>Feature sequence01 213 1346 gene locus_tag LOCUS_00010 213 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1415 2629 gene locus_tag LOCUS_00020 1415 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2607 3638 gene locus_tag LOCUS_00030 2607 3638 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_00030 3638 4423 gene locus_tag LOCUS_00040 3638 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4437 4811 gene locus_tag LOCUS_00050 4437 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5056 7599 gene locus_tag LOCUS_00060 5056 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7656 7732 gene locus_tag LOCUS_t00010 7656 7732 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7924 9198 gene locus_tag LOCUS_00070 7924 9198 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_00070 11156 9261 gene locus_tag LOCUS_00080 11156 9261 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_00080 11341 12075 gene locus_tag LOCUS_00090 11341 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12072 14036 gene locus_tag LOCUS_00100 12072 14036 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_00100 14033 14473 gene locus_tag LOCUS_00110 14033 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15256 14498 gene locus_tag LOCUS_00120 15256 14498 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_00120 15297 16196 gene locus_tag LOCUS_00130 15297 16196 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_00130 16964 16230 gene locus_tag LOCUS_00140 16964 16230 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_00140 20836 16970 gene locus_tag LOCUS_00150 20836 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20958 22139 gene locus_tag LOCUS_00160 20958 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22494 22204 gene locus_tag LOCUS_00170 22494 22204 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_00170 22775 22491 gene locus_tag LOCUS_00180 22775 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24095 22815 gene locus_tag LOCUS_00190 24095 22815 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_00190 26587 24092 gene locus_tag LOCUS_00200 26587 24092 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_00200 28053 26590 gene locus_tag LOCUS_00210 28053 26590 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_00210 28140 30242 gene locus_tag LOCUS_00220 28140 30242 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_00220 30307 30885 gene locus_tag LOCUS_00230 30307 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30913 32118 gene locus_tag LOCUS_00240 30913 32118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32115 32924 gene locus_tag LOCUS_00250 32115 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32914 34287 gene locus_tag LOCUS_00260 32914 34287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_00260 34289 36346 gene locus_tag LOCUS_00270 34289 36346 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338342.1 protein_id gnl|my_center|LOCUS_00270 37107 36358 gene locus_tag LOCUS_00280 37107 36358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_00280 37198 38757 gene locus_tag LOCUS_00290 37198 38757 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_00290 38795 40579 gene locus_tag LOCUS_00300 gene ggt 38795 40579 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868894.1 protein_id gnl|my_center|LOCUS_00300 40619 41722 gene locus_tag LOCUS_00310 40619 41722 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 protein_id gnl|my_center|LOCUS_00310 43056 41734 gene locus_tag LOCUS_00320 43056 41734 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_00320 43709 43053 gene locus_tag LOCUS_00330 43709 43053 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_00330 46135 43754 gene locus_tag LOCUS_00340 46135 43754 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090108.1 protein_id gnl|my_center|LOCUS_00340 46286 47356 gene locus_tag LOCUS_00350 gene bla 46286 47356 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_00350 47356 48105 gene locus_tag LOCUS_00360 47356 48105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 49346 48102 gene locus_tag LOCUS_00370 49346 48102 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_00370 49389 50771 gene locus_tag LOCUS_00380 49389 50771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_00380 50768 51961 gene locus_tag LOCUS_00390 50768 51961 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_00390 51978 53024 gene locus_tag LOCUS_00400 51978 53024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 53021 54289 gene locus_tag LOCUS_00410 53021 54289 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 protein_id gnl|my_center|LOCUS_00410 54286 54825 gene locus_tag LOCUS_00420 54286 54825 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_00420 54838 55605 gene locus_tag LOCUS_00430 54838 55605 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731408.1 protein_id gnl|my_center|LOCUS_00430 55642 55902 gene locus_tag LOCUS_00440 55642 55902 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_00440 55899 56300 gene locus_tag LOCUS_00450 55899 56300 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_00450 57559 56297 gene locus_tag LOCUS_00460 57559 56297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58723 57575 gene locus_tag LOCUS_00470 58723 57575 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_00470 59697 58738 gene locus_tag LOCUS_00480 59697 58738 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_00480 59757 60623 gene locus_tag LOCUS_00490 59757 60623 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_00490 61338 60625 gene locus_tag LOCUS_00500 61338 60625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 62939 61344 gene locus_tag LOCUS_00510 62939 61344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63132 62905 gene locus_tag LOCUS_00520 63132 62905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63524 63282 gene locus_tag LOCUS_00530 63524 63282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64043 63702 gene locus_tag LOCUS_00540 64043 63702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64261 64040 gene locus_tag LOCUS_00550 64261 64040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 65694 64321 gene locus_tag LOCUS_00560 65694 64321 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_00560 67241 65691 gene locus_tag LOCUS_00570 67241 65691 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_00570 67297 68490 gene locus_tag LOCUS_00580 67297 68490 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_00580 68487 70028 gene locus_tag LOCUS_00590 68487 70028 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_00590 70046 71194 gene locus_tag LOCUS_00600 70046 71194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_00600 71934 71191 gene locus_tag LOCUS_00610 71934 71191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72917 71949 gene locus_tag LOCUS_00620 72917 71949 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_00620 73760 72960 gene locus_tag LOCUS_00630 73760 72960 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_00630 73805 74383 gene locus_tag LOCUS_00640 73805 74383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74419 75255 gene locus_tag LOCUS_00650 74419 75255 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 protein_id gnl|my_center|LOCUS_00650 76564 75344 gene locus_tag LOCUS_00660 76564 75344 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_00660 78879 76672 gene locus_tag LOCUS_00670 gene katG 78879 76672 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_00670 79021 80562 gene locus_tag LOCUS_00680 79021 80562 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_00680 81850 80588 gene locus_tag LOCUS_00690 81850 80588 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_00690 82460 81852 gene locus_tag LOCUS_00700 82460 81852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 83956 82457 gene locus_tag LOCUS_00710 83956 82457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_00710 84010 84936 gene locus_tag LOCUS_00720 84010 84936 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_00720 84986 86350 gene locus_tag LOCUS_00730 84986 86350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87038 86352 gene locus_tag LOCUS_00740 87038 86352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 88996 87035 gene locus_tag LOCUS_00750 88996 87035 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_00750 89197 90930 gene locus_tag LOCUS_00760 89197 90930 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_00760 90927 92645 gene locus_tag LOCUS_00770 90927 92645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93442 92660 gene locus_tag LOCUS_00780 93442 92660 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_00780 93526 95349 gene locus_tag LOCUS_00790 93526 95349 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_00790 95377 98358 gene locus_tag LOCUS_00800 95377 98358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 98381 99808 gene locus_tag LOCUS_00810 98381 99808 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_00810 99845 101485 gene locus_tag LOCUS_00820 99845 101485 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_00820 102815 101580 gene locus_tag LOCUS_00830 102815 101580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 103916 103368 gene locus_tag LOCUS_00840 103916 103368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 104401 103913 gene locus_tag LOCUS_00850 104401 103913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 104529 105932 gene locus_tag LOCUS_00860 104529 105932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 107158 105947 gene locus_tag LOCUS_00870 107158 105947 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_00870 107697 107164 gene locus_tag LOCUS_00880 107697 107164 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_00880 107753 109126 gene locus_tag LOCUS_00890 107753 109126 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_00890 109446 109234 gene locus_tag LOCUS_00900 109446 109234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 109658 109467 gene locus_tag LOCUS_00910 109658 109467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 protein_id gnl|my_center|LOCUS_00910 110443 109667 gene locus_tag LOCUS_00920 110443 109667 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530618.1 protein_id gnl|my_center|LOCUS_00920 110876 112831 gene locus_tag LOCUS_00930 110876 112831 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_00930 113729 115078 gene locus_tag LOCUS_00940 113729 115078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_00940 115075 115833 gene locus_tag LOCUS_00950 115075 115833 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_00950 116405 115956 gene locus_tag LOCUS_00960 116405 115956 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_00960 116677 117870 gene locus_tag LOCUS_00970 116677 117870 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_00970 117884 118432 gene locus_tag LOCUS_00980 117884 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 119184 118513 gene locus_tag LOCUS_00990 119184 118513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 123358 119384 gene locus_tag LOCUS_01000 123358 119384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 124362 123424 gene locus_tag LOCUS_01010 124362 123424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_01010 125293 124355 gene locus_tag LOCUS_01020 125293 124355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_01020 126922 125312 gene locus_tag LOCUS_01030 126922 125312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_01030 126991 128562 gene locus_tag LOCUS_01040 126991 128562 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_01040 128727 130565 gene locus_tag LOCUS_01050 128727 130565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 131232 130576 gene locus_tag LOCUS_01060 131232 130576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 131496 131702 gene locus_tag LOCUS_01070 131496 131702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 131911 132603 gene locus_tag LOCUS_01080 131911 132603 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_01080 133121 132756 gene locus_tag LOCUS_01090 133121 132756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 133321 133118 gene locus_tag LOCUS_01100 133321 133118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 133362 135224 gene locus_tag LOCUS_01110 133362 135224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 135236 135409 gene locus_tag LOCUS_01120 135236 135409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 136325 135357 gene locus_tag LOCUS_01130 136325 135357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01130 138474 136378 gene locus_tag LOCUS_01140 138474 136378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 140933 138474 gene locus_tag LOCUS_01150 140933 138474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 142188 140959 gene locus_tag LOCUS_01160 142188 140959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 145129 142208 gene locus_tag LOCUS_01170 145129 142208 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919676.1 protein_id gnl|my_center|LOCUS_01170 145305 147386 gene locus_tag LOCUS_01180 145305 147386 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_01180 147455 149035 gene locus_tag LOCUS_01190 147455 149035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 149886 149032 gene locus_tag LOCUS_01200 149886 149032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 149967 150890 gene locus_tag LOCUS_01210 149967 150890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 150877 152358 gene locus_tag LOCUS_01220 150877 152358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 152355 153875 gene locus_tag LOCUS_01230 152355 153875 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_01230 156405 153865 gene locus_tag LOCUS_01240 156405 153865 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_01240 156542 157384 gene locus_tag LOCUS_01250 156542 157384 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063715.1 protein_id gnl|my_center|LOCUS_01250 157381 158286 gene locus_tag LOCUS_01260 157381 158286 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_01260 158303 159886 gene locus_tag LOCUS_01270 158303 159886 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 protein_id gnl|my_center|LOCUS_01270 159958 161310 gene locus_tag LOCUS_01280 159958 161310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 162064 161342 gene locus_tag LOCUS_01290 162064 161342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 162286 163779 gene locus_tag LOCUS_01300 162286 163779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 164324 163788 gene locus_tag LOCUS_01310 164324 163788 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_01310 165519 164311 gene locus_tag LOCUS_01320 gene soxC 165519 164311 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_01320 166617 165562 gene locus_tag LOCUS_01330 166617 165562 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_01330 168511 166631 gene locus_tag LOCUS_01340 168511 166631 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_01340 168643 169077 gene locus_tag LOCUS_01350 168643 169077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 169074 170345 gene locus_tag LOCUS_01360 169074 170345 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027989172.1 protein_id gnl|my_center|LOCUS_01360 171240 170329 gene locus_tag LOCUS_01370 171240 170329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 171395 171404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 171804 171634 gene locus_tag LOCUS_01380 171804 171634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 171905 174259 gene locus_tag LOCUS_01390 171905 174259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 174383 174293 gene locus_tag LOCUS_t00020 174383 174293 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 175701 174409 gene locus_tag LOCUS_01400 gene serS 175701 174409 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_01400 175860 177626 gene locus_tag LOCUS_01410 175860 177626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 177623 178660 gene locus_tag LOCUS_01420 177623 178660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 178657 179565 gene locus_tag LOCUS_01430 178657 179565 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_01430 179562 181709 gene locus_tag LOCUS_01440 179562 181709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 181740 183179 gene locus_tag LOCUS_01450 181740 183179 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_01450 184010 183285 gene locus_tag LOCUS_01460 184010 183285 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_01460 185173 184007 gene locus_tag LOCUS_01470 gene purD 185173 184007 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_01470 186162 185299 gene locus_tag LOCUS_01480 gene ispH 186162 185299 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_01480 186750 186235 gene locus_tag LOCUS_01490 186750 186235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 187275 186769 gene locus_tag LOCUS_01500 187275 186769 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_01500 188415 187753 gene locus_tag LOCUS_01510 188415 187753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 189816 188470 gene locus_tag LOCUS_01520 189816 188470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 191464 189866 gene locus_tag LOCUS_01530 191464 189866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 191805 192734 gene locus_tag LOCUS_01540 191805 192734 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_01540 193518 192838 gene locus_tag LOCUS_01550 193518 192838 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_01550 194081 193515 gene locus_tag LOCUS_01560 194081 193515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 194351 194097 gene locus_tag LOCUS_01570 194351 194097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 195452 194364 gene locus_tag LOCUS_01580 gene waaC 195452 194364 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_01580 195552 195476 gene locus_tag LOCUS_t00030 195552 195476 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 195655 195580 gene locus_tag LOCUS_t00040 195655 195580 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 195763 195687 gene locus_tag LOCUS_t00050 195763 195687 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 195887 195812 gene locus_tag LOCUS_t00060 195887 195812 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 198251 195927 gene locus_tag LOCUS_01590 198251 195927 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_01590 199548 198256 gene locus_tag LOCUS_01600 gene glmU 199548 198256 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 protein_id gnl|my_center|LOCUS_01600 200128 199625 gene locus_tag LOCUS_01610 200128 199625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 200755 200180 gene locus_tag LOCUS_01620 200755 200180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 202253 200766 gene locus_tag LOCUS_01630 202253 200766 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_01630 202267 203691 gene locus_tag LOCUS_01640 202267 203691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 203688 204446 gene locus_tag LOCUS_01650 gene truA 203688 204446 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_01650 204443 205291 gene locus_tag LOCUS_01660 204443 205291 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_01660 205566 205246 gene locus_tag LOCUS_01670 205566 205246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 205456 206484 gene locus_tag LOCUS_01680 gene dxr 205456 206484 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919783.1 protein_id gnl|my_center|LOCUS_01680 206496 207806 gene locus_tag LOCUS_01690 gene rseP 206496 207806 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_01690 207820 208599 gene locus_tag LOCUS_01700 207820 208599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 208633 209286 gene locus_tag LOCUS_01710 gene rpe 208633 209286 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_01710 209283 210152 gene locus_tag LOCUS_01720 209283 210152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 210281 210574 gene locus_tag LOCUS_01730 210281 210574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 210727 211476 gene locus_tag LOCUS_01740 210727 211476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 211683 211489 gene locus_tag LOCUS_01750 211683 211489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 212666 211728 gene locus_tag LOCUS_01760 212666 211728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 212800 213102 gene locus_tag LOCUS_01770 212800 213102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 213803 213099 gene locus_tag LOCUS_01780 213803 213099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 213806 215308 gene locus_tag LOCUS_01790 gene gatB 213806 215308 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_01790 216477 215305 gene locus_tag LOCUS_01800 216477 215305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 217221 216478 gene locus_tag LOCUS_01810 217221 216478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 218625 217513 gene locus_tag LOCUS_01820 218625 217513 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921032.1 protein_id gnl|my_center|LOCUS_01820 219451 218708 gene locus_tag LOCUS_01830 219451 218708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 219982 219545 gene locus_tag LOCUS_01840 219982 219545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 220465 220037 gene locus_tag LOCUS_01850 220465 220037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 221166 220501 gene locus_tag LOCUS_01860 221166 220501 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_01860 221848 221333 gene locus_tag LOCUS_01870 gene ruvC 221848 221333 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_01870 222632 221868 gene locus_tag LOCUS_01880 222632 221868 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_01880 222663 223991 gene locus_tag LOCUS_01890 222663 223991 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_01890 224450 224013 gene locus_tag LOCUS_01900 gene rpiB 224450 224013 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_01900 224701 224459 gene locus_tag LOCUS_01910 224701 224459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 225207 224698 gene locus_tag LOCUS_01920 gene purE 225207 224698 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404367.1 protein_id gnl|my_center|LOCUS_01920 226857 225271 gene locus_tag LOCUS_01930 226857 225271 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_01930 227078 228418 gene locus_tag LOCUS_01940 227078 228418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 228415 229833 gene locus_tag LOCUS_01950 228415 229833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 230962 229847 gene locus_tag LOCUS_01960 230962 229847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 231048 232385 gene locus_tag LOCUS_01970 gene selA 231048 232385 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_01970 234076 232382 gene locus_tag LOCUS_01980 234076 232382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 235089 234073 gene locus_tag LOCUS_01990 235089 234073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 235580 235086 gene locus_tag LOCUS_02000 235580 235086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 236387 235596 gene locus_tag LOCUS_02010 236387 235596 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_02010 237811 236384 gene locus_tag LOCUS_02020 237811 236384 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_02020 239238 237808 gene locus_tag LOCUS_02030 239238 237808 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_02030 239362 240408 gene locus_tag LOCUS_02040 239362 240408 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_02040 241200 240316 gene locus_tag LOCUS_02050 241200 240316 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_02050 242521 241208 gene locus_tag LOCUS_02060 242521 241208 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841575.1 protein_id gnl|my_center|LOCUS_02060 243269 242529 gene locus_tag LOCUS_02070 243269 242529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 244560 243271 gene locus_tag LOCUS_02080 244560 243271 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_02080 244715 246253 gene locus_tag LOCUS_02090 gene accC 244715 246253 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_02090 246244 246753 gene locus_tag LOCUS_02100 246244 246753 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_02100 247427 246750 gene locus_tag LOCUS_02110 247427 246750 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_02110 248295 247414 gene locus_tag LOCUS_02120 248295 247414 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_02120 249344 248292 gene locus_tag LOCUS_02130 gene mvaD 249344 248292 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_02130 250487 249357 gene locus_tag LOCUS_02140 250487 249357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 251995 250718 gene locus_tag LOCUS_02150 gene hmgA 251995 250718 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_02150 253031 251988 gene locus_tag LOCUS_02160 gene fni 253031 251988 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_02160 254180 253131 gene locus_tag LOCUS_02170 gene moaA 254180 253131 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_02170 255247 254297 gene locus_tag LOCUS_02180 gene nudC 255247 254297 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_02180 256382 255270 gene locus_tag LOCUS_02190 256382 255270 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_02190 257016 256471 gene locus_tag LOCUS_02200 257016 256471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 257949 257050 gene locus_tag LOCUS_02210 257949 257050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_02210 259375 257951 gene locus_tag LOCUS_02220 259375 257951 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_02220 259361 260635 gene locus_tag LOCUS_02230 259361 260635 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_02230 260923 260636 gene locus_tag LOCUS_02240 260923 260636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 261597 260935 gene locus_tag LOCUS_02250 261597 260935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 263313 261610 gene locus_tag LOCUS_02260 263313 261610 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_02260 263965 263354 gene locus_tag LOCUS_02270 263965 263354 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 protein_id gnl|my_center|LOCUS_02270 264122 265231 gene locus_tag LOCUS_02280 264122 265231 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385032.1 protein_id gnl|my_center|LOCUS_02280 266842 265361 gene locus_tag LOCUS_02290 266842 265361 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_02290 267393 266842 gene locus_tag LOCUS_02300 267393 266842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 267812 267435 gene locus_tag LOCUS_02310 267812 267435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 269032 268124 gene locus_tag LOCUS_02320 269032 268124 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_02320 269113 271692 gene locus_tag LOCUS_02330 gene ligD 269113 271692 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_02330 275617 271697 gene locus_tag LOCUS_02340 275617 271697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 277229 275628 gene locus_tag LOCUS_02350 gene ggt 277229 275628 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_02350 277496 278605 gene locus_tag LOCUS_02360 277496 278605 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_02360 279820 278732 gene locus_tag LOCUS_02370 279820 278732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 279932 281005 gene locus_tag LOCUS_02380 279932 281005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 281022 282176 gene locus_tag LOCUS_02390 281022 282176 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113220.1 protein_id gnl|my_center|LOCUS_02390 282210 283328 gene locus_tag LOCUS_02400 282210 283328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 283339 284688 gene locus_tag LOCUS_02410 283339 284688 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_02410 284685 285953 gene locus_tag LOCUS_02420 284685 285953 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_02420 285971 286675 gene locus_tag LOCUS_02430 285971 286675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 288025 286685 gene locus_tag LOCUS_02440 288025 286685 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185271872.1 protein_id gnl|my_center|LOCUS_02440 289095 288022 gene locus_tag LOCUS_02450 289095 288022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 289132 291114 gene locus_tag LOCUS_02460 289132 291114 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_02460 291128 292147 gene locus_tag LOCUS_02470 291128 292147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 292284 293654 gene locus_tag LOCUS_02480 292284 293654 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_02480 293740 294924 gene locus_tag LOCUS_02490 293740 294924 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_02490 295341 295730 gene locus_tag LOCUS_02500 295341 295730 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_02500 298557 295732 gene locus_tag LOCUS_02510 298557 295732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 298627 300399 gene locus_tag LOCUS_02520 298627 300399 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_02520 300663 300409 gene locus_tag LOCUS_02530 300663 300409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 300862 300635 gene locus_tag LOCUS_02540 300862 300635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 301455 300955 gene locus_tag LOCUS_02550 301455 300955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 302055 301513 gene locus_tag LOCUS_02560 302055 301513 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_02560 302079 305330 gene locus_tag LOCUS_02570 302079 305330 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_02570 305347 306813 gene locus_tag LOCUS_02580 305347 306813 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_02580 308096 306810 gene locus_tag LOCUS_02590 308096 306810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 308218 309321 gene locus_tag LOCUS_02600 308218 309321 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_02600 309311 310234 gene locus_tag LOCUS_02610 309311 310234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 310231 310407 gene locus_tag LOCUS_02620 310231 310407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 311672 310419 gene locus_tag LOCUS_02630 311672 310419 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_02630 312343 311672 gene locus_tag LOCUS_02640 312343 311672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_02640 312386 312727 gene locus_tag LOCUS_02650 312386 312727 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_02650 312745 313479 gene locus_tag LOCUS_02660 312745 313479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 313445 315460 gene locus_tag LOCUS_02670 313445 315460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 315475 318207 gene locus_tag LOCUS_02680 315475 318207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_02680 319249 318218 gene locus_tag LOCUS_02690 319249 318218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 320229 319267 gene locus_tag LOCUS_02700 320229 319267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 320216 321565 gene locus_tag LOCUS_02710 320216 321565 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_02710 323352 321562 gene locus_tag LOCUS_02720 323352 321562 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_02720 324532 323582 gene locus_tag LOCUS_02730 324532 323582 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_02730 325776 324529 gene locus_tag LOCUS_02740 325776 324529 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_02740 325776 326153 gene locus_tag LOCUS_02750 325776 326153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 326150 326599 gene locus_tag LOCUS_02760 326150 326599 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_02760 327994 326615 gene locus_tag LOCUS_02770 327994 326615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 328405 328019 gene locus_tag LOCUS_02780 328405 328019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 328987 328454 gene locus_tag LOCUS_02790 328987 328454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 331846 329000 gene locus_tag LOCUS_02800 331846 329000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 332059 333726 gene locus_tag LOCUS_02810 332059 333726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 333872 334651 gene locus_tag LOCUS_02820 333872 334651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_02820 334626 335729 gene locus_tag LOCUS_02830 334626 335729 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_02830 335745 336935 gene locus_tag LOCUS_02840 335745 336935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 336952 337788 gene locus_tag LOCUS_02850 336952 337788 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_02850 337876 338607 gene locus_tag LOCUS_02860 337876 338607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 339727 338612 gene locus_tag LOCUS_02870 339727 338612 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_02870 339991 339749 gene locus_tag LOCUS_02880 339991 339749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 340302 340018 gene locus_tag LOCUS_02890 340302 340018 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_02890 340422 340592 gene locus_tag LOCUS_02900 340422 340592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 342526 340589 gene locus_tag LOCUS_02910 342526 340589 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_02910 342626 345472 gene locus_tag LOCUS_02920 342626 345472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 345476 346231 gene locus_tag LOCUS_02930 345476 346231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 346337 349408 gene locus_tag LOCUS_02940 346337 349408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 348653 348560 gene locus_tag LOCUS_t00070 348653 348560 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 349405 350367 gene locus_tag LOCUS_02950 gene hflC 349405 350367 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_02950 350364 351296 gene locus_tag LOCUS_02960 350364 351296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 351293 351772 gene locus_tag LOCUS_02970 351293 351772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 351791 352984 gene locus_tag LOCUS_02980 351791 352984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 352989 354248 gene locus_tag LOCUS_02990 352989 354248 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_02990 354262 355239 gene locus_tag LOCUS_03000 354262 355239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_03000 355245 356243 gene locus_tag LOCUS_03010 355245 356243 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479910.1 protein_id gnl|my_center|LOCUS_03010 356262 356735 gene locus_tag LOCUS_03020 356262 356735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 356746 359046 gene locus_tag LOCUS_03030 356746 359046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 359050 361377 gene locus_tag LOCUS_03040 359050 361377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 362976 361378 gene locus_tag LOCUS_03050 362976 361378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 363110 363724 gene locus_tag LOCUS_03060 363110 363724 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_03060 365387 363750 gene locus_tag LOCUS_03070 365387 363750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 366985 365384 gene locus_tag LOCUS_03080 366985 365384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 367932 367150 gene locus_tag LOCUS_03090 367932 367150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 369667 368033 gene locus_tag LOCUS_03100 369667 368033 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537605.1 protein_id gnl|my_center|LOCUS_03100 369654 369872 gene locus_tag LOCUS_03110 369654 369872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 369912 372044 gene locus_tag LOCUS_03120 369912 372044 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_03120 373480 372041 gene locus_tag LOCUS_03130 373480 372041 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_03130 373631 373640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 375763 373754 gene locus_tag LOCUS_03140 375763 373754 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_03140 375868 377208 gene locus_tag LOCUS_03150 375868 377208 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_03150 377277 378617 gene locus_tag LOCUS_03160 377277 378617 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_03160 378716 379903 gene locus_tag LOCUS_03170 378716 379903 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_03170 381256 379904 gene locus_tag LOCUS_03180 381256 379904 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_03180 381975 381253 gene locus_tag LOCUS_03190 381975 381253 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_03190 381997 383406 gene locus_tag LOCUS_03200 381997 383406 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_03200 383403 384827 gene locus_tag LOCUS_03210 383403 384827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 386558 384834 gene locus_tag LOCUS_03220 386558 384834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 386931 386566 gene locus_tag LOCUS_03230 386931 386566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 388216 386921 gene locus_tag LOCUS_03240 388216 386921 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_03240 388354 389736 gene locus_tag LOCUS_03250 388354 389736 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_03250 389761 390426 gene locus_tag LOCUS_03260 gene msrA 389761 390426 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_03260 390451 390687 gene locus_tag LOCUS_03270 390451 390687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 390698 391018 gene locus_tag LOCUS_03280 390698 391018 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_03280 392101 391019 gene locus_tag LOCUS_03290 392101 391019 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926062.1 protein_id gnl|my_center|LOCUS_03290 392205 393842 gene locus_tag LOCUS_03300 392205 393842 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_03300 394250 394942 gene locus_tag LOCUS_03310 394250 394942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 395757 394939 gene locus_tag LOCUS_03320 395757 394939 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_03320 395856 396524 gene locus_tag LOCUS_03330 gene rpoE 395856 396524 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_03330 396521 396934 gene locus_tag LOCUS_03340 396521 396934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 396947 397816 gene locus_tag LOCUS_03350 396947 397816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 397886 399646 gene locus_tag LOCUS_03360 397886 399646 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390124.1 protein_id gnl|my_center|LOCUS_03360 401333 399684 gene locus_tag LOCUS_03370 401333 399684 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730448.1 protein_id gnl|my_center|LOCUS_03370 402703 401405 gene locus_tag LOCUS_03380 402703 401405 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_03380 402892 404415 gene locus_tag LOCUS_03390 402892 404415 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_03390 406075 404807 gene locus_tag LOCUS_03400 406075 404807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 406074 406442 gene locus_tag LOCUS_03410 406074 406442 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_03410 406439 407281 gene locus_tag LOCUS_03420 406439 407281 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_03420 407547 408650 gene locus_tag LOCUS_03430 407547 408650 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_03430 410908 408695 gene locus_tag LOCUS_03440 410908 408695 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_03440 411782 410925 gene locus_tag LOCUS_03450 411782 410925 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_03450 412162 411779 gene locus_tag LOCUS_03460 412162 411779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 412740 412159 gene locus_tag LOCUS_03470 gene nthA 412740 412159 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_03470 413312 412737 gene locus_tag LOCUS_03480 gene nthB 413312 412737 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_03480 413396 414811 gene locus_tag LOCUS_03490 413396 414811 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_03490 416455 414815 gene locus_tag LOCUS_03500 416455 414815 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_03500 416572 417939 gene locus_tag LOCUS_03510 416572 417939 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_03510 418898 417927 gene locus_tag LOCUS_03520 418898 417927 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105584.1 protein_id gnl|my_center|LOCUS_03520 422338 418895 gene locus_tag LOCUS_03530 422338 418895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 422415 423248 gene locus_tag LOCUS_03540 422415 423248 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_03540 423263 425041 gene locus_tag LOCUS_03550 423263 425041 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_03550 425869 425045 gene locus_tag LOCUS_03560 gene mutM 425869 425045 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_03560 427373 425871 gene locus_tag LOCUS_03570 427373 425871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 428755 427370 gene locus_tag LOCUS_03580 428755 427370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 429558 428776 gene locus_tag LOCUS_03590 429558 428776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 429526 430305 gene locus_tag LOCUS_03600 429526 430305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 430334 433717 gene locus_tag LOCUS_03610 gene ileS 430334 433717 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_03610 433752 435131 gene locus_tag LOCUS_03620 433752 435131 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_03620 435909 435220 gene locus_tag LOCUS_03630 435909 435220 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_03630 436072 436710 gene locus_tag LOCUS_03640 436072 436710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948360.1 protein_id gnl|my_center|LOCUS_03640 436831 437178 gene locus_tag LOCUS_03650 436831 437178 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 protein_id gnl|my_center|LOCUS_03650 437602 437237 gene locus_tag LOCUS_03660 437602 437237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 438425 437832 gene locus_tag LOCUS_03670 438425 437832 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_03670 438552 438941 gene locus_tag LOCUS_03680 438552 438941 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_03680 440890 438938 gene locus_tag LOCUS_03690 440890 438938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 441648 440959 gene locus_tag LOCUS_03700 gene moaD 441648 440959 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417290.1 protein_id gnl|my_center|LOCUS_03700 441709 442413 gene locus_tag LOCUS_03710 441709 442413 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_03710 442410 443384 gene locus_tag LOCUS_03720 442410 443384 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_03720 443467 443703 gene locus_tag LOCUS_03730 443467 443703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 443707 444093 gene locus_tag LOCUS_03740 443707 444093 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_03740 444249 445205 gene locus_tag LOCUS_03750 444249 445205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_03750 445293 447008 gene locus_tag LOCUS_03760 445293 447008 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_03760 447109 448257 gene locus_tag LOCUS_03770 447109 448257 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_03770 448254 451160 gene locus_tag LOCUS_03780 448254 451160 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_03780 452751 451300 gene locus_tag LOCUS_03790 gene moeB 452751 451300 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_03790 453248 452790 gene locus_tag LOCUS_03800 453248 452790 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_03800 454260 453256 gene locus_tag LOCUS_03810 454260 453256 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_03810 454387 455013 gene locus_tag LOCUS_03820 454387 455013 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227865.1 protein_id gnl|my_center|LOCUS_03820 455457 454999 gene locus_tag LOCUS_03830 gene argR 455457 454999 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_03830 456959 455454 gene locus_tag LOCUS_03840 gene argH 456959 455454 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_03840 458134 456956 gene locus_tag LOCUS_03850 458134 456956 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03850 458999 458142 gene locus_tag LOCUS_03860 gene argB 458999 458142 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_03860 460216 459014 gene locus_tag LOCUS_03870 gene argJ 460216 459014 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_03870 461253 460213 gene locus_tag LOCUS_03880 gene argC 461253 460213 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_03880 462156 461311 gene locus_tag LOCUS_03890 462156 461311 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_03890 462449 462156 gene locus_tag LOCUS_03900 462449 462156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 463849 462473 gene locus_tag LOCUS_03910 gene xseA 463849 462473 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_03910 464394 463846 gene locus_tag LOCUS_03920 464394 463846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 465128 464496 gene locus_tag LOCUS_03930 465128 464496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 467677 465167 gene locus_tag LOCUS_03940 467677 465167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 468105 467695 gene locus_tag LOCUS_03950 468105 467695 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_03950 469165 468149 gene locus_tag LOCUS_03960 gene mltG 469165 468149 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_03960 469635 469222 gene locus_tag LOCUS_03970 gene ruvX 469635 469222 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_03970 469726 472074 gene locus_tag LOCUS_03980 gene lptD 469726 472074 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_03980 472071 472949 gene locus_tag LOCUS_03990 gene rfbD 472071 472949 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_03990 472946 473884 gene locus_tag LOCUS_04000 472946 473884 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_04000 474459 473881 gene locus_tag LOCUS_04010 474459 473881 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015559.1 protein_id gnl|my_center|LOCUS_04010 475415 474522 gene locus_tag LOCUS_04020 475415 474522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 476431 475451 gene locus_tag LOCUS_04030 476431 475451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 477735 476428 gene locus_tag LOCUS_04040 477735 476428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 479006 477732 gene locus_tag LOCUS_04050 479006 477732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 480926 479052 gene locus_tag LOCUS_04060 480926 479052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 481203 483140 gene locus_tag LOCUS_04070 481203 483140 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_04070 484414 483161 gene locus_tag LOCUS_04080 484414 483161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 485705 484455 gene locus_tag LOCUS_04090 gene ftsA 485705 484455 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_04090 486621 485725 gene locus_tag LOCUS_04100 486621 485725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 488081 486663 gene locus_tag LOCUS_04110 gene murC 488081 486663 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_04110 489205 488084 gene locus_tag LOCUS_04120 gene murG 489205 488084 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_04120 490278 489202 gene locus_tag LOCUS_04130 gene ftsW 490278 489202 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04130 491725 490271 gene locus_tag LOCUS_04140 gene murD 491725 490271 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_04140 492805 491729 gene locus_tag LOCUS_04150 gene mraY 492805 491729 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_04150 494250 492805 gene locus_tag LOCUS_04160 494250 492805 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_04160 495860 494280 gene locus_tag LOCUS_04170 495860 494280 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04170 497620 495836 gene locus_tag LOCUS_04180 497620 495836 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_04180 498069 497683 gene locus_tag LOCUS_04190 498069 497683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 499066 498095 gene locus_tag LOCUS_04200 gene rsmH 499066 498095 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_04200 499542 499072 gene locus_tag LOCUS_04210 gene mraZ 499542 499072 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_04210 500882 499722 gene locus_tag LOCUS_04220 500882 499722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 501714 500893 gene locus_tag LOCUS_04230 501714 500893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 505205 501711 gene locus_tag LOCUS_04240 gene mfd 505205 501711 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_04240 505573 505223 gene locus_tag LOCUS_04250 505573 505223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 505664 505740 gene locus_tag LOCUS_t00080 505664 505740 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 506974 505886 gene locus_tag LOCUS_04260 506974 505886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 508174 506999 gene locus_tag LOCUS_04270 508174 506999 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_04270 509879 508191 gene locus_tag LOCUS_04280 509879 508191 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_04280 510970 509876 gene locus_tag LOCUS_04290 510970 509876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_04290 511964 511014 gene locus_tag LOCUS_04300 511964 511014 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_04300 512352 512080 gene locus_tag LOCUS_04310 512352 512080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 513320 512355 gene locus_tag LOCUS_04320 gene ilvA 513320 512355 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_04320 513350 514297 gene locus_tag LOCUS_04330 513350 514297 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_04330 516023 514575 gene locus_tag LOCUS_04340 gene panF 516023 514575 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937399.1 protein_id gnl|my_center|LOCUS_04340 516107 517720 gene locus_tag LOCUS_04350 516107 517720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 517751 518806 gene locus_tag LOCUS_04360 517751 518806 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_04360 518809 519879 gene locus_tag LOCUS_04370 518809 519879 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_04370 519885 520634 gene locus_tag LOCUS_04380 519885 520634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_04380 520631 521116 gene locus_tag LOCUS_04390 520631 521116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 521129 522409 gene locus_tag LOCUS_04400 521129 522409 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_04400 522423 523394 gene locus_tag LOCUS_04410 522423 523394 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_04410 523440 524345 gene locus_tag LOCUS_04420 523440 524345 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_04420 524480 527266 gene locus_tag LOCUS_04430 524480 527266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_04430 527604 530033 gene locus_tag LOCUS_04440 527604 530033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 530030 531859 gene locus_tag LOCUS_04450 530030 531859 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_04450 531956 534076 gene locus_tag LOCUS_04460 531956 534076 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792117.