>Feature sequence001 501 193 gene locus_tag LOCUS_00010 501 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1412 2620 gene locus_tag LOCUS_00020 1412 2620 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058173.1 protein_id gnl|my_center|LOCUS_00020 2721 5147 gene locus_tag LOCUS_00030 2721 5147 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_00030 5330 5755 gene locus_tag LOCUS_00040 5330 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5930 6115 gene locus_tag LOCUS_00050 5930 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6866 6606 gene locus_tag LOCUS_00060 6866 6606 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124284.1 protein_id gnl|my_center|LOCUS_00060 7627 6869 gene locus_tag LOCUS_00070 7627 6869 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_00070 7688 7897 gene locus_tag LOCUS_00080 7688 7897 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124286.1 protein_id gnl|my_center|LOCUS_00080 7901 8275 gene locus_tag LOCUS_00090 gene rbfA 7901 8275 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124287.1 protein_id gnl|my_center|LOCUS_00090 8539 9537 gene locus_tag LOCUS_00100 8539 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10697 9534 gene locus_tag LOCUS_00110 10697 9534 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_00110 10811 11086 gene locus_tag LOCUS_00120 10811 11086 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124263.1 protein_id gnl|my_center|LOCUS_00120 11163 11534 gene locus_tag LOCUS_00130 11163 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124264.1 protein_id gnl|my_center|LOCUS_00130 11809 12756 gene locus_tag LOCUS_00140 11809 12756 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057945.1 protein_id gnl|my_center|LOCUS_00140 12825 12971 gene locus_tag LOCUS_00150 12825 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13170 13179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14515 13307 gene locus_tag LOCUS_00160 14515 13307 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125527.1 protein_id gnl|my_center|LOCUS_00160 15802 14621 gene locus_tag LOCUS_00170 15802 14621 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_00170 15968 15887 gene locus_tag LOCUS_t00010 15968 15887 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16938 16003 gene locus_tag LOCUS_00180 16938 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17488 16922 gene locus_tag LOCUS_00190 17488 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17010 17019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17707 17791 gene locus_tag LOCUS_t00020 17707 17791 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18823 18419 gene locus_tag LOCUS_00200 18823 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19599 19390 gene locus_tag LOCUS_00210 19599 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19874 19500 gene locus_tag LOCUS_00220 19874 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 20053 19841 gene locus_tag LOCUS_00230 20053 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 20766 20548 gene locus_tag LOCUS_00240 20766 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124403.1 protein_id gnl|my_center|LOCUS_00240 21169 20900 gene locus_tag LOCUS_00250 21169 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 21852 21247 gene locus_tag LOCUS_00260 21852 21247 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124404.1 protein_id gnl|my_center|LOCUS_00260 22886 21915 gene locus_tag LOCUS_00270 22886 21915 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124405.1 protein_id gnl|my_center|LOCUS_00270 22994 24115 gene locus_tag LOCUS_00280 22994 24115 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_00280 24115 24420 gene locus_tag LOCUS_00290 24115 24420 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125392.1 protein_id gnl|my_center|LOCUS_00290 24417 25826 gene locus_tag LOCUS_00300 24417 25826 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125391.1 protein_id gnl|my_center|LOCUS_00300 25875 26801 gene locus_tag LOCUS_00310 25875 26801 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_00310 28515 27115 gene locus_tag LOCUS_00320 28515 27115 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125088.1 protein_id gnl|my_center|LOCUS_00320 29004 28567 gene locus_tag LOCUS_00330 gene cynS 29004 28567 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616247.1 protein_id gnl|my_center|LOCUS_00330 30791 29121 gene locus_tag LOCUS_00340 30791 29121 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262614.1 protein_id gnl|my_center|LOCUS_00340 >Feature sequence002 <1 803 gene locus_tag LOCUS_00350 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337852.1:branched-chain amino acid ABC transporter permease 832 2229 gene locus_tag LOCUS_00360 gene pds 832 2229 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_00360 2263 3240 gene locus_tag LOCUS_00370 2263 3240 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892168.1 protein_id gnl|my_center|LOCUS_00370 3698 3237 gene locus_tag LOCUS_00380 3698 3237 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124320.1 protein_id gnl|my_center|LOCUS_00380 5135 3822 gene locus_tag LOCUS_00390 5135 3822 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124319.1 protein_id gnl|my_center|LOCUS_00390 5220 6251 gene locus_tag LOCUS_00400 5220 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6262 6897 gene locus_tag LOCUS_00410 6262 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 6956 7168 gene locus_tag LOCUS_00420 6956 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7419 8999 gene locus_tag LOCUS_00430 gene leuC 7419 8999 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_00430 8996 9604 gene locus_tag LOCUS_00440 gene leuD 8996 9604 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_00440 11890 9605 gene locus_tag LOCUS_00450 11890 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 12218 15088 gene locus_tag LOCUS_00460 12218 15088 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056145.1 protein_id gnl|my_center|LOCUS_00460 15252 15103 gene locus_tag LOCUS_00470 gene psbN 15252 15103 CDS product photosystem II reaction center protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124439.1 protein_id gnl|my_center|LOCUS_00470 15341 15541 gene locus_tag LOCUS_00480 gene psbH 15341 15541 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_00480 15608 15901 gene locus_tag LOCUS_00490 15608 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 15905 16573 gene locus_tag LOCUS_00500 gene pth 15905 16573 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124436.1 protein_id gnl|my_center|LOCUS_00500 16576 16833 gene locus_tag LOCUS_00510 16576 16833 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124435.1 protein_id gnl|my_center|LOCUS_00510 17293 16823 gene locus_tag LOCUS_00520 gene ruvX 17293 16823 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_00520 18440 17268 gene locus_tag LOCUS_00530 18440 17268 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_00530 19200 18538 gene locus_tag LOCUS_00540 gene ntcA 19200 18538 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866410.1 protein_id gnl|my_center|LOCUS_00540 19579 20232 gene locus_tag LOCUS_00550 19579 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 20308 20901 gene locus_tag LOCUS_00560 gene dcd 20308 20901 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124429.1 protein_id gnl|my_center|LOCUS_00560 21394 22260 gene locus_tag LOCUS_00570 21394 22260 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_00570 23022 23159 gene locus_tag LOCUS_00580 23022 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 23182 23373 gene locus_tag LOCUS_00590 23182 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 23671 24453 gene locus_tag LOCUS_00600 23671 24453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 24510 24785 gene locus_tag LOCUS_00610 24510 24785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 25790 25215 gene locus_tag LOCUS_00620 25790 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125563.1 protein_id gnl|my_center|LOCUS_00620 26485 25787 gene locus_tag LOCUS_00630 26485 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 26604 26924 gene locus_tag LOCUS_00640 26604 26924 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125562.1 protein_id gnl|my_center|LOCUS_00640 26977 28212 gene locus_tag LOCUS_00650 gene tyrS 26977 28212 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125561.1 