tag LOCUS_26410 2104 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4963 6636 gene locus_tag LOCUS_26420 4963 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6675 7253 gene locus_tag LOCUS_26430 6675 7253 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731335.1 protein_id gnl|my_center|LOCUS_26430 7383 7574 gene locus_tag LOCUS_26440 7383 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 7575 10625 gene locus_tag LOCUS_26450 7575 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26450 13955 10638 gene locus_tag LOCUS_26460 13955 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 14184 15815 gene locus_tag LOCUS_26470 14184 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 15872 19192 gene locus_tag LOCUS_26480 15872 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 20106 19318 gene locus_tag LOCUS_26490 20106 19318 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_26490 20962 20180 gene locus_tag LOCUS_26500 20962 20180 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_26500 21632 20964 gene locus_tag LOCUS_26510 21632 20964 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_26510 22617 21679 gene locus_tag LOCUS_26520 22617 21679 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_26520 23091 22624 gene locus_tag LOCUS_26530 23091 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 23287 23559 gene locus_tag LOCUS_26540 23287 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 23569 24549 gene locus_tag LOCUS_26550 gene hemB 23569 24549 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_26550 25290 24616 gene locus_tag LOCUS_26560 25290 24616 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_26560 26464 25274 gene locus_tag LOCUS_26570 26464 25274 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_26570 28581 26488 gene locus_tag LOCUS_26580 gene thrS 28581 26488 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_26580 28868 28689 gene locus_tag LOCUS_26590 28868 28689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 32615 29037 gene locus_tag LOCUS_26600 gene dnaE 32615 29037 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_26600 32852 33739 gene locus_tag LOCUS_26610 32852 33739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 33751 34590 gene locus_tag LOCUS_26620 33751 34590 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_26620 35078 34587 gene locus_tag LOCUS_26630 35078 34587 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_26630 35384 36517 gene locus_tag LOCUS_26640 35384 36517 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_26640 36738 40004 gene locus_tag LOCUS_26650 36738 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence41 <1 1466 gene locus_tag LOCUS_26660 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein 1793 3193 gene locus_tag LOCUS_26670 1793 3193 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_26670 3282 4211 gene locus_tag LOCUS_26680 3282 4211 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_26680 4199 4993 gene locus_tag LOCUS_26690 4199 4993 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_26690 5014 6417 gene locus_tag LOCUS_26700 5014 6417 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_26700 6420 6875 gene locus_tag LOCUS_26710 6420 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 6930 8261 gene locus_tag LOCUS_26720 6930 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 9542 8277 gene locus_tag LOCUS_26730 9542 8277 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_26730 10928 9573 gene locus_tag LOCUS_26740 10928 9573 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_26740 13383 11005 gene locus_tag LOCUS_26750 13383 11005 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_26750 13837 13412 gene locus_tag LOCUS_26760 13837 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 14064 13936 gene locus_tag LOCUS_26770 14064 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 14290 14075 gene locus_tag LOCUS_26780 14290 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 15839 14454 gene locus_tag LOCUS_26790 15839 14454 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_26790 16507 16061 gene locus_tag LOCUS_26800 16507 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 16727 16500 gene locus_tag LOCUS_26810 16727 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 17424 16732 gene locus_tag LOCUS_26820 17424 16732 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_26820 17587 17596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18722 17736 gene locus_tag LOCUS_26830 18722 17736 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_26830 18788 19261 gene locus_tag LOCUS_26840 18788 19261 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_26840 20238 19327 gene locus_tag LOCUS_26850 20238 19327 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_26850 23371 20225 gene locus_tag LOCUS_26860 23371 20225 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_26860 24144 23371 gene locus_tag LOCUS_26870 24144 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 24475 24275 gene locus_tag LOCUS_26880 24475 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 24904 24503 gene locus_tag LOCUS_26890 24904 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 27312 25225 gene locus_tag LOCUS_26900 27312 25225 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_26900 27814 27347 gene locus_tag LOCUS_26910 27814 27347 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_26910 29070 27811 gene locus_tag LOCUS_26920 29070 27811 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089076.1 protein_id gnl|my_center|LOCUS_26920 29127 29441 gene locus_tag LOCUS_26930 29127 29441 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529740.1 protein_id gnl|my_center|LOCUS_26930 30084 29476 gene locus_tag LOCUS_26940 30084 29476 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731327.1 protein_id gnl|my_center|LOCUS_26940 31341 30181 gene locus_tag LOCUS_26950 31341 30181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 33069 31372 gene locus_tag LOCUS_26960 33069 31372 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_26960 33494 33066 gene locus_tag LOCUS_26970 33494 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 34757 33537 gene locus_tag LOCUS_26980 34757 33537 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_26980 34905 36131 gene locus_tag LOCUS_26990 34905 36131 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 protein_id gnl|my_center|LOCUS_26990 36828 36379 gene locus_tag LOCUS_27000 36828 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence42 497 955 gene locus_tag LOCUS_27010 497 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1376 2590 gene locus_tag LOCUS_27020 1376 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2709 4841 gene locus_tag LOCUS_27030 2709 4841 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_27030 4912 5769 gene locus_tag LOCUS_27040 4912 5769 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_27040 6938 5796 gene locus_tag LOCUS_27050 6938 5796 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_27050 7049 8569 gene locus_tag LOCUS_27060 gene tcuA 7049 8569 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_27060 8625 10889 gene locus_tag LOCUS_27070 8625 10889 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_27070 12245 10914 gene locus_tag LOCUS_27080 gene argG 12245 10914 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_27080 12401 13585 gene locus_tag LOCUS_27090 12401 13585 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_27090 14143 13688 gene locus_tag LOCUS_27100 14143 13688 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_27100 14216 14677 gene locus_tag LOCUS_27110 14216 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 14693 15865 gene locus_tag LOCUS_27120 14693 15865 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_27120 