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence02 2201 1035 gene locus_tag LOCUS_04470 2201 1035 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_04470 2550 2206 gene locus_tag LOCUS_04480 2550 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2706 3914 gene locus_tag LOCUS_04490 2706 3914 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965460.1 protein_id gnl|my_center|LOCUS_04490 3991 5220 gene locus_tag LOCUS_04500 3991 5220 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_04500 6062 5301 gene locus_tag LOCUS_04510 6062 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7521 6109 gene locus_tag LOCUS_04520 gene trkA 7521 6109 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_04520 7600 8019 gene locus_tag LOCUS_04530 7600 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8031 8828 gene locus_tag LOCUS_04540 8031 8828 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_04540 8834 10786 gene locus_tag LOCUS_04550 8834 10786 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_04550 11476 10796 gene locus_tag LOCUS_04560 11476 10796 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_04560 11600 12931 gene locus_tag LOCUS_04570 11600 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 13699 12941 gene locus_tag LOCUS_04580 13699 12941 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_04580 15509 13701 gene locus_tag LOCUS_04590 15509 13701 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_04590 16309 15509 gene locus_tag LOCUS_04600 16309 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_04600 16463 18868 gene locus_tag LOCUS_04610 16463 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 20327 18906 gene locus_tag LOCUS_04620 20327 18906 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_04620 21055 20351 gene locus_tag LOCUS_04630 21055 20351 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_04630 22819 21095 gene locus_tag LOCUS_04640 gene rpoD 22819 21095 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_04640 23257 23039 gene locus_tag LOCUS_04650 23257 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 24162 23275 gene locus_tag LOCUS_04660 24162 23275 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_04660 24278 25399 gene locus_tag LOCUS_04670 24278 25399 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_04670 26704 25400 gene locus_tag LOCUS_04680 26704 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 27399 26686 gene locus_tag LOCUS_04690 27399 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 27443 27832 gene locus_tag LOCUS_04700 gene bolA 27443 27832 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 protein_id gnl|my_center|LOCUS_04700 28497 27841 gene locus_tag LOCUS_04710 28497 27841 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_04710 28981 28634 gene locus_tag LOCUS_04720 28981 28634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 30118 30127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30179 30901 gene locus_tag LOCUS_04730 30179 30901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 33830 30912 gene locus_tag LOCUS_04740 33830 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 33935 35173 gene locus_tag LOCUS_04750 33935 35173 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_04750 35189 36601 gene locus_tag LOCUS_04760 35189 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 37945 36713 gene locus_tag LOCUS_04770 37945 36713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 39037 37979 gene locus_tag LOCUS_04780 39037 37979 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_04780 40529 39111 gene locus_tag LOCUS_04790 gene amt 40529 39111 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_04790 41108 40692 gene locus_tag LOCUS_04800 41108 40692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 42693 41176 gene locus_tag LOCUS_04810 42693 41176 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_04810 46370 42690 gene locus_tag LOCUS_04820 46370 42690 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_04820 46540 47610 gene locus_tag LOCUS_04830 gene mer 46540 47610 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_04830 47635 48744 gene locus_tag LOCUS_04840 47635 48744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 49712 48759 gene locus_tag LOCUS_04850 49712 48759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 51154 49760 gene locus_tag LOCUS_04860 51154 49760 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_04860 52026 51223 gene locus_tag LOCUS_04870 52026 51223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 52496 52023 gene locus_tag LOCUS_04880 52496 52023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 52845 52516 gene locus_tag LOCUS_04890 52845 52516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 53497 52898 gene locus_tag LOCUS_04900 53497 52898 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_04900 55275 53518 gene locus_tag LOCUS_04910 55275 53518 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_04910 56033 55317 gene locus_tag LOCUS_04920 56033 55317 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_04920 57386 56151 gene locus_tag LOCUS_04930 57386 56151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_04930 57994 57386 gene locus_tag LOCUS_04940 57994 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 59456 57996 gene locus_tag LOCUS_04950 gene nrfD 59456 57996 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_04950 59589 60383 gene locus_tag LOCUS_04960 59589 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 61032 60367 gene locus_tag LOCUS_04970 61032 60367 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_04970 62092 61049 gene locus_tag LOCUS_04980 62092 61049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 63578 62085 gene locus_tag LOCUS_04990 gene tcuA 63578 62085 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_04990 63645 64451 gene locus_tag LOCUS_05000 63645 64451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_05000 65755 64466 gene locus_tag LOCUS_05010 65755 64466 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_05010 66705 65752 gene locus_tag LOCUS_05020 66705 65752 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_05020 67259 66702 gene locus_tag LOCUS_05030 gene pyrR 67259 66702 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_05030 67415 70975 gene locus_tag LOCUS_05040 gene smc 67415 70975 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_05040 70996 72300 gene locus_tag LOCUS_05050 70996 72300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 72682 72269 gene locus_tag LOCUS_05060 72682 72269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 72992 72693 gene locus_tag LOCUS_05070 72992 72693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 72897 73340 gene locus_tag LOCUS_05080 72897 73340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 73363 74631 gene locus_tag LOCUS_05090 73363 74631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 74640 77804 gene locus_tag LOCUS_05100 74640 77804 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_05100 80424 77818 gene locus_tag LOCUS_05110 80424 77818 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_05110 81528 80467 gene locus_tag LOCUS_05120 81528 80467 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_05120 81614 82237 gene locus_tag LOCUS_05130 81614 82237 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257344.1 protein_id gnl|my_center|LOCUS_05130 82279 83043 gene locus_tag LOCUS_05140 gene xth 82279 83043 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_05140 83040 83942 gene locus_tag LOCUS_05150 83040 83942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 84679 83945 gene locus_tag LOCUS_05160 84679 83945 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_05160 84791 85402 gene locus_tag LOCUS_05170 84791 85402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 85399 86304 gene locus_tag LOCUS_05180 85399 86304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_05180 86322 87587 gene locus_tag LOCUS_05190 86322 87587 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_05190 87612 88112 gene locus_tag LOCUS_05200 87612 88112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 88221 88754 gene locus_tag LOCUS_05210 88221 88754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 88815 89339 gene locus_tag LOCUS_05220 88815 89339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_05220 89362 89835 gene locus_tag LOCUS_05230 89362 89835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 89856 91823 gene locus_tag LOCUS_05240 89856 91823 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_05240 91820 93967 gene locus_tag LOCUS_05250 91820 93967 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_05250 93964 94407 gene locus_tag LOCUS_05260 93964 94407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 94459 95091 gene locus_tag LOCUS_05270 94459 95091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 96351 95095 gene locus_tag LOCUS_05280 96351 95095 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_05280 98170 96362 gene locus_tag LOCUS_05290 98170 96362 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_05290 99300 98251 gene locus_tag LOCUS_05300 99300 98251 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_05300 102031 99398 gene locus_tag LOCUS_05310 102031 99398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 103221 102076 gene locus_tag LOCUS_05320 103221 102076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 104947 103208 gene locus_tag LOCUS_05330 104947 103208 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_05330 105025 105264 gene locus_tag LOCUS_05340 105025 105264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 105261 105692 gene locus_tag LOCUS_05350 105261 105692 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_05350 105770 106258 gene locus_tag LOCUS_05360 105770 106258 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_05360 106305 107453 gene locus_tag LOCUS_05370 106305 107453 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392016.1 protein_id gnl|my_center|LOCUS_05370 107450 110065 gene locus_tag LOCUS_05380 107450 110065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 110076 113543 gene locus_tag LOCUS_05390 110076 113543 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_05390 114615 113581 gene locus_tag LOCUS_05400 114615 113581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110512.1 protein_id gnl|my_center|LOCUS_05400 115298 114672 gene locus_tag LOCUS_05410 115298 114672 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_05410 116641 115292 gene locus_tag LOCUS_05420 116641 115292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_05420 116742 116816 gene locus_tag LOCUS_t00090 116742 116816 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 116881 117537 gene locus_tag LOCUS_05430 116881 117537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 117575 118477 gene locus_tag LOCUS_05440 117575 118477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 118468 119514 gene locus_tag LOCUS_05450 118468 119514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 119849 121972 gene locus_tag LOCUS_05460 119849 121972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 121980 122912 gene locus_tag LOCUS_05470 121980 122912 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 protein_id gnl|my_center|LOCUS_05470 124365 122983 gene locus_tag LOCUS_05480 124365 122983 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_05480 124589 124374 gene locus_tag LOCUS_05490 124589 124374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 125123 124641 gene locus_tag LOCUS_05500 125123 124641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 125210 125839 gene locus_tag LOCUS_05510 125210 125839 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_05510 128982 125800 gene locus_tag LOCUS_05520 128982 125800 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_05520 130495 128987 gene locus_tag LOCUS_05530 130495 128987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 131793 130492 gene locus_tag LOCUS_05540 131793 130492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 132303 131938 gene locus_tag LOCUS_05550 132303 131938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 132403 133491 gene locus_tag LOCUS_05560 132403 133491 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_05560 134444 133488 gene locus_tag LOCUS_05570 134444 133488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 135985 134447 gene locus_tag LOCUS_05580 135985 134447 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_05580 138713 135975 gene locus_tag LOCUS_05590 138713 135975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 139919 138762 gene locus_tag LOCUS_05600 139919 138762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_05600 141093 139948 gene locus_tag LOCUS_05610 141093 139948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 141788 141090 gene locus_tag LOCUS_05620 141788 141090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_05620 143061 141826 gene locus_tag LOCUS_05630 143061 141826 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_05630 143583 143200 gene locus_tag LOCUS_05640 gene vapc11 143583 143200 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_05640 143792 143589 gene locus_tag LOCUS_05650 143792 143589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 145092 143890 gene locus_tag LOCUS_05660 145092 143890 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_05660 145167 146819 gene locus_tag LOCUS_05670 145167 146819 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_05670 146847 148208 gene locus_tag LOCUS_05680 146847 148208 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_05680 149445 148123 gene locus_tag LOCUS_05690 149445 148123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 150814 149750 gene locus_tag LOCUS_05700 150814 149750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 151975 150848 gene locus_tag LOCUS_05710 151975 150848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 153568 152465 gene locus_tag LOCUS_05720 153568 152465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 154923 153637 gene locus_tag LOCUS_05730 gene pvdM 154923 153637 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_05730 155953 154940 gene locus_tag LOCUS_05740 155953 154940 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_05740 156019 157437 gene locus_tag LOCUS_05750 156019 157437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 157554 161501 gene locus_tag LOCUS_05760 157554 161501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 161522 162634 gene locus_tag LOCUS_05770 161522 162634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_05770 162677 164110 gene locus_tag LOCUS_05780 162677 164110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_05780 164185 164433 gene locus_tag LOCUS_05790 164185 164433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 164430 164882 gene locus_tag LOCUS_05800 164430 164882 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_05800 164964 166382 gene locus_tag LOCUS_05810 164964 166382 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_05810 166588 166379 gene locus_tag LOCUS_05820 166588 166379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 166655 167266 gene locus_tag LOCUS_05830 166655 167266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 167758 167291 gene locus_tag LOCUS_05840 167758 167291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 167857 168240 gene locus_tag LOCUS_05850 167857 168240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818687.1 protein_id gnl|my_center|LOCUS_05850 168853 168293 gene locus_tag LOCUS_05860 168853 168293 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_05860 169904 168885 gene locus_tag LOCUS_05870 169904 168885 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_05870 170015 170965 gene locus_tag LOCUS_05880 170015 170965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_05880 170962 172227 gene locus_tag LOCUS_05890 170962 172227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_05890 174124 172241 gene locus_tag LOCUS_05900 174124 172241 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_05900 176067 174142 gene locus_tag LOCUS_05910 176067 174142 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_05910 176707 176099 gene locus_tag LOCUS_05920 176707 176099 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_05920 178844 176721 gene locus_tag LOCUS_05930 178844 176721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 180321 178954 gene locus_tag LOCUS_05940 180321 178954 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878019.1 protein_id gnl|my_center|LOCUS_05940 181087 180485 gene locus_tag LOCUS_05950 181087 180485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 181432 181214 gene locus_tag LOCUS_05960 181432 181214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 182116 183285 gene locus_tag LOCUS_05970 182116 183285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 183290 186451 gene locus_tag LOCUS_05980 183290 186451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 186769 186395 gene locus_tag LOCUS_05990 186769 186395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 186830 187048 gene locus_tag LOCUS_06000 186830 187048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 188164 187070 gene locus_tag LOCUS_06010 188164 187070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 188565 188176 gene locus_tag LOCUS_06020 188565 188176 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_06020 188712 190265 gene locus_tag LOCUS_06030 188712 190265 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_06030 190486 190253 gene locus_tag LOCUS_06040 190486 190253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 192423 190570 gene locus_tag LOCUS_06050 192423 190570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 194330 192411 gene locus_tag LOCUS_06060 194330 192411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 196923 194467 gene locus_tag LOCUS_06070 196923 194467 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_06070 196986 197975 gene locus_tag LOCUS_06080 196986 197975 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809641.1 protein_id gnl|my_center|LOCUS_06080 199035 198010 gene locus_tag LOCUS_06090 199035 198010 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_06090 199179 202403 gene locus_tag LOCUS_06100 199179 202403 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_06100 202421 203461 gene locus_tag LOCUS_06110 202421 203461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 203488 205512 gene locus_tag LOCUS_06120 203488 205512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 205569 206900 gene locus_tag LOCUS_06130 205569 206900 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_06130 207990 206923 gene locus_tag LOCUS_06140 207990 206923 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_06140 209004 208111 gene locus_tag LOCUS_06150 209004 208111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 209250 209026 gene locus_tag LOCUS_06160 209250 209026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 210727 209309 gene locus_tag LOCUS_06170 210727 209309 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_06170 211141 210737 gene locus_tag LOCUS_06180 211141 210737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 212630 211221 gene locus_tag LOCUS_06190 212630 211221 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_06190 213588 212677 gene locus_tag LOCUS_06200 gene ada 213588 212677 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_06200 214713 213706 gene locus_tag LOCUS_06210 214713 213706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 216379 214724 gene locus_tag LOCUS_06220 216379 214724 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_06220 217746 216394 gene locus_tag LOCUS_06230 217746 216394 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_06230 220121 217743 gene locus_tag LOCUS_06240 220121 217743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 220341 221249 gene locus_tag LOCUS_06250 220341 221249 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_06250 223082 221328 gene locus_tag LOCUS_06260 223082 221328 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_06260 224695 223127 gene locus_tag LOCUS_06270 224695 223127 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_06270 224884 226701 gene locus_tag LOCUS_06280 224884 226701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 228173 226698 gene locus_tag LOCUS_06290 228173 226698 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_06290 229047 228205 gene locus_tag LOCUS_06300 229047 228205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 229477 229064 gene locus_tag LOCUS_06310 229477 229064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 230536 229508 gene locus_tag LOCUS_06320 230536 229508 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063640.1 protein_id gnl|my_center|LOCUS_06320 231690 230533 gene locus_tag LOCUS_06330 231690 230533 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082971.1 protein_id gnl|my_center|LOCUS_06330 231747 233171 gene locus_tag LOCUS_06340 231747 233171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 233819 233214 gene locus_tag LOCUS_06350 233819 233214 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_06350 234906 233794 gene locus_tag LOCUS_06360 234906 233794 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_06360 235925 234903 gene locus_tag LOCUS_06370 235925 234903 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_06370 237990 235942 gene locus_tag LOCUS_06380 237990 235942 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_06380 239295 238069 gene locus_tag LOCUS_06390 239295 238069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 240740 239394 gene locus_tag LOCUS_06400 240740 239394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 241182 240733 gene locus_tag LOCUS_06410 241182 240733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 244330 241265 gene locus_tag LOCUS_06420 244330 241265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 245734 244364 gene locus_tag LOCUS_06430 245734 244364 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_06430 246024 247037 gene locus_tag LOCUS_06440 246024 247037 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_06440 247404 248645 gene locus_tag LOCUS_06450 gene frc 247404 248645 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_06450 248642 250297 gene locus_tag LOCUS_06460 gene oxc 248642 250297 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878289.1 protein_id gnl|my_center|LOCUS_06460 250319 251173 gene locus_tag LOCUS_06470 250319 251173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_06470 251274 251636 gene locus_tag LOCUS_06480 251274 251636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 251644 252936 gene locus_tag LOCUS_06490 251644 252936 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_06490 252924 253505 gene locus_tag LOCUS_06500 252924 253505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 253517 255067 gene locus_tag LOCUS_06510 253517 255067 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 protein_id gnl|my_center|LOCUS_06510 255562 255122 gene locus_tag LOCUS_06520 255562 255122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 256712 255630 gene locus_tag LOCUS_06530 256712 255630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 257658 256732 gene locus_tag LOCUS_06540 257658 256732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 258808 257783 gene locus_tag LOCUS_06550 258808 257783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 260627 258870 gene locus_tag LOCUS_06560 260627 258870 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537467.1 protein_id gnl|my_center|LOCUS_06560 260991 262166 gene locus_tag LOCUS_06570 260991 262166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 261862 261961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 262094 264223 gene locus_tag LOCUS_06580 262094 264223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 264649 264395 gene locus_tag LOCUS_06590 264649 264395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 264567 267407 gene locus_tag LOCUS_06600 264567 267407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 267437 268687 gene locus_tag LOCUS_06610 gene fabF 267437 268687 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_06610 269448 268762 gene locus_tag LOCUS_06620 269448 268762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 269536 269766 gene locus_tag LOCUS_06630 269536 269766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 269763 270134 gene locus_tag LOCUS_06640 269763 270134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 271507 270146 gene locus_tag LOCUS_06650 271507 270146 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_06650 273065 271542 gene locus_tag LOCUS_06660 273065 271542 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_06660 274840 273062 gene locus_tag LOCUS_06670 274840 273062 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_06670 275128 275415 gene locus_tag LOCUS_06680 gene groES 275128 275415 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975851.1 protein_id gnl|my_center|LOCUS_06680 275438 277075 gene locus_tag LOCUS_06690 gene groL 275438 277075 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_06690 <277714 277129 gene locus_tag LOCUS_06700 <277714 277129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028173962.1:NAD(P)-dependent oxidoreductase >Feature sequence03 575 2173 gene locus_tag LOCUS_06710 575 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2629 2201 gene locus_tag LOCUS_06720 2629 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2781 3263 gene locus_tag LOCUS_06730 2781 3263 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_06730 3266 5680 gene locus_tag LOCUS_06740 3266 5680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_06740 6584 5715 gene locus_tag LOCUS_06750 6584 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7002 6619 gene locus_tag LOCUS_06760 7002 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7137 8528 gene locus_tag LOCUS_06770 7137 8528 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_06770 8529 9926 gene locus_tag LOCUS_06780 8529 9926 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_06780 9956 11602 gene locus_tag LOCUS_06790 9956 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141929.1 protein_id gnl|my_center|LOCUS_06790 12108 11599 gene locus_tag LOCUS_06800 12108 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13427 12105 gene locus_tag LOCUS_06810 13427 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13562 14170 gene locus_tag LOCUS_06820 13562 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 15139 14183 gene locus_tag LOCUS_06830 15139 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 16131 15172 gene locus_tag LOCUS_06840 16131 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 16191 19508 gene locus_tag LOCUS_06850 16191 19508 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_06850 19521 20336 gene locus_tag LOCUS_06860 19521 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 20374 20781 gene locus_tag LOCUS_06870 20374 20781 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_06870 21567 20797 gene locus_tag LOCUS_06880 21567 20797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_06880 23330 21570 gene locus_tag LOCUS_06890 23330 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 24973 23327 gene locus_tag LOCUS_06900 24973 23327 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_06900 25133 26233 gene locus_tag LOCUS_06910 25133 26233 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_06910 26291 27286 gene locus_tag LOCUS_06920 26291 27286 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_06920 28718 27303 gene locus_tag LOCUS_06930 28718 27303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 28813 30126 gene locus_tag LOCUS_06940 28813 30126 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_06940 30149 31165 gene locus_tag LOCUS_06950 30149 31165 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_06950 32033 31167 gene locus_tag LOCUS_06960 32033 31167 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224475.1 protein_id gnl|my_center|LOCUS_06960 37045 32315 gene locus_tag LOCUS_06970 37045 32315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 39088 38234 gene locus_tag LOCUS_06980 39088 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 45361 39359 gene locus_tag LOCUS_06990 45361 39359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 45509 45997 gene locus_tag LOCUS_07000 45509 45997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 47466 46567 gene locus_tag LOCUS_07010 47466 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 47927 48712 gene locus_tag LOCUS_07020 47927 48712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067690.1 protein_id gnl|my_center|LOCUS_07020 48772 49761 gene locus_tag LOCUS_07030 48772 49761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 49903 50772 gene locus_tag LOCUS_07040 49903 50772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 52095 50821 gene locus_tag LOCUS_07050 52095 50821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 53651 52272 gene locus_tag LOCUS_07060 53651 52272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 54845 53724 gene locus_tag LOCUS_07070 54845 53724 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 protein_id gnl|my_center|LOCUS_07070 54941 55306 gene locus_tag LOCUS_07080 54941 55306 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_07080 55323 56195 gene locus_tag LOCUS_07090 55323 56195 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_07090 56192 57064 gene locus_tag LOCUS_07100 56192 57064 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_07100 57174 59816 gene locus_tag LOCUS_07110 gene lon 57174 59816 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228447.1 protein_id gnl|my_center|LOCUS_07110 60158 59895 gene locus_tag LOCUS_07120 60158 59895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 61388 60258 gene locus_tag LOCUS_07130 61388 60258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 61454 62857 gene locus_tag LOCUS_07140 61454 62857 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_07140 64429 62867 gene locus_tag LOCUS_07150 64429 62867 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_07150 64471 65376 gene locus_tag LOCUS_07160 64471 65376 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_07160 65499 65903 gene locus_tag LOCUS_07170 65499 65903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 66094 67446 gene locus_tag LOCUS_07180 66094 67446 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_07180 67474 68052 gene locus_tag LOCUS_07190 67474 68052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 68049 68498 gene locus_tag LOCUS_07200 68049 68498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 69417 68476 gene locus_tag LOCUS_07210 69417 68476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 69950 69414 gene locus_tag LOCUS_07220 69950 69414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_07220 71494 69980 gene locus_tag LOCUS_07230 71494 69980 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_07230 73155 71491 gene locus_tag LOCUS_07240 73155 71491 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_07240 74663 73152 gene locus_tag LOCUS_07250 74663 73152 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_07250 77255 74676 gene locus_tag LOCUS_07260 77255 74676 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_07260 77277 78374 gene locus_tag LOCUS_07270 77277 78374 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_07270 78434 79867 gene locus_tag LOCUS_07280 78434 79867 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_07280 79873 80610 gene locus_tag LOCUS_07290 79873 80610 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_07290 81726 80626 gene locus_tag LOCUS_07300 gene rsgA 81726 80626 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_07300 82565 81726 gene locus_tag LOCUS_07310 82565 81726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 protein_id gnl|my_center|LOCUS_07310 83475 82558 gene locus_tag LOCUS_07320 83475 82558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_07320 85063 83489 gene locus_tag LOCUS_07330 85063 83489 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_07330 85571 85140 gene locus_tag LOCUS_07340 85571 85140 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_07340 85849 85568 gene locus_tag LOCUS_07350 85849 85568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 86176 87024 gene locus_tag LOCUS_07360 86176 87024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 87833 87054 gene locus_tag LOCUS_07370 87833 87054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 88996 87833 gene locus_tag LOCUS_07380 88996 87833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 89769 89023 gene locus_tag LOCUS_07390 89769 89023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 91234 89852 gene locus_tag LOCUS_07400 91234 89852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 92869 91253 gene locus_tag LOCUS_07410 92869 91253 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_07410 93645 92872 gene locus_tag LOCUS_07420 93645 92872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 93880 95451 gene locus_tag LOCUS_07430 93880 95451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 95536 96777 gene locus_tag LOCUS_07440 95536 96777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 97027 96845 gene locus_tag LOCUS_07450 97027 96845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 96957 97853 gene locus_tag LOCUS_07460 96957 97853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 98407 97982 gene locus_tag LOCUS_07470 98407 97982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 99444 98404 gene locus_tag LOCUS_07480 99444 98404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 100353 99472 gene locus_tag LOCUS_07490 100353 99472 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_07490 102580 100505 gene locus_tag LOCUS_07500 102580 100505 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491174.1 protein_id gnl|my_center|LOCUS_07500 103617 102625 gene locus_tag LOCUS_07510 103617 102625 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_07510 103671 104975 gene locus_tag LOCUS_07520 103671 104975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 105038 106252 gene locus_tag LOCUS_07530 105038 106252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 106249 107490 gene locus_tag LOCUS_07540 106249 107490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 107867 107550 gene locus_tag LOCUS_07550 107867 107550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 108626 107922 gene locus_tag LOCUS_07560 108626 107922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 108746 109624 gene locus_tag LOCUS_07570 108746 109624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_07570 109824 112124 gene locus_tag LOCUS_07580 109824 112124 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_07580 112124 112711 gene locus_tag LOCUS_07590 112124 112711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 113322 112708 gene locus_tag LOCUS_07600 113322 112708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 114261 113323 gene locus_tag LOCUS_07610 114261 113323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 115005 114304 gene locus_tag LOCUS_07620 115005 114304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_07620 115151 115738 gene locus_tag LOCUS_07630 115151 115738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 115771 116910 gene locus_tag LOCUS_07640 115771 116910 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_07640 118597 116921 gene locus_tag LOCUS_07650 118597 116921 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_07650 120270 118594 gene locus_tag LOCUS_07660 120270 118594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 121328 120288 gene locus_tag LOCUS_07670 121328 120288 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_07670 121528 122724 gene locus_tag LOCUS_07680 121528 122724 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_07680 123434 122721 gene locus_tag LOCUS_07690 123434 122721 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_07690 125024 123453 gene locus_tag LOCUS_07700 125024 123453 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_07700 125609 125061 gene locus_tag LOCUS_07710 125609 125061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 127114 125630 gene locus_tag LOCUS_07720 127114 125630 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_07720 128241 127111 gene locus_tag LOCUS_07730 128241 127111 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_07730 128447 128241 gene locus_tag LOCUS_07740 128447 128241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 128777 128502 gene locus_tag LOCUS_07750 128777 128502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 128905 129402 gene locus_tag LOCUS_07760 128905 129402 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775378.1 protein_id gnl|my_center|LOCUS_07760 130434 129406 gene locus_tag LOCUS_07770 130434 129406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 130531 130785 gene locus_tag LOCUS_07780 130531 130785 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_07780 130788 131168 gene locus_tag LOCUS_07790 130788 131168 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_07790 131205 133307 gene locus_tag LOCUS_07800 131205 133307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 133304 134182 gene locus_tag LOCUS_07810 133304 134182 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_07810 134179 135762 gene locus_tag LOCUS_07820 134179 135762 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_07820 135759 135998 gene locus_tag LOCUS_07830 135759 135998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 136019 136237 gene locus_tag LOCUS_07840 136019 136237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 136554 136195 gene locus_tag LOCUS_07850 136554 136195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 136597 136800 gene locus_tag LOCUS_07860 136597 136800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 137609 136797 gene locus_tag LOCUS_07870 137609 136797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 137758 138720 gene locus_tag LOCUS_07880 137758 138720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965847.1 protein_id gnl|my_center|LOCUS_07880 138717 140459 gene locus_tag LOCUS_07890 138717 140459 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_07890 140456 140941 gene locus_tag LOCUS_07900 140456 140941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_07900 140953 141594 gene locus_tag LOCUS_07910 140953 141594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 141609 143330 gene locus_tag LOCUS_07920 141609 143330 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_07920 143403 144485 gene locus_tag LOCUS_07930 143403 144485 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110512.1 protein_id gnl|my_center|LOCUS_07930 144572 145396 gene locus_tag LOCUS_07940 144572 145396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 145339 146691 gene locus_tag LOCUS_07950 145339 146691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 148121 146697 gene locus_tag LOCUS_07960 148121 146697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 149331 148138 gene locus_tag LOCUS_07970 149331 148138 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_07970 149369 150385 gene locus_tag LOCUS_07980 149369 150385 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_07980 150442 151539 gene locus_tag LOCUS_07990 150442 151539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 152593 151667 gene locus_tag LOCUS_08000 152593 151667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 153307 152903 gene locus_tag LOCUS_08010 153307 152903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 154383 153370 gene locus_tag LOCUS_08020 154383 153370 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_08020 154450 155814 gene locus_tag LOCUS_08030 154450 155814 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_08030 155852 157174 gene locus_tag LOCUS_08040 155852 157174 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_08040 157579 157202 gene locus_tag LOCUS_08050 157579 157202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 157648 159600 gene locus_tag LOCUS_08060 157648 159600 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_08060 162414 159649 gene locus_tag LOCUS_08070 162414 159649 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_08070 163830 162523 gene locus_tag LOCUS_08080 163830 162523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_08080 164979 163861 gene locus_tag LOCUS_08090 gene modC 164979 163861 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_08090 165646 164969 gene locus_tag LOCUS_08100 gene modB 165646 164969 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_08100 166417 165659 gene locus_tag LOCUS_08110 gene modA 166417 165659 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_08110 168198 166414 gene locus_tag LOCUS_08120 gene ggt 168198 166414 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595115.1 protein_id gnl|my_center|LOCUS_08120 168282 169055 gene locus_tag LOCUS_08130 168282 169055 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_08130 170572 169052 gene locus_tag LOCUS_08140 170572 169052 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_08140 172377 170572 gene locus_tag LOCUS_08150 172377 170572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_08150 172483 174015 gene locus_tag LOCUS_08160 172483 174015 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_08160 174006 175748 gene locus_tag LOCUS_08170 174006 175748 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_08170 175741 176121 gene locus_tag LOCUS_08180 175741 176121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 177667 176141 gene locus_tag LOCUS_08190 177667 176141 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538264.1 protein_id gnl|my_center|LOCUS_08190 179274 177736 gene locus_tag LOCUS_08200 gene fadD13 179274 177736 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_08200 179967 179326 gene locus_tag LOCUS_08210 179967 179326 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_08210 181108 179981 gene locus_tag LOCUS_08220 181108 179981 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085669.1 protein_id gnl|my_center|LOCUS_08220 181494 181105 gene locus_tag LOCUS_08230 181494 181105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 181839 181504 gene locus_tag LOCUS_08240 181839 181504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 182012 182518 gene locus_tag LOCUS_08250 gene phaR 182012 182518 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_08250 182541 183416 gene locus_tag LOCUS_08260 182541 183416 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_08260 183464 184375 gene locus_tag LOCUS_08270 183464 184375 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_08270 184628 184392 gene locus_tag LOCUS_08280 184628 184392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 184821 186191 gene locus_tag LOCUS_08290 184821 186191 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_08290 186188 187135 gene locus_tag LOCUS_08300 186188 187135 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_08300 187207 187752 gene locus_tag LOCUS_08310 187207 187752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 187841 188896 gene locus_tag LOCUS_08320 187841 188896 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_08320 188893 189573 gene locus_tag LOCUS_08330 188893 189573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 189579 190709 gene locus_tag LOCUS_08340 189579 190709 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_08340 190716 190964 gene locus_tag LOCUS_08350 190716 190964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975287.1 protein_id gnl|my_center|LOCUS_08350 190961 191398 gene locus_tag LOCUS_08360 190961 191398 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_08360 192290 191403 gene locus_tag LOCUS_08370 192290 191403 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_08370 193264 192287 gene locus_tag LOCUS_08380 193264 192287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 194499 193318 gene locus_tag LOCUS_08390 194499 193318 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_08390 196326 194518 gene locus_tag LOCUS_08400 196326 194518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 197087 196341 gene locus_tag LOCUS_08410 gene map 197087 196341 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061441.1 protein_id gnl|my_center|LOCUS_08410 199065 197089 gene locus_tag LOCUS_08420 199065 197089 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_08420 199844 199065 gene locus_tag LOCUS_08430 199844 199065 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_08430 201818 199857 gene locus_tag LOCUS_08440 201818 199857 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204928.1 protein_id gnl|my_center|LOCUS_08440 201868 204237 gene locus_tag LOCUS_08450 201868 204237 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_08450 204275 204724 gene locus_tag LOCUS_08460 204275 204724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 204721 206706 gene locus_tag LOCUS_08470 204721 206706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 207066 207539 gene locus_tag LOCUS_08480 207066 207539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 207591 207998 gene locus_tag LOCUS_08490 207591 207998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 208004 209734 gene locus_tag LOCUS_08500 208004 209734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 209731 211074 gene locus_tag LOCUS_08510 209731 211074 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_08510 211115 212815 gene locus_tag LOCUS_08520 211115 212815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 212812 214464 gene locus_tag LOCUS_08530 212812 214464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 214473 216140 gene locus_tag LOCUS_08540 214473 216140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 216166 217722 gene locus_tag LOCUS_08550 216166 217722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 221471 218301 gene locus_tag LOCUS_08560 221471 218301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 224814 221686 gene locus_tag LOCUS_08570 224814 221686 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_08570 228374 224811 gene locus_tag LOCUS_08580 228374 224811 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_08580 229568 228405 gene locus_tag LOCUS_08590 229568 228405 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_08590 230874 229717 gene locus_tag LOCUS_08600 230874 229717 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence04 124 1050 gene locus_tag LOCUS_08610 124 1050 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116577.1 protein_id gnl|my_center|LOCUS_08610 1098 2072 gene locus_tag LOCUS_08620 1098 2072 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_08620 2132 3703 gene locus_tag LOCUS_08630 2132 3703 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 protein_id gnl|my_center|LOCUS_08630 3711 4211 gene locus_tag LOCUS_08640 3711 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4208 5572 gene locus_tag LOCUS_08650 4208 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6786 5569 gene locus_tag LOCUS_08660 6786 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_08660 7558 6803 gene locus_tag LOCUS_08670 7558 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7617 7931 gene locus_tag LOCUS_08680 7617 7931 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256664.1 protein_id gnl|my_center|LOCUS_08680 7950 8672 gene locus_tag LOCUS_08690 7950 8672 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256663.1 protein_id gnl|my_center|LOCUS_08690 8669 9280 gene locus_tag LOCUS_08700 8669 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 9277 10482 gene locus_tag LOCUS_08710 gene manA 9277 10482 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 protein_id gnl|my_center|LOCUS_08710 11025 10582 gene locus_tag LOCUS_08720 11025 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11621 11028 gene locus_tag LOCUS_08730 11621 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 13024 11618 gene locus_tag LOCUS_08740 13024 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 13092 13616 gene locus_tag LOCUS_08750 13092 13616 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_08750 14674 13613 gene locus_tag LOCUS_08760 14674 13613 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965522.1 protein_id gnl|my_center|LOCUS_08760 16332 14671 gene locus_tag LOCUS_08770 16332 14671 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_08770 16448 20551 gene locus_tag LOCUS_08780 16448 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 20548 22419 gene locus_tag LOCUS_08790 20548 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 22444 25149 gene locus_tag LOCUS_08800 22444 25149 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 protein_id gnl|my_center|LOCUS_08800 25342 27534 gene locus_tag LOCUS_08810 25342 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 27631 29985 gene locus_tag LOCUS_08820 27631 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 33483 30019 gene locus_tag LOCUS_08830 33483 30019 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_08830 33643 34290 gene locus_tag LOCUS_08840 33643 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 34840 34361 gene locus_tag LOCUS_08850 34840 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_08850 36232 34901 gene locus_tag LOCUS_08860 36232 34901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_08860 36338 37129 gene locus_tag LOCUS_08870 36338 37129 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_08870 37140 38231 gene locus_tag LOCUS_08880 37140 38231 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_08880 39430 38234 gene locus_tag LOCUS_08890 39430 38234 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_08890 40462 39488 gene locus_tag LOCUS_08900 40462 39488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408445.1 protein_id gnl|my_center|LOCUS_08900 40517 41317 gene locus_tag LOCUS_08910 40517 41317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 42277 41333 gene locus_tag LOCUS_08920 42277 41333 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_08920 43538 42291 gene locus_tag LOCUS_08930 43538 42291 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_08930 46478 43542 gene locus_tag LOCUS_08940 46478 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 47586 46471 gene locus_tag LOCUS_08950 47586 46471 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856704.1 protein_id gnl|my_center|LOCUS_08950 49046 47583 gene locus_tag LOCUS_08960 49046 47583 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_08960 50584 49043 gene locus_tag LOCUS_08970 50584 49043 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_08970 50665 52134 gene locus_tag LOCUS_08980 50665 52134 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_08980 52134 52901 gene locus_tag LOCUS_08990 52134 52901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 