protein_id gnl|my_center|LOCUS_00650 28212 28988 gene locus_tag LOCUS_00660 gene pyrF 28212 28988 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125560.1 protein_id gnl|my_center|LOCUS_00660 >Feature sequence003 1443 289 gene locus_tag LOCUS_00670 gene proB 1443 289 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_00670 1534 1743 gene locus_tag LOCUS_00680 1534 1743 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124526.1 protein_id gnl|my_center|LOCUS_00680 1839 2696 gene locus_tag LOCUS_00690 1839 2696 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124525.1 protein_id gnl|my_center|LOCUS_00690 3494 2751 gene locus_tag LOCUS_00700 3494 2751 CDS product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 protein_id gnl|my_center|LOCUS_00700 3532 5013 gene locus_tag LOCUS_00710 3532 5013 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_00710 5481 4999 gene locus_tag LOCUS_00720 gene petD 5481 4999 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124523.1 protein_id gnl|my_center|LOCUS_00720 6206 5559 gene locus_tag LOCUS_00730 6206 5559 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124522.1 protein_id gnl|my_center|LOCUS_00730 6409 7668 gene locus_tag LOCUS_00740 6409 7668 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328861.1 protein_id gnl|my_center|LOCUS_00740 8341 7646 gene locus_tag LOCUS_00750 gene mtnX 8341 7646 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_00750 8507 9115 gene locus_tag LOCUS_00760 gene minC 8507 9115 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124519.1 protein_id gnl|my_center|LOCUS_00760 9169 10035 gene locus_tag LOCUS_00770 gene minD 9169 10035 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124518.1 protein_id gnl|my_center|LOCUS_00770 10045 10317 gene locus_tag LOCUS_00780 gene minE 10045 10317 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124517.1 protein_id gnl|my_center|LOCUS_00780 10557 10360 gene locus_tag LOCUS_00790 10557 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11556 10564 gene locus_tag LOCUS_00800 11556 10564 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_00800 11691 11765 gene locus_tag LOCUS_t00030 11691 11765 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12857 11766 gene locus_tag LOCUS_00810 12857 11766 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_00810 13921 12851 gene locus_tag LOCUS_00820 13921 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14076 15407 gene locus_tag LOCUS_00830 gene miaB 14076 15407 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125530.1 protein_id gnl|my_center|LOCUS_00830 15473 16504 gene locus_tag LOCUS_00840 15473 16504 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_00840 16525 16935 gene locus_tag LOCUS_00850 16525 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125532.1 protein_id gnl|my_center|LOCUS_00850 16950 17792 gene locus_tag LOCUS_00860 16950 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 18078 19304 gene locus_tag LOCUS_00870 gene ftsZ 18078 19304 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923238.1 protein_id gnl|my_center|LOCUS_00870 19468 20283 gene locus_tag LOCUS_00880 gene panB 19468 20283 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125535.1 protein_id gnl|my_center|LOCUS_00880 21409 20186 gene locus_tag LOCUS_00890 gene hemW 21409 20186 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125536.1 protein_id gnl|my_center|LOCUS_00890 21834 22904 gene locus_tag LOCUS_00900 21834 22904 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125537.1 protein_id gnl|my_center|LOCUS_00900 22951 24084 gene locus_tag LOCUS_00910 22951 24084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 25484 24243 gene locus_tag LOCUS_00920 25484 24243 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_00920 26437 25481 gene locus_tag LOCUS_00930 26437 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 26632 27339 gene locus_tag LOCUS_00940 26632 27339 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_00940 27376 27972 gene locus_tag LOCUS_00950 27376 27972 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_00950 28155 28559 gene locus_tag LOCUS_00960 28155 28559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 28605 29600 gene locus_tag LOCUS_00970 gene ilvC 28605 29600 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125540.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence004 246 1166 gene locus_tag LOCUS_00980 246 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 1163 2173 gene locus_tag LOCUS_00990 1163 2173 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_00990 2358 3293 gene locus_tag LOCUS_01000 gene queG 2358 3293 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124162.1 protein_id gnl|my_center|LOCUS_01000 4458 4036 gene locus_tag LOCUS_01010 4458 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5675 5196 gene locus_tag LOCUS_01020 5675 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5217 5226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6043 7479 gene locus_tag LOCUS_01030 gene glmU 6043 7479 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_01030 7817 7554 gene locus_tag LOCUS_01040 gene rpmA 7817 7554 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125577.1 protein_id gnl|my_center|LOCUS_01040 8320 7856 gene locus_tag LOCUS_01050 8320 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 8518 8700 gene locus_tag LOCUS_01060 8518 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 8687 9025 gene locus_tag LOCUS_01070 gene kaiB 8687 9025 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125575.1 protein_id gnl|my_center|LOCUS_01070 9030 10625 gene locus_tag LOCUS_01080 gene kaiC 9030 10625 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125574.1 protein_id gnl|my_center|LOCUS_01080 12630 10600 gene locus_tag LOCUS_01090 12630 10600 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125573.1 protein_id gnl|my_center|LOCUS_01090 13955 12657 gene locus_tag LOCUS_01100 gene purD 13955 12657 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125572.1 protein_id gnl|my_center|LOCUS_01100 14020 14817 gene locus_tag LOCUS_01110 14020 14817 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125571.1 protein_id gnl|my_center|LOCUS_01110 14855 17734 gene locus_tag LOCUS_01120 14855 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17746 18672 gene locus_tag LOCUS_01130 gene lpxC 17746 18672 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866382.1 protein_id gnl|my_center|LOCUS_01130 18605 19087 gene locus_tag LOCUS_01140 gene fabZ 18605 19087 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_01140 19089 19913 gene locus_tag LOCUS_01150 gene lpxA 19089 19913 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125567.1 protein_id gnl|my_center|LOCUS_01150 19870 21150 gene locus_tag LOCUS_01160 gene lpxB 19870 21150 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125566.1 protein_id gnl|my_center|LOCUS_01160 21147 21815 gene locus_tag LOCUS_01170 gene msrA 21147 21815 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_01170 22180 23916 gene locus_tag LOCUS_01180 22180 23916 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124200.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence005 1052 1597 gene locus_tag LOCUS_01190 gene moaC 1052 1597 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_01190 2129 1668 gene locus_tag LOCUS_01200 2129 1668 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929079.1 protein_id gnl|my_center|LOCUS_01200 3870 2419 gene locus_tag LOCUS_01210 3870 2419 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125603.1 protein_id gnl|my_center|LOCUS_01210 3841 5004 gene locus_tag LOCUS_01220 3841 5004 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124280.1 protein_id gnl|my_center|LOCUS_01220 5033 5416 gene locus_tag LOCUS_01230 5033 5416 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124278.1 protein_id gnl|my_center|LOCUS_01230 6514 5636 gene locus_tag LOCUS_01240 6514 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 6678 6529 gene locus_tag LOCUS_01250 6678 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8096 6786 gene locus_tag LOCUS_01260 gene rimO 8096 6786 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_01260 9401 10207 gene locus_tag LOCUS_01270 9401 10207 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_01270 10530 11495 gene locus_tag LOCUS_01280 10530 11495 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124275.1 protein_id