15893 17842 gene locus_tag LOCUS_27130 gene tkt 15893 17842 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_27130 17876 19009 gene locus_tag LOCUS_27140 gene tal 17876 19009 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031085.1 protein_id gnl|my_center|LOCUS_27140 19087 19644 gene locus_tag LOCUS_27150 19087 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 19641 22163 gene locus_tag LOCUS_27160 19641 22163 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_27160 22230 22979 gene locus_tag LOCUS_27170 22230 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 22997 23608 gene locus_tag LOCUS_27180 22997 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 23863 23642 gene locus_tag LOCUS_27190 23863 23642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 25143 23860 gene locus_tag LOCUS_27200 25143 23860 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_27200 26126 25137 gene locus_tag LOCUS_27210 26126 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 27568 26123 gene locus_tag LOCUS_27220 27568 26123 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_27220 27598 28362 gene locus_tag LOCUS_27230 27598 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_27230 28683 28363 gene locus_tag LOCUS_27240 28683 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 29950 28787 gene locus_tag LOCUS_27250 gene rnd 29950 28787 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 protein_id gnl|my_center|LOCUS_27250 30645 30067 gene locus_tag LOCUS_27260 30645 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 31106 30642 gene locus_tag LOCUS_27270 31106 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 31220 31531 gene locus_tag LOCUS_27280 31220 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 32986 31553 gene locus_tag LOCUS_27290 gene pyk 32986 31553 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_27290 33054 33671 gene locus_tag LOCUS_27300 33054 33671 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_27300 34526 33711 gene locus_tag LOCUS_27310 34526 33711 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_27310 34661 35452 gene locus_tag LOCUS_27320 34661 35452 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_27320 35449 36861 gene locus_tag LOCUS_27330 35449 36861 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730277.1 protein_id gnl|my_center|LOCUS_27330 36913 37569 gene locus_tag LOCUS_27340 36913 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 37693 39237 gene locus_tag LOCUS_27350 37693 39237 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368533.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence43 <1 624 gene locus_tag LOCUS_27360 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388389.1:diguanylate cyclase 1195 668 gene locus_tag LOCUS_27370 1195 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2012 1221 gene locus_tag LOCUS_27380 2012 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3655 2081 gene locus_tag LOCUS_27390 3655 2081 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_27390 3554 3745 gene locus_tag LOCUS_27400 3554 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3827 4348 gene locus_tag LOCUS_27410 3827 4348 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_27410 4353 5252 gene locus_tag LOCUS_27420 4353 5252 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_27420 5536 5318 gene locus_tag LOCUS_27430 5536 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5746 5558 gene locus_tag LOCUS_27440 5746 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7434 5914 gene locus_tag LOCUS_27450 7434 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 7483 7977 gene locus_tag LOCUS_27460 7483 7977 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_27460 8010 8384 gene locus_tag LOCUS_27470 8010 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 10574 8409 gene locus_tag LOCUS_27480 10574 8409 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_27480 10664 11182 gene locus_tag LOCUS_27490 10664 11182 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_27490 11249 12154 gene locus_tag LOCUS_27500 11249 12154 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_27500 12212 13624 gene locus_tag LOCUS_27510 gene sufB 12212 13624 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_27510 13624 14682 gene locus_tag LOCUS_27520 13624 14682 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_27520 14700 15578 gene locus_tag LOCUS_27530 14700 15578 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_27530 15593 16006 gene locus_tag LOCUS_27540 15593 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 16073 17323 gene locus_tag LOCUS_27550 16073 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 17378 17710 gene locus_tag LOCUS_27560 17378 17710 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080101.1 protein_id gnl|my_center|LOCUS_27560 17707 18597 gene locus_tag LOCUS_27570 gene sufC 17707 18597 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_27570 18699 18995 gene locus_tag LOCUS_27580 18699 18995 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 protein_id gnl|my_center|LOCUS_27580 19006 19560 gene locus_tag LOCUS_27590 19006 19560 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_27590 20754 19585 gene locus_tag LOCUS_27600 20754 19585 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_27600 20419 20323 gene locus_tag LOCUS_t00430 20419 20323 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21257 20751 gene locus_tag LOCUS_27610 gene sufU 21257 20751 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 protein_id gnl|my_center|LOCUS_27610 22535 21288 gene locus_tag LOCUS_27620 22535 21288 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_27620 23314 22532 gene locus_tag LOCUS_27630 gene sufC 23314 22532 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_27630 24764 23391 gene locus_tag LOCUS_27640 24764 23391 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_27640 24815 26257 gene locus_tag LOCUS_27650 24815 26257 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_27650 26334 27407 gene locus_tag LOCUS_27660 26334 27407 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_27660 27404 28225 gene locus_tag LOCUS_27670 27404 28225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_27670 28870 28229 gene locus_tag LOCUS_27680 28870 28229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_27680 30753 29008 gene locus_tag LOCUS_27690 30753 29008 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_27690 31021 32133 gene locus_tag LOCUS_27700 31021 32133 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_27700 32210 32656 gene locus_tag LOCUS_27710 32210 32656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 32685 32906 gene locus_tag LOCUS_27720 32685 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 32969 33733 gene locus_tag LOCUS_27730 32969 33733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 34298 33801 gene locus_tag LOCUS_27740 34298 33801 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_27740 37029 34327 gene locus_tag LOCUS_27750 gene aceE 37029 34327 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_27750 37123 38229 gene locus_tag LOCUS_27760 37123 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence44 99 413 gene locus_tag LOCUS_27770 99 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1398 559 gene locus_tag LOCUS_27780 1398 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2498 1539 gene locus_tag LOCUS_27790 2498 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2780 3961 gene locus_tag LOCUS_27800 2780 3961 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_27800 4902 4054 gene locus_tag LOCUS_27810 4902 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5249 6580 gene locus_tag LOCUS_27820 5249 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6577 