53925 52915 gene locus_tag LOCUS_09000 53925 52915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 53987 55006 gene locus_tag LOCUS_09010 53987 55006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 55038 56732 gene locus_tag LOCUS_09020 55038 56732 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_09020 56729 57316 gene locus_tag LOCUS_09030 gene lacC 56729 57316 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_09030 57365 58003 gene locus_tag LOCUS_09040 57365 58003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 58384 58127 gene locus_tag LOCUS_09050 58384 58127 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537648.1 protein_id gnl|my_center|LOCUS_09050 58508 58852 gene locus_tag LOCUS_09060 58508 58852 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_09060 58839 59231 gene locus_tag LOCUS_09070 58839 59231 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_09070 59254 60120 gene locus_tag LOCUS_09080 59254 60120 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922397.1 protein_id gnl|my_center|LOCUS_09080 60154 60807 gene locus_tag LOCUS_09090 60154 60807 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_09090 61382 60888 gene locus_tag LOCUS_09100 61382 60888 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_09100 61635 61369 gene locus_tag LOCUS_09110 61635 61369 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414620.1 protein_id gnl|my_center|LOCUS_09110 62730 61669 gene locus_tag LOCUS_09120 62730 61669 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_09120 64028 62778 gene locus_tag LOCUS_09130 64028 62778 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_09130 64087 65538 gene locus_tag LOCUS_09140 64087 65538 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_09140 66857 65553 gene locus_tag LOCUS_09150 66857 65553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920509.1 protein_id gnl|my_center|LOCUS_09150 67928 66879 gene locus_tag LOCUS_09160 67928 66879 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_09160 68537 68016 gene locus_tag LOCUS_09170 68537 68016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 69085 68537 gene locus_tag LOCUS_09180 69085 68537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 69199 71247 gene locus_tag LOCUS_09190 69199 71247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 71273 75181 gene locus_tag LOCUS_09200 71273 75181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 75178 76596 gene locus_tag LOCUS_09210 75178 76596 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_09210 76799 78193 gene locus_tag LOCUS_09220 76799 78193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 78190 80655 gene locus_tag LOCUS_09230 78190 80655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 80652 83204 gene locus_tag LOCUS_09240 80652 83204 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_09240 83214 84668 gene locus_tag LOCUS_09250 83214 84668 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_09250 84699 85943 gene locus_tag LOCUS_09260 84699 85943 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_09260 85996 86616 gene locus_tag LOCUS_09270 85996 86616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 87446 86658 gene locus_tag LOCUS_09280 87446 86658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 87507 88580 gene locus_tag LOCUS_09290 87507 88580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 89462 88605 gene locus_tag LOCUS_09300 89462 88605 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_09300 90975 89476 gene locus_tag LOCUS_09310 90975 89476 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_09310 91105 92259 gene locus_tag LOCUS_09320 91105 92259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 92273 93643 gene locus_tag LOCUS_09330 92273 93643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 93684 94850 gene locus_tag LOCUS_09340 93684 94850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_09340 94854 96881 gene locus_tag LOCUS_09350 94854 96881 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_09350 96909 98351 gene locus_tag LOCUS_09360 96909 98351 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_09360 98943 98353 gene locus_tag LOCUS_09370 98943 98353 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_09370 100533 98947 gene locus_tag LOCUS_09380 gene putP 100533 98947 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_09380 100617 101450 gene locus_tag LOCUS_09390 100617 101450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 101499 103712 gene locus_tag LOCUS_09400 101499 103712 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_09400 104227 103709 gene locus_tag LOCUS_09410 104227 103709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 105524 104220 gene locus_tag LOCUS_09420 105524 104220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 105616 107838 gene locus_tag LOCUS_09430 105616 107838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 107848 110115 gene locus_tag LOCUS_09440 107848 110115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 111017 110118 gene locus_tag LOCUS_09450 111017 110118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 111288 114902 gene locus_tag LOCUS_09460 111288 114902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 115314 115817 gene locus_tag LOCUS_09470 115314 115817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 115807 116409 gene locus_tag LOCUS_09480 115807 116409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 116425 116742 gene locus_tag LOCUS_09490 116425 116742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 116779 116952 gene locus_tag LOCUS_09500 116779 116952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 116986 117306 gene locus_tag LOCUS_09510 116986 117306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 117376 117663 gene locus_tag LOCUS_09520 117376 117663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 118040 119626 gene locus_tag LOCUS_09530 118040 119626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 119678 120463 gene locus_tag LOCUS_09540 119678 120463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080881.1 protein_id gnl|my_center|LOCUS_09540 120460 121239 gene locus_tag LOCUS_09550 120460 121239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 121284 121982 gene locus_tag LOCUS_09560 121284 121982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 122200 123300 gene locus_tag LOCUS_09570 122200 123300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 123758 123333 gene locus_tag LOCUS_09580 123758 123333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 124624 123788 gene locus_tag LOCUS_09590 124624 123788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 124792 126627 gene locus_tag LOCUS_09600 124792 126627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 128758 126629 gene locus_tag LOCUS_09610 128758 126629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 128983 130020 gene locus_tag LOCUS_09620 128983 130020 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_09620 130066 131088 gene locus_tag LOCUS_09630 130066 131088 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_09630 131085 132452 gene locus_tag LOCUS_09640 131085 132452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 132683 132501 gene locus_tag LOCUS_09650 132683 132501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 134261 132987 gene locus_tag LOCUS_09660 134261 132987 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_09660 134682 137354 gene locus_tag LOCUS_09670 134682 137354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 137974 137438 gene locus_tag LOCUS_09680 137974 137438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 139368 137971 gene locus_tag LOCUS_09690 gene nrfD 139368 137971 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_09690 140066 139365 gene locus_tag LOCUS_09700 140066 139365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 142399 140063 gene locus_tag LOCUS_09710 142399 140063 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_09710 142616 142371 gene locus_tag LOCUS_09720 142616 142371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 143708 143097 gene locus_tag LOCUS_09730 143708 143097 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_09730 144508 143705 gene locus_tag LOCUS_09740 144508 143705 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_09740 146543 144540 gene locus_tag LOCUS_09750 146543 144540 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_09750 148276 146645 gene locus_tag LOCUS_09760 148276 146645 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_09760 149946 148345 gene locus_tag LOCUS_09770 gene lbuL 149946 148345 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_09770 150001 150990 gene locus_tag LOCUS_09780 150001 150990 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461738.1 protein_id gnl|my_center|LOCUS_09780 151272 151012 gene locus_tag LOCUS_09790 151272 151012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 151857 151297 gene locus_tag LOCUS_09800 151857 151297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 152236 151862 gene locus_tag LOCUS_09810 152236 151862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 152520 152233 gene locus_tag LOCUS_09820 152520 152233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 153495 152536 gene locus_tag LOCUS_09830 153495 152536 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_09830 153538 154986 gene locus_tag LOCUS_09840 153538 154986 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_09840 155766 154999 gene locus_tag LOCUS_09850 155766 154999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 157013 155784 gene locus_tag LOCUS_09860 157013 155784 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_09860 158013 157006 gene locus_tag LOCUS_09870 158013 157006 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_09870 158485 158036 gene locus_tag LOCUS_09880 158485 158036 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_09880 159573 158482 gene locus_tag LOCUS_09890 159573 158482 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_09890 160781 159570 gene locus_tag LOCUS_09900 160781 159570 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_09900 163261 160847 gene locus_tag LOCUS_09910 163261 160847 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_09910 164733 163360 gene locus_tag LOCUS_09920 164733 163360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 164830 166788 gene locus_tag LOCUS_09930 164830 166788 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_09930 166804 168285 gene locus_tag LOCUS_09940 166804 168285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 168282 169184 gene locus_tag LOCUS_09950 168282 169184 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_09950 169185 170654 gene locus_tag LOCUS_09960 169185 170654 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_09960 170651 172204 gene locus_tag LOCUS_09970 170651 172204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 173150 172209 gene locus_tag LOCUS_09980 173150 172209 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132545545.1 protein_id gnl|my_center|LOCUS_09980 173410 175395 gene locus_tag LOCUS_09990 gene shc 173410 175395 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144045.1 protein_id gnl|my_center|LOCUS_09990 175392 177401 gene locus_tag LOCUS_10000 175392 177401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 177415 178557 gene locus_tag LOCUS_10010 177415 178557 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_10010 180474 178573 gene locus_tag LOCUS_10020 gene btuB 180474 178573 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_10020 180803 184078 gene locus_tag LOCUS_10030 gene recC 180803 184078 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_10030 184075 187857 gene locus_tag LOCUS_10040 gene recB 184075 187857 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_10040 187854 189614 gene locus_tag LOCUS_10050 gene recD 187854 189614 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_10050 191176 189767 gene locus_tag LOCUS_10060 191176 189767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 192516 191278 gene locus_tag LOCUS_10070 gene kynU 192516 191278 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_10070 192596 194452 gene locus_tag LOCUS_10080 192596 194452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 194764 196347 gene locus_tag LOCUS_10090 194764 196347 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_10090 196357 197553 gene locus_tag LOCUS_10100 196357 197553 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_10100 197571 199103 gene locus_tag LOCUS_10110 197571 199103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10110 199100 200308 gene locus_tag LOCUS_10120 199100 200308 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_10120 200357 200611 gene locus_tag LOCUS_10130 200357 200611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 200631 201488 gene locus_tag LOCUS_10140 200631 201488 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_10140 201964 201485 gene locus_tag LOCUS_10150 201964 201485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 201957 204320 gene locus_tag LOCUS_10160 201957 204320 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_10160 204595 205605 gene locus_tag LOCUS_10170 204595 205605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 205873 207009 gene locus_tag LOCUS_10180 205873 207009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 207054 208235 gene locus_tag LOCUS_10190 207054 208235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 209235 208291 gene locus_tag LOCUS_10200 209235 208291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 210797 210105 gene locus_tag LOCUS_10210 210797 210105 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_10210 211556 210819 gene locus_tag LOCUS_10220 211556 210819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 211889 212539 gene locus_tag LOCUS_10230 211889 212539 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_10230 212605 213573 gene locus_tag LOCUS_10240 212605 213573 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368575.1 protein_id gnl|my_center|LOCUS_10240 213585 213800 gene locus_tag LOCUS_10250 213585 213800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 213806 214417 gene locus_tag LOCUS_10260 213806 214417 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_10260 216091 214463 gene locus_tag LOCUS_10270 216091 214463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_10270 216030 216275 gene locus_tag LOCUS_10280 216030 216275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence05 3005 156 gene locus_tag LOCUS_10290 3005 156 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_10290 4657 3002 gene locus_tag LOCUS_10300 4657 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6257 4773 gene locus_tag LOCUS_10310 6257 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6335 7504 gene locus_tag LOCUS_10320 6335 7504 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_10320 7658 8728 gene locus_tag LOCUS_10330 7658 8728 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_10330 8753 9445 gene locus_tag LOCUS_10340 8753 9445 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_10340 9435 10166 gene locus_tag LOCUS_10350 9435 10166 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_10350 10224 10475 gene locus_tag LOCUS_10360 10224 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12034 10472 gene locus_tag LOCUS_10370 12034 10472 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_10370 12799 12080 gene locus_tag LOCUS_10380 12799 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 13183 12833 gene locus_tag LOCUS_10390 13183 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 13331 14467 gene locus_tag LOCUS_10400 13331 14467 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_10400 14496 16268 gene locus_tag LOCUS_10410 14496 16268 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_10410 16298 16585 gene locus_tag LOCUS_10420 16298 16585 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755918.1 protein_id gnl|my_center|LOCUS_10420 16600 17895 gene locus_tag LOCUS_10430 16600 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115906.1 protein_id gnl|my_center|LOCUS_10430 18007 17934 gene locus_tag LOCUS_t00100 18007 17934 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18843 18043 gene locus_tag LOCUS_10440 18843 18043 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_10440 20009 18849 gene locus_tag LOCUS_10450 20009 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 20105 21649 gene locus_tag LOCUS_10460 20105 21649 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222576.1 protein_id gnl|my_center|LOCUS_10460 21752 22264 gene locus_tag LOCUS_10470 21752 22264 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_10470 22261 24489 gene locus_tag LOCUS_10480 22261 24489 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_10480 24496 25071 gene locus_tag LOCUS_10490 24496 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 25512 26363 gene locus_tag LOCUS_10500 25512 26363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 26411 26980 gene locus_tag LOCUS_10510 26411 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 27381 27860 gene locus_tag LOCUS_10520 27381 27860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 27857 28639 gene locus_tag LOCUS_10530 27857 28639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 28900 28661 gene locus_tag LOCUS_10540 28900 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 28913 29092 gene locus_tag LOCUS_10550 28913 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 29151 30713 gene locus_tag LOCUS_10560 29151 30713 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_10560 30758 32185 gene locus_tag LOCUS_10570 30758 32185 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_10570 33477 32284 gene locus_tag LOCUS_10580 33477 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 33755 34015 gene locus_tag LOCUS_10590 33755 34015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 34210 34119 gene locus_tag LOCUS_t00110 34210 34119 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34660 34256 gene locus_tag LOCUS_10600 34660 34256 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_10600 36205 34697 gene locus_tag LOCUS_10610 gene atpD 36205 34697 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_10610 37125 36226 gene locus_tag LOCUS_10620 37125 36226 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_10620 38703 37165 gene locus_tag LOCUS_10630 gene atpA 38703 37165 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_10630 39329 38766 gene locus_tag LOCUS_10640 gene atpH 39329 38766 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_10640 39943 39326 gene locus_tag LOCUS_10650 39943 39326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 40362 39940 gene locus_tag LOCUS_10660 40362 39940 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_10660 40582 41721 gene locus_tag LOCUS_10670 40582 41721 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_10670 42578 41745 gene locus_tag LOCUS_10680 42578 41745 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_10680 43379 42621 gene locus_tag LOCUS_10690 43379 42621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 43487 44368 gene locus_tag LOCUS_10700 gene ftcD 43487 44368 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_10700 45730 44318 gene locus_tag LOCUS_10710 45730 44318 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_10710 46491 45739 gene locus_tag LOCUS_10720 gene rph 46491 45739 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_10720 47405 46572 gene locus_tag LOCUS_10730 gene murI 47405 46572 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_10730 48023 47409 gene locus_tag LOCUS_10740 48023 47409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 49786 48020 gene locus_tag LOCUS_10750 49786 48020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 49931 49856 gene locus_tag LOCUS_t00120 49931 49856 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50814 49975 gene locus_tag LOCUS_10760 50814 49975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393975.1 protein_id gnl|my_center|LOCUS_10760 52362 50836 gene locus_tag LOCUS_10770 52362 50836 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_10770 52430 53401 gene locus_tag LOCUS_10780 52430 53401 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_10780 53420 55069 gene locus_tag LOCUS_10790 53420 55069 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 protein_id gnl|my_center|LOCUS_10790 55078 56007 gene locus_tag LOCUS_10800 55078 56007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 56227 56030 gene locus_tag LOCUS_10810 56227 56030 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_10810 57825 56224 gene locus_tag LOCUS_10820 57825 56224 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_10820 58772 57822 gene locus_tag LOCUS_10830 58772 57822 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_10830 60115 58772 gene locus_tag LOCUS_10840 gene hmgA 60115 58772 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970302.1 protein_id gnl|my_center|LOCUS_10840 60862 60173 gene locus_tag LOCUS_10850 60862 60173 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_10850 62736 60859 gene locus_tag LOCUS_10860 62736 60859 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_10860 63436 62789 gene locus_tag LOCUS_10870 63436 62789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 64003 63656 gene locus_tag LOCUS_10880 64003 63656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 64896 64036 gene locus_tag LOCUS_10890 64896 64036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 64998 66635 gene locus_tag LOCUS_10900 64998 66635 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_10900 66935 66654 gene locus_tag LOCUS_10910 66935 66654 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 protein_id gnl|my_center|LOCUS_10910 67185 66922 gene locus_tag LOCUS_10920 gene dinJ 67185 66922 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729709.1 protein_id gnl|my_center|LOCUS_10920 68457 67300 gene locus_tag LOCUS_10930 68457 67300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_10930 68507 69421 gene locus_tag LOCUS_10940 gene tauD 68507 69421 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_10940 69425 70495 gene locus_tag LOCUS_10950 69425 70495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 72187 70505 gene locus_tag LOCUS_10960 72187 70505 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_10960 73035 72184 gene locus_tag LOCUS_10970 73035 72184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 75323 73032 gene locus_tag LOCUS_10980 75323 73032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 77101 75335 gene locus_tag LOCUS_10990 77101 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 78268 77117 gene locus_tag LOCUS_11000 78268 77117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 79397 78309 gene locus_tag LOCUS_11010 79397 78309 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_11010 79562 82996 gene locus_tag LOCUS_11020 79562 82996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 83099 85681 gene locus_tag LOCUS_11030 83099 85681 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036948.1 protein_id gnl|my_center|LOCUS_11030 85698 87329 gene locus_tag LOCUS_11040 85698 87329 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_11040 89911 87326 gene locus_tag LOCUS_11050 89911 87326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 89952 90596 gene locus_tag LOCUS_11060 89952 90596 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083342.1 protein_id gnl|my_center|LOCUS_11060 90628 90918 gene locus_tag LOCUS_11070 90628 90918 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_11070 90915 91358 gene locus_tag LOCUS_11080 90915 91358 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_11080 91372 92859 gene locus_tag LOCUS_11090 91372 92859 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_11090 93822 92911 gene locus_tag LOCUS_11100 93822 92911 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_11100 95303 93819 gene locus_tag LOCUS_11110 gene hpaE 95303 93819 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_11110 96073 95300 gene locus_tag LOCUS_11120 96073 95300 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_11120 96891 96088 gene locus_tag LOCUS_11130 96891 96088 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_11130 97681 96905 gene locus_tag LOCUS_11140 97681 96905 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 protein_id gnl|my_center|LOCUS_11140 98928 97678 gene locus_tag LOCUS_11150 98928 97678 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_11150 100256 98940 gene locus_tag LOCUS_11160 gene glnA 100256 98940 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906377.1 protein_id gnl|my_center|LOCUS_11160 101729 100284 gene locus_tag LOCUS_11170 101729 100284 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_11170 104512 101726 gene locus_tag LOCUS_11180 104512 101726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 106247 104502 gene locus_tag LOCUS_11190 106247 104502 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_11190 108018 106237 gene locus_tag LOCUS_11200 108018 106237 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_11200 110514 108025 gene locus_tag LOCUS_11210 110514 108025 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090108.1 protein_id gnl|my_center|LOCUS_11210 110594 111892 gene locus_tag LOCUS_11220 110594 111892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 113092 111917 gene locus_tag LOCUS_11230 113092 111917 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_11230 114984 113089 gene locus_tag LOCUS_11240 114984 113089 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_11240 115751 114987 gene locus_tag LOCUS_11250 115751 114987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_11250 116513 115752 gene locus_tag LOCUS_11260 116513 115752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_11260 117586 116510 gene locus_tag LOCUS_11270 117586 116510 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_11270 118377 117604 gene locus_tag LOCUS_11280 118377 117604 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_11280 119775 118540 gene locus_tag LOCUS_11290 119775 118540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(119311..119313),aa:Sec) note codon on position 155 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11290 119876 121378 gene locus_tag LOCUS_11300 gene gabD 119876 121378 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_11300 122752 121424 gene locus_tag LOCUS_11310 122752 121424 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_11310 124088 122877 gene locus_tag LOCUS_11320 124088 122877 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_11320 125359 124160 gene locus_tag LOCUS_11330 125359 124160 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_11330 125823 125491 gene locus_tag LOCUS_11340 125823 125491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 126146 126358 gene locus_tag LOCUS_11350 126146 126358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 126771 126346 gene locus_tag LOCUS_11360 126771 126346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 127688 126786 gene locus_tag LOCUS_11370 127688 126786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 128032 127688 gene locus_tag LOCUS_11380 128032 127688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 protein_id gnl|my_center|LOCUS_11380 128415 128029 gene locus_tag LOCUS_11390 128415 128029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 128796 128443 gene locus_tag LOCUS_11400 128796 128443 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_11400 128904 129914 gene locus_tag LOCUS_11410 128904 129914 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_11410 130039 130533 gene locus_tag LOCUS_11420 130039 130533 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803706.1 protein_id gnl|my_center|LOCUS_11420 130530 131003 gene locus_tag LOCUS_11430 130530 131003 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_11430 131003 132271 gene locus_tag LOCUS_11440 131003 132271 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_11440 132274 133176 gene locus_tag LOCUS_11450 132274 133176 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228893.1 protein_id gnl|my_center|LOCUS_11450 133783 133184 gene locus_tag LOCUS_11460 133783 133184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 136981 133799 gene locus_tag LOCUS_11470 136981 133799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 137034 138713 gene locus_tag LOCUS_11480 137034 138713 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_11480 138734 140284 gene locus_tag LOCUS_11490 138734 140284 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_11490 140514 140897 gene locus_tag LOCUS_11500 140514 140897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 141336 140923 gene locus_tag LOCUS_11510 141336 140923 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_11510 141410 142042 gene locus_tag LOCUS_11520 141410 142042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 142421 142092 gene locus_tag LOCUS_11530 142421 142092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 143184 142483 gene locus_tag LOCUS_11540 143184 142483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 143390 143181 gene locus_tag LOCUS_11550 143390 143181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 143439 143633 gene locus_tag LOCUS_11560 143439 143633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 143638 143817 gene locus_tag LOCUS_11570 143638 143817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 144267 143824 gene locus_tag LOCUS_11580 144267 143824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 144659 144264 gene locus_tag LOCUS_11590 144659 144264 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_11590 144967 144656 gene locus_tag LOCUS_11600 144967 144656 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_11600 145370 146752 gene locus_tag LOCUS_11610 145370 146752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 146828 147421 gene locus_tag LOCUS_11620 146828 147421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 147655 147849 gene locus_tag LOCUS_11630 147655 147849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 148041 150413 gene locus_tag LOCUS_11640 148041 150413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 150545 150922 gene locus_tag LOCUS_11650 150545 150922 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039801.1 protein_id gnl|my_center|LOCUS_11650 150919 151341 gene locus_tag LOCUS_11660 150919 151341 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224367.1 protein_id gnl|my_center|LOCUS_11660 151338 152321 gene locus_tag LOCUS_11670 151338 152321 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_11670 152318 152476 gene locus_tag LOCUS_11680 152318 152476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 153538 152723 gene locus_tag LOCUS_11690 153538 152723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 153820 154512 gene locus_tag LOCUS_11700 153820 154512 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_11700 154567 154794 gene locus_tag LOCUS_11710 154567 154794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 155307 155555 gene locus_tag LOCUS_11720 155307 155555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 155530 155961 gene locus_tag LOCUS_11730 155530 155961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 155962 156720 gene locus_tag LOCUS_11740 155962 156720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11740 156717 157100 gene locus_tag LOCUS_11750 156717 157100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 159768 157390 gene locus_tag LOCUS_11760 159768 157390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 161496 160081 gene locus_tag LOCUS_11770 161496 160081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 163254 161623 gene locus_tag LOCUS_11780 163254 161623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 164315 163272 gene locus_tag LOCUS_11790 164315 163272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 165805 164312 gene locus_tag LOCUS_11800 165805 164312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 166250 165810 gene locus_tag LOCUS_11810 166250 165810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 167296 166247 gene locus_tag LOCUS_11820 167296 166247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 170175 167590 gene locus_tag LOCUS_11830 170175 167590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 171532 170351 gene locus_tag LOCUS_11840 171532 170351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 172040 172139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence06 488 114 gene locus_tag LOCUS_11850 488 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 734 516 gene locus_tag LOCUS_11860 734 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2440 731 gene locus_tag LOCUS_11870 2440 731 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_11870 2520 6074 gene locus_tag LOCUS_11880 2520 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6078 6557 gene locus_tag LOCUS_11890 6078 6557 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_11890 7729 6575 gene locus_tag LOCUS_11900 gene gshA 7729 6575 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_11900 7842 8615 gene locus_tag LOCUS_11910 7842 8615 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_11910 8693 9586 gene locus_tag LOCUS_11920 8693 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 10126 9566 gene locus_tag LOCUS_11930 10126 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10698 10123 gene locus_tag LOCUS_11940 10698 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 11384 10782 gene locus_tag LOCUS_11950 gene sigE 11384 10782 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_11950 11515 13170 gene locus_tag LOCUS_11960 gene metG 11515 13170 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113898.1 protein_id gnl|my_center|LOCUS_11960 13175 14389 gene locus_tag LOCUS_11970 13175 14389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_11970 14485 15357 gene locus_tag LOCUS_11980 14485 15357 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_11980 16216 15563 gene locus_tag LOCUS_11990 16216 15563 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_11990 17601 16231 gene locus_tag LOCUS_12000 gene ahbD 17601 16231 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_12000 18098 17619 gene locus_tag LOCUS_12010 18098 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 18833 18111 gene locus_tag LOCUS_12020 18833 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12020 19914 19015 gene locus_tag LOCUS_12030 19914 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 21268 19919 gene locus_tag LOCUS_12040 21268 19919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_12040 22178 21294 gene locus_tag LOCUS_12050 22178 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 23917 22181 gene locus_tag LOCUS_12060 23917 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 26203 24032 gene locus_tag LOCUS_12070 26203 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 28046 26271 gene locus_tag LOCUS_12080 28046 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 28864 28046 gene locus_tag LOCUS_12090 28864 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 29361 28876 gene locus_tag LOCUS_12100 29361 28876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 31289 29358 gene locus_tag LOCUS_12110 31289 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 31891 31304 gene locus_tag LOCUS_12120 31891 31304 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_12120 35178 31891 gene locus_tag LOCUS_12130 35178 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 35822 35175 gene locus_tag LOCUS_12140 35822 35175 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_12140 35933 36589 gene locus_tag LOCUS_12150 35933 36589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 37719 36595 gene locus_tag LOCUS_12160 37719 36595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 38956 37706 gene locus_tag LOCUS_12170 38956 37706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 39031 39549 gene locus_tag LOCUS_12180 39031 39549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 39675 40607 gene locus_tag LOCUS_12190 39675 40607 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_12190 40630 41502 gene locus_tag LOCUS_12200 40630 41502 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_12200 42138 41563 gene locus_tag LOCUS_12210 42138 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 42336 43778 gene locus_tag LOCUS_12220 42336 43778 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265725.1 protein_id gnl|my_center|LOCUS_12220 43778 44740 gene locus_tag LOCUS_12230 43778 44740 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_12230 44737 45645 gene locus_tag LOCUS_12240 44737 45645 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_12240 45642 45977 gene locus_tag LOCUS_12250 45642 45977 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_12250 45999 47183 gene locus_tag LOCUS_12260 45999 47183 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_12260 47180 47599 gene locus_tag LOCUS_12270 47180 47599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 47596 48840 gene locus_tag LOCUS_12280 47596 48840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_12280 48837 50993 gene locus_tag LOCUS_12290 48837 50993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 50993 51730 gene locus_tag LOCUS_12300 50993 51730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_12300 51735 54104 gene locus_tag LOCUS_12310 51735 54104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_12310 54120 55322 gene locus_tag LOCUS_12320 54120 55322 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_12320 56466 55336 gene locus_tag LOCUS_12330 56466 55336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 57644 56466 gene locus_tag LOCUS_12340 57644 56466 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_12340 59086 57641 gene locus_tag LOCUS_12350 59086 57641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 60094 59141 gene locus_tag LOCUS_12360 60094 59141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 61397 60201 gene locus_tag LOCUS_12370 61397 60201 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256635.1 protein_id gnl|my_center|LOCUS_12370 61461 62297 gene locus_tag LOCUS_12380 61461 62297 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_12380 63430 62294 gene locus_tag LOCUS_12390 63430 62294 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_12390 64649 63432 gene locus_tag LOCUS_12400 64649 63432 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_12400 64735 65820 gene locus_tag LOCUS_12410 64735 65820 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_12410 66757 65774 gene locus_tag LOCUS_12420 gene glpQ 66757 65774 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_12420 68808 66766 gene locus_tag LOCUS_12430 68808 66766 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_12430 68892 70028 gene locus_tag LOCUS_12440 gene serC 68892 70028 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_12440 71097 70099 gene locus_tag LOCUS_12450 71097 70099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 72683 71103 gene locus_tag LOCUS_12460 72683 71103 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_12460 74132 72687 gene locus_tag LOCUS_12470 74132 72687 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_12470 74355 76322 gene locus_tag LOCUS_12480 74355 76322 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_12480 76319 77179 gene locus_tag LOCUS_12490 76319 77179 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_12490 80214 77176 gene locus_tag LOCUS_12500 80214 77176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 83184 80221 gene locus_tag LOCUS_12510 83184 80221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 84997 83519 gene locus_tag LOCUS_12520 84997 83519 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_12520 87333 85009 gene locus_tag LOCUS_12530 87333 85009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 87428 88267 gene locus_tag LOCUS_12540 gene purU 87428 88267 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_12540 90007 88271 gene locus_tag LOCUS_12550 90007 88271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 91779 90004 gene locus_tag LOCUS_12560 91779 90004 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_12560 95558 91878 gene locus_tag LOCUS_12570 95558 91878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 99468 95764 gene locus_tag LOCUS_12580 99468 95764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 100532 100074 gene locus_tag LOCUS_12590 100532 100074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 104713 101087 gene locus_tag LOCUS_12600 104713 101087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 107026 104900 gene locus_tag LOCUS_12610 107026 104900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 108941 107229 gene locus_tag LOCUS_12620 108941 107229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 110674 108938 gene locus_tag LOCUS_12630 110674 108938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 113167 110687 gene locus_tag LOCUS_12640 113167 110687 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_12640 113209 114495 gene locus_tag LOCUS_12650 113209 114495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_12650 115418 114552 gene locus_tag LOCUS_12660 115418 114552 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_12660 115600 115977 gene locus_tag LOCUS_12670 115600 115977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 115974 116246 gene locus_tag LOCUS_12680 115974 116246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 116407 117189 gene locus_tag LOCUS_12690 116407 117189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 117200 118105 gene locus_tag LOCUS_12700 117200 118105 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_12700 118116 119465 gene locus_tag LOCUS_12710 118116 119465 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_12710 122085 119590 gene locus_tag LOCUS_12720 122085 119590 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_12720 122827 123474 gene locus_tag LOCUS_12730 122827 123474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 123471 129560 gene locus_tag LOCUS_12740 123471 129560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 129618 130355 gene locus_tag LOCUS_12750 129618 130355 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_12750 130931 130431 gene locus_tag LOCUS_12760 130931 130431 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_12760 131291 131899 gene locus_tag LOCUS_12770 131291 131899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 131896 132708 gene locus_tag LOCUS_12780 131896 132708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 132892 132719 gene locus_tag LOCUS_12790 132892 132719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 132891 133811 gene locus_tag LOCUS_12800 132891 133811 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_12800 134062 133826 gene locus_tag LOCUS_12810 134062 133826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 135404 134073 gene locus_tag LOCUS_12820 135404 134073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 135528 135627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135929 136420 gene locus_tag LOCUS_12830 135929 136420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 136417 137445 gene locus_tag LOCUS_12840 136417 137445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 137923 137453 gene locus_tag LOCUS_12850 137923 137453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 138000 138707 gene locus_tag LOCUS_12860 138000 138707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 138866 141154 gene locus_tag LOCUS_12870 138866 141154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 142260 141217 gene locus_tag LOCUS_12880 142260 141217 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_12880 143342 142257 gene locus_tag LOCUS_12890 143342 142257 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_12890 144903 143347 gene locus_tag LOCUS_12900 144903 143347 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_12900 145492 144929 gene locus_tag LOCUS_12910 145492 144929 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_12910 145656 146885 gene locus_tag LOCUS_12920 145656 146885 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_12920 146882 148042 gene locus_tag LOCUS_12930 gene hppD 146882 148042 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_12930 148056 148994 gene locus_tag LOCUS_12940 gene phhA 148056 148994 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_12940 150475 148988 gene locus_tag LOCUS_12950 150475 148988 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_12950 150547 152352 gene locus_tag LOCUS_12960 150547 152352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 152403 154043 gene locus_tag LOCUS_12970 152403 154043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 154059 155726 gene locus_tag LOCUS_12980 154059 155726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 155723 156178 gene locus_tag LOCUS_12990 155723 156178 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225099.1 protein_id gnl|my_center|LOCUS_12990 156496 156185 gene locus_tag LOCUS_13000 156496 156185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 156706 156500 gene locus_tag LOCUS_13010 156706 156500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 156835 157935 gene locus_tag LOCUS_13020 156835 157935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence07 <1 1554 gene locus_tag LOCUS_13030 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase 1574 2743 gene locus_tag LOCUS_13040 1574 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2740 3726 gene locus_tag LOCUS_13050 gene ftsY 2740 3726 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_13050 3723 4892 gene locus_tag LOCUS_13060 gene ribD 3723 4892 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_13060 4856 5491 gene locus_tag LOCUS_13070 4856 5491 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_13070 5496 6485 gene locus_tag LOCUS_13080 5496 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8022 6535 gene locus_tag LOCUS_13090 gene lysS 8022 6535 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_13090 8946 8026 gene locus_tag LOCUS_13100 8946 8026 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_13100 8962 9501 gene locus_tag LOCUS_13110 gene hpt 8962 9501 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_13110 9514 10731 gene locus_tag LOCUS_13120 9514 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10728 11402 gene locus_tag LOCUS_13130 10728 11402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_13130 11413 13881 gene locus_tag LOCUS_13140 11413 13881 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_13140 13868 16327 gene locus_tag LOCUS_13150 gene bamA 13868 16327 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_13150 16350 16901 gene locus_tag LOCUS_13160 16350 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 18297 16912 gene locus_tag LOCUS_13170 18297 16912 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_13170 18374 19465 gene locus_tag LOCUS_13180 gene lpxD 18374 19465 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_13180 19462 19947 gene locus_tag LOCUS_13190 19462 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 19973 20785 gene locus_tag LOCUS_13200 gene lpxA 19973 20785 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_13200 20850 21788 gene locus_tag LOCUS_13210 20850 21788 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_13210 21839 22678 gene locus_tag LOCUS_13220 gene mtnP 21839 22678 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_13220 22675 23457 gene locus_tag LOCUS_13230 gene surE 22675 23457 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_13230 23454 24143 gene locus_tag LOCUS_13240 23454 24143 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_13240 24163 24696 gene locus_tag LOCUS_13250 24163 24696 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_13250 24752 24828 gene locus_tag LOCUS_t00130 24752 24828 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25055 24870 gene locus_tag LOCUS_13260 25055 24870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 25192 26031 gene locus_tag LOCUS_13270 25192 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 26118 27311 gene locus_tag LOCUS_13280 26118 27311 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869768.1 protein_id gnl|my_center|LOCUS_13280 27358 28680 gene locus_tag LOCUS_13290 27358 28680 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_13290 28677 29330 gene locus_tag LOCUS_13300 gene plsY 28677 29330 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_13300 29327 30388 gene locus_tag LOCUS_13310 29327 30388 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_13310 30385 31950 gene locus_tag LOCUS_13320 gene guaA 30385 31950 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_13320 33007 31967 gene locus_tag LOCUS_13330 33007 31967 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_13330 33053 33853 gene locus_tag LOCUS_13340 gene lgt 33053 33853 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820749.1 protein_id gnl|my_center|LOCUS_13340 33826 34647 gene locus_tag LOCUS_13350 gene thiD 33826 34647 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_13350 34717 36489 gene locus_tag LOCUS_13360 34717 36489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 36552 37016 gene locus_tag LOCUS_13370 36552 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 37013 37234 gene locus_tag LOCUS_13380 37013 37234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 37231 37899 gene locus_tag LOCUS_13390 37231 37899 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_13390 37896 39443 gene locus_tag LOCUS_13400 37896 39443 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_13400 39440 39868 gene locus_tag LOCUS_13410 gene tsaE 39440 39868 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_13410 39927 40778 gene locus_tag LOCUS_13420 39927 40778 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_13420 40825 41787 gene locus_tag LOCUS_13430 40825 41787 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_13430 41784 44201 gene locus_tag LOCUS_13440 41784 44201 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_13440 44210 45535 gene locus_tag LOCUS_13450 44210 45535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 45844 47265 gene locus_tag LOCUS_13460 gene glnA 45844 47265 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141054.1 protein_id gnl|my_center|LOCUS_13460 47399 48745 gene locus_tag LOCUS_13470 47399 48745 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_13470 48723 50006 gene locus_tag LOCUS_13480 48723 50006 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_13480 50021 51367 gene locus_tag LOCUS_13490 50021 51367 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_13490 51378 52208 gene locus_tag LOCUS_13500 51378 52208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 53271 52219 gene locus_tag LOCUS_13510 53271 52219 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_13510 54491 53298 gene locus_tag LOCUS_13520 54491 53298 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_13520 54610 55788 gene locus_tag LOCUS_13530 gene pepQ 54610 55788 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_13530 58837 55808 gene locus_tag LOCUS_13540 58837 55808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 