gnl|my_center|LOCUS_01280 11576 11956 gene locus_tag LOCUS_01290 11576 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 13661 12003 gene locus_tag LOCUS_01300 gene nadB 13661 12003 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_01300 14106 13708 gene locus_tag LOCUS_01310 gene psbU 14106 13708 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_01310 15655 14249 gene locus_tag LOCUS_01320 gene murD 15655 14249 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_01320 16029 15754 gene locus_tag LOCUS_01330 16029 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 17110 16460 gene locus_tag LOCUS_01340 17110 16460 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125108.1 protein_id gnl|my_center|LOCUS_01340 17701 17114 gene locus_tag LOCUS_01350 gene hemJ 17701 17114 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125107.1 protein_id gnl|my_center|LOCUS_01350 18032 18514 gene locus_tag LOCUS_01360 18032 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 18520 18831 gene locus_tag LOCUS_01370 18520 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19563 19216 gene locus_tag LOCUS_01380 19563 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 21732 20053 gene locus_tag LOCUS_01390 21732 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 20265 20364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21815 22246 gene locus_tag LOCUS_01400 21815 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22457 22215 gene locus_tag LOCUS_01410 22457 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 22865 22671 gene locus_tag LOCUS_01420 22865 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence006 105 566 gene locus_tag LOCUS_01430 105 566 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125862.1 protein_id gnl|my_center|LOCUS_01430 571 1590 gene locus_tag LOCUS_01440 571 1590 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866389.1 protein_id gnl|my_center|LOCUS_01440 2114 3532 gene locus_tag LOCUS_01450 2114 3532 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_01450 3558 3629 gene locus_tag LOCUS_t00040 3558 3629 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3648 4247 gene locus_tag LOCUS_01460 3648 4247 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_01460 4340 5101 gene locus_tag LOCUS_01470 4340 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5251 6429 gene locus_tag LOCUS_01480 5251 6429 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124243.1 protein_id gnl|my_center|LOCUS_01480 6493 6669 gene locus_tag LOCUS_01490 6493 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7764 6673 gene locus_tag LOCUS_01500 7764 6673 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124944.1 protein_id gnl|my_center|LOCUS_01500 7885 9597 gene locus_tag LOCUS_01510 7885 9597 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125265.1 protein_id gnl|my_center|LOCUS_01510 9622 10092 gene locus_tag LOCUS_01520 9622 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10267 10545 gene locus_tag LOCUS_01530 10267 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10514 10666 gene locus_tag LOCUS_01540 10514 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10949 11956 gene locus_tag LOCUS_01550 10949 11956 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527912.1 protein_id gnl|my_center|LOCUS_01550 12182 13354 gene locus_tag LOCUS_01560 12182 13354 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842701.1 protein_id gnl|my_center|LOCUS_01560 13537 14079 gene locus_tag LOCUS_01570 13537 14079 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125036.1 protein_id gnl|my_center|LOCUS_01570 14778 16286 gene locus_tag LOCUS_01580 14778 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17098 16484 gene locus_tag LOCUS_01590 gene cobU 17098 16484 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_01590 18245 17085 gene locus_tag LOCUS_01600 18245 17085 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_01600 18921 18259 gene locus_tag LOCUS_01610 18921 18259 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_01610 19373 18939 gene locus_tag LOCUS_01620 19373 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19460 20104 gene locus_tag LOCUS_01630 19460 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 20161 21435 gene locus_tag LOCUS_01640 20161 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 21650 21414 gene locus_tag LOCUS_01650 21650 21414 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125182.1 protein_id gnl|my_center|LOCUS_01650 21731 22297 gene locus_tag LOCUS_01660 21731 22297 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_01660 22302 22802 gene locus_tag LOCUS_01670 22302 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence007 722 1582 gene locus_tag LOCUS_01680 722 1582 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_01680 3599 1587 gene locus_tag LOCUS_01690 gene tkt 3599 1587 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125919.1 protein_id gnl|my_center|LOCUS_01690 4881 3655 gene locus_tag LOCUS_01700 gene fabF 4881 3655 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125918.1 protein_id gnl|my_center|LOCUS_01700 5217 4951 gene locus_tag LOCUS_01710 gene acpP 5217 4951 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_01710 5450 5695 gene locus_tag LOCUS_01720 gene psaC 5450 5695 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_01720 5804 7657 gene locus_tag LOCUS_01730 gene glmS 5804 7657 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_01730 8726 7644 gene locus_tag LOCUS_01740 gene rlmN 8726 7644 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_01740 16328 8925 gene locus_tag LOCUS_01750 16328 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 19209 16372 gene locus_tag LOCUS_01760 19209 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 <22143 19291 gene locus_tag LOCUS_01770 <22143 19291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125790.1:DNA-directed RNA polymerase subunit beta >Feature sequence008 18 1534 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgctcaacgaaggccggggccgaaaccccggcgacac 2149 1859 gene locus_tag LOCUS_01780 gene cas2 2149 1859 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_01780 3169 2153 gene locus_tag LOCUS_01790 gene cas1c 3169 2153 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_01790 3774 3157 gene locus_tag LOCUS_01800 gene cas4 3774 3157 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_01800 4352 3771 gene locus_tag LOCUS_01810 4352 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7555 4667 gene locus_tag LOCUS_01820 7555 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 8970 7552 gene locus_tag LOCUS_01830 8970 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10187 8970 gene locus_tag LOCUS_01840 10187 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10353 10171 gene locus_tag LOCUS_01850 10353 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10608 11264 gene locus_tag LOCUS_01860 10608 11264 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170879.1 protein_id gnl|my_center|LOCUS_01860 12050 11232 gene locus_tag LOCUS_01870 12050 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 13331 12102 gene locus_tag LOCUS_01880 13331 12102 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530038.1 protein_id gnl|my_center|LOCUS_01880 13638 13318 gene locus_tag LOCUS_01890 gene trxA 13638 13318 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_01890 14391 14215 gene locus_tag LOCUS_01900 14391 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15507 14650 gene locus_tag LOCUS_01910 15507 14650 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125774.1 protein_id gnl|my_center|LOCUS_01910 16211 15504 gene locus_tag LOCUS_01920 16211 15504 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125773.1 protein_id gnl|my_center|LOCUS_01920 17356 16208 gene locus_tag LOCUS_01930 17356 16208 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125772.1 protein_id gnl|my_center|LOCUS_01930 17495 18445 gene locus_tag LOCUS_01940 gene rsmH 17495 18445 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124351.1 protein_id gnl|my_center|LOCUS_01940 19079 18408 gene locus_tag LOCUS_01950 19079 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 19672 19091 gene locus_tag LOCUS_01960 19672 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 19786 20364 gene locus_tag LOCUS_01970 19786 20364 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_01970 21563 20355 gene