8292 gene locus_tag LOCUS_27830 6577 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 8582 8506 gene locus_tag LOCUS_t00440 8582 8506 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11726 8676 gene locus_tag LOCUS_27840 11726 8676 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_27840 11810 12466 gene locus_tag LOCUS_27850 gene purN 11810 12466 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109748.1 protein_id gnl|my_center|LOCUS_27850 12463 14031 gene locus_tag LOCUS_27860 gene purH 12463 14031 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_27860 14093 15889 gene locus_tag LOCUS_27870 14093 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 17019 15871 gene locus_tag LOCUS_27880 17019 15871 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078326.1 protein_id gnl|my_center|LOCUS_27880 17170 17418 gene locus_tag LOCUS_27890 17170 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 17415 17816 gene locus_tag LOCUS_27900 17415 17816 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408465.1 protein_id gnl|my_center|LOCUS_27900 18183 17860 gene locus_tag LOCUS_27910 18183 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 19279 18290 gene locus_tag LOCUS_27920 19279 18290 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_27920 20260 19412 gene locus_tag LOCUS_27930 20260 19412 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 protein_id gnl|my_center|LOCUS_27930 21581 20301 gene locus_tag LOCUS_27940 21581 20301 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_27940 21672 23309 gene locus_tag LOCUS_27950 21672 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 23796 23314 gene locus_tag LOCUS_27960 23796 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 23844 25064 gene locus_tag LOCUS_27970 23844 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 25616 25089 gene locus_tag LOCUS_27980 25616 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 25659 25946 gene locus_tag LOCUS_27990 25659 25946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 26958 26059 gene locus_tag LOCUS_28000 26958 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 27198 28406 gene locus_tag LOCUS_28010 27198 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 29291 28407 gene locus_tag LOCUS_28020 gene sucD 29291 28407 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_28020 30465 29305 gene locus_tag LOCUS_28030 gene sucC 30465 29305 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_28030 32865 30517 gene locus_tag LOCUS_28040 gene pcrA 32865 30517 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_28040 34097 32889 gene locus_tag LOCUS_28050 gene argJ 34097 32889 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240078.1 protein_id gnl|my_center|LOCUS_28050 35785 34208 gene locus_tag LOCUS_28060 gene guaA 35785 34208 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_28060 37588 35939 gene locus_tag LOCUS_28070 gene groL 37588 35939 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_28070 37913 37623 gene locus_tag LOCUS_28080 gene groES 37913 37623 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence45 322 1119 gene locus_tag LOCUS_28090 322 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1413 4832 gene locus_tag LOCUS_28100 1413 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 7017 4849 gene locus_tag LOCUS_28110 gene recG 7017 4849 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_28110 8828 7014 gene locus_tag LOCUS_28120 8828 7014 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_28120 8930 9175 gene locus_tag LOCUS_28130 8930 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 9262 11049 gene locus_tag LOCUS_28140 9262 11049 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_28140 11468 11085 gene locus_tag LOCUS_28150 11468 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 12178 11486 gene locus_tag LOCUS_28160 12178 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 12423 12590 gene locus_tag LOCUS_28170 12423 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 12628 13182 gene locus_tag LOCUS_28180 12628 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 13653 13282 gene locus_tag LOCUS_28190 13653 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 14062 13643 gene locus_tag LOCUS_28200 14062 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 15200 14049 gene locus_tag LOCUS_28210 15200 14049 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_28210 16211 15303 gene locus_tag LOCUS_28220 16211 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 16179 18029 gene locus_tag LOCUS_28230 16179 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 18808 18035 gene locus_tag LOCUS_28240 18808 18035 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_28240 20556 18775 gene locus_tag LOCUS_28250 gene ettA 20556 18775 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_28250 21230 20592 gene locus_tag LOCUS_28260 21230 20592 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_28260 21551 21745 gene locus_tag LOCUS_28270 21551 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 22645 21785 gene locus_tag LOCUS_28280 22645 21785 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_28280 24545 22614 gene locus_tag LOCUS_28290 24545 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 26091 24547 gene locus_tag LOCUS_28300 26091 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 27434 26286 gene locus_tag LOCUS_28310 27434 26286 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066799.1 protein_id gnl|my_center|LOCUS_28310 27606 28373 gene locus_tag LOCUS_28320 27606 28373 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_28320 28408 29229 gene locus_tag LOCUS_28330 28408 29229 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_28330 31062 29263 gene locus_tag LOCUS_28340 31062 29263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 31199 32218 gene locus_tag LOCUS_28350 31199 32218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_28350 32222 32881 gene locus_tag LOCUS_28360 gene nucS 32222 32881 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence46 528 2531 gene locus_tag LOCUS_28370 528 2531 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_28370 2599 3417 gene locus_tag LOCUS_28380 2599 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3410 5242 gene locus_tag LOCUS_28390 3410 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 5316 5627 gene locus_tag LOCUS_28400 gene rplU 5316 5627 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258181.1 protein_id gnl|my_center|LOCUS_28400 5690 5941 gene locus_tag LOCUS_28410 gene rpmA 5690 5941 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_28410 6092 7375 gene locus_tag LOCUS_28420 gene obgE 6092 7375 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_28420 7524 8516 gene locus_tag LOCUS_28430 gene proB 7524 8516 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_28430 8627 9859 gene locus_tag LOCUS_28440 8627 9859 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_28440 9972 10853 gene locus_tag LOCUS_28450 9972 10853 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_28450 10886 12322 gene locus_tag LOCUS_28460 10886 12322 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_28460 13762 12332 gene locus_tag LOCUS_28470 13762 12332 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028829.1 protein_id gnl|my_center|LOCUS_28470 14606 13740 gene locus_tag LOCUS_28480 14606 13740 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_28480 14961 15554 gene locus_tag LOCUS_28490 gene nadD 14961 15554 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931710.1 protein_id gnl|my_center|LOCUS_28490 15551 15976 gene locus_tag LOCUS_28500 15551 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 17213 15999 gene locus_tag LOCUS_28510 17213 