59315 58872 gene locus_tag LOCUS_13550 59315 58872 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_13550 59429 60412 gene locus_tag LOCUS_13560 59429 60412 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059575.1 protein_id gnl|my_center|LOCUS_13560 60893 60426 gene locus_tag LOCUS_13570 60893 60426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 61091 60903 gene locus_tag LOCUS_13580 61091 60903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 61357 62556 gene locus_tag LOCUS_13590 61357 62556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 62559 63893 gene locus_tag LOCUS_13600 62559 63893 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 protein_id gnl|my_center|LOCUS_13600 63894 64562 gene locus_tag LOCUS_13610 gene nth 63894 64562 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_13610 64579 67425 gene locus_tag LOCUS_13620 64579 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 67452 68723 gene locus_tag LOCUS_13630 67452 68723 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_13630 69287 68745 gene locus_tag LOCUS_13640 69287 68745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 69625 69284 gene locus_tag LOCUS_13650 69625 69284 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_13650 71046 69628 gene locus_tag LOCUS_13660 71046 69628 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_13660 71588 71121 gene locus_tag LOCUS_13670 71588 71121 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_13670 72505 71729 gene locus_tag LOCUS_13680 72505 71729 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_13680 72658 73488 gene locus_tag LOCUS_13690 72658 73488 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_13690 73504 74697 gene locus_tag LOCUS_13700 73504 74697 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_13700 74772 75701 gene locus_tag LOCUS_13710 74772 75701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 77272 75707 gene locus_tag LOCUS_13720 gene xylB 77272 75707 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_13720 78612 77269 gene locus_tag LOCUS_13730 gene xylA 78612 77269 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_13730 79632 78637 gene locus_tag LOCUS_13740 79632 78637 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_13740 80821 79664 gene locus_tag LOCUS_13750 80821 79664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_13750 83057 80847 gene locus_tag LOCUS_13760 83057 80847 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_13760 83156 83788 gene locus_tag LOCUS_13770 83156 83788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 83803 84078 gene locus_tag LOCUS_13780 83803 84078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 84146 85477 gene locus_tag LOCUS_13790 84146 85477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 85567 86577 gene locus_tag LOCUS_13800 85567 86577 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_13800 89157 86533 gene locus_tag LOCUS_13810 89157 86533 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_13810 90866 89157 gene locus_tag LOCUS_13820 90866 89157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 91771 90866 gene locus_tag LOCUS_13830 91771 90866 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582648.1 protein_id gnl|my_center|LOCUS_13830 92810 91797 gene locus_tag LOCUS_13840 92810 91797 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_13840 94270 92807 gene locus_tag LOCUS_13850 94270 92807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 95430 94267 gene locus_tag LOCUS_13860 95430 94267 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839763.1 protein_id gnl|my_center|LOCUS_13860 97579 95462 gene locus_tag LOCUS_13870 97579 95462 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_13870 99007 97592 gene locus_tag LOCUS_13880 gene lpdA 99007 97592 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_13880 100846 99098 gene locus_tag LOCUS_13890 100846 99098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 102216 100852 gene locus_tag LOCUS_13900 gene odhB 102216 100852 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970379.1 protein_id gnl|my_center|LOCUS_13900 105133 102239 gene locus_tag LOCUS_13910 105133 102239 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_13910 106236 105169 gene locus_tag LOCUS_13920 106236 105169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 107219 106239 gene locus_tag LOCUS_13930 107219 106239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_13930 107319 108653 gene locus_tag LOCUS_13940 107319 108653 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_13940 108738 109967 gene locus_tag LOCUS_13950 108738 109967 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_13950 111552 109945 gene locus_tag LOCUS_13960 111552 109945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 112599 111628 gene locus_tag LOCUS_13970 112599 111628 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_13970 113461 112637 gene locus_tag LOCUS_13980 113461 112637 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_13980 114140 113481 gene locus_tag LOCUS_13990 114140 113481 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851111.1 protein_id gnl|my_center|LOCUS_13990 116307 114226 gene locus_tag LOCUS_14000 116307 114226 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271989.1 protein_id gnl|my_center|LOCUS_14000 118461 116536 gene locus_tag LOCUS_14010 118461 116536 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_14010 119606 118458 gene locus_tag LOCUS_14020 119606 118458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 119702 120061 gene locus_tag LOCUS_14030 119702 120061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 120058 121563 gene locus_tag LOCUS_14040 gene putP 120058 121563 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 protein_id gnl|my_center|LOCUS_14040 121577 122593 gene locus_tag LOCUS_14050 gene trpS 121577 122593 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_14050 123912 122602 gene locus_tag LOCUS_14060 123912 122602 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_14060 124038 125042 gene locus_tag LOCUS_14070 124038 125042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 125051 125518 gene locus_tag LOCUS_14080 125051 125518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 125515 126288 gene locus_tag LOCUS_14090 125515 126288 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_14090 126305 127672 gene locus_tag LOCUS_14100 126305 127672 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_14100 127734 129149 gene locus_tag LOCUS_14110 127734 129149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 129146 130855 gene locus_tag LOCUS_14120 gene murJ 129146 130855 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_14120 130882 131457 gene locus_tag LOCUS_14130 130882 131457 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_14130 131568 132710 gene locus_tag LOCUS_14140 131568 132710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 132745 135012 gene locus_tag LOCUS_14150 132745 135012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 135079 136587 gene locus_tag LOCUS_14160 135079 136587 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_14160 136601 137866 gene locus_tag LOCUS_14170 136601 137866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 137863 140100 gene locus_tag LOCUS_14180 137863 140100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence08 257 1786 gene locus_tag LOCUS_14190 257 1786 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_14190 1789 2961 gene locus_tag LOCUS_14200 gene vmeY 1789 2961 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_14200 2958 6170 gene locus_tag LOCUS_14210 2958 6170 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_14210 6289 7707 gene locus_tag LOCUS_14220 6289 7707 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_14220 8540 7710 gene locus_tag LOCUS_14230 8540 7710 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_14230 9392 8667 gene locus_tag LOCUS_14240 9392 8667 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_14240 10603 9425 gene locus_tag LOCUS_14250 gene galK 10603 9425 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_14250 11069 10620 gene locus_tag LOCUS_14260 11069 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 13166 11139 gene locus_tag LOCUS_14270 13166 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 13738 13094 gene locus_tag LOCUS_14280 13738 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 13842 16079 gene locus_tag LOCUS_14290 13842 16079 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_14290 17773 16076 gene locus_tag LOCUS_14300 17773 16076 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 protein_id gnl|my_center|LOCUS_14300 18007 17804 gene locus_tag LOCUS_14310 18007 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 18365 18637 gene locus_tag LOCUS_14320 18365 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 18681 20933 gene locus_tag LOCUS_14330 18681 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 20974 21435 gene locus_tag LOCUS_14340 20974 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 21635 22540 gene locus_tag LOCUS_14350 21635 22540 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_14350 22642 24141 gene locus_tag LOCUS_14360 22642 24141 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_14360 25107 24148 gene locus_tag LOCUS_14370 gene coaA 25107 24148 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_14370 25624 25139 gene locus_tag LOCUS_14380 25624 25139 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_14380 25684 26745 gene locus_tag LOCUS_14390 25684 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 26742 27800 gene locus_tag LOCUS_14400 gene btuC 26742 27800 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_14400 27797 28597 gene locus_tag LOCUS_14410 27797 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 29062 28607 gene locus_tag LOCUS_14420 29062 28607 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965056.1 protein_id gnl|my_center|LOCUS_14420 30089 29055 gene locus_tag LOCUS_14430 gene ltaE 30089 29055 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_14430 30040 31644 gene locus_tag LOCUS_14440 gene ppx 30040 31644 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_14440 32413 31670 gene locus_tag LOCUS_14450 32413 31670 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_14450 36449 33003 gene locus_tag LOCUS_14460 36449 33003 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101675310.1 protein_id gnl|my_center|LOCUS_14460 36519 37016 gene locus_tag LOCUS_14470 36519 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 37632 37003 gene locus_tag LOCUS_14480 37632 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 39071 37629 gene locus_tag LOCUS_14490 39071 37629 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066453.1 protein_id gnl|my_center|LOCUS_14490 39189 40925 gene locus_tag LOCUS_14500 39189 40925 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197709.1 protein_id gnl|my_center|LOCUS_14500 41371 41087 gene locus_tag LOCUS_14510 41371 41087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 41256 41669 gene locus_tag LOCUS_14520 41256 41669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 41666 42109 gene locus_tag LOCUS_14530 41666 42109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 42248 43132 gene locus_tag LOCUS_14540 42248 43132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 43203 44366 gene locus_tag LOCUS_14550 43203 44366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_14550 44363 44971 gene locus_tag LOCUS_14560 44363 44971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 45847 45014 gene locus_tag LOCUS_14570 45847 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 48407 45891 gene locus_tag LOCUS_14580 48407 45891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 48513 50147 gene locus_tag LOCUS_14590 48513 50147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 50158 50559 gene locus_tag LOCUS_14600 50158 50559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 50586 52238 gene locus_tag LOCUS_14610 50586 52238 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_14610 52257 53471 gene locus_tag LOCUS_14620 52257 53471 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_14620 53557 54963 gene locus_tag LOCUS_14630 53557 54963 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_14630 54963 55742 gene locus_tag LOCUS_14640 54963 55742 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_14640 58076 55800 gene locus_tag LOCUS_14650 58076 55800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 58840 58073 gene locus_tag LOCUS_14660 58840 58073 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_14660 58891 59574 gene locus_tag LOCUS_14670 58891 59574 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_14670 59571 60299 gene locus_tag LOCUS_14680 59571 60299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_14680 60296 62893 gene locus_tag LOCUS_14690 60296 62893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972487.1 protein_id gnl|my_center|LOCUS_14690 62893 64101 gene locus_tag LOCUS_14700 62893 64101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_14700 64834 64094 gene locus_tag LOCUS_14710 64834 64094 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 protein_id gnl|my_center|LOCUS_14710 65865 64873 gene locus_tag LOCUS_14720 65865 64873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 65912 66313 gene locus_tag LOCUS_14730 65912 66313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 66338 67033 gene locus_tag LOCUS_14740 66338 67033 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_14740 68188 67061 gene locus_tag LOCUS_14750 68188 67061 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383906.1 protein_id gnl|my_center|LOCUS_14750 68284 68724 gene locus_tag LOCUS_14760 gene gloA 68284 68724 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_14760 69142 68750 gene locus_tag LOCUS_14770 69142 68750 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_14770 70405 69185 gene locus_tag LOCUS_14780 70405 69185 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868574.1 protein_id gnl|my_center|LOCUS_14780 70476 71762 gene locus_tag LOCUS_14790 70476 71762 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_14790 71795 72982 gene locus_tag LOCUS_14800 71795 72982 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817751.1 protein_id gnl|my_center|LOCUS_14800 73066 73830 gene locus_tag LOCUS_14810 73066 73830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_14810 73833 74636 gene locus_tag LOCUS_14820 73833 74636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 75827 74556 gene locus_tag LOCUS_14830 75827 74556 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_14830 76060 77124 gene locus_tag LOCUS_14840 76060 77124 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704825.1 protein_id gnl|my_center|LOCUS_14840 77121 77927 gene locus_tag LOCUS_14850 77121 77927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 77939 78871 gene locus_tag LOCUS_14860 77939 78871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 80029 78881 gene locus_tag LOCUS_14870 80029 78881 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_14870 80103 81041 gene locus_tag LOCUS_14880 80103 81041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 81067 81603 gene locus_tag LOCUS_14890 81067 81603 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_14890 81645 83015 gene locus_tag LOCUS_14900 81645 83015 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_14900 83105 84220 gene locus_tag LOCUS_14910 83105 84220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 85471 84224 gene locus_tag LOCUS_14920 85471 84224 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974941.1 protein_id gnl|my_center|LOCUS_14920 85889 85485 gene locus_tag LOCUS_14930 85889 85485 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085844.1 protein_id gnl|my_center|LOCUS_14930 86653 85922 gene locus_tag LOCUS_14940 86653 85922 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_14940 87267 86674 gene locus_tag LOCUS_14950 gene rpsD 87267 86674 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_14950 88566 87487 gene locus_tag LOCUS_14960 88566 87487 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_14960 90873 88639 gene locus_tag LOCUS_14970 90873 88639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 92093 90873 gene locus_tag LOCUS_14980 92093 90873 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_14980 93918 92128 gene locus_tag LOCUS_14990 93918 92128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 93988 94218 gene locus_tag LOCUS_15000 93988 94218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 94796 94227 gene locus_tag LOCUS_15010 94796 94227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 95152 94793 gene locus_tag LOCUS_15020 95152 94793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 96539 95166 gene locus_tag LOCUS_15030 96539 95166 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_15030 97357 96536 gene locus_tag LOCUS_15040 97357 96536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 98868 97357 gene locus_tag LOCUS_15050 98868 97357 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_15050 100949 98982 gene locus_tag LOCUS_15060 100949 98982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 101935 100946 gene locus_tag LOCUS_15070 101935 100946 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_15070 102630 101887 gene locus_tag LOCUS_15080 102630 101887 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_15080 103483 102638 gene locus_tag LOCUS_15090 103483 102638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 103535 104659 gene locus_tag LOCUS_15100 103535 104659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 104656 106050 gene locus_tag LOCUS_15110 104656 106050 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_15110 106408 106118 gene locus_tag LOCUS_15120 106408 106118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 106451 107497 gene locus_tag LOCUS_15130 106451 107497 CDS product sugar phosphate isomerase/epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421554.1 protein_id gnl|my_center|LOCUS_15130 108749 107502 gene locus_tag LOCUS_15140 108749 107502 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_15140 108765 108998 gene locus_tag LOCUS_15150 108765 108998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 109430 109032 gene locus_tag LOCUS_15160 109430 109032 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_15160 109666 109427 gene locus_tag LOCUS_15170 109666 109427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 110591 109713 gene locus_tag LOCUS_15180 gene tesB 110591 109713 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_15180 111106 110588 gene locus_tag LOCUS_15190 111106 110588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 112371 111133 gene locus_tag LOCUS_15200 112371 111133 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444040.1 protein_id gnl|my_center|LOCUS_15200 112355 113587 gene locus_tag LOCUS_15210 112355 113587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 115077 113590 gene locus_tag LOCUS_15220 115077 113590 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_15220 116569 115085 gene locus_tag LOCUS_15230 116569 115085 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_15230 116996 116598 gene locus_tag LOCUS_15240 116996 116598 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335819.1 protein_id gnl|my_center|LOCUS_15240 117493 116993 gene locus_tag LOCUS_15250 117493 116993 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_15250 118053 117490 gene locus_tag LOCUS_15260 118053 117490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 118372 118040 gene locus_tag LOCUS_15270 gene mnhG 118372 118040 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_15270 118650 118369 gene locus_tag LOCUS_15280 118650 118369 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_15280 119141 118650 gene locus_tag LOCUS_15290 119141 118650 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_15290 119603 119172 gene locus_tag LOCUS_15300 119603 119172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 121741 119600 gene locus_tag LOCUS_15310 121741 119600 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 protein_id gnl|my_center|LOCUS_15310 122789 121755 gene locus_tag LOCUS_15320 122789 121755 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126540609.1 protein_id gnl|my_center|LOCUS_15320 124337 122796 gene locus_tag LOCUS_15330 124337 122796 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_15330 124492 125550 gene locus_tag LOCUS_15340 124492 125550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 125615 126166 gene locus_tag LOCUS_15350 gene thpR 125615 126166 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 protein_id gnl|my_center|LOCUS_15350 127114 126173 gene locus_tag LOCUS_15360 127114 126173 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_15360 130368 127111 gene locus_tag LOCUS_15370 130368 127111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 131401 130373 gene locus_tag LOCUS_15380 131401 130373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 131549 132115 gene locus_tag LOCUS_15390 131549 132115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 132425 132120 gene locus_tag LOCUS_15400 gene rpsN 132425 132120 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence09 <1 958 gene locus_tag LOCUS_15410 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542268.1:molybdopterin molybdotransferase MoeA 2097 955 gene locus_tag LOCUS_15420 2097 955 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_15420 2808 2143 gene locus_tag LOCUS_15430 2808 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2895 4223 gene locus_tag LOCUS_15440 2895 4223 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_15440 4369 5256 gene locus_tag LOCUS_15450 4369 5256 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615605.1 protein_id gnl|my_center|LOCUS_15450 5243 6796 gene locus_tag LOCUS_15460 5243 6796 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665541.1 protein_id gnl|my_center|LOCUS_15460 6803 7444 gene locus_tag LOCUS_15470 gene tmk 6803 7444 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_15470 7441 8403 gene locus_tag LOCUS_15480 7441 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8538 9626 gene locus_tag LOCUS_15490 8538 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 9619 10329 gene locus_tag LOCUS_15500 9619 10329 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_15500 10337 11392 gene locus_tag LOCUS_15510 10337 11392 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_15510 11410 12120 gene locus_tag LOCUS_15520 11410 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 13271 12087 gene locus_tag LOCUS_15530 13271 12087 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_15530 13311 14048 gene locus_tag LOCUS_15540 13311 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 14144 15193 gene locus_tag LOCUS_15550 gene tgt 14144 15193 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_15550 15268 15579 gene locus_tag LOCUS_15560 gene yajC 15268 15579 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_15560 15576 17150 gene locus_tag LOCUS_15570 gene secD 15576 17150 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880603.1 protein_id gnl|my_center|LOCUS_15570 17161 18339 gene locus_tag LOCUS_15580 17161 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 18350 20584 gene locus_tag LOCUS_15590 18350 20584 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_15590 20676 21347 gene locus_tag LOCUS_15600 20676 21347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 21433 22317 gene locus_tag LOCUS_15610 21433 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 22329 22547 gene locus_tag LOCUS_15620 22329 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 22537 23010 gene locus_tag LOCUS_15630 22537 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 23007 24386 gene locus_tag LOCUS_15640 gene accC 23007 24386 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_15640 24467 25081 gene locus_tag LOCUS_15650 gene thiE 24467 25081 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_15650 25191 26273 gene locus_tag LOCUS_15660 25191 26273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 26287 27921 gene locus_tag LOCUS_15670 26287 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 28075 28575 gene locus_tag LOCUS_15680 28075 28575 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881430.1 protein_id gnl|my_center|LOCUS_15680 29294 28572 gene locus_tag LOCUS_15690 29294 28572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 30040 29492 gene locus_tag LOCUS_15700 30040 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 30578 30042 gene locus_tag LOCUS_15710 30578 30042 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_15710 32575 30575 gene locus_tag LOCUS_15720 32575 30575 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_15720 33063 32572 gene locus_tag LOCUS_15730 gene ccmE 33063 32572 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_15730 33205 33032 gene locus_tag LOCUS_15740 33205 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 33924 33244 gene locus_tag LOCUS_15750 33924 33244 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_15750 34613 33921 gene locus_tag LOCUS_15760 34613 33921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_15760 34766 35353 gene locus_tag LOCUS_15770 34766 35353 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_15770 35375 35947 gene locus_tag LOCUS_15780 35375 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 35996 36922 gene locus_tag LOCUS_15790 35996 36922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 38748 36919 gene locus_tag LOCUS_15800 38748 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 38822 40561 gene locus_tag LOCUS_15810 38822 40561 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_15810 41881 40532 gene locus_tag LOCUS_15820 41881 40532 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_15820 43285 42038 gene locus_tag LOCUS_15830 43285 42038 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 protein_id gnl|my_center|LOCUS_15830 43419 43495 gene locus_tag LOCUS_t00140 43419 43495 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43521 43597 gene locus_tag LOCUS_t00150 43521 43597 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43669 45606 gene locus_tag LOCUS_15840 gene thrS 43669 45606 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_15840 45694 45885 gene locus_tag LOCUS_15850 gene rpmI 45694 45885 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720098.1 protein_id gnl|my_center|LOCUS_15850 45914 46297 gene locus_tag LOCUS_15860 45914 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 46297 46512 gene locus_tag LOCUS_15870 46297 46512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 46557 46874 gene locus_tag LOCUS_15880 46557 46874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 47111 48679 gene locus_tag LOCUS_15890 gene rny 47111 48679 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_15890 48690 49475 gene locus_tag LOCUS_15900 48690 49475 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_15900 50366 49494 gene locus_tag LOCUS_15910 50366 49494 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_15910 50401 50964 gene locus_tag LOCUS_15920 50401 50964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 50979 51236 gene locus_tag LOCUS_15930 50979 51236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 51233 52126 gene locus_tag LOCUS_15940 51233 52126 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_15940 52123 52851 gene locus_tag LOCUS_15950 52123 52851 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_15950 52856 53659 gene locus_tag LOCUS_15960 52856 53659 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_15960 53699 54931 gene locus_tag LOCUS_15970 53699 54931 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_15970 54928 55980 gene locus_tag LOCUS_15980 gene gmd 54928 55980 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_15980 55971 57521 gene locus_tag LOCUS_15990 55971 57521 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_15990 59073 57523 gene locus_tag LOCUS_16000 59073 57523 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_16000 59159 60880 gene locus_tag LOCUS_16010 59159 60880 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_16010 60924 61313 gene locus_tag LOCUS_16020 60924 61313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 61356 64832 gene locus_tag LOCUS_16030 gene metH 61356 64832 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_16030 66521 64845 gene locus_tag LOCUS_16040 66521 64845 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_16040 66674 67639 gene locus_tag LOCUS_16050 66674 67639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 68784 67558 gene locus_tag LOCUS_16060 68784 67558 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_16060 69836 68781 gene locus_tag LOCUS_16070 69836 68781 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_16070 72316 69833 gene locus_tag LOCUS_16080 72316 69833 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139603260.1 protein_id gnl|my_center|LOCUS_16080 72380 73417 gene locus_tag LOCUS_16090 gene hflK 72380 73417 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_16090 73414 74370 gene locus_tag LOCUS_16100 gene hflC 73414 74370 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_16100 74397 75596 gene locus_tag LOCUS_16110 74397 75596 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_16110 76565 75726 gene locus_tag LOCUS_16120 76565 75726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 76664 77884 gene locus_tag LOCUS_16130 76664 77884 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_16130 77881 78855 gene locus_tag LOCUS_16140 gene glpX 77881 78855 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479842.1 protein_id gnl|my_center|LOCUS_16140 78892 79380 gene locus_tag LOCUS_16150 gene dcd 78892 79380 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776509.1 protein_id gnl|my_center|LOCUS_16150 79394 79867 gene locus_tag LOCUS_16160 79394 79867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 79857 80195 gene locus_tag LOCUS_16170 79857 80195 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_16170 80203 81423 gene locus_tag LOCUS_16180 80203 81423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 82306 81431 gene locus_tag LOCUS_16190 gene mazG 82306 81431 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_16190 82278 82757 gene locus_tag LOCUS_16200 82278 82757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 82982 84931 gene locus_tag LOCUS_16210 gene dnaK 82982 84931 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_16210 84932 85363 gene locus_tag LOCUS_16220 84932 85363 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_16220 85360 86109 gene locus_tag LOCUS_16230 85360 86109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_16230 86118 87926 gene locus_tag LOCUS_16240 86118 87926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 87923 88963 gene locus_tag LOCUS_16250 gene meaB 87923 88963 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_16250 88966 89367 gene locus_tag LOCUS_16260 gene mce 88966 89367 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_16260 89364 90434 gene locus_tag LOCUS_16270 gene carA 89364 90434 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_16270 90427 91671 gene locus_tag LOCUS_16280 90427 91671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_16280 92022 95288 gene locus_tag LOCUS_16290 gene carB 92022 95288 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_16290 97134 95566 gene locus_tag LOCUS_16300 97134 95566 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_16300 97391 100261 gene locus_tag LOCUS_16310 97391 100261 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_16310 100312 100839 gene locus_tag LOCUS_16320 100312 100839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 100888 101124 gene locus_tag LOCUS_16330 100888 101124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 101057 102424 gene locus_tag LOCUS_16340 gene rlmD 101057 102424 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_16340 102906 102472 gene locus_tag LOCUS_16350 102906 102472 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_16350 103402 102917 gene locus_tag LOCUS_16360 103402 102917 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_16360 103604 103449 gene locus_tag LOCUS_16370 103604 103449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 103733 104359 gene locus_tag LOCUS_16380 gene folE 103733 104359 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_16380 104361 104960 gene locus_tag LOCUS_16390 104361 104960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 105253 104972 gene locus_tag LOCUS_16400 105253 104972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 106410 105250 gene locus_tag LOCUS_16410 106410 105250 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932017.1 protein_id gnl|my_center|LOCUS_16410 107203 106400 gene locus_tag LOCUS_16420 107203 106400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_16420 107969 107190 gene locus_tag LOCUS_16430 107969 107190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_16430 108150 108905 gene locus_tag LOCUS_16440 108150 108905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 108898 109971 gene locus_tag LOCUS_16450 108898 109971 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_16450 109989 110666 gene locus_tag LOCUS_16460 gene lpxH 109989 110666 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262169.1 protein_id gnl|my_center|LOCUS_16460 110654 111979 gene locus_tag LOCUS_16470 gene aroA 110654 111979 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 protein_id gnl|my_center|LOCUS_16470 111976 115221 gene locus_tag LOCUS_16480 111976 115221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 115337 116254 gene locus_tag LOCUS_16490 115337 116254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 117236 116244 gene locus_tag LOCUS_16500 gene thiL 117236 116244 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113052.1 protein_id gnl|my_center|LOCUS_16500 119608 117212 gene locus_tag LOCUS_16510 gene lon 119608 117212 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_16510 120092 119664 gene locus_tag LOCUS_16520 gene nrdR 120092 119664 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_16520 120172 121212 gene locus_tag LOCUS_16530 gene hrcA 120172 121212 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_16530 121247 121789 gene locus_tag LOCUS_16540 gene grpE 121247 121789 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16540 >Feature sequence10 169 807 gene locus_tag LOCUS_16550 gene thiE 169 807 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_16550 840 1370 gene locus_tag LOCUS_16560 gene lspA 840 1370 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_16560 1367 2362 gene locus_tag LOCUS_16570 1367 2362 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_16570 2793 2326 gene locus_tag LOCUS_16580 2793 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2936 2861 gene locus_tag LOCUS_t00160 2936 2861 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3052 3312 gene locus_tag LOCUS_16590 3052 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4320 3316 gene locus_tag LOCUS_16600 4320 3316 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_16600 5227 4391 gene locus_tag LOCUS_16610 5227 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5308 6897 gene locus_tag LOCUS_16620 5308 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 10322 6858 gene locus_tag LOCUS_16630 10322 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10987 10319 gene locus_tag LOCUS_16640 gene cmk 10987 10319 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_16640 11814 10984 gene locus_tag LOCUS_16650 11814 10984 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_16650 12424 11807 gene locus_tag LOCUS_16660 gene scpB 12424 11807 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_16660 13215 12421 gene locus_tag LOCUS_16670 13215 12421 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_16670 14411 13212 gene locus_tag LOCUS_16680 14411 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 16546 14408 gene locus_tag LOCUS_16690 gene recG 16546 14408 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_16690 17536 16562 gene locus_tag LOCUS_16700 17536 16562 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_16700 19743 17932 gene locus_tag LOCUS_16710 gene uvrC 19743 17932 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404327.1 protein_id gnl|my_center|LOCUS_16710 21818 19743 gene locus_tag LOCUS_16720 gene uvrB 21818 19743 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 protein_id gnl|my_center|LOCUS_16720 22287 21820 gene locus_tag LOCUS_16730 22287 21820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 22314 24803 gene locus_tag LOCUS_16740 22314 24803 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_16740 25870 24800 gene locus_tag LOCUS_16750 25870 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 26468 26022 gene locus_tag LOCUS_16760 gene rplI 26468 26022 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_16760 26741 26511 gene locus_tag LOCUS_16770 gene rpsR 26741 26511 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090471.1 protein_id gnl|my_center|LOCUS_16770 27130 26744 gene locus_tag LOCUS_16780 gene rpsF 27130 26744 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831345.1 protein_id gnl|my_center|LOCUS_16780 29357 27285 gene locus_tag LOCUS_16790 29357 27285 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_16790 29961 29371 gene locus_tag LOCUS_16800 gene pth 29961 29371 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_16800 30616 29948 gene locus_tag LOCUS_16810 30616 29948 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_16810 31617 30643 gene locus_tag LOCUS_16820 31617 30643 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_16820 31800 31726 gene locus_tag LOCUS_t00170 31800 31726 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32722 31817 gene locus_tag LOCUS_16830 gene ispE 32722 31817 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_16830 33495 32722 gene locus_tag LOCUS_16840 33495 32722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 35596 33515 gene locus_tag LOCUS_16850 35596 33515 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_16850 35740 36006 gene locus_tag LOCUS_16860 35740 36006 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_16860 36432 36007 gene locus_tag LOCUS_16870 gene dtd 36432 36007 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_16870 36365 36598 gene locus_tag LOCUS_16880 36365 36598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 36617 37060 gene locus_tag LOCUS_16890 36617 37060 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_16890 39684 37057 gene locus_tag LOCUS_16900 gene mutS 39684 37057 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_16900 39805 40518 gene locus_tag LOCUS_16910 gene tsaB 39805 40518 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_16910 40515 40742 gene locus_tag LOCUS_16920 40515 40742 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_16920 40770 41468 gene locus_tag LOCUS_16930 40770 41468 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_16930 41495 42235 gene locus_tag LOCUS_16940 gene pssA 41495 42235 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_16940 42232 43185 gene locus_tag LOCUS_16950 gene trxB 42232 43185 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_16950 43228 44349 gene locus_tag LOCUS_16960 43228 44349 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_16960 45660 44356 gene locus_tag LOCUS_16970 45660 44356 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_16970 45711 48266 gene locus_tag LOCUS_16980 45711 48266 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_16980 49598 48279 gene locus_tag LOCUS_16990 49598 48279 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_16990 50179 49595 gene locus_tag LOCUS_17000 50179 49595 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_17000 50216 51535 gene locus_tag LOCUS_17010 gene gntT 50216 51535 CDS product guanitoxin biosynthesis MATE family efflux transporter GntT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_17010 51617 52402 gene locus_tag LOCUS_17020 51617 52402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_17020 52406 52909 gene locus_tag LOCUS_17030 52406 52909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 53384 52926 gene locus_tag LOCUS_17040 53384 52926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 53898 53425 gene locus_tag LOCUS_17050 53898 53425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 54386 53895 gene locus_tag LOCUS_17060 54386 53895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 54463 55761 gene locus_tag LOCUS_17070 gene asnS 54463 55761 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_17070 55818 56444 gene locus_tag LOCUS_17080 55818 56444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 58186 56447 gene locus_tag LOCUS_17090 gene mutL 58186 56447 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_17090 59049 58285 gene locus_tag LOCUS_17100 59049 58285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 60439 59069 gene locus_tag LOCUS_17110 gene mgtE 60439 59069 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_17110 60921 60457 gene locus_tag LOCUS_17120 60921 60457 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_17120 61855 60926 gene locus_tag LOCUS_17130 61855 60926 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_17130 61928 63187 gene locus_tag LOCUS_17140 61928 63187 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_17140 63814 63203 gene locus_tag LOCUS_17150 63814 63203 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_17150 63922 64719 gene locus_tag LOCUS_17160 63922 64719 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_17160 64828 65532 gene locus_tag LOCUS_17170 gene npdG 64828 65532 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_17170 65624 66385 gene locus_tag LOCUS_17180 gene cofE 65624 66385 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_17180 66399 67412 gene locus_tag LOCUS_17190 gene cofD 66399 67412 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_17190 67409 68134 gene locus_tag LOCUS_17200 67409 68134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 68188 70704 gene locus_tag LOCUS_17210 68188 70704 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092974.1 protein_id gnl|my_center|LOCUS_17210 70742 71431 gene locus_tag LOCUS_17220 70742 71431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_17220 72484 71444 gene locus_tag LOCUS_17230 72484 71444 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_17230 72574 73401 gene locus_tag LOCUS_17240 72574 73401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 73394 74698 gene locus_tag LOCUS_17250 73394 74698 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_17250 76841 74682 gene locus_tag LOCUS_17260 76841 74682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 77824 76838 gene locus_tag LOCUS_17270 77824 76838 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 protein_id gnl|my_center|LOCUS_17270 79133 77907 gene locus_tag LOCUS_17280 79133 77907 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_17280 82168 79211 gene locus_tag LOCUS_17290 82168 79211 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_17290 82960 82199 gene locus_tag LOCUS_17300 82960 82199 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_17300 83770 82979 gene locus_tag LOCUS_17310 83770 82979 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_17310 83803 84369 gene locus_tag LOCUS_17320 gene nfuA 83803 84369 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_17320 84519 85961 gene locus_tag LOCUS_17330 84519 85961 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 protein_id gnl|my_center|LOCUS_17330 85968 87233 gene locus_tag LOCUS_17340 85968 87233 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_17340 87260 88039 gene locus_tag LOCUS_17350 87260 88039 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 protein_id gnl|my_center|LOCUS_17350 88039 88665 gene locus_tag LOCUS_17360 88039 88665 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_17360 88679 89296 gene locus_tag LOCUS_17370 gene nqrE 88679 89296 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_17370 89293 90510 gene locus_tag LOCUS_17380 gene nqrF 89293 90510 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_17380 90830 91858 gene locus_tag LOCUS_17390 90830 91858 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_17390 92110 92292 gene locus_tag LOCUS_17400 92110 92292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 92421 94478 gene locus_tag LOCUS_17410 92421 94478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 94495 95013 gene locus_tag LOCUS_17420 94495 95013 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418920.1 protein_id gnl|my_center|LOCUS_17420 95698 95015 gene locus_tag LOCUS_17430 95698 95015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 96529 95711 gene locus_tag LOCUS_17440 96529 95711 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931747.1 protein_id gnl|my_center|LOCUS_17440 99220 96542 gene locus_tag LOCUS_17450 99220 96542 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_17450 99711 99268 gene locus_tag LOCUS_17460 99711 99268 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_17460 101075 99708 gene locus_tag LOCUS_17470 101075 99708 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_17470 102609 101098 gene locus_tag LOCUS_17480 102609 101098 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_17480 103047 103508 gene locus_tag LOCUS_17490 gene rimP 103047 103508 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_17490 103524 104981 gene locus_tag LOCUS_17500 103524 104981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 105041 107455 gene locus_tag LOCUS_17510 105041 107455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 107462 107797 gene locus_tag LOCUS_17520 gene rbfA 107462 107797 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_17520 107794 108789 gene locus_tag LOCUS_17530 107794 108789 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_17530 108786 109733 gene locus_tag LOCUS_17540 108786 109733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 109855 110124 gene locus_tag LOCUS_17550 gene rpsO 109855 110124 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence11 64 1188 gene locus_tag LOCUS_17560 64 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1212 1937 gene locus_tag LOCUS_17570 1212 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4702 1934 gene locus_tag LOCUS_17580 4702 1934 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_17580 6664 4742 gene locus_tag LOCUS_17590 6664 4742 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_17590 6762 7865 gene locus_tag LOCUS_17600 6762 7865 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_17600 7870 9312 gene locus_tag LOCUS_17610 7870 9312 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_17610 10397 9288 gene locus_tag LOCUS_17620 10397 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 12672 10438 gene locus_tag LOCUS_17630 12672 10438 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_17630 13262 12780 gene locus_tag LOCUS_17640 13262 12780 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_17640 13375 14412 gene locus_tag LOCUS_17650 13375 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15384 14416 gene locus_tag LOCUS_17660 15384 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 17317 15422 gene locus_tag LOCUS_17670 17317 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 17592 19121 gene locus_tag LOCUS_17680 17592 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 19477 20355 gene locus_tag LOCUS_17690 19477 20355 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_17690 20428 21984 gene locus_tag LOCUS_17700 20428 21984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 21989 25219 gene locus_tag LOCUS_17710 21989 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 25647 25246 gene locus_tag LOCUS_17720 25647 25246 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_17720 25880 25644 gene locus_tag LOCUS_17730 25880 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 26641 25949 gene locus_tag LOCUS_17740 26641 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 27826 26645 gene locus_tag LOCUS_17750 27826 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 28786 27968 gene locus_tag LOCUS_17760 28786 27968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 29797 28793 gene locus_tag LOCUS_17770 29797 28793 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_17770 32297 29847 gene locus_tag LOCUS_17780 32297 29847 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_17780 33003 32308 gene locus_tag LOCUS_17790 33003 32308 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640560.1 protein_id gnl|my_center|LOCUS_17790 34822 33122 gene locus_tag LOCUS_17800 34822 33122 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_17800 34963 37275 gene locus_tag LOCUS_17810 gene aceA 34963 37275 CDS product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409584.1 protein_id gnl|my_center|LOCUS_17810 37272 39941 gene locus_tag LOCUS_17820 37272 39941 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_17820 39938 41155 gene locus_tag LOCUS_17830 gene sndA 39938 41155 CDS product S-alkyl-N-acetyl-metabolite deacetylase SndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229395.1 protein_id gnl|my_center|LOCUS_17830 41838 41167 gene locus_tag LOCUS_17840 41838 41167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 42896 42036 gene locus_tag LOCUS_17850 gene fabI 42896 42036 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971127.1 protein_id gnl|my_center|LOCUS_17850 42951 43838 gene locus_tag LOCUS_17860 42951 43838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 43849 45435 gene locus_tag LOCUS_17870 43849 45435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 45476 46648 gene locus_tag LOCUS_17880 45476 46648 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_17880 46653 47912 gene locus_tag LOCUS_17890 46653 47912 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_17890 49355 48015 gene locus_tag LOCUS_17900 49355 48015 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_17900 50287 49352 gene locus_tag LOCUS_17910 50287 49352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 50432 51571 gene locus_tag LOCUS_17920 gene rnd 50432 51571 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267099.1 protein_id gnl|my_center|LOCUS_17920 51583 52218 gene locus_tag LOCUS_17930 51583 52218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 53153 52167 gene locus_tag LOCUS_17940 gene epmA 53153 52167 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_17940 53730 53161 gene locus_tag LOCUS_17950 gene efp 53730 53161 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_17950 53897 55099 gene locus_tag LOCUS_17960 53897 55099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 55625 55143 gene locus_tag LOCUS_17970 55625 55143 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_17970 56556 55651 gene locus_tag LOCUS_17980 gene rocF 56556 55651 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_17980 56610 58400 gene locus_tag LOCUS_17990 gene lepA 56610 58400 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_17990 58474 58722 gene locus_tag LOCUS_18000 58474 58722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 