locus_tag LOCUS_01980 21563 20355 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence009 453 3755 gene locus_tag LOCUS_01990 gene carB 453 3755 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125049.1 protein_id gnl|my_center|LOCUS_01990 4025 4405 gene locus_tag LOCUS_02000 4025 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4402 5130 gene locus_tag LOCUS_02010 gene lptB 4402 5130 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124988.1 protein_id gnl|my_center|LOCUS_02010 5130 6287 gene locus_tag LOCUS_02020 5130 6287 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923226.1 protein_id gnl|my_center|LOCUS_02020 6341 7267 gene locus_tag LOCUS_02030 gene ccsB 6341 7267 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165438633.1 protein_id gnl|my_center|LOCUS_02030 7312 7563 gene locus_tag LOCUS_02040 7312 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8261 7578 gene locus_tag LOCUS_02050 gene rpe 8261 7578 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_02050 8386 9390 gene locus_tag LOCUS_02060 gene glpX 8386 9390 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124992.1 protein_id gnl|my_center|LOCUS_02060 9422 10729 gene locus_tag LOCUS_02070 9422 10729 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124993.1 protein_id gnl|my_center|LOCUS_02070 10745 12088 gene locus_tag LOCUS_02080 10745 12088 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124994.1 protein_id gnl|my_center|LOCUS_02080 12174 13598 gene locus_tag LOCUS_02090 gene gndA 12174 13598 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124995.1 protein_id gnl|my_center|LOCUS_02090 13595 14305 gene locus_tag LOCUS_02100 gene pgl 13595 14305 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124996.1 protein_id gnl|my_center|LOCUS_02100 14317 15045 gene locus_tag LOCUS_02110 14317 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 15638 15129 gene locus_tag LOCUS_02120 15638 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 15737 15973 gene locus_tag LOCUS_02130 15737 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 16025 16960 gene locus_tag LOCUS_02140 16025 16960 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_02140 17079 18116 gene locus_tag LOCUS_02150 gene csaB 17079 18116 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057733.1 protein_id gnl|my_center|LOCUS_02150 18937 19221 gene locus_tag LOCUS_02160 18937 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 19486 19181 gene locus_tag LOCUS_02170 19486 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 20223 20624 gene locus_tag LOCUS_02180 20223 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence010 280 1503 gene locus_tag LOCUS_02190 280 1503 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_02190 2395 1511 gene locus_tag LOCUS_02200 2395 1511 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_02200 3788 2796 gene locus_tag LOCUS_02210 gene fmt 3788 2796 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_02210 5188 3800 gene locus_tag LOCUS_02220 5188 3800 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_02220 6611 5175 gene locus_tag LOCUS_02230 6611 5175 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892364.1 protein_id gnl|my_center|LOCUS_02230 7021 7413 gene locus_tag LOCUS_02240 7021 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7806 7549 gene locus_tag LOCUS_02250 7806 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 8037 8222 gene locus_tag LOCUS_02260 8037 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8466 8678 gene locus_tag LOCUS_02270 8466 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 8999 8559 gene locus_tag LOCUS_02280 8999 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9573 9310 gene locus_tag LOCUS_02290 9573 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10804 9635 gene locus_tag LOCUS_02300 gene murG 10804 9635 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124378.1 protein_id gnl|my_center|LOCUS_02300 10770 11540 gene locus_tag LOCUS_02310 10770 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124377.1 protein_id gnl|my_center|LOCUS_02310 11551 12273 gene locus_tag LOCUS_02320 11551 12273 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124326.1 protein_id gnl|my_center|LOCUS_02320 12557 12300 gene locus_tag LOCUS_02330 12557 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 13279 12554 gene locus_tag LOCUS_02340 13279 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13988 13263 gene locus_tag LOCUS_02350 13988 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 15038 13992 gene locus_tag LOCUS_02360 15038 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 16251 15079 gene locus_tag LOCUS_02370 16251 15079 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124380.1 protein_id gnl|my_center|LOCUS_02370 17019 16276 gene locus_tag LOCUS_02380 17019 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17615 17220 gene locus_tag LOCUS_02390 gene rplL 17615 17220 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124382.1 protein_id gnl|my_center|LOCUS_02390 18266 17670 gene locus_tag LOCUS_02400 gene rplJ 18266 17670 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124383.1 protein_id gnl|my_center|LOCUS_02400 19198 18485 gene locus_tag LOCUS_02410 gene rplA 19198 18485 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124384.1 protein_id gnl|my_center|LOCUS_02410 19711 19286 gene locus_tag LOCUS_02420 gene rplK 19711 19286 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124385.1 protein_id gnl|my_center|LOCUS_02420 20321 19779 gene locus_tag LOCUS_02430 gene nusG 20321 19779 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124386.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence011 2184 667 gene locus_tag LOCUS_02440 gene atpA 2184 667 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125754.1 protein_id gnl|my_center|LOCUS_02440 2795 2238 gene locus_tag LOCUS_02450 gene atpH 2795 2238 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_02450 3332 2799 gene locus_tag LOCUS_02460 3332 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3808 3341 gene locus_tag LOCUS_02470 3808 3341 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125757.1 protein_id gnl|my_center|LOCUS_02470 4206 3895 gene locus_tag LOCUS_02480 4206 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5053 4280 gene locus_tag LOCUS_02490 gene atpB 5053 4280 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125759.1 protein_id gnl|my_center|LOCUS_02490 5455 5057 gene locus_tag LOCUS_02500 5455 5057 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_02500 6921 5713 gene locus_tag LOCUS_02510 6921 5713 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_02510 7094 10522 gene locus_tag LOCUS_02520 7094 10522 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_02520 11046 11531 gene locus_tag LOCUS_02530 gene apcA 11046 11531 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_02530 11586 12074 gene locus_tag LOCUS_02540 gene apcB 11586 12074 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_02540 12114 12314 gene locus_tag LOCUS_02550 12114 12314 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_02550 12400 13515 gene locus_tag LOCUS_02560 12400 13515 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866423.1 protein_id gnl|my_center|LOCUS_02560 13535 14290 gene locus_tag LOCUS_02570 13535 14290 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125762.1 protein_id gnl|my_center|LOCUS_02570 14294 15604 gene locus_tag LOCUS_02580 14294 15604 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125763.1 protein_id gnl|my_center|LOCUS_02580 15993 15598 gene locus_tag LOCUS_02590 gene queF 15993 15598 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125764.1 protein_id gnl|my_center|LOCUS_02590 16296 16502 gene locus_tag LOCUS_02600 16296 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 16901 17239 gene locus_tag LOCUS_02610 16901 17239 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125766.1 protein_id gnl|my_center|LOCUS_02610 18101 17253 gene locus_tag LOCUS_02620 18101 17253 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143173.1 protein_id gnl|my_center|LOCUS_02620 18208 19503 gene locus_tag LOCUS_02630 gene purB 18208 19503 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125769.1 protein_id gnl|my_center|LOCUS_02630 19543 19962 gene locus_tag LOCUS_02640 19543 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence012 1114 260 gene locus_tag LOCUS_02650 