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 17561 17268 gene locus_tag LOCUS_28520 17561 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 17466 18320 gene locus_tag LOCUS_28530 gene galE 17466 18320 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_28530 19876 18278 gene locus_tag LOCUS_28540 19876 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 19974 21371 gene locus_tag LOCUS_28550 19974 21371 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090595110.1 protein_id gnl|my_center|LOCUS_28550 21368 22408 gene locus_tag LOCUS_28560 21368 22408 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337572.1 protein_id gnl|my_center|LOCUS_28560 22481 24196 gene locus_tag LOCUS_28570 22481 24196 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_28570 24201 25406 gene locus_tag LOCUS_28580 24201 25406 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 protein_id gnl|my_center|LOCUS_28580 26864 25518 gene locus_tag LOCUS_28590 26864 25518 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_28590 28028 27003 gene locus_tag LOCUS_28600 28028 27003 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_28600 28804 28025 gene locus_tag LOCUS_28610 gene hpaH 28804 28025 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528547.1 protein_id gnl|my_center|LOCUS_28610 28901 29338 gene locus_tag LOCUS_28620 gene cadI 28901 29338 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_28620 30181 29354 gene locus_tag LOCUS_28630 gene tesB 30181 29354 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174978.1 protein_id gnl|my_center|LOCUS_28630 31427 30210 gene locus_tag LOCUS_28640 31427 30210 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_28640 32301 31468 gene locus_tag LOCUS_28650 32301 31468 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_28650 32777 32397 gene locus_tag LOCUS_28660 32777 32397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 33034 32774 gene locus_tag LOCUS_28670 33034 32774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence47 296 99 gene locus_tag LOCUS_28680 296 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1439 768 gene locus_tag LOCUS_28690 1439 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1879 2385 gene locus_tag LOCUS_28700 1879 2385 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_28700 2866 2408 gene locus_tag LOCUS_28710 2866 2408 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831103.1 protein_id gnl|my_center|LOCUS_28710 3876 2929 gene locus_tag LOCUS_28720 3876 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4070 5209 gene locus_tag LOCUS_28730 4070 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 5281 6180 gene locus_tag LOCUS_28740 gene aztB 5281 6180 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013330.1 protein_id gnl|my_center|LOCUS_28740 7091 6207 gene locus_tag LOCUS_28750 7091 6207 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_28750 8268 7132 gene locus_tag LOCUS_28760 8268 7132 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_28760 10003 8309 gene locus_tag LOCUS_28770 10003 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 10088 11005 gene locus_tag LOCUS_28780 gene dapD 10088 11005 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_28780 11145 12347 gene locus_tag LOCUS_28790 11145 12347 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_28790 12487 12819 gene locus_tag LOCUS_28800 12487 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 15439 14021 gene locus_tag LOCUS_28810 15439 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 16748 15582 gene locus_tag LOCUS_28820 16748 15582 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_28820 17883 16858 gene locus_tag LOCUS_28830 17883 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 19089 17965 gene locus_tag LOCUS_28840 19089 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 20039 19251 gene locus_tag LOCUS_28850 20039 19251 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_28850 21134 20115 gene locus_tag LOCUS_28860 21134 20115 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_28860 21401 22648 gene locus_tag LOCUS_28870 21401 22648 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_28870 22693 23265 gene locus_tag LOCUS_28880 22693 23265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 28675 23273 gene locus_tag LOCUS_28890 28675 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 31476 28612 gene locus_tag LOCUS_28900 31476 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28900 28706 28715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence48 670 1854 gene locus_tag LOCUS_28910 670 1854 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_28910 2346 1996 gene locus_tag LOCUS_28920 2346 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3441 2416 gene locus_tag LOCUS_28930 3441 2416 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_28930 3613 4065 gene locus_tag LOCUS_28940 3613 4065 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_28940 4142 6856 gene locus_tag LOCUS_28950 4142 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6849 7496 gene locus_tag LOCUS_28960 6849 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 7583 7510 gene locus_tag LOCUS_t00450 7583 7510 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9261 7846 gene locus_tag LOCUS_28970 9261 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 10772 9507 gene locus_tag LOCUS_28980 10772 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 11009 11674 gene locus_tag LOCUS_28990 11009 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 11837 12268 gene locus_tag LOCUS_29000 11837 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 12265 12441 gene locus_tag LOCUS_29010 12265 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 13327 12782 gene locus_tag LOCUS_29020 13327 12782 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_29020 13896 13489 gene locus_tag LOCUS_29030 13896 13489 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 protein_id gnl|my_center|LOCUS_29030 14073 14273 gene locus_tag LOCUS_29040 14073 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 14421 14765 gene locus_tag LOCUS_29050 14421 14765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 15171 14806 gene locus_tag LOCUS_29060 15171 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 16072 15518 gene locus_tag LOCUS_29070 16072 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 16367 17458 gene locus_tag LOCUS_29080 16367 17458 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_29080 17087 17177 gene locus_tag LOCUS_t00460 17087 17177 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17604 20603 gene locus_tag LOCUS_29090 17604 20603 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_29090 20624 23218 gene locus_tag LOCUS_29100 20624 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 23289 23552 gene locus_tag LOCUS_29110 23289 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 23631 24758 gene locus_tag LOCUS_29120 23631 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 24895 25266 gene locus_tag LOCUS_29130 24895 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 25259 25459 gene locus_tag LOCUS_29140 25259 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 25545 29729 gene locus_tag LOCUS_29150 25545 29729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence49 <1 1050 gene locus_tag LOCUS_29160 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126863657.1:LLM class flavin-dependent oxidoreductase 1047 1859 gene locus_tag LOCUS_29170 1047 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2395 1856 gene locus_tag LOCUS_29180 gene smpB 2395 1856 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_29180 2439 2714 gene locus_tag LOCUS_29190 2439 2714 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_29190 2757 3704 gene locus_tag LOCUS_29200 2757 