58736 59146 gene locus_tag LOCUS_18010 58736 59146 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_18010 59863 59219 gene locus_tag LOCUS_18020 59863 59219 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 protein_id gnl|my_center|LOCUS_18020 61834 59909 gene locus_tag LOCUS_18030 61834 59909 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_18030 61934 64519 gene locus_tag LOCUS_18040 61934 64519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 64864 66042 gene locus_tag LOCUS_18050 gene hemW 64864 66042 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_18050 67695 66046 gene locus_tag LOCUS_18060 67695 66046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_18060 67756 68763 gene locus_tag LOCUS_18070 67756 68763 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_18070 69963 68773 gene locus_tag LOCUS_18080 69963 68773 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_18080 70417 73656 gene locus_tag LOCUS_18090 70417 73656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 73993 73709 gene locus_tag LOCUS_18100 73993 73709 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_18100 74712 73960 gene locus_tag LOCUS_18110 74712 73960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 74784 75404 gene locus_tag LOCUS_18120 74784 75404 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_18120 75518 76585 gene locus_tag LOCUS_18130 75518 76585 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_18130 76604 77536 gene locus_tag LOCUS_18140 76604 77536 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_18140 77539 78558 gene locus_tag LOCUS_18150 77539 78558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 78555 79613 gene locus_tag LOCUS_18160 78555 79613 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_18160 79610 80779 gene locus_tag LOCUS_18170 79610 80779 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_18170 80853 81653 gene locus_tag LOCUS_18180 80853 81653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 81658 83484 gene locus_tag LOCUS_18190 81658 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 83496 83828 gene locus_tag LOCUS_18200 83496 83828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 83898 84341 gene locus_tag LOCUS_18210 83898 84341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 84950 84345 gene locus_tag LOCUS_18220 84950 84345 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_18220 86086 84974 gene locus_tag LOCUS_18230 86086 84974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_18230 86593 86099 gene locus_tag LOCUS_18240 86593 86099 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_18240 86683 87522 gene locus_tag LOCUS_18250 86683 87522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 87745 88926 gene locus_tag LOCUS_18260 gene lysS 87745 88926 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_18260 88923 90278 gene locus_tag LOCUS_18270 88923 90278 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_18270 90275 90793 gene locus_tag LOCUS_18280 90275 90793 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_18280 90801 91829 gene locus_tag LOCUS_18290 90801 91829 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_18290 92285 91860 gene locus_tag LOCUS_18300 92285 91860 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_18300 95579 92301 gene locus_tag LOCUS_18310 95579 92301 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_18310 97826 95625 gene locus_tag LOCUS_18320 97826 95625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 99702 97843 gene locus_tag LOCUS_18330 gene mdlC 99702 97843 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099962.1 protein_id gnl|my_center|LOCUS_18330 99883 100122 gene locus_tag LOCUS_18340 gene rpmB 99883 100122 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258648.1 protein_id gnl|my_center|LOCUS_18340 101585 100152 gene locus_tag LOCUS_18350 101585 100152 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_18350 102192 101602 gene locus_tag LOCUS_18360 102192 101602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 103541 102240 gene locus_tag LOCUS_18370 103541 102240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_18370 104464 103586 gene locus_tag LOCUS_18380 104464 103586 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_18380 105763 104480 gene locus_tag LOCUS_18390 105763 104480 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence12 152 240 gene locus_tag LOCUS_t00180 152 240 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5468 4317 gene locus_tag LOCUS_18400 5468 4317 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731366.1 protein_id gnl|my_center|LOCUS_18400 5689 6216 gene locus_tag LOCUS_18410 5689 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6301 7443 gene locus_tag LOCUS_18420 6301 7443 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_18420 7547 8974 gene locus_tag LOCUS_18430 7547 8974 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_18430 9183 9758 gene locus_tag LOCUS_18440 9183 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 9771 9914 gene locus_tag LOCUS_18450 9771 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 11210 10149 gene locus_tag LOCUS_18460 gene recA 11210 10149 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_18460 11431 12432 gene locus_tag LOCUS_18470 gene murB 11431 12432 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_18470 12495 15434 gene locus_tag LOCUS_18480 12495 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 15497 15808 gene locus_tag LOCUS_18490 15497 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 15830 16702 gene locus_tag LOCUS_18500 15830 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 17241 16663 gene locus_tag LOCUS_18510 17241 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 19102 17255 gene locus_tag LOCUS_18520 19102 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 20138 19095 gene locus_tag LOCUS_18530 20138 19095 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_18530 20830 20135 gene locus_tag LOCUS_18540 20830 20135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 20887 22707 gene locus_tag LOCUS_18550 20887 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 22673 23998 gene locus_tag LOCUS_18560 22673 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 24017 26413 gene locus_tag LOCUS_18570 24017 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 26413 27561 gene locus_tag LOCUS_18580 gene thiO 26413 27561 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_18580 27646 27897 gene locus_tag LOCUS_18590 27646 27897 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_18590 28059 29039 gene locus_tag LOCUS_18600 28059 29039 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_18600 29069 31717 gene locus_tag LOCUS_18610 gene clpB 29069 31717 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_18610 31757 33013 gene locus_tag LOCUS_18620 31757 33013 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_18620 33258 33019 gene locus_tag LOCUS_18630 33258 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 34934 33285 gene locus_tag LOCUS_18640 34934 33285 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_18640 35015 35905 gene locus_tag LOCUS_18650 gene xerD 35015 35905 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_18650 36698 36006 gene locus_tag LOCUS_18660 36698 36006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 38771 36708 gene locus_tag LOCUS_18670 38771 36708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 38911 40776 gene locus_tag LOCUS_18680 38911 40776 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_18680 40778 41842 gene locus_tag LOCUS_18690 40778 41842 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_18690 41856 43544 gene locus_tag LOCUS_18700 41856 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 44051 43569 gene locus_tag LOCUS_18710 gene coaD 44051 43569 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_18710 46339 44048 gene locus_tag LOCUS_18720 46339 44048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 48186 46336 gene locus_tag LOCUS_18730 48186 46336 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_18730 48816 48229 gene locus_tag LOCUS_18740 48816 48229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 50560 48845 gene locus_tag LOCUS_18750 gene recN 50560 48845 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_18750 51417 50569 gene locus_tag LOCUS_18760 gene proC 51417 50569 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_18760 52459 51482 gene locus_tag LOCUS_18770 52459 51482 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_18770 53402 52470 gene locus_tag LOCUS_18780 gene lipA 53402 52470 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_18780 54175 53408 gene locus_tag LOCUS_18790 gene lipB 54175 53408 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_18790 54268 55419 gene locus_tag LOCUS_18800 54268 55419 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838133.1 protein_id gnl|my_center|LOCUS_18800 56467 55406 gene locus_tag LOCUS_18810 56467 55406 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_18810 57126 56548 gene locus_tag LOCUS_18820 57126 56548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 58838 57123 gene locus_tag LOCUS_18830 58838 57123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 60484 58835 gene locus_tag LOCUS_18840 60484 58835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 61475 60468 gene locus_tag LOCUS_18850 61475 60468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 63062 61590 gene locus_tag LOCUS_18860 gene lnt 63062 61590 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_18860 63709 63170 gene locus_tag LOCUS_18870 63709 63170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 64485 63706 gene locus_tag LOCUS_18880 64485 63706 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_18880 65896 64514 gene locus_tag LOCUS_18890 65896 64514 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_18890 66010 65934 gene locus_tag LOCUS_t00190 66010 65934 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 66855 66079 gene locus_tag LOCUS_18900 66855 66079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 67363 66830 gene locus_tag LOCUS_18910 67363 66830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 67244 69058 gene locus_tag LOCUS_18920 67244 69058 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873253.1 protein_id gnl|my_center|LOCUS_18920 69194 69529 gene locus_tag LOCUS_18930 gene gatC 69194 69529 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_18930 69529 70986 gene locus_tag LOCUS_18940 gene gatA 69529 70986 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_18940 70983 72773 gene locus_tag LOCUS_18950 70983 72773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 73511 72807 gene locus_tag LOCUS_18960 gene lexA 73511 72807 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_18960 73526 74818 gene locus_tag LOCUS_18970 73526 74818 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_18970 74815 76200 gene locus_tag LOCUS_18980 74815 76200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 76267 78363 gene locus_tag LOCUS_18990 gene fusA 76267 78363 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_18990 79293 78931 gene locus_tag LOCUS_19000 gene rplQ 79293 78931 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583372.1 protein_id gnl|my_center|LOCUS_19000 80323 79337 gene locus_tag LOCUS_19010 80323 79337 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_19010 80776 80402 gene locus_tag LOCUS_19020 gene rpsK 80776 80402 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_19020 81186 80806 gene locus_tag LOCUS_19030 gene rpsM 81186 80806 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_19030 81607 81362 gene locus_tag LOCUS_19040 gene infA 81607 81362 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_19040 82198 81626 gene locus_tag LOCUS_19050 82198 81626 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_19050 83576 82191 gene locus_tag LOCUS_19060 gene secY 83576 82191 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_19060 84022 83588 gene locus_tag LOCUS_19070 gene rplO 84022 83588 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_19070 84224 84024 gene locus_tag LOCUS_19080 gene rpmD 84224 84024 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722524.1 protein_id gnl|my_center|LOCUS_19080 84753 84142 gene locus_tag LOCUS_19090 gene rpsE 84753 84142 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_19090 85176 84790 gene locus_tag LOCUS_19100 gene rplR 85176 84790 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_19100 85702 85187 gene locus_tag LOCUS_19110 gene rplF 85702 85187 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_19110 86134 85736 gene locus_tag LOCUS_19120 gene rpsH 86134 85736 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_19120 86726 86184 gene locus_tag LOCUS_19130 gene rplE 86726 86184 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_19130 87067 86726 gene locus_tag LOCUS_19140 gene rplX 87067 86726 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_19140 87437 87069 gene locus_tag LOCUS_19150 gene rplN 87437 87069 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_19150 87730 87446 gene locus_tag LOCUS_19160 gene rpsQ 87730 87446 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_19160 87915 87727 gene locus_tag LOCUS_19170 gene rpmC 87915 87727 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_19170 88348 87929 gene locus_tag LOCUS_19180 gene rplP 88348 87929 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_19180 89034 88384 gene locus_tag LOCUS_19190 gene rpsC 89034 88384 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_19190 89405 89043 gene locus_tag LOCUS_19200 gene rplV 89405 89043 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_19200 89726 89439 gene locus_tag LOCUS_19210 gene rpsS 89726 89439 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_19210 90587 89757 gene locus_tag LOCUS_19220 gene rplB 90587 89757 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_19220 90880 90599 gene locus_tag LOCUS_19230 90880 90599 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_19230 91557 90883 gene locus_tag LOCUS_19240 gene rplD 91557 90883 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_19240 92201 91557 gene locus_tag LOCUS_19250 gene rplC 92201 91557 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_19250 92574 92242 gene locus_tag LOCUS_19260 gene rpsJ 92574 92242 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence13 2655 970 gene locus_tag LOCUS_19270 2655 970 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_19270 3893 2655 gene locus_tag LOCUS_19280 3893 2655 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_19280 4650 3907 gene locus_tag LOCUS_19290 4650 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5210 4647 gene locus_tag LOCUS_19300 5210 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5890 5207 gene locus_tag LOCUS_19310 5890 5207 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_19310 6057 7334 gene locus_tag LOCUS_19320 gene waaA 6057 7334 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_19320 7331 8320 gene locus_tag LOCUS_19330 gene lpxK 7331 8320 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_19330 9749 8340 gene locus_tag LOCUS_19340 9749 8340 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_19340 13406 9840 gene locus_tag LOCUS_19350 13406 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 13435 16122 gene locus_tag LOCUS_19360 gene polA 13435 16122 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_19360 17144 16119 gene locus_tag LOCUS_19370 17144 16119 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_19370 19121 17196 gene locus_tag LOCUS_19380 gene selB 19121 17196 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_19380 20485 19118 gene locus_tag LOCUS_19390 20485 19118 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_19390 22765 20507 gene locus_tag LOCUS_19400 22765 20507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_19400 23376 22762 gene locus_tag LOCUS_19410 23376 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 24501 23509 gene locus_tag LOCUS_19420 gene lpxC 24501 23509 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389005.1 protein_id gnl|my_center|LOCUS_19420 24761 25312 gene locus_tag LOCUS_19430 gene smpB 24761 25312 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_19430 25309 28155 gene locus_tag LOCUS_19440 gene uvrA 25309 28155 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_19440 28166 29656 gene locus_tag LOCUS_19450 28166 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 29923 30108 gene locus_tag LOCUS_19460 29923 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 30146 30589 gene locus_tag LOCUS_19470 30146 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 30623 30982 gene locus_tag LOCUS_19480 30623 30982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 30979 32622 gene locus_tag LOCUS_19490 30979 32622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 34013 32619 gene locus_tag LOCUS_19500 34013 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 34038 34793 gene locus_tag LOCUS_19510 34038 34793 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_19510 34887 34812 gene locus_tag LOCUS_t00200 34887 34812 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34951 35346 gene locus_tag LOCUS_19520 34951 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 35330 35560 gene locus_tag LOCUS_19530 35330 35560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 35658 36401 gene locus_tag LOCUS_19540 35658 36401 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_19540 36398 37696 gene locus_tag LOCUS_19550 36398 37696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 37686 38963 gene locus_tag LOCUS_19560 37686 38963 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_19560 40709 38976 gene locus_tag LOCUS_19570 40709 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 40743 41873 gene locus_tag LOCUS_19580 gene gcvT 40743 41873 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404363.1 protein_id gnl|my_center|LOCUS_19580 41891 42268 gene locus_tag LOCUS_19590 gene gcvH 41891 42268 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404804.1 protein_id gnl|my_center|LOCUS_19590 42284 42730 gene locus_tag LOCUS_19600 42284 42730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 42732 43514 gene locus_tag LOCUS_19610 gene larE 42732 43514 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_19610 43526 44284 gene locus_tag LOCUS_19620 gene larB 43526 44284 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_19620 45276 44248 gene locus_tag LOCUS_19630 gene queA 45276 44248 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_19630 46310 45273 gene locus_tag LOCUS_19640 46310 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 47272 46307 gene locus_tag LOCUS_19650 47272 46307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_19650 48890 47289 gene locus_tag LOCUS_19660 48890 47289 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_19660 48923 50296 gene locus_tag LOCUS_19670 48923 50296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 50438 50767 gene locus_tag LOCUS_19680 gene rplU 50438 50767 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_19680 50799 51056 gene locus_tag LOCUS_19690 gene rpmA 50799 51056 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_19690 51081 52142 gene locus_tag LOCUS_19700 gene obgE 51081 52142 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_19700 52139 52732 gene locus_tag LOCUS_19710 gene nadD 52139 52732 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_19710 52729 53181 gene locus_tag LOCUS_19720 52729 53181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 53159 53380 gene locus_tag LOCUS_19730 gene thiS 53159 53380 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_19730 53452 53527 gene locus_tag LOCUS_t00210 53452 53527 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 53540 53624 gene locus_tag LOCUS_t00220 53540 53624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53691 55046 gene locus_tag LOCUS_19740 gene tig 53691 55046 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_19740 55051 55641 gene locus_tag LOCUS_19750 gene clpP 55051 55641 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_19750 55763 56998 gene locus_tag LOCUS_19760 gene clpX 55763 56998 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_19760 57001 59469 gene locus_tag LOCUS_19770 gene lon 57001 59469 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_19770 59500 60078 gene locus_tag LOCUS_19780 gene yihA 59500 60078 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_19780 60116 61462 gene locus_tag LOCUS_19790 gene rho 60116 61462 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_19790 61492 62769 gene locus_tag LOCUS_19800 61492 62769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 62790 64910 gene locus_tag LOCUS_19810 62790 64910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 65639 64911 gene locus_tag LOCUS_19820 65639 64911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 66430 65636 gene locus_tag LOCUS_19830 66430 65636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_19830 68741 66420 gene locus_tag LOCUS_19840 68741 66420 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114386.1 protein_id gnl|my_center|LOCUS_19840 68740 69627 gene locus_tag LOCUS_19850 68740 69627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 69701 72067 gene locus_tag LOCUS_19860 69701 72067 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938956.1 protein_id gnl|my_center|LOCUS_19860 72080 73078 gene locus_tag LOCUS_19870 gene fmt 72080 73078 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_19870 73075 74481 gene locus_tag LOCUS_19880 gene rsmB 73075 74481 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_19880 74615 74890 gene locus_tag LOCUS_19890 gene hupA 74615 74890 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_19890 75604 74921 gene locus_tag LOCUS_19900 75604 74921 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_19900 75689 76168 gene locus_tag LOCUS_19910 gene moaC 75689 76168 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_19910 76181 77365 gene locus_tag LOCUS_19920 76181 77365 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_19920 77389 78996 gene locus_tag LOCUS_19930 gene serA 77389 78996 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_19930 79730 79017 gene locus_tag LOCUS_19940 79730 79017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 81168 79738 gene locus_tag LOCUS_19950 gene purB 81168 79738 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_19950 82161 81232 gene locus_tag LOCUS_19960 gene argF 82161 81232 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 protein_id gnl|my_center|LOCUS_19960 82280 82855 gene locus_tag LOCUS_19970 82280 82855 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_19970 83461 82856 gene locus_tag LOCUS_19980 gene coaE 83461 82856 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_19980 83658 84137 gene locus_tag LOCUS_19990 gene rplM 83658 84137 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_19990 84134 84523 gene locus_tag LOCUS_20000 gene rpsI 84134 84523 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_20000 84552 85565 gene locus_tag LOCUS_20010 84552 85565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 85656 86300 gene locus_tag LOCUS_20020 gene tsf 85656 86300 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_20020 86312 87025 gene locus_tag LOCUS_20030 gene pyrH 86312 87025 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_20030 87067 87621 gene locus_tag LOCUS_20040 gene frr 87067 87621 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_20040 87662 88861 gene locus_tag LOCUS_20050 87662 88861 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence14 131 925 gene locus_tag LOCUS_20060 131 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_20060 961 1398 gene locus_tag LOCUS_20070 961 1398 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_20070 1466 2455 gene locus_tag LOCUS_20080 1466 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2468 2686 gene locus_tag LOCUS_20090 2468 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4135 2693 gene locus_tag LOCUS_20100 4135 2693 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_20100 4201 5376 gene locus_tag LOCUS_20110 4201 5376 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_20110 5394 6311 gene locus_tag LOCUS_20120 5394 6311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_20120 7124 6321 gene locus_tag LOCUS_20130 7124 6321 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_20130 8302 7121 gene locus_tag LOCUS_20140 8302 7121 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_20140 9237 8386 gene locus_tag LOCUS_20150 9237 8386 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_20150 9374 9748 gene locus_tag LOCUS_20160 9374 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9745 10620 gene locus_tag LOCUS_20170 9745 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 11454 10633 gene locus_tag LOCUS_20180 11454 10633 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_20180 12746 11451 gene locus_tag LOCUS_20190 12746 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145058669.1 protein_id gnl|my_center|LOCUS_20190 13665 12736 gene locus_tag LOCUS_20200 13665 12736 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_20200 14360 13662 gene locus_tag LOCUS_20210 14360 13662 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_20210 16671 14377 gene locus_tag LOCUS_20220 16671 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 16753 17580 gene locus_tag LOCUS_20230 16753 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 17606 18496 gene locus_tag LOCUS_20240 17606 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 19900 18611 gene locus_tag LOCUS_20250 19900 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 20124 21623 gene locus_tag LOCUS_20260 20124 21623 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929823.1 protein_id gnl|my_center|LOCUS_20260 21648 22457 gene locus_tag LOCUS_20270 21648 22457 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902331.1 protein_id gnl|my_center|LOCUS_20270 22454 23716 gene locus_tag LOCUS_20280 22454 23716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 23713 24387 gene locus_tag LOCUS_20290 23713 24387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 24384 24815 gene locus_tag LOCUS_20300 24384 24815 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939741.1 protein_id gnl|my_center|LOCUS_20300 24906 25739 gene locus_tag LOCUS_20310 24906 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 25729 27315 gene locus_tag LOCUS_20320 25729 27315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 27743 27366 gene locus_tag LOCUS_20330 27743 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_20330 27787 28161 gene locus_tag LOCUS_20340 27787 28161 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922062.1 protein_id gnl|my_center|LOCUS_20340 28180 29886 gene locus_tag LOCUS_20350 28180 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 30217 29897 gene locus_tag LOCUS_20360 30217 29897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 30286 33765 gene locus_tag LOCUS_20370 gene dnaE2 30286 33765 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_20370 36192 33790 gene locus_tag LOCUS_20380 36192 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 38016 36214 gene locus_tag LOCUS_20390 38016 36214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 38045 40255 gene locus_tag LOCUS_20400 38045 40255 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_20400 40252 41154 gene locus_tag LOCUS_20410 gene fdhD 40252 41154 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_20410 41236 42687 gene locus_tag LOCUS_20420 41236 42687 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_20420 42724 43680 gene locus_tag LOCUS_20430 42724 43680 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_20430 43677 46622 gene locus_tag LOCUS_20440 gene gcvP 43677 46622 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_20440 48198 46639 gene locus_tag LOCUS_20450 gene cimA 48198 46639 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_20450 51163 48224 gene locus_tag LOCUS_20460 51163 48224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 51221 52318 gene locus_tag LOCUS_20470 51221 52318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 52545 53501 gene locus_tag LOCUS_20480 52545 53501 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_20480 53517 55409 gene locus_tag LOCUS_20490 gene ilvB 53517 55409 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_20490 55440 55985 gene locus_tag LOCUS_20500 gene ilvN 55440 55985 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_20500 56024 57025 gene locus_tag LOCUS_20510 gene ilvC 56024 57025 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_20510 57028 58647 gene locus_tag LOCUS_20520 57028 58647 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256076.1 protein_id gnl|my_center|LOCUS_20520 58644 60083 gene locus_tag LOCUS_20530 gene leuC 58644 60083 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_20530 60080 60703 gene locus_tag LOCUS_20540 gene leuD 60080 60703 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_20540 60734 61102 gene locus_tag LOCUS_20550 60734 61102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 61681 62193 gene locus_tag LOCUS_20560 61681 62193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 62257 63327 gene locus_tag LOCUS_20570 gene leuB 62257 63327 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_20570 63848 63333 gene locus_tag LOCUS_20580 63848 63333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 68350 64103 gene locus_tag LOCUS_20590 68350 64103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 64939 64948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70731 68857 gene locus_tag LOCUS_20600 70731 68857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 71771 70728 gene locus_tag LOCUS_20610 71771 70728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 72100 73542 gene locus_tag LOCUS_20620 72100 73542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 74323 73595 gene locus_tag LOCUS_20630 74323 73595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 76038 74542 gene locus_tag LOCUS_20640 76038 74542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 76753 76073 gene locus_tag LOCUS_20650 76753 76073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 80139 76756 gene locus_tag LOCUS_20660 80139 76756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 85477 80198 gene locus_tag LOCUS_20670 85477 80198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence15 87 869 gene locus_tag LOCUS_20680 87 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 866 1720 gene locus_tag LOCUS_20690 866 1720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_20690 1746 2585 gene locus_tag LOCUS_20700 1746 2585 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310200.1 protein_id gnl|my_center|LOCUS_20700 2582 5287 gene locus_tag LOCUS_20710 2582 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5790 5323 gene locus_tag LOCUS_20720 5790 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6625 5846 gene locus_tag LOCUS_20730 6625 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 6724 7599 gene locus_tag LOCUS_20740 6724 7599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_20740 8773 7637 gene locus_tag LOCUS_20750 8773 7637 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394617.1 protein_id gnl|my_center|LOCUS_20750 8878 11469 gene locus_tag LOCUS_20760 gene leuS 8878 11469 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_20760 11556 11798 gene locus_tag LOCUS_20770 11556 11798 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_20770 14177 11877 gene locus_tag LOCUS_20780 14177 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 15220 14174 gene locus_tag LOCUS_20790 15220 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 15347 16612 gene locus_tag LOCUS_20800 15347 16612 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_20800 16705 17832 gene locus_tag LOCUS_20810 16705 17832 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_20810 17878 18186 gene locus_tag LOCUS_20820 17878 18186 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_20820 18189 19601 gene locus_tag LOCUS_20830 18189 19601 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_20830 20681 19602 gene locus_tag LOCUS_20840 20681 19602 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_20840 22242 20731 gene locus_tag LOCUS_20850 gene panF 22242 20731 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_20850 22388 22251 gene locus_tag LOCUS_20860 22388 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 23500 22475 gene locus_tag LOCUS_20870 23500 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 23534 25111 gene locus_tag LOCUS_20880 23534 25111 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_20880 25199 27037 gene locus_tag LOCUS_20890 25199 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 27034 28437 gene locus_tag LOCUS_20900 27034 28437 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_20900 30435 28453 gene locus_tag LOCUS_20910 30435 28453 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_20910 30586 31896 gene locus_tag LOCUS_20920 gene eno 30586 31896 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_20920 35583 31909 gene locus_tag LOCUS_20930 35583 31909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 36940 35660 gene locus_tag LOCUS_20940 36940 35660 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_20940 36991 38514 gene locus_tag LOCUS_20950 36991 38514 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256989.1 protein_id gnl|my_center|LOCUS_20950 38517 40265 gene locus_tag LOCUS_20960 38517 40265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 40262 42217 gene locus_tag LOCUS_20970 40262 42217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 42202 43881 gene locus_tag LOCUS_20980 42202 43881 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20980 43931 46174 gene locus_tag LOCUS_20990 43931 46174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 48216 46171 gene locus_tag LOCUS_21000 48216 46171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 49304 48351 gene locus_tag LOCUS_21010 49304 48351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 52367 49500 gene locus_tag LOCUS_21020 52367 49500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 52890 54038 gene locus_tag LOCUS_21030 52890 54038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 54085 56307 gene locus_tag LOCUS_21040 54085 56307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 56375 58552 gene locus_tag LOCUS_21050 56375 58552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 61095 58561 gene locus_tag LOCUS_21060 61095 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 62960 61137 gene locus_tag LOCUS_21070 62960 61137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 65140 62957 gene locus_tag LOCUS_21080 65140 62957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 65622 65137 gene locus_tag LOCUS_21090 65622 65137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 65719 67161 gene locus_tag LOCUS_21100 65719 67161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 68687 67155 gene locus_tag LOCUS_21110 68687 67155 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857632.1 protein_id gnl|my_center|LOCUS_21110 70128 68689 gene locus_tag LOCUS_21120 70128 68689 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_21120 71783 70146 gene locus_tag LOCUS_21130 71783 70146 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_21130 71901 73133 gene locus_tag LOCUS_21140 71901 73133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 73130 73675 gene locus_tag LOCUS_21150 gene folK 73130 73675 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_21150 74847 73678 gene locus_tag LOCUS_21160 74847 73678 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_21160 75188 74847 gene locus_tag LOCUS_21170 75188 74847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 77347 75197 gene locus_tag LOCUS_21180 77347 75197 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_21180 78304 77360 gene locus_tag LOCUS_21190 78304 77360 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_21190 78334 79077 gene locus_tag LOCUS_21200 78334 79077 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_21200 79074 80717 gene locus_tag LOCUS_21210 79074 80717 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_21210 80741 81769 gene locus_tag LOCUS_21220 80741 81769 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_21220 81735 82049 gene locus_tag LOCUS_21230 81735 82049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 <82917 82039 gene locus_tag LOCUS_21240 <82917 82039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083381.1:enoyl-CoA hydratase >Feature sequence16 172 801 gene locus_tag LOCUS_21250 172 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 972 6188 gene locus_tag LOCUS_21260 972 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6725 6228 gene locus_tag LOCUS_21270 6725 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8031 6736 gene locus_tag LOCUS_21280 8031 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 9506 8028 gene locus_tag LOCUS_21290 9506 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9880 9503 gene locus_tag LOCUS_21300 9880 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10340 9885 gene locus_tag LOCUS_21310 10340 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 10627 11826 gene locus_tag LOCUS_21320 10627 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11828 13267 gene locus_tag LOCUS_21330 11828 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 13264 16080 gene locus_tag LOCUS_21340 13264 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 16955 17572 gene locus_tag LOCUS_21350 gene cas4 16955 17572 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_21350 17560 18576 gene locus_tag LOCUS_21360 gene cas1c 17560 18576 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_21360 18580 18870 gene locus_tag LOCUS_21370 gene cas2 18580 18870 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_21370 19075 19706 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgtcgccggggcctatgctccggccttcgttgagcg 19710 20182 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgtcgccggggcttaggctccggcctt 20381 20845 gene locus_tag LOCUS_21380 20381 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 20842 22116 gene locus_tag LOCUS_21390 20842 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 22182 25286 gene locus_tag LOCUS_21400 22182 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 25617 26651 gene locus_tag LOCUS_21410 25617 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 26836 27255 gene locus_tag LOCUS_21420 26836 27255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 27255 27572 gene locus_tag LOCUS_21430 27255 27572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 27733 28089 gene locus_tag LOCUS_21440 27733 28089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 30447 28399 gene locus_tag LOCUS_21450 30447 28399 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965347.1 protein_id gnl|my_center|LOCUS_21450 30780 30710 gene locus_tag LOCUS_t00230 30780 30710 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 30897 30824 gene locus_tag LOCUS_t00240 30897 30824 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31571 30918 gene locus_tag LOCUS_21460 31571 30918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 32169 31708 gene locus_tag LOCUS_21470 32169 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 33021 32767 gene locus_tag LOCUS_21480 33021 32767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 33282 33986 gene locus_tag LOCUS_21490 33282 33986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 34159 34722 gene locus_tag LOCUS_21500 34159 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 34755 34940 gene locus_tag LOCUS_21510 gene rpmF 34755 34940 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_21510 35004 36032 gene locus_tag LOCUS_21520 gene plsX 35004 36032 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_21520 36065 37072 gene locus_tag LOCUS_21530 36065 37072 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_21530 37095 38024 gene locus_tag LOCUS_21540 gene fabD 37095 38024 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_21540 38021 38767 gene locus_tag LOCUS_21550 gene fabG 38021 38767 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389704.1 protein_id gnl|my_center|LOCUS_21550 38887 39126 gene locus_tag LOCUS_21560 gene acpP 38887 39126 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_21560 39160 40401 gene locus_tag LOCUS_21570 gene fabF 39160 40401 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_21570 41021 40419 gene locus_tag LOCUS_21580 41021 40419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 41102 41803 gene locus_tag LOCUS_21590 41102 41803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 42158 43699 gene locus_tag LOCUS_21600 42158 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 43696 44697 gene locus_tag LOCUS_21610 43696 44697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 44694 45332 gene locus_tag LOCUS_21620 gene hisG 44694 45332 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_21620 45325 46725 gene locus_tag LOCUS_21630 gene hisD 45325 46725 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391986.1 protein_id gnl|my_center|LOCUS_21630 46722 47816 gene locus_tag LOCUS_21640 46722 47816 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227928.1 protein_id gnl|my_center|LOCUS_21640 47813 48412 gene locus_tag LOCUS_21650 gene hisB 47813 48412 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_21650 48409 49074 gene locus_tag LOCUS_21660 gene hisH 48409 49074 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404308.1 protein_id gnl|my_center|LOCUS_21660 49052 49792 gene locus_tag LOCUS_21670 gene hisA 49052 49792 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_21670 49789 50598 gene locus_tag LOCUS_21680 gene hisF 49789 50598 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111203.1 protein_id gnl|my_center|LOCUS_21680 50595 51248 gene locus_tag LOCUS_21690 gene hisIE 50595 51248 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_21690 51245 52738 gene locus_tag LOCUS_21700 gene trpE 51245 52738 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_21700 52735 53313 gene locus_tag LOCUS_21710 52735 53313 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 protein_id gnl|my_center|LOCUS_21710 53306 54346 gene locus_tag LOCUS_21720 gene trpD 53306 54346 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_21720 54350 55186 gene locus_tag LOCUS_21730 gene trpC 54350 55186 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_21730 55183 55824 gene locus_tag LOCUS_21740 55183 55824 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 protein_id gnl|my_center|LOCUS_21740 55821 57113 gene locus_tag LOCUS_21750 gene trpB 55821 57113 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_21750 57110 57940 gene locus_tag LOCUS_21760 gene trpA 57110 57940 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_21760 58079 58249 gene locus_tag LOCUS_21770 58079 58249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 58289 59338 gene locus_tag LOCUS_21780 58289 59338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 59328 61646 gene locus_tag LOCUS_21790 59328 61646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 63375 61654 gene locus_tag LOCUS_21800 63375 61654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 65154 63400 gene locus_tag LOCUS_21810 65154 63400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 65320 66261 gene locus_tag LOCUS_21820 65320 66261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 66372 66995 gene locus_tag LOCUS_21830 66372 66995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 67010 69844 gene locus_tag LOCUS_21840 67010 69844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 69844 70794 gene locus_tag LOCUS_21850 69844 70794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_21850 70781 71653 gene locus_tag LOCUS_21860 70781 71653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 71650 72606 gene locus_tag LOCUS_21870 71650 72606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_21870 72603 73457 gene locus_tag LOCUS_21880 72603 73457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 73584 74006 gene locus_tag LOCUS_21890 gene arfB 73584 74006 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957569.1 protein_id gnl|my_center|LOCUS_21890 74417 74010 gene locus_tag LOCUS_21900 74417 74010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 74471 75796 gene locus_tag LOCUS_21910 74471 75796 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_21910 76591 75833 gene locus_tag LOCUS_21920 76591 75833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 77515 76595 gene locus_tag LOCUS_21930 77515 76595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 78338 77556 gene locus_tag LOCUS_21940 78338 77556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 79090 78380 gene locus_tag LOCUS_21950 79090 78380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 79693 79139 gene locus_tag LOCUS_21960 79693 79139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 79616 79954 gene locus_tag LOCUS_21970 79616 79954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 79951 80121 gene locus_tag LOCUS_21980 79951 80121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 80576 80145 gene locus_tag LOCUS_21990 80576 80145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 80791 80982 gene locus_tag LOCUS_22000 80791 80982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 80982 81209 gene locus_tag LOCUS_22010 80982 81209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence17 2526 1231 gene locus_tag LOCUS_22020 2526 1231 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 protein_id gnl|my_center|LOCUS_22020 7246 2585 gene locus_tag LOCUS_22030 7246 2585 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 protein_id gnl|my_center|LOCUS_22030 8280 7345 gene locus_tag LOCUS_22040 8280 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 9701 8604 gene locus_tag LOCUS_22050 9701 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10441 9698 gene locus_tag LOCUS_22060 10441 9698 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_22060 10707 11552 gene locus_tag LOCUS_22070 gene aroE 10707 11552 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_22070 12878 11796 gene locus_tag LOCUS_22080 12878 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 13369 13022 gene locus_tag LOCUS_22090 13369 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 14854 13457 gene locus_tag LOCUS_22100 14854 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 16385 14847 gene locus_tag LOCUS_22110 16385 14847 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 protein_id gnl|my_center|LOCUS_22110 17362 16409 gene locus_tag LOCUS_22120 17362 16409 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 protein_id gnl|my_center|LOCUS_22120 17429 19318 gene locus_tag LOCUS_22130 17429 19318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040762.1 protein_id gnl|my_center|LOCUS_22130 19315 20697 gene locus_tag LOCUS_22140 19315 20697 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 protein_id gnl|my_center|LOCUS_22140 21570 20719 gene locus_tag LOCUS_22150 21570 20719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 21627 21980 gene locus_tag LOCUS_22160 21627 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 23096 22221 gene locus_tag LOCUS_22170 23096 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(22623..22625),aa:Sec) note codon on position 158 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_22170 23153 23614 gene locus_tag LOCUS_22180 23153 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 23619 25232 gene locus_tag LOCUS_22190 23619 25232 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_22190 25297 25626 gene locus_tag LOCUS_22200 25297 25626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 26363 25635 gene locus_tag LOCUS_22210 26363 25635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 26453 27841 gene locus_tag LOCUS_22220 26453 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 27913 29166 gene locus_tag LOCUS_22230 27913 29166 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22230 29171 30793 gene locus_tag LOCUS_22240 29171 30793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 31495 30803 gene locus_tag LOCUS_22250 31495 30803 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_22250 31579 32325 gene locus_tag LOCUS_22260 31579 32325 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_22260 32338 33825 gene locus_tag LOCUS_22270 gene glpK 32338 33825 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_22270 33875 34702 gene locus_tag LOCUS_22280 33875 34702 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_22280 36853 34727 gene locus_tag LOCUS_22290 gene ppk1 36853 34727 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_22290 38899 37004 gene locus_tag LOCUS_22300 38899 37004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 39744 38908 gene locus_tag LOCUS_22310 39744 38908 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_22310 39764 41917 gene locus_tag LOCUS_22320 39764 41917 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_22320 42598 41921 gene locus_tag LOCUS_22330 42598 41921 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_22330 42647 43546 gene locus_tag LOCUS_22340 42647 43546 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_22340 43595 44320 gene locus_tag LOCUS_22350 43595 44320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 45407 44325 gene locus_tag LOCUS_22360 45407 44325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 46719 45472 gene locus_tag LOCUS_22370 46719 45472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 46964 46716 gene locus_tag LOCUS_22380 46964 46716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 47004 47747 gene locus_tag LOCUS_22390 47004 47747 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_22390 47826 48596 gene locus_tag LOCUS_22400 47826 48596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_22400 49042 48593 gene locus_tag LOCUS_22410 49042 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 49740 49039 gene locus_tag LOCUS_22420 49740 49039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_22420 50603 49737 gene locus_tag LOCUS_22430 50603 49737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 50816 50622 gene locus_tag LOCUS_22440 50816 50622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 52854 50854 gene locus_tag LOCUS_22450 52854 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 54977 52851 gene locus_tag LOCUS_22460 54977 52851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 55075 55683 gene locus_tag LOCUS_22470 55075 55683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 56788 55694 gene locus_tag LOCUS_22480 56788 55694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_22480 58603 56888 gene locus_tag LOCUS_22490 58603 56888 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_22490 59169 58606 gene locus_tag LOCUS_22500 59169 58606 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_22500 59267 60697 gene locus_tag LOCUS_22510 59267 60697 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_22510 60754 61611 gene locus_tag LOCUS_22520 60754 61611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351130.1 