1114 260 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_02650 1929 1114 gene locus_tag LOCUS_02660 1929 1114 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125211.1 protein_id gnl|my_center|LOCUS_02660 2874 1963 gene locus_tag LOCUS_02670 2874 1963 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921125.1 protein_id gnl|my_center|LOCUS_02670 3107 3613 gene locus_tag LOCUS_02680 3107 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3613 4638 gene locus_tag LOCUS_02690 gene trpS 3613 4638 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125215.1 protein_id gnl|my_center|LOCUS_02690 5140 4667 gene locus_tag LOCUS_02700 5140 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 5158 5712 gene locus_tag LOCUS_02710 gene pgsA 5158 5712 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125026.1 protein_id gnl|my_center|LOCUS_02710 6693 5698 gene locus_tag LOCUS_02720 gene mutY 6693 5698 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_02720 6918 7943 gene locus_tag LOCUS_02730 gene pdxA 6918 7943 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124183.1 protein_id gnl|my_center|LOCUS_02730 8544 8086 gene locus_tag LOCUS_02740 gene accB 8544 8086 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_02740 9202 8591 gene locus_tag LOCUS_02750 gene efp 9202 8591 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124181.1 protein_id gnl|my_center|LOCUS_02750 9255 10361 gene locus_tag LOCUS_02760 9255 10361 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124180.1 protein_id gnl|my_center|LOCUS_02760 10354 11478 gene locus_tag LOCUS_02770 gene thiL 10354 11478 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124179.1 protein_id gnl|my_center|LOCUS_02770 12446 11406 gene locus_tag LOCUS_02780 gene gap 12446 11406 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124178.1 protein_id gnl|my_center|LOCUS_02780 12667 14031 gene locus_tag LOCUS_02790 gene murC 12667 14031 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124177.1 protein_id gnl|my_center|LOCUS_02790 14040 14984 gene locus_tag LOCUS_02800 gene murB 14040 14984 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124176.1 protein_id gnl|my_center|LOCUS_02800 15005 15352 gene locus_tag LOCUS_02810 15005 15352 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124175.1 protein_id gnl|my_center|LOCUS_02810 15614 15384 gene locus_tag LOCUS_02820 15614 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 16769 15633 gene locus_tag LOCUS_02830 gene dnaJ 16769 15633 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_02830 17662 16808 gene locus_tag LOCUS_02840 17662 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 17970 17659 gene locus_tag LOCUS_02850 gene clpS 17970 17659 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125804.1 protein_id gnl|my_center|LOCUS_02850 19273 18038 gene locus_tag LOCUS_02860 19273 18038 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence013 290 505 gene locus_tag LOCUS_02870 290 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3541 1010 gene locus_tag LOCUS_02880 3541 1010 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125908.1 protein_id gnl|my_center|LOCUS_02880 3792 5162 gene locus_tag LOCUS_02890 3792 5162 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125907.1 protein_id gnl|my_center|LOCUS_02890 5366 6202 gene locus_tag LOCUS_02900 5366 6202 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039744.1 protein_id gnl|my_center|LOCUS_02900 6277 7572 gene locus_tag LOCUS_02910 6277 7572 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125166.1 protein_id gnl|my_center|LOCUS_02910 8489 7833 gene locus_tag LOCUS_02920 8489 7833 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_02920 9542 8772 gene locus_tag LOCUS_02930 9542 8772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866420.1 protein_id gnl|my_center|LOCUS_02930 9750 10013 gene locus_tag LOCUS_02940 9750 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125236.1 protein_id gnl|my_center|LOCUS_02940 10370 10047 gene locus_tag LOCUS_02950 gene grxD 10370 10047 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_02950 10696 10454 gene locus_tag LOCUS_02960 10696 10454 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125238.1 protein_id gnl|my_center|LOCUS_02960 11274 10723 gene locus_tag LOCUS_02970 11274 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125239.1 protein_id gnl|my_center|LOCUS_02970 12691 11297 gene locus_tag LOCUS_02980 12691 11297 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_02980 12706 13905 gene locus_tag LOCUS_02990 12706 13905 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057501.1 protein_id gnl|my_center|LOCUS_02990 14717 13866 gene locus_tag LOCUS_03000 14717 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14780 15529 gene locus_tag LOCUS_03010 14780 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124639.1 protein_id gnl|my_center|LOCUS_03010 16677 15550 gene locus_tag LOCUS_03020 gene ald 16677 15550 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125750.1 protein_id gnl|my_center|LOCUS_03020 17625 16696 gene locus_tag LOCUS_03030 gene glyQ 17625 16696 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125419.1 protein_id gnl|my_center|LOCUS_03030 17728 17976 gene locus_tag LOCUS_03040 17728 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18076 18783 gene locus_tag LOCUS_03050 gene tpiA 18076 18783 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125053.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence014 1869 1135 gene locus_tag LOCUS_03060 1869 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2080 1889 gene locus_tag LOCUS_03070 2080 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2472 2299 gene locus_tag LOCUS_03080 2472 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2642 2923 gene locus_tag LOCUS_03090 2642 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3040 3528 gene locus_tag LOCUS_03100 3040 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4066 3863 gene locus_tag LOCUS_03110 4066 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 6765 6424 gene locus_tag LOCUS_03120 6765 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8115 7402 gene locus_tag LOCUS_03130 8115 7402 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124929.1 protein_id gnl|my_center|LOCUS_03130 8158 8616 gene locus_tag LOCUS_03140 8158 8616 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_03140 8613 9368 gene locus_tag LOCUS_03150 8613 9368 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124928.1 protein_id gnl|my_center|LOCUS_03150 9693 9298 gene locus_tag LOCUS_03160 9693 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10221 10535 gene locus_tag LOCUS_03170 10221 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10661 10452 gene locus_tag LOCUS_03180 10661 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11295 11543 gene locus_tag LOCUS_03190 11295 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11738 12388 gene locus_tag LOCUS_03200 11738 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12595 12993 gene locus_tag LOCUS_03210 12595 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12905 14227 gene locus_tag LOCUS_03220 12905 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 14250 14591 gene locus_tag LOCUS_03230 14250 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 15363 14497 gene locus_tag LOCUS_03240 15363 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 16009 15272 gene locus_tag LOCUS_03250 16009 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16529 15972 gene locus_tag LOCUS_03260 16529 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 16769 16569 gene locus_tag LOCUS_03270 16769 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 16981 16682 gene locus_tag LOCUS_03280 16981 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 17914 17045 gene locus_tag LOCUS_03290 17914 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03290 18305 18057 gene locus_tag LOCUS_03300 18305 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence015 333 1946 gene locus_tag LOCUS_03310 333 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1946 3286 gene locus_tag LOCUS_03320 1946 3286 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125883.1 protein_id gnl|my_center|LOCUS_03320 3397 3819 gene locus_tag LOCUS_03330 3397 3819 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_03330 3855 5369 gene locus_tag LOCUS_03340 3855 5369 