3704 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_29200 3797 4549 gene locus_tag LOCUS_29210 3797 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4610 5359 gene locus_tag LOCUS_29220 4610 5359 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_29220 5394 6122 gene locus_tag LOCUS_29230 gene rph 5394 6122 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_29230 6167 6748 gene locus_tag LOCUS_29240 6167 6748 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_29240 6829 7449 gene locus_tag LOCUS_29250 6829 7449 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_29250 7944 7489 gene locus_tag LOCUS_29260 7944 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 8660 7941 gene locus_tag LOCUS_29270 gene rpe 8660 7941 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_29270 9959 8730 gene locus_tag LOCUS_29280 9959 8730 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_29280 12418 10106 gene locus_tag LOCUS_29290 12418 10106 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_29290 13368 12571 gene locus_tag LOCUS_29300 13368 12571 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730386.1 protein_id gnl|my_center|LOCUS_29300 17523 13405 gene locus_tag LOCUS_29310 17523 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 22232 18660 gene locus_tag LOCUS_29320 22232 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 25054 22229 gene locus_tag LOCUS_29330 25054 22229 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_29330 29553 25051 gene locus_tag LOCUS_29340 29553 25051 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence50 332 1741 gene locus_tag LOCUS_29350 332 1741 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_29350 1871 3073 gene locus_tag LOCUS_29360 1871 3073 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_29360 5134 3170 gene locus_tag LOCUS_29370 gene dxs 5134 3170 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728575.1 protein_id gnl|my_center|LOCUS_29370 6072 5152 gene locus_tag LOCUS_29380 6072 5152 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_29380 6422 6177 gene locus_tag LOCUS_29390 6422 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 6382 7827 gene locus_tag LOCUS_29400 6382 7827 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_29400 7872 9236 gene locus_tag LOCUS_29410 7872 9236 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_29410 9240 9965 gene locus_tag LOCUS_29420 9240 9965 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_29420 9974 10834 gene locus_tag LOCUS_29430 9974 10834 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_29430 11435 10818 gene locus_tag LOCUS_29440 11435 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 11910 11503 gene locus_tag LOCUS_29450 11910 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 12058 13209 gene locus_tag LOCUS_29460 12058 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 13272 14513 gene locus_tag LOCUS_29470 13272 14513 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_29470 14547 15575 gene locus_tag LOCUS_29480 gene moaA 14547 15575 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_29480 15580 16074 gene locus_tag LOCUS_29490 gene moaC 15580 16074 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_29490 16167 16673 gene locus_tag LOCUS_29500 16167 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 16739 16812 gene locus_tag LOCUS_t00470 16739 16812 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16950 18305 gene locus_tag LOCUS_29510 16950 18305 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279869.1 protein_id gnl|my_center|LOCUS_29510 18389 18476 gene locus_tag LOCUS_t00480 18389 18476 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18646 20664 gene locus_tag LOCUS_29520 18646 20664 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_29520 21114 20857 gene locus_tag LOCUS_29530 21114 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 22946 21411 gene locus_tag LOCUS_29540 22946 21411 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234707997.1 protein_id gnl|my_center|LOCUS_29540 23105 25165 gene locus_tag LOCUS_29550 23105 25165 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_29550 25162 25575 gene locus_tag LOCUS_29560 25162 25575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 25554 26036 gene locus_tag LOCUS_29570 25554 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence51 1366 311 gene locus_tag LOCUS_29580 1366 311 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_29580 1611 2930 gene locus_tag LOCUS_29590 gene hisD 1611 2930 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969917.1 protein_id gnl|my_center|LOCUS_29590 2944 4752 gene locus_tag LOCUS_29600 2944 4752 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_29600 4875 5807 gene locus_tag LOCUS_29610 4875 5807 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086169.1 protein_id gnl|my_center|LOCUS_29610 5794 6816 gene locus_tag LOCUS_29620 5794 6816 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563086.1 protein_id gnl|my_center|LOCUS_29620 6864 8276 gene locus_tag LOCUS_29630 6864 8276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086171.1 protein_id gnl|my_center|LOCUS_29630 8789 8376 gene locus_tag LOCUS_29640 8789 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 8709 9137 gene locus_tag LOCUS_29650 8709 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 9217 9852 gene locus_tag LOCUS_29660 9217 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 10145 10384 gene locus_tag LOCUS_29670 10145 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 10371 10685 gene locus_tag LOCUS_29680 10371 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 12085 10718 gene locus_tag LOCUS_29690 12085 10718 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_29690 14509 12176 gene locus_tag LOCUS_29700 14509 12176 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144196.1 protein_id gnl|my_center|LOCUS_29700 15031 16119 gene locus_tag LOCUS_29710 15031 16119 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_29710 16262 17314 gene locus_tag LOCUS_29720 16262 17314 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_29720 17311 19341 gene locus_tag LOCUS_29730 17311 19341 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_29730 20189 19431 gene locus_tag LOCUS_29740 20189 19431 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_29740 20837 20289 gene locus_tag LOCUS_29750 20837 20289 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919453.1 protein_id gnl|my_center|LOCUS_29750 20914 21318 gene locus_tag LOCUS_29760 20914 21318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 21375 21965 gene locus_tag LOCUS_29770 21375 21965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 21962 22489 gene locus_tag LOCUS_29780 21962 22489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 22474 24450 gene locus_tag LOCUS_29790 22474 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence52 1269 910 gene locus_tag LOCUS_29800 1269 910 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_29800 1553 1269 gene locus_tag LOCUS_29810 1553 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1810 1556 gene locus_tag LOCUS_29820 1810 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 1999 2769 gene locus_tag LOCUS_29830 gene trpC 1999 2769 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_29830 3340 2807 gene locus_tag LOCUS_29840 3340 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3630 3430 gene locus_tag LOCUS_29850 3630 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3984 4083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4561 5043 gene locus_tag LOCUS_29860 gene thpR 4561 5043 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228104.1 protein_id gnl|my_center|LOCUS_29860 5124 5624 gene locus_tag LOCUS_29870 5124 5624 