protein_id gnl|my_center|LOCUS_22520 61608 62735 gene locus_tag LOCUS_22530 gene menC 61608 62735 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_22530 63512 62751 gene locus_tag LOCUS_22540 63512 62751 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_22540 64324 63533 gene locus_tag LOCUS_22550 64324 63533 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_22550 64416 65468 gene locus_tag LOCUS_22560 64416 65468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 67566 65473 gene locus_tag LOCUS_22570 67566 65473 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_22570 69027 67612 gene locus_tag LOCUS_22580 69027 67612 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942926.1 protein_id gnl|my_center|LOCUS_22580 70859 69024 gene locus_tag LOCUS_22590 70859 69024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 70908 71720 gene locus_tag LOCUS_22600 70908 71720 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_22600 71727 72563 gene locus_tag LOCUS_22610 71727 72563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 72580 74046 gene locus_tag LOCUS_22620 72580 74046 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_22620 75570 74650 gene locus_tag LOCUS_22630 75570 74650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 76915 75563 gene locus_tag LOCUS_22640 76915 75563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 77535 77837 gene locus_tag LOCUS_22650 77535 77837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 77840 79081 gene locus_tag LOCUS_22660 77840 79081 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence18 203 982 gene locus_tag LOCUS_22670 203 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 979 1371 gene locus_tag LOCUS_22680 979 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1418 3007 gene locus_tag LOCUS_22690 1418 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3004 3855 gene locus_tag LOCUS_22700 3004 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3852 4181 gene locus_tag LOCUS_22710 3852 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4178 5113 gene locus_tag LOCUS_22720 4178 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5233 5406 gene locus_tag LOCUS_22730 5233 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5403 5864 gene locus_tag LOCUS_22740 5403 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5861 6043 gene locus_tag LOCUS_22750 5861 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 6040 6735 gene locus_tag LOCUS_22760 6040 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 6732 7022 gene locus_tag LOCUS_22770 6732 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7015 7686 gene locus_tag LOCUS_22780 7015 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7689 8045 gene locus_tag LOCUS_22790 7689 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 8042 8362 gene locus_tag LOCUS_22800 8042 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8382 8915 gene locus_tag LOCUS_22810 8382 8915 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018652012.1 protein_id gnl|my_center|LOCUS_22810 8912 10429 gene locus_tag LOCUS_22820 8912 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_22820 10429 11997 gene locus_tag LOCUS_22830 10429 11997 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_22830 11987 12799 gene locus_tag LOCUS_22840 11987 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 12796 14559 gene locus_tag LOCUS_22850 12796 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 14559 15578 gene locus_tag LOCUS_22860 14559 15578 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_22860 15571 17181 gene locus_tag LOCUS_22870 15571 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 17309 17587 gene locus_tag LOCUS_22880 17309 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 17587 18036 gene locus_tag LOCUS_22890 17587 18036 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_22890 18743 18144 gene locus_tag LOCUS_22900 18743 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 19477 18746 gene locus_tag LOCUS_22910 19477 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 20181 19480 gene locus_tag LOCUS_22920 20181 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 21987 20191 gene locus_tag LOCUS_22930 21987 20191 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_22930 22787 21984 gene locus_tag LOCUS_22940 gene otsB 22787 21984 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_22940 22869 24224 gene locus_tag LOCUS_22950 22869 24224 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_22950 24230 25474 gene locus_tag LOCUS_22960 24230 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 25507 26604 gene locus_tag LOCUS_22970 gene msrP 25507 26604 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_22970 26646 26906 gene locus_tag LOCUS_22980 26646 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 27220 26903 gene locus_tag LOCUS_22990 27220 26903 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_22990 28923 27343 gene locus_tag LOCUS_23000 28923 27343 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_23000 29038 29247 gene locus_tag LOCUS_23010 29038 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 29337 30794 gene locus_tag LOCUS_23020 29337 30794 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_23020 30791 31909 gene locus_tag LOCUS_23030 30791 31909 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_23030 33409 31973 gene locus_tag LOCUS_23040 33409 31973 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_23040 34870 33470 gene locus_tag LOCUS_23050 gene hemG 34870 33470 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383354.1 protein_id gnl|my_center|LOCUS_23050 35835 34867 gene locus_tag LOCUS_23060 gene hemE 35835 34867 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_23060 37316 35958 gene locus_tag LOCUS_23070 37316 35958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 38447 37362 gene locus_tag LOCUS_23080 gene hemH 38447 37362 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_23080 39464 38454 gene locus_tag LOCUS_23090 gene hemF 39464 38454 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 protein_id gnl|my_center|LOCUS_23090 40759 39461 gene locus_tag LOCUS_23100 gene hemL 40759 39461 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_23100 42639 40756 gene locus_tag LOCUS_23110 42639 40756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 42768 44588 gene locus_tag LOCUS_23120 42768 44588 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_23120 44593 45369 gene locus_tag LOCUS_23130 gene xth 44593 45369 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_23130 46985 45375 gene locus_tag LOCUS_23140 46985 45375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_23140 47526 46999 gene locus_tag LOCUS_23150 47526 46999 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_23150 48614 47634 gene locus_tag LOCUS_23160 48614 47634 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_23160 48957 48784 gene locus_tag LOCUS_23170 48957 48784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 48905 52285 gene locus_tag LOCUS_23180 48905 52285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 52343 53368 gene locus_tag LOCUS_23190 gene galE 52343 53368 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_23190 53365 54027 gene locus_tag LOCUS_23200 53365 54027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 54028 55761 gene locus_tag LOCUS_23210 54028 55761 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23210 55758 57122 gene locus_tag LOCUS_23220 55758 57122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 57119 58609 gene locus_tag LOCUS_23230 gene gltX 57119 58609 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_23230 58968 58618 gene locus_tag LOCUS_23240 58968 58618 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967765.1 protein_id gnl|my_center|LOCUS_23240 59562 59020 gene locus_tag LOCUS_23250 59562 59020 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_23250 61305 59605 gene locus_tag LOCUS_23260 61305 59605 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_23260 61399 62607 gene locus_tag LOCUS_23270 61399 62607 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_23270 63347 62625 gene locus_tag LOCUS_23280 63347 62625 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_23280 63670 63344 gene locus_tag LOCUS_23290 63670 63344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 63656 63937 gene locus_tag LOCUS_23300 63656 63937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 64953 64000 gene locus_tag LOCUS_23310 64953 64000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 65114 65626 gene locus_tag LOCUS_23320 65114 65626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 65764 66654 gene locus_tag LOCUS_23330 65764 66654 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_23330 68951 66651 gene locus_tag LOCUS_23340 68951 66651 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_23340 70087 68990 gene locus_tag LOCUS_23350 70087 68990 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_23350 <75203 70087 gene locus_tag LOCUS_23360 <75203 70087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein >Feature sequence19 268 1299 gene locus_tag LOCUS_23370 gene ruvB 268 1299 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_23370 2234 1617 gene locus_tag LOCUS_23380 gene ruvA 2234 1617 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_23380 4212 2260 gene locus_tag LOCUS_23390 4212 2260 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_23390 4314 5330 gene locus_tag LOCUS_23400 4314 5330 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_23400 5346 6185 gene locus_tag LOCUS_23410 5346 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6169 6681 gene locus_tag LOCUS_23420 6169 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6698 8494 gene locus_tag LOCUS_23430 gene mrdA 6698 8494 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938087.1 protein_id gnl|my_center|LOCUS_23430 8475 9590 gene locus_tag LOCUS_23440 gene rodA 8475 9590 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_23440 9620 11104 gene locus_tag LOCUS_23450 gene rng 9620 11104 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_23450 11101 13320 gene locus_tag LOCUS_23460 11101 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 13334 14134 gene locus_tag LOCUS_23470 13334 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 14136 15476 gene locus_tag LOCUS_23480 14136 15476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_23480 15473 15787 gene locus_tag LOCUS_23490 15473 15787 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_23490 17558 15780 gene locus_tag LOCUS_23500 17558 15780 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_23500 18328 17654 gene locus_tag LOCUS_23510 18328 17654 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338538.1 protein_id gnl|my_center|LOCUS_23510 19113 18373 gene locus_tag LOCUS_23520 19113 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 19244 19171 gene locus_tag LOCUS_t00250 19244 19171 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19367 20158 gene locus_tag LOCUS_23530 19367 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 20286 20495 gene locus_tag LOCUS_23540 gene rpsU 20286 20495 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546110.1 protein_id gnl|my_center|LOCUS_23540 20552 23056 gene locus_tag LOCUS_23550 20552 23056 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_23550 23257 25062 gene locus_tag LOCUS_23560 23257 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 25072 26796 gene locus_tag LOCUS_23570 gene rpoD 25072 26796 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_23570 26888 26962 gene locus_tag LOCUS_t00260 26888 26962 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 27029 28618 gene locus_tag LOCUS_23580 gene pckA 27029 28618 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404573.1 protein_id gnl|my_center|LOCUS_23580 28638 30581 gene locus_tag LOCUS_23590 gene acs 28638 30581 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_23590 30586 31689 gene locus_tag LOCUS_23600 30586 31689 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_23600 32472 31699 gene locus_tag LOCUS_23610 32472 31699 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_23610 32456 33007 gene locus_tag LOCUS_23620 32456 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 33007 34455 gene locus_tag LOCUS_23630 gene sufB 33007 34455 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_23630 34523 35278 gene locus_tag LOCUS_23640 gene sufC 34523 35278 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_23640 35283 36644 gene locus_tag LOCUS_23650 gene sufD 35283 36644 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_23650 36649 37932 gene locus_tag LOCUS_23660 36649 37932 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_23660 37959 38411 gene locus_tag LOCUS_23670 37959 38411 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_23670 38441 38782 gene locus_tag LOCUS_23680 38441 38782 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_23680 38782 39303 gene locus_tag LOCUS_23690 38782 39303 CDS product sulfur transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_23690 39342 40163 gene locus_tag LOCUS_23700 39342 40163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 40252 42294 gene locus_tag LOCUS_23710 gene tkt 40252 42294 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_23710 43388 42327 gene locus_tag LOCUS_23720 43388 42327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_23720 45559 43544 gene locus_tag LOCUS_23730 45559 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 46803 45640 gene locus_tag LOCUS_23740 46803 45640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_23740 48254 46875 gene locus_tag LOCUS_23750 48254 46875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 48361 48286 gene locus_tag LOCUS_t00270 48361 48286 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 49724 48378 gene locus_tag LOCUS_23760 49724 48378 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_23760 49821 51641 gene locus_tag LOCUS_23770 49821 51641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 51669 53045 gene locus_tag LOCUS_23780 51669 53045 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_23780 55386 53053 gene locus_tag LOCUS_23790 55386 53053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 56447 55383 gene locus_tag LOCUS_23800 56447 55383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 56508 57209 gene locus_tag LOCUS_23810 56508 57209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189933225.1 protein_id gnl|my_center|LOCUS_23810 58699 57230 gene locus_tag LOCUS_23820 58699 57230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 60105 58732 gene locus_tag LOCUS_23830 60105 58732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 60249 61427 gene locus_tag LOCUS_23840 60249 61427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 61440 62504 gene locus_tag LOCUS_23850 gene ychF 61440 62504 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_23850 62515 63207 gene locus_tag LOCUS_23860 gene aat 62515 63207 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_23860 64172 63204 gene locus_tag LOCUS_23870 64172 63204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 65341 65266 gene locus_tag LOCUS_t00280 65341 65266 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 65537 69025 gene locus_tag LOCUS_23880 65537 69025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 69063 70634 gene locus_tag LOCUS_23890 gene purH 69063 70634 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_23890 70634 71278 gene locus_tag LOCUS_23900 70634 71278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 71284 73653 gene locus_tag LOCUS_23910 71284 73653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence20 2939 1161 gene locus_tag LOCUS_23920 2939 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2987 3874 gene locus_tag LOCUS_23930 2987 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3888 5678 gene locus_tag LOCUS_23940 3888 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 6394 5630 gene locus_tag LOCUS_23950 6394 5630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_23950 7717 6485 gene locus_tag LOCUS_23960 7717 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 9100 7769 gene locus_tag LOCUS_23970 9100 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 9124 11592 gene locus_tag LOCUS_23980 9124 11592 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727995.1 protein_id gnl|my_center|LOCUS_23980 11610 12035 gene locus_tag LOCUS_23990 11610 12035 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 protein_id gnl|my_center|LOCUS_23990 13834 12032 gene locus_tag LOCUS_24000 13834 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 15564 13837 gene locus_tag LOCUS_24010 15564 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 16674 15613 gene locus_tag LOCUS_24020 16674 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 17735 16671 gene locus_tag LOCUS_24030 17735 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 19243 17747 gene locus_tag LOCUS_24040 19243 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 21413 19545 gene locus_tag LOCUS_24050 21413 19545 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_24050 22970 21450 gene locus_tag LOCUS_24060 gene hutH 22970 21450 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902906.1 protein_id gnl|my_center|LOCUS_24060 24643 22967 gene locus_tag LOCUS_24070 24643 22967 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918841.1 protein_id gnl|my_center|LOCUS_24070 26019 24658 gene locus_tag LOCUS_24080 gene hutF 26019 24658 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394609.1 protein_id gnl|my_center|LOCUS_24080 26085 27314 gene locus_tag LOCUS_24090 gene hutI 26085 27314 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_24090 27329 28768 gene locus_tag LOCUS_24100 27329 28768 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_24100 31208 28743 gene locus_tag LOCUS_24110 31208 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 34258 31220 gene locus_tag LOCUS_24120 34258 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 37578 34366 gene locus_tag LOCUS_24130 37578 34366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 37486 37671 gene locus_tag LOCUS_24140 37486 37671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 38168 39409 gene locus_tag LOCUS_24150 gene ispG 38168 39409 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615358.1 protein_id gnl|my_center|LOCUS_24150 39412 39693 gene locus_tag LOCUS_24160 39412 39693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 39769 40299 gene locus_tag LOCUS_24170 39769 40299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 41794 40355 gene locus_tag LOCUS_24180 41794 40355 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_24180 42402 41809 gene locus_tag LOCUS_24190 42402 41809 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_24190 42504 43259 gene locus_tag LOCUS_24200 42504 43259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 45252 43252 gene locus_tag LOCUS_24210 45252 43252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 protein_id gnl|my_center|LOCUS_24210 46029 45271 gene locus_tag LOCUS_24220 46029 45271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_24220 47324 46026 gene locus_tag LOCUS_24230 47324 46026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 48421 47363 gene locus_tag LOCUS_24240 48421 47363 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_24240 50355 48451 gene locus_tag LOCUS_24250 gene thiC 50355 48451 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_24250 50202 50281 gene locus_tag LOCUS_t00290 50202 50281 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50560 53262 gene locus_tag LOCUS_24260 gene aceE 50560 53262 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039835.1 protein_id gnl|my_center|LOCUS_24260 53259 54557 gene locus_tag LOCUS_24270 gene aceF 53259 54557 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24270 54554 56386 gene locus_tag LOCUS_24280 gene lpdA 54554 56386 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_24280 56400 56765 gene locus_tag LOCUS_24290 56400 56765 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 protein_id gnl|my_center|LOCUS_24290 56809 58626 gene locus_tag LOCUS_24300 56809 58626 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_24300 58920 59267 gene locus_tag LOCUS_24310 58920 59267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 59264 59665 gene locus_tag LOCUS_24320 59264 59665 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_24320 60593 59643 gene locus_tag LOCUS_24330 60593 59643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 60657 61340 gene locus_tag LOCUS_24340 60657 61340 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_24340 62034 61357 gene locus_tag LOCUS_24350 62034 61357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 62973 62044 gene locus_tag LOCUS_24360 62973 62044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 63446 63042 gene locus_tag LOCUS_24370 63446 63042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 64084 63533 gene locus_tag LOCUS_24380 64084 63533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 63608 63617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65234 64182 gene locus_tag LOCUS_24390 65234 64182 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_24390 66361 65231 gene locus_tag LOCUS_24400 66361 65231 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_24400 66677 68092 gene locus_tag LOCUS_24410 66677 68092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 68103 70283 gene locus_tag LOCUS_24420 68103 70283 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_24420 70300 72045 gene locus_tag LOCUS_24430 70300 72045 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_24430 72042 73151 gene locus_tag LOCUS_24440 72042 73151 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_24440 73374 73159 gene locus_tag LOCUS_24450 73374 73159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence21 96 2396 gene locus_tag LOCUS_24460 96 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5765 2442 gene locus_tag LOCUS_24470 5765 2442 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_24470 7341 5800 gene locus_tag LOCUS_24480 7341 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 10586 7338 gene locus_tag LOCUS_24490 10586 7338 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_24490 11197 10610 gene locus_tag LOCUS_24500 11197 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11655 11197 gene locus_tag LOCUS_24510 11655 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 12353 11655 gene locus_tag LOCUS_24520 gene rpoE 12353 11655 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_24520 13783 12350 gene locus_tag LOCUS_24530 13783 12350 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_24530 13854 14930 gene locus_tag LOCUS_24540 13854 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 14935 17439 gene locus_tag LOCUS_24550 14935 17439 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 protein_id gnl|my_center|LOCUS_24550 20875 17477 gene locus_tag LOCUS_24560 20875 17477 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_24560 21608 20907 gene locus_tag LOCUS_24570 gene lolD 21608 20907 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_24570 22965 21601 gene locus_tag LOCUS_24580 22965 21601 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_24580 24419 22962 gene locus_tag LOCUS_24590 24419 22962 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_24590 24664 24416 gene locus_tag LOCUS_24600 24664 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 25990 24689 gene locus_tag LOCUS_24610 25990 24689 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_24610 26148 28535 gene locus_tag LOCUS_24620 26148 28535 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_24620 29936 28551 gene locus_tag LOCUS_24630 29936 28551 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_24630 31121 29949 gene locus_tag LOCUS_24640 31121 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 32382 31150 gene locus_tag LOCUS_24650 32382 31150 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_24650 33828 32389 gene locus_tag LOCUS_24660 33828 32389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 35232 33865 gene locus_tag LOCUS_24670 35232 33865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 36362 35259 gene locus_tag LOCUS_24680 36362 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 36832 36413 gene locus_tag LOCUS_24690 36832 36413 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_24690 37888 36932 gene locus_tag LOCUS_24700 37888 36932 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_24700 38043 39173 gene locus_tag LOCUS_24710 38043 39173 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_24710 39232 40683 gene locus_tag LOCUS_24720 39232 40683 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_24720 40810 41910 gene locus_tag LOCUS_24730 40810 41910 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925262.1 protein_id gnl|my_center|LOCUS_24730 43822 41924 gene locus_tag LOCUS_24740 43822 41924 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_24740 45036 43822 gene locus_tag LOCUS_24750 45036 43822 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_24750 45163 46170 gene locus_tag LOCUS_24760 45163 46170 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_24760 46204 47793 gene locus_tag LOCUS_24770 46204 47793 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_24770 48048 48302 gene locus_tag LOCUS_24780 48048 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 48317 48724 gene locus_tag LOCUS_24790 48317 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 48752 49237 gene locus_tag LOCUS_24800 48752 49237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 49337 49585 gene locus_tag LOCUS_24810 49337 49585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 50065 49658 gene locus_tag LOCUS_24820 50065 49658 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522187.1 protein_id gnl|my_center|LOCUS_24820 52932 50065 gene locus_tag LOCUS_24830 52932 50065 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_24830 54930 52936 gene locus_tag LOCUS_24840 54930 52936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 57863 54951 gene locus_tag LOCUS_24850 57863 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 58543 57860 gene locus_tag LOCUS_24860 gene radC 58543 57860 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_24860 60074 58596 gene locus_tag LOCUS_24870 60074 58596 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_24870 62116 60089 gene locus_tag LOCUS_24880 62116 60089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 62187 63185 gene locus_tag LOCUS_24890 62187 63185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 63951 63202 gene locus_tag LOCUS_24900 63951 63202 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809109.1 protein_id gnl|my_center|LOCUS_24900 63996 67058 gene locus_tag LOCUS_24910 63996 67058 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_24910 67182 68399 gene locus_tag LOCUS_24920 67182 68399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 68421 68921 gene locus_tag LOCUS_24930 68421 68921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 68970 72017 gene locus_tag LOCUS_24940 68970 72017 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence22 1647 571 gene locus_tag LOCUS_24950 1647 571 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_24950 3446 1644 gene locus_tag LOCUS_24960 3446 1644 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_24960 4687 3443 gene locus_tag LOCUS_24970 4687 3443 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_24970 5784 4684 gene locus_tag LOCUS_24980 5784 4684 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_24980 5912 6586 gene locus_tag LOCUS_24990 5912 6586 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730121.1 protein_id gnl|my_center|LOCUS_24990 7467 6595 gene locus_tag LOCUS_25000 gene yghU 7467 6595 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_25000 7553 7477 gene locus_tag LOCUS_t00300 7553 7477 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8222 8312 gene locus_tag LOCUS_t00310 8222 8312 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8553 9203 gene locus_tag LOCUS_25010 8553 9203 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_25010 9214 10002 gene locus_tag LOCUS_25020 9214 10002 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_25020 11167 10043 gene locus_tag LOCUS_25030 gene tsaD 11167 10043 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904802.1 protein_id gnl|my_center|LOCUS_25030 11234 12454 gene locus_tag LOCUS_25040 11234 12454 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_25040 12451 13227 gene locus_tag LOCUS_25050 gene tpiA 12451 13227 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_25050 13283 13678 gene locus_tag LOCUS_25060 13283 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 13702 13786 gene locus_tag LOCUS_t00320 13702 13786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14430 13849 gene locus_tag LOCUS_25070 gene ppiA 14430 13849 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_25070 14448 15161 gene locus_tag LOCUS_25080 14448 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 15473 15129 gene locus_tag LOCUS_25090 15473 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 15754 15476 gene locus_tag LOCUS_25100 15754 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 16212 15817 gene locus_tag LOCUS_25110 16212 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 17390 16209 gene locus_tag LOCUS_25120 gene bshA 17390 16209 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_25120 19093 17402 gene locus_tag LOCUS_25130 gene bshC 19093 17402 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479890.1 protein_id gnl|my_center|LOCUS_25130 19374 19105 gene locus_tag LOCUS_25140 19374 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 19259 20191 gene locus_tag LOCUS_25150 gene dusB 19259 20191 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_25150 20215 20688 gene locus_tag LOCUS_25160 20215 20688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 20688 21011 gene locus_tag LOCUS_25170 20688 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 21025 21423 gene locus_tag LOCUS_25180 21025 21423 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_25180 21603 23786 gene locus_tag LOCUS_25190 21603 23786 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_25190 23822 24400 gene locus_tag LOCUS_25200 23822 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 24440 24786 gene locus_tag LOCUS_tm00010 24440 24786 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 24850 27456 gene locus_tag LOCUS_25210 24850 27456 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_25210 28561 27440 gene locus_tag LOCUS_25220 28561 27440 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575380.1 protein_id gnl|my_center|LOCUS_25220 28560 30269 gene locus_tag LOCUS_25230 28560 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 31316 30285 gene locus_tag LOCUS_25240 gene mtnA 31316 30285 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937395.1 protein_id gnl|my_center|LOCUS_25240 31966 31337 gene locus_tag LOCUS_25250 31966 31337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 32357 31989 gene locus_tag LOCUS_25260 32357 31989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 32820 33551 gene locus_tag LOCUS_25270 gene lepB 32820 33551 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_25270 33565 34212 gene locus_tag LOCUS_25280 gene lepB 33565 34212 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_25280 34910 34215 gene locus_tag LOCUS_25290 gene pyrF 34910 34215 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_25290 35851 34907 gene locus_tag LOCUS_25300 35851 34907 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_25300 36633 35848 gene locus_tag LOCUS_25310 36633 35848 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_25310 36712 38361 gene locus_tag LOCUS_25320 36712 38361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 38829 38389 gene locus_tag LOCUS_25330 38829 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 39728 38853 gene locus_tag LOCUS_25340 39728 38853 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_25340 40486 39728 gene locus_tag LOCUS_25350 40486 39728 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_25350 41126 40479 gene locus_tag LOCUS_25360 41126 40479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 42442 41630 gene locus_tag LOCUS_25370 42442 41630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 44201 42459 gene locus_tag LOCUS_25380 gene yidC 44201 42459 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_25380 44468 44211 gene locus_tag LOCUS_25390 gene yidD 44468 44211 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307474.1 protein_id gnl|my_center|LOCUS_25390 44884 44465 gene locus_tag LOCUS_25400 44884 44465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 45218 45129 gene locus_tag LOCUS_t00330 45218 45129 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45354 45265 gene locus_tag LOCUS_t00340 45354 45265 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45800 45345 gene locus_tag LOCUS_25410 45800 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 46055 47779 gene locus_tag LOCUS_25420 gene dnaX 46055 47779 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_25420 47813 48106 gene locus_tag LOCUS_25430 47813 48106 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869751.1 protein_id gnl|my_center|LOCUS_25430 48106 48693 gene locus_tag LOCUS_25440 gene recR 48106 48693 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458897.1 protein_id gnl|my_center|LOCUS_25440 50327 49041 gene locus_tag LOCUS_25450 50327 49041 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_25450 51537 50332 gene locus_tag LOCUS_25460 51537 50332 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_25460 52637 51534 gene locus_tag LOCUS_25470 gene mutY 52637 51534 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_25470 53047 54384 gene locus_tag LOCUS_25480 gene dnaA 53047 54384 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_25480 54694 55806 gene locus_tag LOCUS_25490 gene dnaN 54694 55806 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_25490 55948 58392 gene locus_tag LOCUS_25500 gene gyrB 55948 58392 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072072.1 protein_id gnl|my_center|LOCUS_25500 58403 60949 gene locus_tag LOCUS_25510 gene gyrA 58403 60949 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_25510 60968 61624 gene locus_tag LOCUS_25520 gene fsa 60968 61624 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_25520 61643 63040 gene locus_tag LOCUS_25530 61643 63040 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_25530 63037 63624 gene locus_tag LOCUS_25540 63037 63624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 63633 64631 gene locus_tag LOCUS_25550 63633 64631 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_25550 65804 64674 gene locus_tag LOCUS_25560 gene thrC 65804 64674 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_25560 66976 66005 gene locus_tag LOCUS_25570 66976 66005 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_25570 68076 66985 gene locus_tag LOCUS_25580 gene asd 68076 66985 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_25580 70616 68073 gene locus_tag LOCUS_25590 gene thrA 70616 68073 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403462.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence23 1965 784 gene locus_tag LOCUS_25600 1965 784 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_25600 3137 1965 gene locus_tag LOCUS_25610 3137 1965 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_25610 3151 4782 gene locus_tag LOCUS_25620 3151 4782 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_25620 5700 4795 gene locus_tag LOCUS_25630 5700 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 5732 8932 gene locus_tag LOCUS_25640 5732 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_25640 9046 11172 gene locus_tag LOCUS_25650 9046 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 11225 12814 gene locus_tag LOCUS_25660 gene ggt 11225 12814 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_25660 12853 14049 gene locus_tag LOCUS_25670 12853 14049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_25670 14083 14475 gene locus_tag LOCUS_25680 14083 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 14506 16908 gene locus_tag LOCUS_25690 gene clpA 14506 16908 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931114.1 protein_id gnl|my_center|LOCUS_25690 18076 16901 gene locus_tag LOCUS_25700 18076 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 18920 18099 gene locus_tag LOCUS_25710 18920 18099 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_25710 20494 18941 gene locus_tag LOCUS_25720 20494 18941 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_25720 20591 23224 gene locus_tag LOCUS_25730 20591 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 23305 24936 gene locus_tag LOCUS_25740 23305 24936 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_25740 25575 25012 gene locus_tag LOCUS_25750 25575 25012 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640440.1 protein_id gnl|my_center|LOCUS_25750 25699 26652 gene locus_tag LOCUS_25760 gene gshB 25699 26652 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_25760 28024 26657 gene locus_tag LOCUS_25770 gene gorA 28024 26657 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 protein_id gnl|my_center|LOCUS_25770 28256 29098 gene locus_tag LOCUS_25780 28256 29098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 29166 30494 gene locus_tag LOCUS_25790 29166 30494 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_25790 31335 30544 gene locus_tag LOCUS_25800 31335 30544 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_25800 31484 32236 gene locus_tag LOCUS_25810 31484 32236 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_25810 32314 33429 gene locus_tag LOCUS_25820 32314 33429 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 protein_id gnl|my_center|LOCUS_25820 33429 34655 gene locus_tag LOCUS_25830 33429 34655 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_25830 38404 34742 gene locus_tag LOCUS_25840 38404 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 40583 38418 gene locus_tag LOCUS_25850 40583 38418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 41484 40591 gene locus_tag LOCUS_25860 41484 40591 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_25860 42571 41501 gene locus_tag LOCUS_25870 42571 41501 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_25870 43434 42616 gene locus_tag LOCUS_25880 43434 42616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 46196 43431 gene locus_tag LOCUS_25890 46196 43431 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_25890 47212 46193 gene locus_tag LOCUS_25900 47212 46193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_25900 49527 47209 gene locus_tag LOCUS_25910 49527 47209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 50394 49579 gene locus_tag LOCUS_25920 50394 49579 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_25920 51149 50505 gene locus_tag LOCUS_25930 51149 50505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 51841 51188 gene locus_tag LOCUS_25940 51841 51188 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_25940 52848 51853 gene locus_tag LOCUS_25950 52848 51853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 53852 52845 gene locus_tag LOCUS_25960 gene miaA 53852 52845 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_25960 56110 53882 gene locus_tag LOCUS_25970 56110 53882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 56245 60063 gene locus_tag LOCUS_25980 gene dnaE 56245 60063 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_25980 60075 61490 gene locus_tag LOCUS_25990 60075 61490 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_25990 61466 61550 gene locus_tag LOCUS_t00350 61466 61550 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64678 61487 gene locus_tag LOCUS_26000 64678 61487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence24 9 1022 gene locus_tag LOCUS_26010 9 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1032 2090 gene locus_tag LOCUS_26020 1032 2090 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_26020 2908 2084 gene locus_tag LOCUS_26030 2908 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3651 2905 gene locus_tag LOCUS_26040 3651 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3710 4846 gene locus_tag LOCUS_26050 3710 4846 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_26050 4843 5505 gene locus_tag LOCUS_26060 4843 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 6324 5524 gene locus_tag LOCUS_26070 6324 5524 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_26070 6419 7546 gene locus_tag LOCUS_26080 6419 7546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_26080 8566 7562 gene locus_tag LOCUS_26090 8566 7562 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809293.1 protein_id gnl|my_center|LOCUS_26090 9470 8634 gene locus_tag LOCUS_26100 9470 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 10416 9568 gene locus_tag LOCUS_26110 10416 9568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_26110 11690 10413 gene locus_tag LOCUS_26120 11690 10413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_26120 12827 11709 gene locus_tag LOCUS_26130 12827 11709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_26130 13942 12824 gene locus_tag LOCUS_26140 13942 12824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_26140 15078 13936 gene locus_tag LOCUS_26150 15078 13936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_26150 15128 16840 gene locus_tag LOCUS_26160 gene boxC 15128 16840 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_26160 16850 18328 gene locus_tag LOCUS_26170 gene boxB 16850 18328 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_26170 18351 19436 gene locus_tag LOCUS_26180 18351 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 20035 19454 gene locus_tag LOCUS_26190 gene pdxH 20035 19454 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_26190 21070 20036 gene locus_tag LOCUS_26200 21070 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 21406 21086 gene locus_tag LOCUS_26210 21406 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 22300 21416 gene locus_tag LOCUS_26220 22300 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 23055 22297 gene locus_tag LOCUS_26230 23055 22297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 22951 23907 gene locus_tag LOCUS_26240 22951 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 24009 25046 gene locus_tag LOCUS_26250 gene pheS 24009 25046 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_26250 25046 27589 gene locus_tag LOCUS_26260 gene pheT 25046 27589 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_26260 28343 27618 gene locus_tag LOCUS_26270 28343 27618 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_26270 28420 28911 gene locus_tag LOCUS_26280 28420 28911 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_26280 28923 29345 gene locus_tag LOCUS_26290 28923 29345 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_26290 30592 29342 gene locus_tag LOCUS_26300 gene aroC 30592 29342 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_26300 30492 31400 gene locus_tag LOCUS_26310 gene deoC 30492 31400 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_26310 31420 32925 gene locus_tag LOCUS_26320 31420 32925 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_26320 32922 33800 gene locus_tag LOCUS_26330 32922 33800 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_26330 33895 35187 gene locus_tag LOCUS_26340 33895 35187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 35195 35632 gene locus_tag LOCUS_26350 35195 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 35744 36211 gene locus_tag LOCUS_26360 35744 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 36441 42140 gene locus_tag LOCUS_26370 36441 42140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 42767 42165 gene locus_tag LOCUS_26380 42767 42165 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_26380 44057 42846 gene locus_tag LOCUS_26390 44057 42846 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830450.1 protein_id gnl|my_center|LOCUS_26390 44184 45227 gene locus_tag LOCUS_26400 44184 45227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_26400 45237 46025 gene locus_tag LOCUS_26410 45237 46025 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_26410 46336 46085 gene locus_tag LOCUS_26420 46336 46085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 46797 46333 gene locus_tag LOCUS_26430 46797 46333 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_26430 48144 46807 gene locus_tag LOCUS_26440 gene murA 48144 46807 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_26440 48294 48908 gene locus_tag LOCUS_26450 48294 48908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 48951 49901 gene locus_tag LOCUS_26460 48951 49901 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_26460 49936 50397 gene locus_tag LOCUS_26470 49936 50397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 55046 50424 gene locus_tag LOCUS_26480 55046 50424 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_26480 55125 55430 gene locus_tag LOCUS_26490 55125 55430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 55438 57222 gene locus_tag LOCUS_26500 55438 57222 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_26500 57397 58317 gene locus_tag LOCUS_26510 57397 58317 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_26510 58314 62906 gene locus_tag LOCUS_26520 gene gltB 58314 62906 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_26520 62937 64448 gene locus_tag LOCUS_26530 62937 64448 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence25 2204 24 gene locus_tag LOCUS_26540 2204 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2481 2954 gene locus_tag LOCUS_26550 2481 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2990 3493 gene locus_tag LOCUS_26560 2990 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3596 5011 gene locus_tag LOCUS_26570 gene cysS 3596 5011 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_26570 5020 5436 gene locus_tag LOCUS_26580 5020 5436 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_26580 5536 5610 gene locus_tag LOCUS_t00360 5536 5610 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5653 5727 gene locus_tag LOCUS_t00370 5653 5727 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5751 5838 gene locus_tag LOCUS_t00380 5751 5838 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5897 6142 gene locus_tag LOCUS_26590 5897 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6139 8067 gene locus_tag LOCUS_26600 gene feoB 6139 8067 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_26600 8860 8075 gene locus_tag LOCUS_26610 8860 8075 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_26610 9934 8900 gene locus_tag LOCUS_26620 9934 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 10137 11507 gene locus_tag LOCUS_26630 gene dnaB 10137 11507 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_26630 12010 11468 gene locus_tag LOCUS_26640 12010 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 11915 12727 gene locus_tag LOCUS_26650 11915 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26650 13535 12660 gene locus_tag LOCUS_26660 13535 12660 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_26660 13642 15258 gene locus_tag LOCUS_26670 13642 15258 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_26670 15468 17159 gene locus_tag LOCUS_26680 15468 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 17338 17253 gene locus_tag LOCUS_t00390 17338 17253 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17661 18176 gene locus_tag LOCUS_26690 17661 18176 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_26690 18490 20943 gene locus_tag LOCUS_26700 18490 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 20958 22691 gene locus_tag LOCUS_26710 gene recJ 20958 22691 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_26710 22688 24901 gene locus_tag LOCUS_26720 22688 24901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 24898 25641 gene locus_tag LOCUS_26730 gene lptB 24898 25641 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_26730 25718 27280 gene locus_tag LOCUS_26740 gene rpoN 25718 27280 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 protein_id gnl|my_center|LOCUS_26740 27306 27761 gene locus_tag LOCUS_26750 27306 27761 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_26750 27763 28650 gene locus_tag LOCUS_26760 gene rapZ 27763 28650 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_26760 28647 29078 gene locus_tag LOCUS_26770 28647 29078 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_26770 29075 29344 gene locus_tag LOCUS_26780 29075 29344 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_26780 29341 31110 gene locus_tag LOCUS_26790 gene ptsP 29341 31110 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_26790 31173 32519 gene locus_tag LOCUS_26800 gene miaB 31173 32519 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_26800 32525 33109 gene locus_tag LOCUS_26810 32525 33109 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_26810 33117 33998 gene locus_tag LOCUS_26820 33117 33998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 34071 36506 gene locus_tag LOCUS_26830 34071 36506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 37658 36522 gene locus_tag LOCUS_26840 gene metK 37658 36522 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_26840 37780 38604 gene locus_tag LOCUS_26850 37780 38604 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_26850 39570 38650 gene locus_tag LOCUS_26860 39570 38650 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_26860 40409 39579 gene locus_tag LOCUS_26870 40409 39579 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_26870 40454 41260 gene locus_tag LOCUS_26880 gene tolQ 40454 41260 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_26880 41283 41702 gene locus_tag LOCUS_26890 gene tolR 41283 41702 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_26890 41717 42490 gene locus_tag LOCUS_26900 41717 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 42507 43889 gene locus_tag LOCUS_26910 gene tolB 42507 43889 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_26910 44001 44579 gene locus_tag LOCUS_26920 44001 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 44717 45439 gene locus_tag LOCUS_26930 gene ybgF 44717 45439 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 protein_id gnl|my_center|LOCUS_26930 45518 45817 gene locus_tag LOCUS_26940 gene rpsT 45518 45817 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_26940 46388 45837 gene locus_tag LOCUS_26950 46388 45837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 46910 46410 gene locus_tag LOCUS_26960 gene nusB 46910 46410 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_26960 47374 46907 gene locus_tag LOCUS_26970 gene ribE 47374 46907 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_26970 47472 47396 gene locus_tag LOCUS_t00400 47472 47396 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48068 47565 gene locus_tag LOCUS_26980 48068 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 49476 48139 gene locus_tag LOCUS_26990 gene der 49476 48139 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_26990 