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125881.1 protein_id gnl|my_center|LOCUS_03340 5366 6553 gene locus_tag LOCUS_03350 gene gshA 5366 6553 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_03350 6550 9537 gene locus_tag LOCUS_03360 gene ppc 6550 9537 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125879.1 protein_id gnl|my_center|LOCUS_03360 9550 10011 gene locus_tag LOCUS_03370 9550 10011 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125878.1 protein_id gnl|my_center|LOCUS_03370 10125 10051 gene locus_tag LOCUS_t00050 10125 10051 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10148 11323 gene locus_tag LOCUS_03380 gene recF 10148 11323 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071820854.1 protein_id gnl|my_center|LOCUS_03380 11503 11300 gene locus_tag LOCUS_03390 11503 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13272 11899 gene locus_tag LOCUS_03400 gene thiC 13272 11899 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892565.1 protein_id gnl|my_center|LOCUS_03400 14124 13411 gene locus_tag LOCUS_03410 14124 13411 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_03410 14548 14228 gene locus_tag LOCUS_03420 14548 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14834 14613 gene locus_tag LOCUS_03430 14834 14613 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125734.1 protein_id gnl|my_center|LOCUS_03430 14888 15859 gene locus_tag LOCUS_03440 gene rnz 14888 15859 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125581.1 protein_id gnl|my_center|LOCUS_03440 15959 16495 gene locus_tag LOCUS_03450 gene psbV 15959 16495 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence016 1154 687 gene locus_tag LOCUS_03460 1154 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1860 1135 gene locus_tag LOCUS_03470 1860 1135 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125508.1 protein_id gnl|my_center|LOCUS_03470 2971 1952 gene locus_tag LOCUS_03480 2971 1952 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125509.1 protein_id gnl|my_center|LOCUS_03480 3258 2980 gene locus_tag LOCUS_03490 3258 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4872 3394 gene locus_tag LOCUS_03500 gene ffh 4872 3394 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125511.1 protein_id gnl|my_center|LOCUS_03500 7103 4968 gene locus_tag LOCUS_03510 7103 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 7271 8326 gene locus_tag LOCUS_03520 gene pdhA 7271 8326 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125513.1 protein_id gnl|my_center|LOCUS_03520 9308 8397 gene locus_tag LOCUS_03530 gene lipA 9308 8397 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892525.1 protein_id gnl|my_center|LOCUS_03530 9336 9410 gene locus_tag LOCUS_t00060 9336 9410 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11260 9401 gene locus_tag LOCUS_03540 gene cobJ 11260 9401 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_03540 11569 13875 gene locus_tag LOCUS_03550 gene psaA 11569 13875 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_03550 13897 16110 gene locus_tag LOCUS_03560 gene psaB 13897 16110 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125822.1 protein_id gnl|my_center|LOCUS_03560 16543 16211 gene locus_tag LOCUS_03570 16543 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence017 459 1871 gene locus_tag LOCUS_03580 459 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3199 1880 gene locus_tag LOCUS_03590 3199 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3549 3220 gene locus_tag LOCUS_03600 3549 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4945 3575 gene locus_tag LOCUS_03610 4945 3575 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892595.1 protein_id gnl|my_center|LOCUS_03610 5150 5539 gene locus_tag LOCUS_03620 5150 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6351 5542 gene locus_tag LOCUS_03630 6351 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6874 6671 gene locus_tag LOCUS_03640 6874 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124415.1 protein_id gnl|my_center|LOCUS_03640 6985 6913 gene locus_tag LOCUS_t00070 6985 6913 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7041 7271 gene locus_tag LOCUS_03650 7041 7271 CDS product DUF2555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124414.1 protein_id gnl|my_center|LOCUS_03650 7258 8544 gene locus_tag LOCUS_03660 gene coaBC 7258 8544 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124413.1 protein_id gnl|my_center|LOCUS_03660 8829 8560 gene locus_tag LOCUS_03670 8829 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_03670 8987 9805 gene locus_tag LOCUS_03680 8987 9805 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_03680 9947 11110 gene locus_tag LOCUS_03690 gene sat 9947 11110 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124411.1 protein_id gnl|my_center|LOCUS_03690 11170 13026 gene locus_tag LOCUS_03700 gene ftsH 11170 13026 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892144.1 protein_id gnl|my_center|LOCUS_03700 13079 13759 gene locus_tag LOCUS_03710 13079 13759 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029031.1 protein_id gnl|my_center|LOCUS_03710 13857 14405 gene locus_tag LOCUS_03720 13857 14405 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124997.1 protein_id gnl|my_center|LOCUS_03720 16074 14398 gene locus_tag LOCUS_03730 gene ilvD 16074 14398 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_03730 16470 16165 gene locus_tag LOCUS_03740 16470 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence018 112 615 gene locus_tag LOCUS_03750 112 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 4234 752 gene locus_tag LOCUS_03760 gene addA 4234 752 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 protein_id gnl|my_center|LOCUS_03760 7293 4231 gene locus_tag LOCUS_03770 gene addB 7293 4231 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336807.1 protein_id gnl|my_center|LOCUS_03770 7616 7843 gene locus_tag LOCUS_03780 7616 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7858 9381 gene locus_tag LOCUS_03790 7858 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9576 9830 gene locus_tag LOCUS_03800 9576 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9845 10111 gene locus_tag LOCUS_03810 9845 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 10221 10454 gene locus_tag LOCUS_03820 10221 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10793 11239 gene locus_tag LOCUS_03830 10793 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11280 11909 gene locus_tag LOCUS_03840 11280 11909 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968621.1 protein_id gnl|my_center|LOCUS_03840 11909 12514 gene locus_tag LOCUS_03850 11909 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 12511 13086 gene locus_tag LOCUS_03860 12511 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 13469 13948 gene locus_tag LOCUS_03870 13469 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14302 15486 gene locus_tag LOCUS_03880 14302 15486 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_03880 15470 16615 gene locus_tag LOCUS_03890 15470 16615 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence019 315 812 gene locus_tag LOCUS_03900 315 812 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892330.1 protein_id gnl|my_center|LOCUS_03900 2358 919 gene locus_tag LOCUS_03910 gene dnaA 2358 919 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124720.1 protein_id gnl|my_center|LOCUS_03910 2619 3773 gene locus_tag LOCUS_03920 2619 3773 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_03920 3774 4553 gene locus_tag LOCUS_03930 3774 4553 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923209.1 protein_id gnl|my_center|LOCUS_03930 4878 4498 gene locus_tag LOCUS_03940 4878 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5596 4904 gene locus_tag LOCUS_03950 5596 4904 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_03950 6128 5586 gene locus_tag LOCUS_03960 6128 5586 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124717.1 protein_id gnl|my_center|LOCUS_03960 7008 6550 gene locus_tag LOCUS_03970 7008 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7162 7503 gene locus_tag LOCUS_03980 7162 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7500 8405 gene locus_tag LOCUS_03990 7500 8405 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_03990 8402 9253 gene locus_tag LOCUS_04000 8402 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9322 