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640658.1 protein_id gnl|my_center|LOCUS_29870 5644 6768 gene locus_tag LOCUS_29880 5644 6768 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876815.1 protein_id gnl|my_center|LOCUS_29880 6847 7614 gene locus_tag LOCUS_29890 6847 7614 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_29890 7636 8760 gene locus_tag LOCUS_29900 7636 8760 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_29900 9120 8776 gene locus_tag LOCUS_29910 9120 8776 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_29910 9207 9818 gene locus_tag LOCUS_29920 9207 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9885 11153 gene locus_tag LOCUS_29930 9885 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 12045 11146 gene locus_tag LOCUS_29940 12045 11146 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_29940 12062 12250 gene locus_tag LOCUS_29950 12062 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 13047 12154 gene locus_tag LOCUS_29960 gene ftsX 13047 12154 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_29960 13778 13044 gene locus_tag LOCUS_29970 gene ftsE 13778 13044 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_29970 15060 13927 gene locus_tag LOCUS_29980 gene prfB 15060 13927 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_29980 17869 15062 gene locus_tag LOCUS_29990 gene secA 17869 15062 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_29990 19189 17948 gene locus_tag LOCUS_30000 19189 17948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_30000 20161 19313 gene locus_tag LOCUS_30010 20161 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence53 91 312 gene locus_tag LOCUS_30020 91 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 309 647 gene locus_tag LOCUS_30030 309 647 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_30030 831 1196 gene locus_tag LOCUS_30040 831 1196 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_30040 1217 1822 gene locus_tag LOCUS_30050 1217 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1825 2574 gene locus_tag LOCUS_30060 1825 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2571 3755 gene locus_tag LOCUS_30070 2571 3755 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_30070 3755 4780 gene locus_tag LOCUS_30080 gene nuoH 3755 4780 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546488.1 protein_id gnl|my_center|LOCUS_30080 4781 5368 gene locus_tag LOCUS_30090 4781 5368 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_30090 5377 5871 gene locus_tag LOCUS_30100 5377 5871 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_30100 5878 6177 gene locus_tag LOCUS_30110 gene nuoK 5878 6177 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_30110 6188 8398 gene locus_tag LOCUS_30120 gene nuoL 6188 8398 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_30120 8443 10005 gene locus_tag LOCUS_30130 8443 10005 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_30130 10008 11672 gene locus_tag LOCUS_30140 10008 11672 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_30140 11852 12118 gene locus_tag LOCUS_30150 11852 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 12253 13320 gene locus_tag LOCUS_30160 12253 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 13476 15575 gene locus_tag LOCUS_30170 gene acs 13476 15575 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_30170 15583 16122 gene locus_tag LOCUS_30180 15583 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 16138 16329 gene locus_tag LOCUS_30190 16138 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 16341 16571 gene locus_tag LOCUS_30200 16341 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 17963 16692 gene locus_tag LOCUS_30210 17963 16692 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_30210 18192 19046 gene locus_tag LOCUS_30220 18192 19046 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461896.1 protein_id gnl|my_center|LOCUS_30220 19556 19068 gene locus_tag LOCUS_30230 19556 19068 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_30230 19659 19743 gene locus_tag LOCUS_t00490 19659 19743 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 <20500 19751 gene locus_tag LOCUS_30240 <20500 19751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257603.1:SDR family oxidoreductase >Feature sequence54 77 1054 gene locus_tag LOCUS_30250 77 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1121 2491 gene locus_tag LOCUS_30260 1121 2491 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_30260 3212 2550 gene locus_tag LOCUS_30270 3212 2550 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_30270 4474 3341 gene locus_tag LOCUS_30280 4474 3341 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_30280 4614 5456 gene locus_tag LOCUS_30290 4614 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 5570 7213 gene locus_tag LOCUS_30300 5570 7213 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_30300 7432 7920 gene locus_tag LOCUS_30310 7432 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9107 8124 gene locus_tag LOCUS_30320 9107 8124 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_30320 9230 9895 gene locus_tag LOCUS_30330 9230 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 9916 11406 gene locus_tag LOCUS_30340 9916 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 11418 12152 gene locus_tag LOCUS_30350 11418 12152 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_30350 12579 14951 gene locus_tag LOCUS_30360 12579 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 14952 15344 gene locus_tag LOCUS_30370 14952 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 15387 15875 gene locus_tag LOCUS_30380 15387 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 16454 17356 gene locus_tag LOCUS_30390 16454 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 17440 19539 gene locus_tag LOCUS_30400 17440 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence55 413 1102 gene locus_tag LOCUS_30410 413 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1099 1581 gene locus_tag LOCUS_30420 1099 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1678 2292 gene locus_tag LOCUS_30430 1678 2292 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_30430 2398 2652 gene locus_tag LOCUS_30440 2398 2652 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409276.1 protein_id gnl|my_center|LOCUS_30440 2649 3044 gene locus_tag LOCUS_30450 2649 3044 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_30450 5440 3254 gene locus_tag LOCUS_30460 5440 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 5847 7127 gene locus_tag LOCUS_30470 5847 7127 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_30470 7458 8777 gene locus_tag LOCUS_30480 7458 8777 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 protein_id gnl|my_center|LOCUS_30480 14312 8892 gene locus_tag LOCUS_30490 14312 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 16426 14438 gene locus_tag LOCUS_30500 16426 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 17335 16433 gene locus_tag LOCUS_30510 17335 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence56 858 235 gene locus_tag LOCUS_30520 858 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2832 1609 gene locus_tag LOCUS_30530 2832 1609 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811630.1 protein_id gnl|my_center|LOCUS_30530 4199 2895 gene locus_tag LOCUS_30540 4199 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 5053 4211 gene locus_tag LOCUS_30550 5053 4211 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_30550 5274 6359 gene locus_tag LOCUS_30560 gene recA 5274 6359 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_30560 6436 8208 gene locus_tag LOCUS_30570 6436 8208 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_30570 8273 9769 gene locus_tag LOCUS_30580 gene miaB 8273 