49946 49497 gene locus_tag LOCUS_27000 49946 49497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 50086 50172 gene locus_tag LOCUS_t00410 50086 50172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 50753 50181 gene locus_tag LOCUS_27010 gene rsmD 50753 50181 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_27010 52465 50750 gene locus_tag LOCUS_27020 52465 50750 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_27020 54258 52465 gene locus_tag LOCUS_27030 54258 52465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 55874 54336 gene locus_tag LOCUS_27040 gene ahcY 55874 54336 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_27040 56955 55927 gene locus_tag LOCUS_27050 56955 55927 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_27050 57840 56956 gene locus_tag LOCUS_27060 57840 56956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 57861 59645 gene locus_tag LOCUS_27070 57861 59645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 60631 59642 gene locus_tag LOCUS_27080 60631 59642 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970486.1 protein_id gnl|my_center|LOCUS_27080 61663 60740 gene locus_tag LOCUS_27090 61663 60740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061838.1 protein_id gnl|my_center|LOCUS_27090 62424 61690 gene locus_tag LOCUS_27100 62424 61690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083940.1 protein_id gnl|my_center|LOCUS_27100 63830 62442 gene locus_tag LOCUS_27110 63830 62442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence26 1902 1525 gene locus_tag LOCUS_27120 1902 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3726 1936 gene locus_tag LOCUS_27130 3726 1936 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_27130 3774 4637 gene locus_tag LOCUS_27140 3774 4637 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_27140 4634 5479 gene locus_tag LOCUS_27150 4634 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6378 5485 gene locus_tag LOCUS_27160 6378 5485 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 protein_id gnl|my_center|LOCUS_27160 6395 7237 gene locus_tag LOCUS_27170 6395 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 7188 8987 gene locus_tag LOCUS_27180 7188 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9009 9470 gene locus_tag LOCUS_27190 9009 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 9482 9970 gene locus_tag LOCUS_27200 9482 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 10031 11119 gene locus_tag LOCUS_27210 10031 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 11291 12523 gene locus_tag LOCUS_27220 11291 12523 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_27220 14492 12579 gene locus_tag LOCUS_27230 14492 12579 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_27230 14493 15131 gene locus_tag LOCUS_27240 14493 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 15128 16768 gene locus_tag LOCUS_27250 15128 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 16822 18450 gene locus_tag LOCUS_27260 16822 18450 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_27260 18560 18769 gene locus_tag LOCUS_27270 18560 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 19775 18780 gene locus_tag LOCUS_27280 19775 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 21481 19889 gene locus_tag LOCUS_27290 21481 19889 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_27290 22894 21599 gene locus_tag LOCUS_27300 22894 21599 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_27300 23785 22940 gene locus_tag LOCUS_27310 23785 22940 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_27310 24857 23790 gene locus_tag LOCUS_27320 24857 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 25004 25240 gene locus_tag LOCUS_27330 25004 25240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 25386 26066 gene locus_tag LOCUS_27340 25386 26066 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_27340 26098 27234 gene locus_tag LOCUS_27350 26098 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 29409 27202 gene locus_tag LOCUS_27360 29409 27202 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368591.1 protein_id gnl|my_center|LOCUS_27360 29561 30691 gene locus_tag LOCUS_27370 29561 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 32306 31350 gene locus_tag LOCUS_27380 32306 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 32800 32357 gene locus_tag LOCUS_27390 32800 32357 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 protein_id gnl|my_center|LOCUS_27390 33455 32793 gene locus_tag LOCUS_27400 33455 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 33945 33466 gene locus_tag LOCUS_27410 33945 33466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 35087 33999 gene locus_tag LOCUS_27420 35087 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 35403 35155 gene locus_tag LOCUS_27430 35403 35155 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_27430 36614 35406 gene locus_tag LOCUS_27440 36614 35406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_27440 39412 36611 gene locus_tag LOCUS_27450 39412 36611 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_27450 39444 40214 gene locus_tag LOCUS_27460 gene fabG 39444 40214 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_27460 40207 41448 gene locus_tag LOCUS_27470 gene fabF 40207 41448 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_27470 42013 43887 gene locus_tag LOCUS_27480 42013 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27480 44324 44423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44426 50830 gene locus_tag LOCUS_27490 44426 50830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27490 50988 52145 gene locus_tag LOCUS_27500 50988 52145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 55373 52164 gene locus_tag LOCUS_27510 55373 52164 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_27510 55998 55381 gene locus_tag LOCUS_27520 55998 55381 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_27520 56660 55995 gene locus_tag LOCUS_27530 56660 55995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_27530 56960 59227 gene locus_tag LOCUS_27540 56960 59227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 59475 59224 gene locus_tag LOCUS_27550 59475 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 60369 59482 gene locus_tag LOCUS_27560 60369 59482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 61970 60516 gene locus_tag LOCUS_27570 61970 60516 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419754.1 protein_id gnl|my_center|LOCUS_27570 63381 62044 gene locus_tag LOCUS_27580 63381 62044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence27 <1 889 gene locus_tag LOCUS_27590 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392123.1:molecular chaperone DnaJ 918 1604 gene locus_tag LOCUS_27600 918 1604 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_27600 1638 2162 gene locus_tag LOCUS_27610 1638 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2156 4789 gene locus_tag LOCUS_27620 gene alaS 2156 4789 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_27620 4804 5418 gene locus_tag LOCUS_27630 gene pgsA 4804 5418 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_27630 5474 8077 gene locus_tag LOCUS_27640 5474 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 8077 9390 gene locus_tag LOCUS_27650 gene ffh 8077 9390 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_27650 9473 9727 gene locus_tag LOCUS_27660 gene rpsP 9473 9727 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_27660 9742 9987 gene locus_tag LOCUS_27670 9742 9987 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880022.1 protein_id gnl|my_center|LOCUS_27670 10049 10576 gene locus_tag LOCUS_27680 gene rimM 10049 10576 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_27680 10558 11280 gene locus_tag LOCUS_27690 gene trmD 10558 11280 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_27690 11328 11675 gene locus_tag LOCUS_27700 gene rplS 11328 11675 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_27700 11717 12340 gene locus_tag LOCUS_27710 11717 12340 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_27710 12367 13455 gene locus_tag LOCUS_27720 12367 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 15346 13472 gene locus_tag LOCUS_27730 15346 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 15345 16547 gene locus_tag LOCUS_27740 15345 16547 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940481.1 protein_id gnl|my_center|LOCUS_27740 16544 17674 gene locus_tag LOCUS_27750 16544 17674 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_27750 17737 18369 gene locus_tag LOCUS_27760 17737 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 18362 20491 gene locus_tag LOCUS_27770 18362 20491 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 protein_id gnl|my_center|LOCUS_27770 20491 21465 gene locus_tag LOCUS_27780 20491 21465 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_27780 21470 21745 gene locus_tag LOCUS_27790 21470 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 21742 22416 gene locus_tag LOCUS_27800 21742 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 22452 22799 gene locus_tag LOCUS_27810 22452 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 23343 22876 gene locus_tag LOCUS_27820 23343 22876 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_27820 23399 24661 gene locus_tag LOCUS_27830 gene icd 23399 24661 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_27830 24675 25865 gene locus_tag LOCUS_27840 gene sucC 24675 25865 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403880.1 protein_id gnl|my_center|LOCUS_27840 25870 26739 gene locus_tag LOCUS_27850 gene sucD 25870 26739 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_27850 26745 27182 gene locus_tag LOCUS_27860 26745 27182 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_27860 28786 27179 gene locus_tag LOCUS_27870 28786 27179 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_27870 29565 28783 gene locus_tag LOCUS_27880 29565 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 29771 31162 gene locus_tag LOCUS_27890 29771 31162 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_27890 31575 32015 gene locus_tag LOCUS_27900 31575 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 32012 33358 gene locus_tag LOCUS_27910 32012 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 33466 36465 gene locus_tag LOCUS_27920 33466 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 36812 36504 gene locus_tag LOCUS_27930 36812 36504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 38034 36799 gene locus_tag LOCUS_27940 gene tyrS 38034 36799 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 protein_id gnl|my_center|LOCUS_27940 38882 38058 gene locus_tag LOCUS_27950 gene dapF 38882 38058 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_27950 39130 38879 gene locus_tag LOCUS_27960 39130 38879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 40493 39120 gene locus_tag LOCUS_27970 gene hslU 40493 39120 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_27970 41038 40490 gene locus_tag LOCUS_27980 gene hslV 41038 40490 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_27980 41902 41090 gene locus_tag LOCUS_27990 41902 41090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 42911 41937 gene locus_tag LOCUS_28000 gene xerC 42911 41937 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_28000 44239 42845 gene locus_tag LOCUS_28010 gene trmFO 44239 42845 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_28010 44327 47002 gene locus_tag LOCUS_28020 gene topA 44327 47002 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_28020 48182 47013 gene locus_tag LOCUS_28030 gene dprA 48182 47013 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_28030 48272 48757 gene locus_tag LOCUS_28040 48272 48757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 48830 49558 gene locus_tag LOCUS_28050 48830 49558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 49568 52480 gene locus_tag LOCUS_28060 49568 52480 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_28060 52488 53366 gene locus_tag LOCUS_28070 52488 53366 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_28070 53388 53654 gene locus_tag LOCUS_28080 gene purS 53388 53654 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975653.1 protein_id gnl|my_center|LOCUS_28080 53651 54577 gene locus_tag LOCUS_28090 53651 54577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 54272 54281 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54583 56835 gene locus_tag LOCUS_28100 gene purL 54583 56835 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_28100 56842 58245 gene locus_tag LOCUS_28110 gene purF 56842 58245 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_28110 58242 59288 gene locus_tag LOCUS_28120 gene purM 58242 59288 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_28120 59285 59926 gene locus_tag LOCUS_28130 gene purN 59285 59926 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583769.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence28 1705 146 gene locus_tag LOCUS_28140 1705 146 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_28140 4484 1719 gene locus_tag LOCUS_28150 4484 1719 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_28150 5443 4643 gene locus_tag LOCUS_28160 5443 4643 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390144.1 protein_id gnl|my_center|LOCUS_28160 5469 5897 gene locus_tag LOCUS_28170 5469 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 6132 5887 gene locus_tag LOCUS_28180 6132 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6763 6278 gene locus_tag LOCUS_28190 6763 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6892 8253 gene locus_tag LOCUS_28200 6892 8253 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_28200 10813 8237 gene locus_tag LOCUS_28210 10813 8237 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_28210 12244 10880 gene locus_tag LOCUS_28220 12244 10880 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_28220 13821 12244 gene locus_tag LOCUS_28230 13821 12244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_28230 14846 13818 gene locus_tag LOCUS_28240 14846 13818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_28240 15919 14843 gene locus_tag LOCUS_28250 15919 14843 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_28250 17815 15923 gene locus_tag LOCUS_28260 17815 15923 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_28260 17827 19197 gene locus_tag LOCUS_28270 17827 19197 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_28270 20408 19194 gene locus_tag LOCUS_28280 20408 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 21483 20425 gene locus_tag LOCUS_28290 21483 20425 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_28290 24618 21664 gene locus_tag LOCUS_28300 24618 21664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 24748 25797 gene locus_tag LOCUS_28310 24748 25797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 25794 26570 gene locus_tag LOCUS_28320 25794 26570 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_28320 26576 29395 gene locus_tag LOCUS_28330 26576 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 29429 32011 gene locus_tag LOCUS_28340 29429 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 32620 31991 gene locus_tag LOCUS_28350 32620 31991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 32767 33498 gene locus_tag LOCUS_28360 32767 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 33520 34488 gene locus_tag LOCUS_28370 33520 34488 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_28370 34510 35418 gene locus_tag LOCUS_28380 34510 35418 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_28380 35415 36443 gene locus_tag LOCUS_28390 35415 36443 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_28390 36436 37206 gene locus_tag LOCUS_28400 36436 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 38072 37260 gene locus_tag LOCUS_28410 38072 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 38146 39045 gene locus_tag LOCUS_28420 38146 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 40566 39223 gene locus_tag LOCUS_28430 40566 39223 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_28430 41548 40577 gene locus_tag LOCUS_28440 41548 40577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 41627 42679 gene locus_tag LOCUS_28450 41627 42679 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_28450 42700 43926 gene locus_tag LOCUS_28460 42700 43926 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_28460 43923 45365 gene locus_tag LOCUS_28470 43923 45365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 45398 46513 gene locus_tag LOCUS_28480 45398 46513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 47718 46510 gene locus_tag LOCUS_28490 47718 46510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 48965 47817 gene locus_tag LOCUS_28500 48965 47817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 49869 49033 gene locus_tag LOCUS_28510 49869 49033 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_28510 51763 49994 gene locus_tag LOCUS_28520 51763 49994 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_28520 54846 51760 gene locus_tag LOCUS_28530 54846 51760 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_28530 56389 54857 gene locus_tag LOCUS_28540 56389 54857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 57720 56521 gene locus_tag LOCUS_28550 57720 56521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 58292 57783 gene locus_tag LOCUS_28560 58292 57783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 58237 58470 gene locus_tag LOCUS_28570 58237 58470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence29 1581 247 gene locus_tag LOCUS_28580 1581 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2488 1565 gene locus_tag LOCUS_28590 2488 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2884 2516 gene locus_tag LOCUS_28600 2884 2516 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_28600 3630 3067 gene locus_tag LOCUS_28610 3630 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 4045 3587 gene locus_tag LOCUS_28620 4045 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4153 4365 gene locus_tag LOCUS_28630 4153 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 5514 4393 gene locus_tag LOCUS_28640 5514 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 5584 6450 gene locus_tag LOCUS_28650 5584 6450 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_28650 6434 7855 gene locus_tag LOCUS_28660 6434 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 10291 7796 gene locus_tag LOCUS_28670 10291 7796 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_28670 10338 13835 gene locus_tag LOCUS_28680 10338 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 14244 13903 gene locus_tag LOCUS_28690 14244 13903 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_28690 15600 14263 gene locus_tag LOCUS_28700 15600 14263 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_28700 17905 15908 gene locus_tag LOCUS_28710 gene tynA 17905 15908 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705615.1 protein_id gnl|my_center|LOCUS_28710 19969 17984 gene locus_tag LOCUS_28720 gene tynA 19969 17984 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705615.1 protein_id gnl|my_center|LOCUS_28720 20082 21023 gene locus_tag LOCUS_28730 20082 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 21043 21546 gene locus_tag LOCUS_28740 21043 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 22628 21552 gene locus_tag LOCUS_28750 22628 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_28750 22774 23955 gene locus_tag LOCUS_28760 22774 23955 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_28760 25268 23991 gene locus_tag LOCUS_28770 25268 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 25537 26769 gene locus_tag LOCUS_28780 25537 26769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_28780 28814 26766 gene locus_tag LOCUS_28790 28814 26766 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_28790 29746 28820 gene locus_tag LOCUS_28800 29746 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 30746 29766 gene locus_tag LOCUS_28810 30746 29766 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_28810 32364 30784 gene locus_tag LOCUS_28820 32364 30784 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_28820 32489 33805 gene locus_tag LOCUS_28830 32489 33805 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_28830 33802 34224 gene locus_tag LOCUS_28840 33802 34224 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243290.1 protein_id gnl|my_center|LOCUS_28840 35461 34196 gene locus_tag LOCUS_28850 35461 34196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 37363 35543 gene locus_tag LOCUS_28860 37363 35543 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_28860 37531 38862 gene locus_tag LOCUS_28870 37531 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 38873 39544 gene locus_tag LOCUS_28880 38873 39544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 40812 39541 gene locus_tag LOCUS_28890 40812 39541 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995765.1 protein_id gnl|my_center|LOCUS_28890 42429 40834 gene locus_tag LOCUS_28900 42429 40834 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_28900 42584 43174 gene locus_tag LOCUS_28910 42584 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 43741 43184 gene locus_tag LOCUS_28920 43741 43184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 43646 43921 gene locus_tag LOCUS_28930 43646 43921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 46230 44140 gene locus_tag LOCUS_28940 46230 44140 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_28940 47085 46288 gene locus_tag LOCUS_28950 47085 46288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence30 <1 964 gene locus_tag LOCUS_28960 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994093.1:nucleoside hydrolase 2144 915 gene locus_tag LOCUS_28970 2144 915 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_28970 3087 2137 gene locus_tag LOCUS_28980 3087 2137 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_28980 4582 3095 gene locus_tag LOCUS_28990 4582 3095 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_28990 5190 4582 gene locus_tag LOCUS_29000 5190 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 5262 7049 gene locus_tag LOCUS_29010 5262 7049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_29010 7046 8914 gene locus_tag LOCUS_29020 7046 8914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_29020 8922 10679 gene locus_tag LOCUS_29030 8922 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 13347 10693 gene locus_tag LOCUS_29040 13347 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 13467 13733 gene locus_tag LOCUS_29050 13467 13733 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_29050 13746 14144 gene locus_tag LOCUS_29060 13746 14144 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_29060 14679 14155 gene locus_tag LOCUS_29070 14679 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 16864 14708 gene locus_tag LOCUS_29080 16864 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 18297 16927 gene locus_tag LOCUS_29090 18297 16927 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_29090 21699 18313 gene locus_tag LOCUS_29100 21699 18313 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_29100 21831 23471 gene locus_tag LOCUS_29110 gene aceB 21831 23471 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_29110 23527 24828 gene locus_tag LOCUS_29120 gene glcF 23527 24828 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_29120 24797 25897 gene locus_tag LOCUS_29130 gene gap 24797 25897 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057792.1 protein_id gnl|my_center|LOCUS_29130 25894 26910 gene locus_tag LOCUS_29140 gene gap 25894 26910 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403953.1 protein_id gnl|my_center|LOCUS_29140 26936 28387 gene locus_tag LOCUS_29150 gene pyk 26936 28387 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_29150 28418 29596 gene locus_tag LOCUS_29160 28418 29596 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_29160 30414 29836 gene locus_tag LOCUS_29170 30414 29836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 31598 30750 gene locus_tag LOCUS_29180 31598 30750 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_29180 34008 31663 gene locus_tag LOCUS_29190 34008 31663 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_29190 34477 34010 gene locus_tag LOCUS_29200 34477 34010 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_29200 35129 34497 gene locus_tag LOCUS_29210 35129 34497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 36242 35241 gene locus_tag LOCUS_29220 36242 35241 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_29220 36558 36343 gene locus_tag LOCUS_29230 36558 36343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 36858 36580 gene locus_tag LOCUS_29240 36858 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 36970 38427 gene locus_tag LOCUS_29250 36970 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 38448 39017 gene locus_tag LOCUS_29260 38448 39017 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_29260 39176 40534 gene locus_tag LOCUS_29270 39176 40534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 40631 42028 gene locus_tag LOCUS_29280 40631 42028 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_29280 42066 43241 gene locus_tag LOCUS_29290 42066 43241 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_29290 44709 43327 gene locus_tag LOCUS_29300 44709 43327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 46173 44800 gene locus_tag LOCUS_29310 46173 44800 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence31 1506 508 gene locus_tag LOCUS_29320 1506 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2818 1538 gene locus_tag LOCUS_29330 2818 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3879 2860 gene locus_tag LOCUS_29340 3879 2860 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_29340 4871 3879 gene locus_tag LOCUS_29350 4871 3879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_29350 6640 4877 gene locus_tag LOCUS_29360 6640 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 7541 6645 gene locus_tag LOCUS_29370 7541 6645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_29370 8499 7549 gene locus_tag LOCUS_29380 8499 7549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_29380 8498 10537 gene locus_tag LOCUS_29390 8498 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 10545 12584 gene locus_tag LOCUS_29400 10545 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 12637 13389 gene locus_tag LOCUS_29410 12637 13389 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_29410 13531 15744 gene locus_tag LOCUS_29420 13531 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 15803 17791 gene locus_tag LOCUS_29430 15803 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 17821 19878 gene locus_tag LOCUS_29440 17821 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 19894 21483 gene locus_tag LOCUS_29450 19894 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 22495 21515 gene locus_tag LOCUS_29460 22495 21515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 22610 24712 gene locus_tag LOCUS_29470 22610 24712 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_29470 25774 24740 gene locus_tag LOCUS_29480 25774 24740 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_29480 27741 25816 gene locus_tag LOCUS_29490 27741 25816 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_29490 29727 27751 gene locus_tag LOCUS_29500 29727 27751 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_29500 30296 29811 gene locus_tag LOCUS_29510 30296 29811 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 protein_id gnl|my_center|LOCUS_29510 30778 30293 gene locus_tag LOCUS_29520 30778 30293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 31599 30811 gene locus_tag LOCUS_29530 31599 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 32078 31614 gene locus_tag LOCUS_29540 32078 31614 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111846.1 protein_id gnl|my_center|LOCUS_29540 32609 32091 gene locus_tag LOCUS_29550 32609 32091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 34323 32626 gene locus_tag LOCUS_29560 gene hflX 34323 32626 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_29560 34746 36710 gene locus_tag LOCUS_29570 34746 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 37207 39471 gene locus_tag LOCUS_29580 37207 39471 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_29580 39610 41685 gene locus_tag LOCUS_29590 39610 41685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 42808 41693 gene locus_tag LOCUS_29600 42808 41693 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_29600 42943 44703 gene locus_tag LOCUS_29610 42943 44703 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_29610 44703 45536 gene locus_tag LOCUS_29620 44703 45536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence32 1760 552 gene locus_tag LOCUS_29630 gene lhgO 1760 552 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_29630 2976 1768 gene locus_tag LOCUS_29640 gene pheA 2976 1768 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_29640 4138 3089 gene locus_tag LOCUS_29650 4138 3089 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_29650 5151 4135 gene locus_tag LOCUS_29660 5151 4135 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_29660 5589 6866 gene locus_tag LOCUS_29670 5589 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 7970 6843 gene locus_tag LOCUS_29680 7970 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 8044 8424 gene locus_tag LOCUS_29690 8044 8424 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 protein_id gnl|my_center|LOCUS_29690 8545 10170 gene locus_tag LOCUS_29700 gene pruA 8545 10170 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_29700 10186 10467 gene locus_tag LOCUS_29710 10186 10467 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_29710 10482 10787 gene locus_tag LOCUS_29720 10482 10787 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_29720 13074 11647 gene locus_tag LOCUS_29730 13074 11647 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_29730 13300 15180 gene locus_tag LOCUS_29740 13300 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 15236 16426 gene locus_tag LOCUS_29750 gene rocD 15236 16426 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_29750 16423 16959 gene locus_tag LOCUS_29760 16423 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 16995 17825 gene locus_tag LOCUS_29770 16995 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 17876 18814 gene locus_tag LOCUS_29780 17876 18814 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_29780 18814 19587 gene locus_tag LOCUS_29790 18814 19587 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249272.1 protein_id gnl|my_center|LOCUS_29790 19677 21122 gene locus_tag LOCUS_29800 19677 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 21248 22687 gene locus_tag LOCUS_29810 21248 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 22754 23023 gene locus_tag LOCUS_29820 22754 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 23113 24627 gene locus_tag LOCUS_29830 23113 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 24837 24846 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24992 27643 gene locus_tag LOCUS_29840 24992 27643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 26375 26282 gene locus_tag LOCUS_t00420 26375 26282 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27751 28014 gene locus_tag LOCUS_29850 27751 28014 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_29850 28011 28397 gene locus_tag LOCUS_29860 28011 28397 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_29860 29412 28579 gene locus_tag LOCUS_29870 29412 28579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 29529 30983 gene locus_tag LOCUS_29880 29529 30983 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_29880 30990 31868 gene locus_tag LOCUS_29890 30990 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 31870 32538 gene locus_tag LOCUS_29900 31870 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 32541 33701 gene locus_tag LOCUS_29910 gene ispB 32541 33701 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_29910 33698 34459 gene locus_tag LOCUS_29920 gene ubiE 33698 34459 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_29920 34456 35964 gene locus_tag LOCUS_29930 34456 35964 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554846.1 protein_id gnl|my_center|LOCUS_29930 35955 37775 gene locus_tag LOCUS_29940 gene menD 35955 37775 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_29940 37772 38545 gene locus_tag LOCUS_29950 gene menH 37772 38545 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_29950 38592 39440 gene locus_tag LOCUS_29960 gene menB 38592 39440 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_29960 39437 40360 gene locus_tag LOCUS_29970 39437 40360 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_29970 40387 41793 gene locus_tag LOCUS_29980 40387 41793 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence33 886 2442 gene locus_tag LOCUS_29990 886 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 2426 4057 gene locus_tag LOCUS_30000 2426 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4681 4316 gene locus_tag LOCUS_30010 4681 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 5374 4697 gene locus_tag LOCUS_30020 5374 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 6363 5371 gene locus_tag LOCUS_30030 6363 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 7448 6441 gene locus_tag LOCUS_30040 7448 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 7447 9567 gene locus_tag LOCUS_30050 7447 9567 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_30050 9595 10410 gene locus_tag LOCUS_30060 9595 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 10425 11492 gene locus_tag LOCUS_30070 10425 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 12206 11613 gene locus_tag LOCUS_30080 12206 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 12226 12783 gene locus_tag LOCUS_30090 12226 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 12669 15329 gene locus_tag LOCUS_30100 12669 15329 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30100 15393 15980 gene locus_tag LOCUS_30110 15393 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 15980 16987 gene locus_tag LOCUS_30120 15980 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 16971 18047 gene locus_tag LOCUS_30130 16971 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 18066 19616 gene locus_tag LOCUS_30140 18066 19616 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 protein_id gnl|my_center|LOCUS_30140 20334 19636 gene locus_tag LOCUS_30150 20334 19636 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_30150 20422 21513 gene locus_tag LOCUS_30160 20422 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 22681 21515 gene locus_tag LOCUS_30170 22681 21515 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_30170 23365 22802 gene locus_tag LOCUS_30180 23365 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 23747 23756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23766 25562 gene locus_tag LOCUS_30190 23766 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 26085 25570 gene locus_tag LOCUS_30200 26085 25570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 26445 26104 gene locus_tag LOCUS_30210 26445 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 27797 26502 gene locus_tag LOCUS_30220 27797 26502 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_30220 27869 29839 gene locus_tag LOCUS_30230 27869 29839 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491174.1 protein_id gnl|my_center|LOCUS_30230 29865 30986 gene locus_tag LOCUS_30240 29865 30986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 30977 33625 gene locus_tag LOCUS_30250 30977 33625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 34453 33635 gene locus_tag LOCUS_30260 34453 33635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 38039 34482 gene locus_tag LOCUS_30270 38039 34482 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_30270 38800 38096 gene locus_tag LOCUS_30280 38800 38096 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_30280 39638 38802 gene locus_tag LOCUS_30290 39638 38802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence34 1410 196 gene locus_tag LOCUS_30300 gene larC 1410 196 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_30300 2140 1421 gene locus_tag LOCUS_30310 gene radC 2140 1421 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_30310 2326 3228 gene locus_tag LOCUS_30320 gene speB 2326 3228 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_30320 4754 3234 gene locus_tag LOCUS_30330 4754 3234 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_30330 6478 4772 gene locus_tag LOCUS_30340 6478 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 7537 6494 gene locus_tag LOCUS_30350 7537 6494 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_30350 7795 9603 gene locus_tag LOCUS_30360 7795 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 9668 10687 gene locus_tag LOCUS_30370 9668 10687 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_30370 10694 11974 gene locus_tag LOCUS_30380 10694 11974 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_30380 11971 12711 gene locus_tag LOCUS_30390 11971 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 13760 12687 gene locus_tag LOCUS_30400 13760 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 14470 13772 gene locus_tag LOCUS_30410 14470 13772 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_30410 15699 14467 gene locus_tag LOCUS_30420 gene coaBC 15699 14467 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_30420 15984 15712 gene locus_tag LOCUS_30430 15984 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 16660 15962 gene locus_tag LOCUS_30440 gene gmk 16660 15962 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_30440 17540 16671 gene locus_tag LOCUS_30450 17540 16671 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_30450 18673 17546 gene locus_tag LOCUS_30460 gene lpxB 18673 17546 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_30460 18944 18747 gene locus_tag LOCUS_30470 18944 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 19362 18949 gene locus_tag LOCUS_30480 19362 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 19748 19425 gene locus_tag LOCUS_30490 19748 19425 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_30490 21842 19779 gene locus_tag LOCUS_30500 21842 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 23154 22051 gene locus_tag LOCUS_30510 gene queG 23154 22051 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 protein_id gnl|my_center|LOCUS_30510 23657 23151 gene locus_tag LOCUS_30520 23657 23151 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243065.1 protein_id gnl|my_center|LOCUS_30520 24517 23678 gene locus_tag LOCUS_30530 24517 23678 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_30530 25916 24588 gene locus_tag LOCUS_30540 25916 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 26878 25913 gene locus_tag LOCUS_30550 26878 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 28113 26875 gene locus_tag LOCUS_30560 28113 26875 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144295.1 protein_id gnl|my_center|LOCUS_30560 29237 28110 gene locus_tag LOCUS_30570 29237 28110 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_30570 29538 29245 gene locus_tag LOCUS_30580 29538 29245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 31028 29589 gene locus_tag LOCUS_30590 31028 29589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 31568 33079 gene locus_tag LOCUS_30600 31568 33079 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_30600 33152 34066 gene locus_tag LOCUS_30610 33152 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 34229 37054 gene locus_tag LOCUS_30620 gene secA 34229 37054 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_30620 37128 38609 gene locus_tag LOCUS_30630 gene guaB 37128 38609 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256512.1 protein_id gnl|my_center|LOCUS_30630 39882 38656 gene locus_tag LOCUS_30640 39882 38656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 40234 39905 gene locus_tag LOCUS_30650 gene trxA 40234 39905 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_30650 <41001 40262 gene locus_tag LOCUS_30660 <41001 40262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704642.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence35 1689 403 gene locus_tag LOCUS_30670 gene hisS 1689 403 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_30670 1755 2888 gene locus_tag LOCUS_30680 1755 2888 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_30680 6477 2896 gene locus_tag LOCUS_30690 6477 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 9797 6474 gene locus_tag LOCUS_30700 9797 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 11218 9794 gene locus_tag LOCUS_30710 11218 9794 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_30710 11604 11221 gene locus_tag LOCUS_30720 11604 11221 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_30720 11786 11649 gene locus_tag LOCUS_30730 11786 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 12657 11800 gene locus_tag LOCUS_30740 12657 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 12703 14214 gene locus_tag LOCUS_30750 12703 14214 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_30750 14243 15010 gene locus_tag LOCUS_30760 14243 15010 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_30760 16633 15152 gene locus_tag LOCUS_30770 16633 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 16850 17836 gene locus_tag LOCUS_30780 16850 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 17833 21366 gene locus_tag LOCUS_30790 17833 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 21363 22436 gene locus_tag LOCUS_30800 21363 22436 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_30800 22462 25644 gene locus_tag LOCUS_30810 22462 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 25658 30475 gene locus_tag LOCUS_30820 25658 30475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 30472 31149 gene locus_tag LOCUS_30830 30472 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 31243 31536 gene locus_tag LOCUS_30840 31243 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 31529 31918 gene locus_tag LOCUS_30850 31529 31918 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_30850 33009 31933 gene locus_tag LOCUS_30860 33009 31933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 33570 33094 gene locus_tag LOCUS_30870 33570 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 33700 34932 gene locus_tag LOCUS_30880 33700 34932 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_30880 34995 35822 gene locus_tag LOCUS_30890 34995 35822 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911100.1 protein_id gnl|my_center|LOCUS_30890 35829 37235 gene locus_tag LOCUS_30900 35829 37235 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_30900 37648 38175 gene locus_tag LOCUS_30910 37648 38175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 <40497 38274 gene locus_tag LOCUS_30920 <40497 38274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973799.1:nitric oxide reductase activation protein NorD >Feature sequence36 24 1730 gene locus_tag LOCUS_30930 24 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1743 3938 gene locus_tag LOCUS_30940 1743 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 3935 5713 gene locus_tag LOCUS_30950 3935 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 5710 7725 gene locus_tag LOCUS_30960 5710 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 9464 8196 gene locus_tag LOCUS_30970 9464 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 9966 9499 gene locus_tag LOCUS_30980 9966 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 10209 9970 gene locus_tag LOCUS_30990 10209 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 11134 10295 gene locus_tag LOCUS_31000 11134 10295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974754.1 protein_id gnl|my_center|LOCUS_31000 12012 11146 gene locus_tag LOCUS_31010 12012 11146 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_31010 13291 12005 gene locus_tag LOCUS_31020 13291 12005 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_31020 13354 14118 gene locus_tag LOCUS_31030 13354 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 14909 14115 gene locus_tag LOCUS_31040 14909 14115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_31040 16123 14924 gene locus_tag LOCUS_31050 16123 14924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_31050 17245 16202 gene locus_tag LOCUS_31060 17245 16202 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_31060 18127 17249 gene locus_tag LOCUS_31070 18127 17249 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_31070 20087 18138 gene locus_tag LOCUS_31080 20087 18138 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_31080 20935 20084 gene locus_tag LOCUS_31090 20935 20084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_31090 20993 22252 gene locus_tag LOCUS_31100 20993 22252 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_31100 22261 24117 gene locus_tag LOCUS_31110 22261 24117 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_31110 24262 25272 gene locus_tag LOCUS_31120 24262 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 25269 26708 gene locus_tag LOCUS_31130 25269 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 28393 27098 gene locus_tag LOCUS_31140 28393 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 29060 28440 gene locus_tag LOCUS_31150 gene sigR 29060 28440 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_31150 29126 29135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29805 29485 gene locus_tag LOCUS_31160 29805 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 30544 29822 gene locus_tag LOCUS_31170 gene atpB 30544 29822 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_31170 31097 30666 gene locus_tag LOCUS_31180 31097 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 31308 31078 gene locus_tag LOCUS_31190 31308 31078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 31914 31354 gene locus_tag LOCUS_31200 31914 31354 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_31200 32490 31921 gene locus_tag LOCUS_31210 32490 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 32714 35146 gene locus_tag LOCUS_31220 32714 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 35331 35222 gene locus_tag LOCUS_r00010 35331 35222 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 38483 35477 gene locus_tag LOCUS_r00020 38483 35477 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 38787 38712 gene locus_tag LOCUS_t00430 38787 38712 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38897 38821 gene locus_tag LOCUS_t00440 38897 38821 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 141 1949 gene locus_tag LOCUS_31230 141 1949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_31230 4680 1975 gene locus_tag LOCUS_31240 4680 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4764 6494 gene locus_tag LOCUS_31250 4764 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 6533 7339 gene locus_tag LOCUS_31260 6533 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 8928 7387 gene locus_tag LOCUS_31270 8928 7387 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_31270 10177 8933 gene locus_tag LOCUS_31280 10177 8933 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_31280 11367 10174 gene locus_tag LOCUS_31290 11367 10174 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_31290 12263 11364 gene locus_tag LOCUS_31300 12263 11364 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_31300 13354 12272 gene locus_tag LOCUS_31310 gene argC 13354 12272 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_31310 14241 13351 gene locus_tag LOCUS_31320 gene lysX 14241 13351 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_31320 14441 14256 gene locus_tag LOCUS_31330 gene lysW 14441 14256 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_31330 15100 14690 gene locus_tag LOCUS_31340 15100 14690 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_31340 15687 15106 gene locus_tag LOCUS_31350 15687 15106 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_31350 17473 15677 gene locus_tag LOCUS_31360 17473 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 18213 17494 gene locus_tag LOCUS_31370 18213 17494 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274445.1 protein_id gnl|my_center|LOCUS_31370 18320 18943 gene locus_tag LOCUS_31380 18320 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 18960 19412 gene locus_tag LOCUS_31390 18960 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 19517 20839 gene locus_tag LOCUS_31400 19517 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 20923 23373 gene locus_tag LOCUS_31410 20923 23373 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_31410 23376 24644 gene locus_tag LOCUS_31420 23376 24644 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_31420 25975 24677 gene locus_tag LOCUS_31430 gene rifK 25975 24677 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_31430 26908 25985 gene locus_tag LOCUS_31440 gene rbsK 26908 25985 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 protein_id gnl|my_center|LOCUS_31440 28193 26913 gene locus_tag LOCUS_31450 28193 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 29066 28212 gene locus_tag LOCUS_31460 29066 28212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_31460 29823 29155 gene locus_tag LOCUS_31470 29823 29155 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_31470 30205 29852 gene locus_tag LOCUS_31480 30205 29852 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_31480 31706 30261 gene locus_tag LOCUS_31490 31706 30261 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_31490 33021 31777 gene locus_tag LOCUS_31500 33021 31777 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_31500 33614 33024 gene locus_tag LOCUS_31510 33614 33024 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence38 1868 2956 gene locus_tag LOCUS_31520 1868 2956 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_31520 2953 4728 gene locus_tag LOCUS_31530 2953 4728 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_31530 4805 5482 gene locus_tag LOCUS_31540 4805 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 5512 5883 gene locus_tag LOCUS_31550 5512 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 7224 5890 gene locus_tag LOCUS_31560 7224 5890 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_31560 7280 9289 gene locus_tag LOCUS_31570 7280 9289 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_31570 9282 9983 gene locus_tag LOCUS_31580 9282 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 11380 10073 gene locus_tag LOCUS_31590 11380 10073 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_31590 12648 11407 gene locus_tag LOCUS_31600 12648 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 15037 12668 gene locus_tag LOCUS_31610 15037 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 15110 15646 gene locus_tag LOCUS_31620 15110 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334707.1 protein_id gnl|my_center|LOCUS_31620 19094 15651 gene locus_tag LOCUS_31630 19094 15651 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_31630 