10803 gene locus_tag LOCUS_04010 9322 10803 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_04010 10800 11753 gene locus_tag LOCUS_04020 10800 11753 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_04020 12767 11823 gene locus_tag LOCUS_04030 gene dusA 12767 11823 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124169.1 protein_id gnl|my_center|LOCUS_04030 12886 13410 gene locus_tag LOCUS_04040 gene msrB 12886 13410 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_04040 13432 13941 gene locus_tag LOCUS_04050 13432 13941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_04050 15401 14115 gene locus_tag LOCUS_04060 15401 14115 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866418.1 protein_id gnl|my_center|LOCUS_04060 15513 16319 gene locus_tag LOCUS_04070 15513 16319 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence020 498 247 gene locus_tag LOCUS_04080 498 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 619 1170 gene locus_tag LOCUS_04090 619 1170 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919983.1 protein_id gnl|my_center|LOCUS_04090 1838 1185 gene locus_tag LOCUS_04100 1838 1185 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_04100 2989 1859 gene locus_tag LOCUS_04110 2989 1859 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125874.1 protein_id gnl|my_center|LOCUS_04110 3087 3929 gene locus_tag LOCUS_04120 gene larE 3087 3929 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892534.1 protein_id gnl|my_center|LOCUS_04120 4048 4584 gene locus_tag LOCUS_04130 gene fldA 4048 4584 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125316.1 protein_id gnl|my_center|LOCUS_04130 4784 6466 gene locus_tag LOCUS_04140 4784 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7574 6432 gene locus_tag LOCUS_04150 7574 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9141 7564 gene locus_tag LOCUS_04160 gene metG 9141 7564 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125122.1 protein_id gnl|my_center|LOCUS_04160 9228 11054 gene locus_tag LOCUS_04170 9228 11054 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057660.1 protein_id gnl|my_center|LOCUS_04170 12285 11035 gene locus_tag LOCUS_04180 12285 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 12590 12372 gene locus_tag LOCUS_04190 gene rpsR 12590 12372 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 protein_id gnl|my_center|LOCUS_04190 12845 12651 gene locus_tag LOCUS_04200 gene rpmG 12845 12651 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_04200 13019 15427 gene locus_tag LOCUS_04210 gene pheT 13019 15427 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_04210 15539 16033 gene locus_tag LOCUS_04220 15539 16033 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence021 607 407 gene locus_tag LOCUS_04230 607 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 708 1586 gene locus_tag LOCUS_04240 708 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3387 1594 gene locus_tag LOCUS_04250 3387 1594 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124982.1 protein_id gnl|my_center|LOCUS_04250 3807 4916 gene locus_tag LOCUS_04260 3807 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 4815 4824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4837 5568 gene locus_tag LOCUS_04270 4837 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 8388 5590 gene locus_tag LOCUS_04280 gene gcvP 8388 5590 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125978.1 protein_id gnl|my_center|LOCUS_04280 10285 9278 gene locus_tag LOCUS_04290 10285 9278 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125232.1 protein_id gnl|my_center|LOCUS_04290 11368 10313 gene locus_tag LOCUS_04300 gene hemE 11368 10313 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_04300 13653 11431 gene locus_tag LOCUS_04310 gene glgB 13653 11431 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125230.1 protein_id gnl|my_center|LOCUS_04310 13570 13782 gene locus_tag LOCUS_04320 13570 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 15274 13787 gene locus_tag LOCUS_04330 15274 13787 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125229.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence022 <1 2483 gene locus_tag LOCUS_04340 <1 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124854.1:AAA family ATPase 3258 2908 gene locus_tag LOCUS_04350 3258 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3445 3885 gene locus_tag LOCUS_04360 gene smpB 3445 3885 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125925.1 protein_id gnl|my_center|LOCUS_04360 4877 3894 gene locus_tag LOCUS_04370 4877 3894 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_04370 4985 6313 gene locus_tag LOCUS_04380 gene egtB 4985 6313 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_04380 6322 7335 gene locus_tag LOCUS_04390 gene egtD 6322 7335 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_04390 7342 7587 gene locus_tag LOCUS_04400 7342 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7590 8075 gene locus_tag LOCUS_04410 7590 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8342 8079 gene locus_tag LOCUS_04420 8342 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125927.1 protein_id gnl|my_center|LOCUS_04420 9962 8436 gene locus_tag LOCUS_04430 gene lysS 9962 8436 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125928.1 protein_id gnl|my_center|LOCUS_04430 10857 9982 gene locus_tag LOCUS_04440 10857 9982 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039745.1 protein_id gnl|my_center|LOCUS_04440 12260 10995 gene locus_tag LOCUS_04450 12260 10995 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_04450 12921 12322 gene locus_tag LOCUS_04460 12921 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125930.1 protein_id gnl|my_center|LOCUS_04460 13709 12918 gene locus_tag LOCUS_04470 gene mreC 13709 12918 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125931.1 protein_id gnl|my_center|LOCUS_04470 14777 13731 gene locus_tag LOCUS_04480 14777 13731 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125932.1 protein_id gnl|my_center|LOCUS_04480 14993 15376 gene locus_tag LOCUS_04490 14993 15376 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence023 1351 209 gene locus_tag LOCUS_04500 gene thrC 1351 209 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_04500 1819 2004 gene locus_tag LOCUS_04510 1819 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2694 2005 gene locus_tag LOCUS_04520 2694 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5851 2756 gene locus_tag LOCUS_04530 5851 2756 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125993.1 protein_id gnl|my_center|LOCUS_04530 6397 6032 gene locus_tag LOCUS_04540 6397 6032 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124728.1 protein_id gnl|my_center|LOCUS_04540 6545 6853 gene locus_tag LOCUS_04550 6545 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7037 7366 gene locus_tag LOCUS_04560 7037 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7677 8006 gene locus_tag LOCUS_04570 7677 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8177 11239 gene locus_tag LOCUS_04580 8177 11239 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_04580 11236 11688 gene locus_tag LOCUS_04590 11236 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 11692 12189 gene locus_tag LOCUS_04600 11692 12189 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968621.1 protein_id gnl|my_center|LOCUS_04600 12189 13364 gene locus_tag LOCUS_04610 12189 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968622.1 protein_id gnl|my_center|LOCUS_04610 14728 15324 gene locus_tag LOCUS_04620 14728 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence024 655 1908 gene locus_tag LOCUS_04630 655 1908 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_04630 3289 1883 gene locus_tag LOCUS_04640 3289 1883 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126016.1 protein_id gnl|my_center|LOCUS_04640 5902 3308 gene locus_tag LOCUS_04650 gene acnB 5902 3308 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126015.1 protein_id gnl|my_center|LOCUS_04650 6114 5923 gene locus_tag LOCUS_04660 6114 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7516 7214 gene locus_tag LOCUS_04670 7516 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7931 7596 gene locus_tag LOCUS_04680 7931 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8606 8400 gene locus_tag LOCUS_04690 8606 