9769 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908058.1 protein_id gnl|my_center|LOCUS_30580 9783 10748 gene locus_tag LOCUS_30590 gene miaA 9783 10748 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_30590 11959 10790 gene locus_tag LOCUS_30600 gene dapC 11959 10790 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_30600 12347 11949 gene locus_tag LOCUS_30610 12347 11949 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649049.1 protein_id gnl|my_center|LOCUS_30610 12607 12344 gene locus_tag LOCUS_30620 12607 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12703 13410 gene locus_tag LOCUS_30630 12703 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 <14763 13407 gene locus_tag LOCUS_30640 <14763 13407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894120.1:GTPase HflX >Feature sequence57 276 1499 gene locus_tag LOCUS_30650 276 1499 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_30650 3882 1537 gene locus_tag LOCUS_30660 3882 1537 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084710.1 protein_id gnl|my_center|LOCUS_30660 4062 4262 gene locus_tag LOCUS_30670 4062 4262 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_30670 5185 4298 gene locus_tag LOCUS_30680 5185 4298 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969803.1 protein_id gnl|my_center|LOCUS_30680 7712 5274 gene locus_tag LOCUS_30690 7712 5274 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_30690 7711 8622 gene locus_tag LOCUS_30700 7711 8622 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_30700 9568 8642 gene locus_tag LOCUS_30710 9568 8642 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_30710 9630 11228 gene locus_tag LOCUS_30720 9630 11228 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 protein_id gnl|my_center|LOCUS_30720 13140 11341 gene locus_tag LOCUS_30730 13140 11341 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 protein_id gnl|my_center|LOCUS_30730 14060 13473 gene locus_tag LOCUS_30740 14060 13473 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_30740 14282 14100 gene locus_tag LOCUS_30750 14282 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 14221 14556 gene locus_tag LOCUS_30760 14221 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence58 212 1069 gene locus_tag LOCUS_30770 212 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1081 1857 gene locus_tag LOCUS_30780 1081 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2661 1867 gene locus_tag LOCUS_30790 2661 1867 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_30790 2721 3965 gene locus_tag LOCUS_30800 2721 3965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_30800 6590 4044 gene locus_tag LOCUS_30810 6590 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 7806 6736 gene locus_tag LOCUS_30820 7806 6736 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_30820 7881 8483 gene locus_tag LOCUS_30830 gene pgsA 7881 8483 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_30830 8535 10001 gene locus_tag LOCUS_30840 8535 10001 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142436.1 protein_id gnl|my_center|LOCUS_30840 10098 11000 gene locus_tag LOCUS_30850 10098 11000 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_30850 11050 11901 gene locus_tag LOCUS_30860 11050 11901 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_30860 11933 12880 gene locus_tag LOCUS_30870 11933 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 13341 13646 gene locus_tag LOCUS_30880 13341 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence59 948 265 gene locus_tag LOCUS_30890 948 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1744 1358 gene locus_tag LOCUS_30900 1744 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1968 1741 gene locus_tag LOCUS_30910 1968 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2136 2909 gene locus_tag LOCUS_30920 2136 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3348 2956 gene locus_tag LOCUS_30930 3348 2956 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_30930 4516 3461 gene locus_tag LOCUS_30940 4516 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 6037 4565 gene locus_tag LOCUS_30950 6037 4565 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 protein_id gnl|my_center|LOCUS_30950 6048 7172 gene locus_tag LOCUS_30960 6048 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 9163 7244 gene locus_tag LOCUS_30970 9163 7244 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_30970 9305 11176 gene locus_tag LOCUS_30980 9305 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 11142 12557 gene locus_tag LOCUS_30990 11142 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 13092 12619 gene locus_tag LOCUS_31000 gene bfr 13092 12619 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence60 151 594 gene locus_tag LOCUS_31010 151 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1908 844 gene locus_tag LOCUS_31020 1908 844 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528693.1 protein_id gnl|my_center|LOCUS_31020 2060 3523 gene locus_tag LOCUS_31030 2060 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3707 4381 gene locus_tag LOCUS_31040 3707 4381 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078328667.1 protein_id gnl|my_center|LOCUS_31040 4416 4610 gene locus_tag LOCUS_31050 4416 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 4630 5352 gene locus_tag LOCUS_31060 4630 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 5400 5618 gene locus_tag LOCUS_31070 5400 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5615 6172 gene locus_tag LOCUS_31080 5615 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 9156 6244 gene locus_tag LOCUS_31090 9156 6244 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_31090 11981 9153 gene locus_tag LOCUS_31100 11981 9153 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_31100 <12915 11978 gene locus_tag LOCUS_31110 <12915 11978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein >Feature sequence61 601 2334 gene locus_tag LOCUS_31120 601 2334 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_31120 3050 2331 gene locus_tag LOCUS_31130 3050 2331 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923472.1 protein_id gnl|my_center|LOCUS_31130 3113 3874 gene locus_tag LOCUS_31140 3113 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 4798 3899 gene locus_tag LOCUS_31150 4798 3899 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111794.1 protein_id gnl|my_center|LOCUS_31150 4961 6319 gene locus_tag LOCUS_31160 4961 6319 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_31160 6370 7521 gene locus_tag LOCUS_31170 6370 7521 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_31170 7524 9368 gene locus_tag LOCUS_31180 7524 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 9365 10162 gene locus_tag LOCUS_31190 9365 10162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965651.1 protein_id gnl|my_center|LOCUS_31190 10159 10935 gene locus_tag LOCUS_31200 10159 10935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_31200 11828 10932 gene locus_tag LOCUS_31210 11828 10932 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_31210 11956 12750 gene locus_tag LOCUS_31220 11956 12750 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence62 1718 1443 gene locus_tag LOCUS_31230 1718 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1977 1720 gene locus_tag LOCUS_31240 1977 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706168.1 protein_id gnl|my_center|LOCUS_31240 2911 2003 gene locus_tag LOCUS_31250 2911 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3047 3427 gene locus_tag LOCUS_31260 3047 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3440 3883 gene locus_tag LOCUS_31270 3440 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3980 5287 gene locus_tag LOCUS_31280 3980 