18978 20183 gene locus_tag LOCUS_31640 18978 20183 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_31640 20191 20850 gene locus_tag LOCUS_31650 20191 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 20967 21518 gene locus_tag LOCUS_31660 20967 21518 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_31660 21529 22383 gene locus_tag LOCUS_31670 21529 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 25468 22322 gene locus_tag LOCUS_31680 25468 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 26675 25488 gene locus_tag LOCUS_31690 26675 25488 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169995.1 protein_id gnl|my_center|LOCUS_31690 26747 27586 gene locus_tag LOCUS_31700 26747 27586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 27628 28554 gene locus_tag LOCUS_31710 27628 28554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 28625 29944 gene locus_tag LOCUS_31720 28625 29944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 31548 30031 gene locus_tag LOCUS_31730 31548 30031 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 protein_id gnl|my_center|LOCUS_31730 33780 31582 gene locus_tag LOCUS_31740 33780 31582 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_31740 34923 33883 gene locus_tag LOCUS_31750 34923 33883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125658.1 protein_id gnl|my_center|LOCUS_31750 <36098 34911 gene locus_tag LOCUS_31760 <36098 34911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125657.1:GTP-binding protein >Feature sequence39 1185 115 gene locus_tag LOCUS_31770 1185 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1343 1182 gene locus_tag LOCUS_31780 1343 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1618 1340 gene locus_tag LOCUS_31790 1618 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1706 2839 gene locus_tag LOCUS_31800 1706 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 4041 2845 gene locus_tag LOCUS_31810 4041 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 4963 4070 gene locus_tag LOCUS_31820 4963 4070 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_31820 5105 5752 gene locus_tag LOCUS_31830 5105 5752 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_31830 5767 6546 gene locus_tag LOCUS_31840 5767 6546 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_31840 7288 6596 gene locus_tag LOCUS_31850 7288 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123273.1 protein_id gnl|my_center|LOCUS_31850 9404 7332 gene locus_tag LOCUS_31860 9404 7332 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_31860 10859 9429 gene locus_tag LOCUS_31870 10859 9429 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_31870 12272 10860 gene locus_tag LOCUS_31880 12272 10860 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_31880 13027 12269 gene locus_tag LOCUS_31890 13027 12269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_31890 16461 13024 gene locus_tag LOCUS_31900 16461 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 17357 16458 gene locus_tag LOCUS_31910 17357 16458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_31910 19766 17397 gene locus_tag LOCUS_31920 19766 17397 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066717.1 protein_id gnl|my_center|LOCUS_31920 20294 19917 gene locus_tag LOCUS_31930 20294 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 20320 21561 gene locus_tag LOCUS_31940 20320 21561 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_31940 21558 22463 gene locus_tag LOCUS_31950 21558 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 22552 23460 gene locus_tag LOCUS_31960 22552 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 23517 25598 gene locus_tag LOCUS_31970 gene shc 23517 25598 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_31970 25621 26622 gene locus_tag LOCUS_31980 gene hpnH 25621 26622 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_31980 26651 27652 gene locus_tag LOCUS_31990 26651 27652 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_31990 27649 28398 gene locus_tag LOCUS_32000 27649 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 28472 29374 gene locus_tag LOCUS_32010 28472 29374 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_32010 29406 30833 gene locus_tag LOCUS_32020 29406 30833 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_32020 33344 30843 gene locus_tag LOCUS_32030 33344 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 34138 33395 gene locus_tag LOCUS_32040 34138 33395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence40 <1 632 gene locus_tag LOCUS_32050 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258100.1:P1 family peptidase 641 1423 gene locus_tag LOCUS_32060 641 1423 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_32060 1466 2242 gene locus_tag LOCUS_32070 1466 2242 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_32070 2268 4613 gene locus_tag LOCUS_32080 2268 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 4664 7435 gene locus_tag LOCUS_32090 4664 7435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 protein_id gnl|my_center|LOCUS_32090 8883 8749 gene locus_tag LOCUS_32100 8883 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9205 8870 gene locus_tag LOCUS_32110 9205 8870 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_32110 9707 9213 gene locus_tag LOCUS_32120 9707 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 9816 10079 gene locus_tag LOCUS_32130 9816 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 10169 10471 gene locus_tag LOCUS_32140 10169 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 10579 10905 gene locus_tag LOCUS_32150 10579 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 10838 11407 gene locus_tag LOCUS_32160 10838 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 12331 11438 gene locus_tag LOCUS_32170 12331 11438 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_32170 12706 13212 gene locus_tag LOCUS_32180 12706 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 14854 13529 gene locus_tag LOCUS_32190 14854 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 15327 15130 gene locus_tag LOCUS_32200 15327 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 15550 17637 gene locus_tag LOCUS_32210 15550 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 17880 18413 gene locus_tag LOCUS_32220 17880 18413 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721332.1 protein_id gnl|my_center|LOCUS_32220 18410 20635 gene locus_tag LOCUS_32230 18410 20635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 21436 20681 gene locus_tag LOCUS_32240 21436 20681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_32240 22839 21517 gene locus_tag LOCUS_32250 22839 21517 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_32250 22940 23854 gene locus_tag LOCUS_32260 22940 23854 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_32260 23872 24354 gene locus_tag LOCUS_32270 23872 24354 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_32270 24326 26695 gene locus_tag LOCUS_32280 24326 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 26794 27162 gene locus_tag LOCUS_32290 26794 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 27209 28042 gene locus_tag LOCUS_32300 27209 28042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 28946 28077 gene locus_tag LOCUS_32310 28946 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 29000 30142 gene locus_tag LOCUS_32320 29000 30142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 30139 30855 gene locus_tag LOCUS_32330 30139 30855 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_32330 31603 30866 gene locus_tag LOCUS_32340 gene fkpA 31603 30866 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417197.1 protein_id gnl|my_center|LOCUS_32340 31653 32432 gene locus_tag LOCUS_32350 31653 32432 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence41 1065 688 gene locus_tag LOCUS_32360 1065 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 1878 1069 gene locus_tag LOCUS_32370 1878 1069 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_32370 3230 1899 gene locus_tag LOCUS_32380 3230 1899 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_32380 6181 3296 gene locus_tag LOCUS_32390 6181 3296 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_32390 6360 7838 gene locus_tag LOCUS_32400 6360 7838 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_32400 7855 10506 gene locus_tag LOCUS_32410 7855 10506 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_32410 10616 11554 gene locus_tag LOCUS_32420 10616 11554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_32420 11551 12312 gene locus_tag LOCUS_32430 11551 12312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32430 12334 14466 gene locus_tag LOCUS_32440 12334 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 14489 15553 gene locus_tag LOCUS_32450 14489 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 15565 15933 gene locus_tag LOCUS_32460 15565 15933 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_32460 16088 18394 gene locus_tag LOCUS_32470 16088 18394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_32470 18397 18966 gene locus_tag LOCUS_32480 18397 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 18995 20347 gene locus_tag LOCUS_32490 18995 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 20773 20360 gene locus_tag LOCUS_32500 20773 20360 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_32500 21024 20770 gene locus_tag LOCUS_32510 21024 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 23705 21159 gene locus_tag LOCUS_32520 23705 21159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 27328 23702 gene locus_tag LOCUS_32530 27328 23702 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615507.1 protein_id gnl|my_center|LOCUS_32530 28488 27325 gene locus_tag LOCUS_32540 28488 27325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 28572 30329 gene locus_tag LOCUS_32550 28572 30329 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_32550 30342 30845 gene locus_tag LOCUS_32560 30342 30845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 30865 31371 gene locus_tag LOCUS_32570 30865 31371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_32570 32169 31372 gene locus_tag LOCUS_32580 32169 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence42 1934 771 gene locus_tag LOCUS_32590 1934 771 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_32590 2073 4652 gene locus_tag LOCUS_32600 2073 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 4649 7213 gene locus_tag LOCUS_32610 4649 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 7210 7800 gene locus_tag LOCUS_32620 7210 7800 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_32620 8995 7808 gene locus_tag LOCUS_32630 8995 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 10332 9079 gene locus_tag LOCUS_32640 10332 9079 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_32640 10760 10344 gene locus_tag LOCUS_32650 10760 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 11288 10761 gene locus_tag LOCUS_32660 11288 10761 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_32660 12662 11358 gene locus_tag LOCUS_32670 12662 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 13705 12659 gene locus_tag LOCUS_32680 13705 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 14493 13702 gene locus_tag LOCUS_32690 14493 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 14946 14521 gene locus_tag LOCUS_32700 14946 14521 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875325.1 protein_id gnl|my_center|LOCUS_32700 15236 14943 gene locus_tag LOCUS_32710 15236 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 15350 18448 gene locus_tag LOCUS_32720 15350 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 19496 18432 gene locus_tag LOCUS_32730 19496 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 20655 19630 gene locus_tag LOCUS_32740 20655 19630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 21768 20674 gene locus_tag LOCUS_32750 21768 20674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 23181 21985 gene locus_tag LOCUS_32760 23181 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 24760 23585 gene locus_tag LOCUS_32770 24760 23585 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_32770 24902 25891 gene locus_tag LOCUS_32780 24902 25891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 25914 26249 gene locus_tag LOCUS_32790 25914 26249 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_32790 28438 26321 gene locus_tag LOCUS_32800 28438 26321 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_32800 28546 30273 gene locus_tag LOCUS_32810 28546 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 31623 30415 gene locus_tag LOCUS_32820 31623 30415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 32025 31681 gene locus_tag LOCUS_32830 32025 31681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence43 1717 254 gene locus_tag LOCUS_32840 gene rimO 1717 254 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_32840 3595 1724 gene locus_tag LOCUS_32850 3595 1724 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_32850 5215 3674 gene locus_tag LOCUS_32860 5215 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5308 6930 gene locus_tag LOCUS_32870 5308 6930 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730448.1 protein_id gnl|my_center|LOCUS_32870 7797 6934 gene locus_tag LOCUS_32880 7797 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 9488 7809 gene locus_tag LOCUS_32890 9488 7809 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_32890 10683 9544 gene locus_tag LOCUS_32900 10683 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 10695 12005 gene locus_tag LOCUS_32910 10695 12005 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_32910 13258 12011 gene locus_tag LOCUS_32920 13258 12011 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_32920 14183 13269 gene locus_tag LOCUS_32930 14183 13269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_32930 14280 14816 gene locus_tag LOCUS_32940 14280 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 14887 15171 gene locus_tag LOCUS_32950 14887 15171 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393693.1 protein_id gnl|my_center|LOCUS_32950 15171 15602 gene locus_tag LOCUS_32960 15171 15602 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_32960 15694 17745 gene locus_tag LOCUS_32970 15694 17745 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_32970 17768 19516 gene locus_tag LOCUS_32980 17768 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 19544 20146 gene locus_tag LOCUS_32990 19544 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 21071 20154 gene locus_tag LOCUS_33000 21071 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 21154 21435 gene locus_tag LOCUS_33010 21154 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 21425 22231 gene locus_tag LOCUS_33020 gene pcaD 21425 22231 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_33020 23249 22245 gene locus_tag LOCUS_33030 23249 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 23360 25603 gene locus_tag LOCUS_33040 23360 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 25652 26290 gene locus_tag LOCUS_33050 25652 26290 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_33050 26330 26869 gene locus_tag LOCUS_33060 26330 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 26866 28173 gene locus_tag LOCUS_33070 26866 28173 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385434.1 protein_id gnl|my_center|LOCUS_33070 28170 29957 gene locus_tag LOCUS_33080 28170 29957 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_33080 29959 30978 gene locus_tag LOCUS_33090 29959 30978 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_33090 31666 30923 gene locus_tag LOCUS_33100 gene cobA 31666 30923 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258423.1 protein_id gnl|my_center|LOCUS_33100 <32291 31663 gene locus_tag LOCUS_33110 <32291 31663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228111.1:bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase >Feature sequence44 243 2159 gene locus_tag LOCUS_33120 243 2159 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_33120 4344 2173 gene locus_tag LOCUS_33130 4344 2173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_33130 5771 4374 gene locus_tag LOCUS_33140 5771 4374 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_33140 7216 5768 gene locus_tag LOCUS_33150 7216 5768 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141303.1 protein_id gnl|my_center|LOCUS_33150 7932 7213 gene locus_tag LOCUS_33160 7932 7213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_33160 8419 8114 gene locus_tag LOCUS_33170 8419 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 8495 9334 gene locus_tag LOCUS_33180 8495 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 9324 10208 gene locus_tag LOCUS_33190 9324 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 11213 10812 gene locus_tag LOCUS_33200 11213 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 11488 11231 gene locus_tag LOCUS_33210 11488 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 11698 12009 gene locus_tag LOCUS_33220 11698 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 12846 11995 gene locus_tag LOCUS_33230 12846 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 13580 13041 gene locus_tag LOCUS_33240 13580 13041 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085497.1 protein_id gnl|my_center|LOCUS_33240 14443 13628 gene locus_tag LOCUS_33250 14443 13628 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_33250 15015 14440 gene locus_tag LOCUS_33260 15015 14440 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085497.1 protein_id gnl|my_center|LOCUS_33260 15042 16118 gene locus_tag LOCUS_33270 15042 16118 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_33270 16132 17208 gene locus_tag LOCUS_33280 16132 17208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_33280 17683 17312 gene locus_tag LOCUS_33290 17683 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 17851 18495 gene locus_tag LOCUS_33300 17851 18495 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 protein_id gnl|my_center|LOCUS_33300 18529 19485 gene locus_tag LOCUS_33310 18529 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 19502 20263 gene locus_tag LOCUS_33320 19502 20263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_33320 20274 21392 gene locus_tag LOCUS_33330 20274 21392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_33330 22527 21457 gene locus_tag LOCUS_33340 22527 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 22560 23156 gene locus_tag LOCUS_33350 22560 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 23507 23175 gene locus_tag LOCUS_33360 23507 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 23664 25151 gene locus_tag LOCUS_33370 gene mmsA 23664 25151 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_33370 25534 25148 gene locus_tag LOCUS_33380 25534 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 27120 25531 gene locus_tag LOCUS_33390 27120 25531 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_33390 28399 27146 gene locus_tag LOCUS_33400 28399 27146 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_33400 28542 29234 gene locus_tag LOCUS_33410 28542 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 29254 30321 gene locus_tag LOCUS_33420 29254 30321 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_33420 30334 31212 gene locus_tag LOCUS_33430 30334 31212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 <31870 31209 gene locus_tag LOCUS_33440 <31870 31209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877342.1:TIGR03857 family LLM class F420-dependent oxidoreductase >Feature sequence45 <1 1942 gene locus_tag LOCUS_33450 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein 1961 3352 gene locus_tag LOCUS_33460 1961 3352 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726822.1 protein_id gnl|my_center|LOCUS_33460 3384 4700 gene locus_tag LOCUS_33470 3384 4700 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_33470 4714 5964 gene locus_tag LOCUS_33480 4714 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 5974 7224 gene locus_tag LOCUS_33490 5974 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 7234 8493 gene locus_tag LOCUS_33500 7234 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 8522 9193 gene locus_tag LOCUS_33510 8522 9193 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_33510 9237 11381 gene locus_tag LOCUS_33520 9237 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 12527 11481 gene locus_tag LOCUS_33530 12527 11481 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_33530 14238 12544 gene locus_tag LOCUS_33540 14238 12544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 15832 14252 gene locus_tag LOCUS_33550 15832 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_33550 18756 15829 gene locus_tag LOCUS_33560 18756 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 18871 20595 gene locus_tag LOCUS_33570 18871 20595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 20722 20952 gene locus_tag LOCUS_33580 20722 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 20949 21704 gene locus_tag LOCUS_33590 20949 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 21709 21978 gene locus_tag LOCUS_33600 21709 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 22073 22270 gene locus_tag LOCUS_33610 22073 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 22267 22821 gene locus_tag LOCUS_33620 22267 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 22845 23069 gene locus_tag LOCUS_33630 22845 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 23469 23170 gene locus_tag LOCUS_33640 23469 23170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 29656 23582 gene locus_tag LOCUS_33650 29656 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 30369 29653 gene locus_tag LOCUS_33660 30369 29653 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211708.1 protein_id gnl|my_center|LOCUS_33660 <31434 30369 gene locus_tag LOCUS_33670 <31434 30369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055651.1:phage minor tail protein L >Feature sequence46 <1 553 gene locus_tag LOCUS_33680 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531969.1:CoA ester lyase 586 2862 gene locus_tag LOCUS_33690 586 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3182 2850 gene locus_tag LOCUS_33700 3182 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3907 3500 gene locus_tag LOCUS_33710 3907 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 4045 4776 gene locus_tag LOCUS_33720 4045 4776 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_33720 4825 6036 gene locus_tag LOCUS_33730 4825 6036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_33730 6061 7308 gene locus_tag LOCUS_33740 6061 7308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_33740 7310 8002 gene locus_tag LOCUS_33750 7310 8002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_33750 8007 9260 gene locus_tag LOCUS_33760 8007 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 9350 10243 gene locus_tag LOCUS_33770 9350 10243 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_33770 10298 11251 gene locus_tag LOCUS_33780 10298 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 11261 12130 gene locus_tag LOCUS_33790 gene pstA 11261 12130 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_33790 12127 12912 gene locus_tag LOCUS_33800 gene pstB 12127 12912 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 protein_id gnl|my_center|LOCUS_33800 12909 13712 gene locus_tag LOCUS_33810 gene pstB 12909 13712 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722628.1 protein_id gnl|my_center|LOCUS_33810 14274 13735 gene locus_tag LOCUS_33820 14274 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 15637 14267 gene locus_tag LOCUS_33830 15637 14267 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226195.1 protein_id gnl|my_center|LOCUS_33830 15813 17117 gene locus_tag LOCUS_33840 15813 17117 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229564.1 protein_id gnl|my_center|LOCUS_33840 17176 18387 gene locus_tag LOCUS_33850 17176 18387 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_33850 18458 19768 gene locus_tag LOCUS_33860 18458 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_33860 19813 21747 gene locus_tag LOCUS_33870 19813 21747 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_33870 22909 21767 gene locus_tag LOCUS_33880 22909 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 23095 23790 gene locus_tag LOCUS_33890 gene phoB 23095 23790 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_33890 23860 25239 gene locus_tag LOCUS_33900 23860 25239 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_33900 25317 25973 gene locus_tag LOCUS_33910 gene phoU 25317 25973 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_33910 26146 26220 gene locus_tag LOCUS_t00450 26146 26220 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence47 843 370 gene locus_tag LOCUS_33920 843 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 6206 843 gene locus_tag LOCUS_33930 6206 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 6868 6200 gene locus_tag LOCUS_33940 6868 6200 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211708.1 protein_id gnl|my_center|LOCUS_33940 7599 6910 gene locus_tag LOCUS_33950 7599 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 7958 7596 gene locus_tag LOCUS_33960 7958 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 10498 7958 gene locus_tag LOCUS_33970 10498 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 10763 10491 gene locus_tag LOCUS_33980 10763 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 11197 10826 gene locus_tag LOCUS_33990 11197 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 12213 11194 gene locus_tag LOCUS_34000 12213 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 12676 12215 gene locus_tag LOCUS_34010 12676 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 13182 12673 gene locus_tag LOCUS_34020 13182 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 13666 13202 gene locus_tag LOCUS_34030 13666 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 13854 13675 gene locus_tag LOCUS_34040 13854 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 14830 13880 gene locus_tag LOCUS_34050 14830 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 protein_id gnl|my_center|LOCUS_34050 15203 14847 gene locus_tag LOCUS_34060 15203 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 16271 15204 gene locus_tag LOCUS_34070 16271 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 16347 16610 gene locus_tag LOCUS_34080 16347 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 16611 19319 gene locus_tag LOCUS_34090 16611 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 19324 20031 gene locus_tag LOCUS_34100 19324 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 20012 21067 gene locus_tag LOCUS_34110 20012 21067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 21064 21585 gene locus_tag LOCUS_34120 21064 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 22427 21582 gene locus_tag LOCUS_34130 22427 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900086.1 protein_id gnl|my_center|LOCUS_34130 23209 23523 gene locus_tag LOCUS_34140 23209 23523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 24275 23781 gene locus_tag LOCUS_34150 24275 23781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 24296 24556 gene locus_tag LOCUS_34160 24296 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 24757 25233 gene locus_tag LOCUS_34170 24757 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 25233 25433 gene locus_tag LOCUS_34180 25233 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 25430 25945 gene locus_tag LOCUS_34190 25430 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence48 207 1055 gene locus_tag LOCUS_34200 207 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34200 1108 2904 gene locus_tag LOCUS_34210 1108 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3440 2841 gene locus_tag LOCUS_34220 gene sodA 3440 2841 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_34220 3588 3662 gene locus_tag LOCUS_t00460 3588 3662 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3738 3814 gene locus_tag LOCUS_t00470 3738 3814 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3864 4019 gene locus_tag LOCUS_34230 gene rpmG 3864 4019 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_34230 4116 4805 gene locus_tag LOCUS_34240 4116 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4873 5244 gene locus_tag LOCUS_34250 4873 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 5268 5344 gene locus_tag LOCUS_t00480 5268 5344 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5378 6424 gene locus_tag LOCUS_34260 5378 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 6470 8473 gene locus_tag LOCUS_34270 gene ftsH 6470 8473 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_34270 8536 9261 gene locus_tag LOCUS_34280 gene cdaA 8536 9261 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_34280 9347 10072 gene locus_tag LOCUS_34290 9347 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 10069 11469 gene locus_tag LOCUS_34300 gene glmM 10069 11469 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_34300 12182 11466 gene locus_tag LOCUS_34310 12182 11466 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_34310 13572 12187 gene locus_tag LOCUS_34320 13572 12187 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_34320 13674 14030 gene locus_tag LOCUS_34330 13674 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 16089 14056 gene locus_tag LOCUS_34340 gene ligA 16089 14056 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_34340 16149 18053 gene locus_tag LOCUS_34350 gene msbA 16149 18053 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_34350 18058 18726 gene locus_tag LOCUS_34360 18058 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 18837 21299 gene locus_tag LOCUS_34370 18837 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 21515 22693 gene locus_tag LOCUS_34380 21515 22693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 22779 23633 gene locus_tag LOCUS_34390 22779 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence49 59 721 gene locus_tag LOCUS_34400 59 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 718 1299 gene locus_tag LOCUS_34410 718 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 1296 1901 gene locus_tag LOCUS_34420 1296 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1915 4335 gene locus_tag LOCUS_34430 1915 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 4332 4802 gene locus_tag LOCUS_34440 4332 4802 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_34440 4804 5253 gene locus_tag LOCUS_34450 4804 5253 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_34450 5240 5956 gene locus_tag LOCUS_34460 5240 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 5962 6426 gene locus_tag LOCUS_34470 gene dut 5962 6426 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_34470 7021 6431 gene locus_tag LOCUS_34480 7021 6431 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338648.1 protein_id gnl|my_center|LOCUS_34480 7154 9883 gene locus_tag LOCUS_34490 gene acnA 7154 9883 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_34490 9953 10675 gene locus_tag LOCUS_34500 gene queE 9953 10675 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_34500 10805 12070 gene locus_tag LOCUS_34510 10805 12070 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_34510 12595 12074 gene locus_tag LOCUS_34520 gene ripB 12595 12074 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_34520 13713 12592 gene locus_tag LOCUS_34530 13713 12592 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_34530 13764 15044 gene locus_tag LOCUS_34540 gene pcnB 13764 15044 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062037.1 protein_id gnl|my_center|LOCUS_34540 16577 15051 gene locus_tag LOCUS_34550 16577 15051 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_34550 17299 16574 gene locus_tag LOCUS_34560 17299 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 18633 17296 gene locus_tag LOCUS_34570 18633 17296 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_34570 19201 18635 gene locus_tag LOCUS_34580 gene rfbC 19201 18635 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_34580 20085 19198 gene locus_tag LOCUS_34590 gene rfbA 20085 19198 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_34590 21197 20082 gene locus_tag LOCUS_34600 gene rfbB 21197 20082 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 protein_id gnl|my_center|LOCUS_34600 22242 21220 gene locus_tag LOCUS_34610 22242 21220 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_34610 22231 22845 gene locus_tag LOCUS_34620 22231 22845 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence50 1661 861 gene locus_tag LOCUS_34630 1661 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 1972 1763 gene locus_tag LOCUS_34640 1972 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3531 1969 gene locus_tag LOCUS_34650 3531 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 5069 3531 gene locus_tag LOCUS_34660 5069 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_34660 5647 5066 gene locus_tag LOCUS_34670 5647 5066 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070988.1 protein_id gnl|my_center|LOCUS_34670 5948 5640 gene locus_tag LOCUS_34680 5948 5640 CDS product winged-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006249663.1 protein_id gnl|my_center|LOCUS_34680 6295 5945 gene locus_tag LOCUS_34690 6295 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 6897 6292 gene locus_tag LOCUS_34700 6897 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 7242 6910 gene locus_tag LOCUS_34710 7242 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 7781 7239 gene locus_tag LOCUS_34720 7781 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 8425 7778 gene locus_tag LOCUS_34730 8425 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 8313 8822 gene locus_tag LOCUS_34740 8313 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 9231 8785 gene locus_tag LOCUS_34750 9231 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 9523 9224 gene locus_tag LOCUS_34760 9523 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 10400 9540 gene locus_tag LOCUS_34770 10400 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 10570 10397 gene locus_tag LOCUS_34780 10570 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 12168 10567 gene locus_tag LOCUS_34790 12168 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 12610 12173 gene locus_tag LOCUS_34800 12610 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 13353 12607 gene locus_tag LOCUS_34810 13353 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 13844 13350 gene locus_tag LOCUS_34820 13844 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 14035 13841 gene locus_tag LOCUS_34830 14035 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 14550 14032 gene locus_tag LOCUS_34840 14550 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 14821 14657 gene locus_tag LOCUS_34850 14821 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 16097 17308 gene locus_tag LOCUS_34860 16097 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 17558 18676 gene locus_tag LOCUS_34870 17558 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 18673 19029 gene locus_tag LOCUS_34880 18673 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 19029 20006 gene locus_tag LOCUS_34890 19029 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 20006 20323 gene locus_tag LOCUS_34900 20006 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 20323 20733 gene locus_tag LOCUS_34910 20323 20733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 20761 21303 gene locus_tag LOCUS_34920 20761 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 21303 21740 gene locus_tag LOCUS_34930 21303 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence51 313 1113 gene locus_tag LOCUS_34940 313 1113 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077174050.1 protein_id gnl|my_center|LOCUS_34940 1115 1954 gene locus_tag LOCUS_34950 1115 1954 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117548.1 protein_id gnl|my_center|LOCUS_34950 1967 2431 gene locus_tag LOCUS_34960 1967 2431 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_34960 2731 2994 gene locus_tag LOCUS_34970 2731 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2995 4323 gene locus_tag LOCUS_34980 2995 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 4323 6656 gene locus_tag LOCUS_34990 4323 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 6657 7265 gene locus_tag LOCUS_35000 6657 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 7294 7935 gene locus_tag LOCUS_35010 7294 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 7935 9884 gene locus_tag LOCUS_35020 7935 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 10410 10781 gene locus_tag LOCUS_35030 10410 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 <20701 10748 gene locus_tag LOCUS_35040 <20701 10748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015508323.1:type I polyketide synthase >Feature sequence52 1544 369 gene locus_tag LOCUS_35050 1544 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1622 2389 gene locus_tag LOCUS_35060 1622 2389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_35060 2386 3834 gene locus_tag LOCUS_35070 2386 3834 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_35070 4666 3839 gene locus_tag LOCUS_35080 4666 3839 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_35080 6169 4691 gene locus_tag LOCUS_35090 6169 4691 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_35090 7549 6188 gene locus_tag LOCUS_35100 gene trkA 7549 6188 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228490.1 protein_id gnl|my_center|LOCUS_35100 9014 7587 gene locus_tag LOCUS_35110 9014 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9163 10026 gene locus_tag LOCUS_35120 9163 10026 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 protein_id gnl|my_center|LOCUS_35120 10114 11187 gene locus_tag LOCUS_35130 10114 11187 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_35130 11271 12044 gene locus_tag LOCUS_35140 11271 12044 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_35140 12188 13159 gene locus_tag LOCUS_35150 12188 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 13187 14209 gene locus_tag LOCUS_35160 13187 14209 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_35160 15647 14229 gene locus_tag LOCUS_35170 15647 14229 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_35170 16909 15623 gene locus_tag LOCUS_35180 16909 15623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 <19541 16942 gene locus_tag LOCUS_35190 <19541 16942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257153.1:VWA domain-containing protein >Feature sequence53 <1 1229 gene locus_tag LOCUS_35200 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265979.1:CaiB/BaiF CoA-transferase family protein 1284 2264 gene locus_tag LOCUS_35210 1284 2264 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_35210 2261 3691 gene locus_tag LOCUS_35220 2261 3691 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_35220 3709 7485 gene locus_tag LOCUS_35230 3709 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 7563 10094 gene locus_tag LOCUS_35240 7563 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 10097 13792 gene locus_tag LOCUS_35250 10097 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 15219 13807 gene locus_tag LOCUS_35260 gene noeA 15219 13807 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_35260 15434 15219 gene locus_tag LOCUS_35270 15434 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 15768 17510 gene locus_tag LOCUS_35280 15768 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence54 <1 1493 gene locus_tag LOCUS_35290 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640383.1:S9 family peptidase 1466 2203 gene locus_tag LOCUS_35300 1466 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3706 2207 gene locus_tag LOCUS_35310 3706 2207 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_35310 4791 3808 gene locus_tag LOCUS_35320 gene hemB 4791 3808 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_35320 4885 5619 gene locus_tag LOCUS_35330 4885 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 5629 6807 gene locus_tag LOCUS_35340 5629 6807 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 protein_id gnl|my_center|LOCUS_35340 6804 7607 gene locus_tag LOCUS_35350 6804 7607 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_35350 7604 8398 gene locus_tag LOCUS_35360 7604 8398 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_35360 8435 9484 gene locus_tag LOCUS_35370 8435 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 10554 9481 gene locus_tag LOCUS_35380 10554 9481 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 protein_id gnl|my_center|LOCUS_35380 10687 12033 gene locus_tag LOCUS_35390 10687 12033 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_35390 12063 13337 gene locus_tag LOCUS_35400 gene larA 12063 13337 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_35400 16365 13450 gene locus_tag LOCUS_35410 16365 13450 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence55 86 161 gene locus_tag LOCUS_t00490 86 161 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 260 466 gene locus_tag LOCUS_35420 260 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 498 1130 gene locus_tag LOCUS_35430 gene nusG 498 1130 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_35430 1202 1642 gene locus_tag LOCUS_35440 gene rplK 1202 1642 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 protein_id gnl|my_center|LOCUS_35440 1687 2391 gene locus_tag LOCUS_35450 gene rplA 1687 2391 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_35450 2425 2967 gene locus_tag LOCUS_35460 gene rplJ 2425 2967 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_35460 3040 3420 gene locus_tag LOCUS_35470 gene rplL 3040 3420 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_35470 3573 7844 gene locus_tag LOCUS_35480 gene rpoB 3573 7844 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_35480 7855 12084 gene locus_tag LOCUS_35490 gene rpoC 7855 12084 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_35490 12356 12730 gene locus_tag LOCUS_35500 gene rpsL 12356 12730 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142358.1 protein_id gnl|my_center|LOCUS_35500 12748 13221 gene locus_tag LOCUS_35510 gene rpsG 12748 13221 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 protein_id gnl|my_center|LOCUS_35510 13378 13387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13620 15674 gene locus_tag LOCUS_35520 gene fusA 13620 15674 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence56 <1 1285 gene locus_tag LOCUS_35530 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030900.1:dihydropyrimidinase 1303 2184 gene locus_tag LOCUS_35540 1303 2184 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_35540 2364 2759 gene locus_tag LOCUS_35550 2364 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3007 3678 gene locus_tag LOCUS_35560 3007 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3905 4549 gene locus_tag LOCUS_35570 3905 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546133.1 protein_id gnl|my_center|LOCUS_35570 5925 4546 gene locus_tag LOCUS_35580 5925 4546 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_35580 8717 5922 gene locus_tag LOCUS_35590 8717 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35590 9242 9937 gene locus_tag LOCUS_35600 9242 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 10466 10681 gene locus_tag LOCUS_35610 10466 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 12916 10817 gene locus_tag LOCUS_35620 12916 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 13673 12939 gene locus_tag LOCUS_35630 13673 12939 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_35630 13740 14291 gene locus_tag LOCUS_35640 13740 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence57 943 446 gene locus_tag LOCUS_35650 943 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 2304 1057 gene locus_tag LOCUS_35660 2304 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2406 4748 gene locus_tag LOCUS_35670 2406 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 5609 4749 gene locus_tag LOCUS_35680 gene prmC 5609 4749 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_35680 6700 5615 gene locus_tag LOCUS_35690 gene prfA 6700 5615 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_35690 6799 9048 gene locus_tag LOCUS_35700 6799 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 9045 9773 gene locus_tag LOCUS_35710 9045 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 10433 9786 gene locus_tag LOCUS_35720 10433 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence58 <1 553 gene locus_tag LOCUS_35730 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392955.1:NTP transferase domain-containing protein 598 1974 gene locus_tag LOCUS_35740 598 1974 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 protein_id gnl|my_center|LOCUS_35740 2004 2465 gene locus_tag LOCUS_35750 2004 2465 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 protein_id gnl|my_center|LOCUS_35750 2539 3618 gene locus_tag LOCUS_35760 2539 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3861 4931 gene locus_tag LOCUS_35770 3861 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 5833 5150 gene locus_tag LOCUS_35780 5833 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 8057 5844 gene locus_tag LOCUS_35790 8057 5844 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_35790 8638 8069 gene locus_tag LOCUS_35800 gene mog 8638 8069 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_35800 8683 9291 gene locus_tag LOCUS_35810 gene pyrE 8683 9291 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence59 697 206 gene locus_tag LOCUS_35820 697 206 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_35820 1851 697 gene locus_tag LOCUS_35830 1851 697 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_35830 2202 4328 gene locus_tag LOCUS_35840 2202 4328 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_35840 4344 4760 gene locus_tag LOCUS_35850 4344 4760 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100764.1 protein_id gnl|my_center|LOCUS_35850 4820 5386 gene locus_tag LOCUS_35860 4820 5386 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_35860 5559 6707 gene locus_tag LOCUS_35870 5559 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 6717 8165 gene locus_tag LOCUS_35880 6717 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence60 294 46 gene locus_tag LOCUS_35890 294 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 841 347 gene locus_tag LOCUS_35900 841 347 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522192.1 protein_id gnl|my_center|LOCUS_35900 1891 860 gene locus_tag LOCUS_35910 1891 860 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_35910 2724 1888 gene locus_tag LOCUS_35920 gene kdsA 2724 1888 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870024.1 protein_id gnl|my_center|LOCUS_35920 4414 2732 gene locus_tag LOCUS_35930 4414 2732 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_35930 5100 4438 gene locus_tag LOCUS_35940 gene kdsB 5100 4438 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_35940 >Feature sequence61 <1 596 gene locus_tag LOCUS_35950 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390103.1:class I SAM-dependent methyltransferase 600 1988 gene locus_tag LOCUS_35960 600 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 1819 1828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2000 3034 gene locus_tag LOCUS_35970 2000 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3273 3893 gene locus_tag LOCUS_35980 3273 3893 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_35980 5816 4140 gene locus_tag LOCUS_35990 gene ilvD 5816 4140 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence62 <1 647 gene locus_tag LOCUS_36000 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942108.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 688 762 gene locus_tag LOCUS_t00500 688 762 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 777 863 gene locus_tag LOCUS_t00510 777 863 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 885 959 gene locus_tag LOCUS_t00520 885 959 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1509 1039 gene locus_tag LOCUS_36010 1509 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 1615 2643 gene locus_tag LOCUS_36020 1615 2643 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_36020 4184 2640 gene locus_tag LOCUS_36030 4184 2640 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_36030 4259 5401 gene locus_tag LOCUS_36040 4259 5401 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence63 212 1378 gene locus_tag LOCUS_36050 212 1378 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_36050 1412 1936 gene locus_tag LOCUS_36060 1412 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36060 1970 3286 gene locus_tag LOCUS_36070 1970 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36070 3348 4505 gene locus_tag LOCUS_36080 3348 4505 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_36080 4622 5413 gene locus_tag LOCUS_36090 4622 5413 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence64 208 11 gene locus_tag LOCUS_36100 208 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 1812 253 gene locus_tag LOCUS_36110 1812 253 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_36110 2872 1823 gene locus_tag LOCUS_36120 gene lpxD 2872 1823 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_36120 3896 2898 gene locus_tag LOCUS_36130 3896 2898 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_36130 4725 3961 gene locus_tag LOCUS_36140 gene gloB 4725 3961 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527442.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence65 1576 59 gene locus_tag LOCUS_36150 1576 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 2742 1573 gene locus_tag LOCUS_36160 2742 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 4519 2834 gene locus_tag LOCUS_36170 4519 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence66 1015 164 gene locus_tag LOCUS_36180 1015 164 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_36180 1316 1035 gene locus_tag LOCUS_36190 1316 1035 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_36190 1383 2594 gene locus_tag LOCUS_36200 1383 2594 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_36200 2677 3462 gene locus_tag LOCUS_36210 2677 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3508 4323 gene locus_tag LOCUS_36220 3508 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 >Feature sequence67 188 1603 gene locus_tag LOCUS_36230 188 1603 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_36230 1600 2913 gene locus_tag LOCUS_36240 gene dgoD 1600 2913 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence68 1687 2031 gene locus_tag LOCUS_36250 1687 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence69 258 485 gene locus_tag LOCUS_36260 258 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 482 958 gene locus_tag LOCUS_36270 482 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 955 1332 gene locus_tag LOCUS_36280 955 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1398 1643 gene locus_tag LOCUS_36290 1398 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290