5287 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448208.1 protein_id gnl|my_center|LOCUS_31280 5297 5791 gene locus_tag LOCUS_31290 5297 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 6584 5808 gene locus_tag LOCUS_31300 6584 5808 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_31300 7823 6657 gene locus_tag LOCUS_31310 7823 6657 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_31310 8913 7864 gene locus_tag LOCUS_31320 8913 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 9419 8970 gene locus_tag LOCUS_31330 9419 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 10291 9596 gene locus_tag LOCUS_31340 10291 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 11060 10416 gene locus_tag LOCUS_31350 11060 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence63 3082 980 gene locus_tag LOCUS_31360 3082 980 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415097.1 protein_id gnl|my_center|LOCUS_31360 4758 3280 gene locus_tag LOCUS_31370 4758 3280 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409362.1 protein_id gnl|my_center|LOCUS_31370 4917 5651 gene locus_tag LOCUS_31380 4917 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 6485 5658 gene locus_tag LOCUS_31390 6485 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 6645 7481 gene locus_tag LOCUS_31400 6645 7481 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056616.1 protein_id gnl|my_center|LOCUS_31400 7640 7945 gene locus_tag LOCUS_31410 7640 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8137 9021 gene locus_tag LOCUS_31420 8137 9021 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence64 285 3716 gene locus_tag LOCUS_31430 285 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 6284 3762 gene locus_tag LOCUS_31440 6284 3762 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_31440 8948 6393 gene locus_tag LOCUS_31450 8948 6393 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence65 602 1921 gene locus_tag LOCUS_31460 602 1921 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967499.1 protein_id gnl|my_center|LOCUS_31460 1927 3075 gene locus_tag LOCUS_31470 gene yeaW 1927 3075 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067841.1 protein_id gnl|my_center|LOCUS_31470 3156 4490 gene locus_tag LOCUS_31480 3156 4490 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_31480 4547 6019 gene locus_tag LOCUS_31490 4547 6019 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_31490 6121 7011 gene locus_tag LOCUS_31500 gene tesB 6121 7011 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_31500 8415 7168 gene locus_tag LOCUS_31510 8415 7168 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence66 489 118 gene locus_tag LOCUS_31520 489 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1255 2022 gene locus_tag LOCUS_31530 1255 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2210 2407 gene locus_tag LOCUS_31540 2210 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2397 3083 gene locus_tag LOCUS_31550 2397 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 3759 3247 gene locus_tag LOCUS_31560 3759 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3968 3756 gene locus_tag LOCUS_31570 3968 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 4106 4315 gene locus_tag LOCUS_31580 4106 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4891 4439 gene locus_tag LOCUS_31590 4891 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 5177 5440 gene locus_tag LOCUS_31600 5177 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 6915 5767 gene locus_tag LOCUS_31610 6915 5767 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_31610 7657 6956 gene locus_tag LOCUS_31620 7657 6956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence67 1722 1150 gene locus_tag LOCUS_31630 1722 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2552 1827 gene locus_tag LOCUS_31640 2552 1827 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_31640 2780 3715 gene locus_tag LOCUS_31650 2780 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 5232 3760 gene locus_tag LOCUS_31660 5232 3760 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_31660 6194 5331 gene locus_tag LOCUS_31670 6194 5331 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_31670 6217 6957 gene locus_tag LOCUS_31680 6217 6957 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence68 769 1293 gene locus_tag LOCUS_31690 769 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1523 2173 gene locus_tag LOCUS_31700 1523 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 2383 2928 gene locus_tag LOCUS_31710 2383 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3050 6961 gene locus_tag LOCUS_31720 3050 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence69 <1 2116 gene locus_tag LOCUS_31730 <1 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 note possible pseudo, frameshifted 1729 1738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2041 2388 gene locus_tag LOCUS_31740 2041 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 3703 2402 gene locus_tag LOCUS_31750 3703 2402 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538165.1 protein_id gnl|my_center|LOCUS_31750 4005 3700 gene locus_tag LOCUS_31760 4005 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 4268 6187 gene locus_tag LOCUS_31770 4268 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence70 509 51 gene locus_tag LOCUS_31780 509 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 767 534 gene locus_tag LOCUS_31790 767 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1148 828 gene locus_tag LOCUS_31800 1148 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1429 2838 gene locus_tag LOCUS_31810 gene lpdA 1429 2838 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_31810 2878 4284 gene locus_tag LOCUS_31820 2878 4284 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence71 89 370 gene locus_tag LOCUS_31830 89 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 548 1933 gene locus_tag LOCUS_31840 gene urtA 548 1933 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_31840 2044 2907 gene locus_tag LOCUS_31850 gene urtB 2044 2907 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_31850 2904 4757 gene locus_tag LOCUS_31860 2904 4757 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089150.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence72 >Feature sequence73 659 129 gene locus_tag LOCUS_31870 659 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1053 1235 gene locus_tag LOCUS_31880 1053 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 1255 1497 gene locus_tag LOCUS_31890 1255 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2599 1805 gene locus_tag LOCUS_31900 2599 1805 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_31900 3411 2596 gene locus_tag LOCUS_31910 3411 2596 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_31910 3639 4247 gene locus_tag LOCUS_31920 3639 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence74 >Feature sequence75 751 1503 gene locus_tag LOCUS_31930 751 1503 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence76 1765 1535 gene locus_tag LOCUS_31940 1765 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31940 2210 1740 gene locus_tag LOCUS_31950 2210 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31950 >Feature sequence77 1577 540 gene locus_tag LOCUS_31960 gene egtD 1577 540 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_31960 <2851 1577 gene locus_tag LOCUS_31970 <2851 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812990.1:ergothioneine biosynthesis protein EgtB >Feature sequence78 >Feature sequence79 1938 1414 gene locus_tag LOCUS_31980 1938 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence80 2537 1632 gene locus_tag LOCUS_31990 2537 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990