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8912 9997 gene locus_tag LOCUS_04700 8912 9997 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126014.1 protein_id gnl|my_center|LOCUS_04700 10637 9987 gene locus_tag LOCUS_04710 10637 9987 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923313.1 protein_id gnl|my_center|LOCUS_04710 11575 10649 gene locus_tag LOCUS_04720 11575 10649 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126012.1 protein_id gnl|my_center|LOCUS_04720 12513 11746 gene locus_tag LOCUS_04730 12513 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 13406 12528 gene locus_tag LOCUS_04740 13406 12528 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_04740 14178 13441 gene locus_tag LOCUS_04750 gene phnC 14178 13441 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence025 410 4057 gene locus_tag LOCUS_04760 410 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4810 8394 gene locus_tag LOCUS_04770 4810 8394 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 protein_id gnl|my_center|LOCUS_04770 8861 8559 gene locus_tag LOCUS_04780 8861 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9846 9307 gene locus_tag LOCUS_04790 9846 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_04790 10495 10019 gene locus_tag LOCUS_04800 10495 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 11222 10524 gene locus_tag LOCUS_04810 11222 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 12091 11534 gene locus_tag LOCUS_04820 12091 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 12254 12628 gene locus_tag LOCUS_04830 12254 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 12836 13138 gene locus_tag LOCUS_04840 12836 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 13491 13192 gene locus_tag LOCUS_04850 13491 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence026 679 996 gene locus_tag LOCUS_04860 679 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04860 2784 2158 gene locus_tag LOCUS_04870 2784 2158 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124454.1 protein_id gnl|my_center|LOCUS_04870 2840 4375 gene locus_tag LOCUS_04880 gene purH 2840 4375 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124453.1 protein_id gnl|my_center|LOCUS_04880 4458 4919 gene locus_tag LOCUS_04890 4458 4919 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_04890 6153 4924 gene locus_tag LOCUS_04900 6153 4924 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_04900 7772 6306 gene locus_tag LOCUS_04910 7772 6306 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124450.1 protein_id gnl|my_center|LOCUS_04910 8711 7929 gene locus_tag LOCUS_04920 gene sfsA 8711 7929 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124449.1 protein_id gnl|my_center|LOCUS_04920 9239 8961 gene locus_tag LOCUS_04930 9239 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 9657 9418 gene locus_tag LOCUS_04940 9657 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 9728 11401 gene locus_tag LOCUS_04950 gene murJ 9728 11401 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124448.1 protein_id gnl|my_center|LOCUS_04950 11757 11428 gene locus_tag LOCUS_04960 11757 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 12052 11768 gene locus_tag LOCUS_04970 12052 11768 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124446.1 protein_id gnl|my_center|LOCUS_04970 12134 12209 gene locus_tag LOCUS_t00080 12134 12209 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12311 13570 gene locus_tag LOCUS_04980 12311 13570 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124445.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence027 247 726 gene locus_tag LOCUS_04990 247 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 732 1934 gene locus_tag LOCUS_05000 732 1934 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125922.1 protein_id gnl|my_center|LOCUS_05000 1937 2188 gene locus_tag LOCUS_05010 1937 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3053 2079 gene locus_tag LOCUS_05020 3053 2079 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_05020 3718 3065 gene locus_tag LOCUS_05030 3718 3065 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_05030 4091 3771 gene locus_tag LOCUS_05040 gene rpsJ 4091 3771 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_05040 5450 4221 gene locus_tag LOCUS_05050 gene tuf 5450 4221 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125813.1 protein_id gnl|my_center|LOCUS_05050 7568 5493 gene locus_tag LOCUS_05060 gene fusA 7568 5493 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125814.1 protein_id gnl|my_center|LOCUS_05060 8157 7687 gene locus_tag LOCUS_05070 gene rpsG 8157 7687 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125815.1 protein_id gnl|my_center|LOCUS_05070 8596 8222 gene locus_tag LOCUS_05080 gene rpsL 8596 8222 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125816.1 protein_id gnl|my_center|LOCUS_05080 9007 8651 gene locus_tag LOCUS_05090 9007 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 10468 9017 gene locus_tag LOCUS_05100 10468 9017 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence028 1761 91 gene locus_tag LOCUS_05110 gene gpmI 1761 91 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125737.1 protein_id gnl|my_center|LOCUS_05110 1927 2487 gene locus_tag LOCUS_05120 gene pyrR 1927 2487 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042503000.1 protein_id gnl|my_center|LOCUS_05120 2748 2527 gene locus_tag LOCUS_05130 2748 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3704 2871 gene locus_tag LOCUS_05140 3704 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5350 3719 gene locus_tag LOCUS_05150 5350 3719 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125735.1 protein_id gnl|my_center|LOCUS_05150 6156 5353 gene locus_tag LOCUS_05160 6156 5353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124365.1 protein_id gnl|my_center|LOCUS_05160 6780 6181 gene locus_tag LOCUS_05170 6780 6181 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124364.1 protein_id gnl|my_center|LOCUS_05170 7196 6783 gene locus_tag LOCUS_05180 7196 6783 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124363.1 protein_id gnl|my_center|LOCUS_05180 7749 7207 gene locus_tag LOCUS_05190 7749 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7956 7801 gene locus_tag LOCUS_05200 7956 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9017 7953 gene locus_tag LOCUS_05210 gene prfB 9017 7953 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152557459.1 protein_id gnl|my_center|LOCUS_05210 9108 9437 gene locus_tag LOCUS_05220 gene grxC 9108 9437 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124359.1 protein_id gnl|my_center|LOCUS_05220 9456 10424 gene locus_tag LOCUS_05230 gene gshB 9456 10424 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124358.1 protein_id gnl|my_center|LOCUS_05230 10566 10754 gene locus_tag LOCUS_05240 10566 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 11951 10815 gene locus_tag LOCUS_05250 11951 10815 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_05250 12611 11970 gene locus_tag LOCUS_05260 12611 11970 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence029 1402 239 gene locus_tag LOCUS_05270 1402 239 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_05270 1478 2341 gene locus_tag LOCUS_05280 1478 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3925 2378 gene locus_tag LOCUS_05290 gene malQ 3925 2378 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125268.1 protein_id gnl|my_center|LOCUS_05290 4902 3904 gene locus_tag LOCUS_05300 gene bciA 4902 3904 CDS product NADPH-dependent 3,8-divinyl protochlorophyllide a 8-vinyl-reductase BciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932741.1 protein_id gnl|my_center|LOCUS_05300 5145 6359 gene locus_tag LOCUS_05310 5145 6359 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228148.1 protein_id gnl|my_center|LOCUS_05310 7796 6387 gene locus_tag LOCUS_05320 gene glgA 7796 6387 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125204.1 protein_id gnl|my_center|LOCUS_05320 8987 8337 gene locus_tag LOCUS_05330 8987 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 9059 9259 gene locus_tag LOCUS_05340 9059 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9620 11272 gene locus_tag LOCUS_05350 9620 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11633 11890 gene locus_tag LOCUS_05360 11633 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 11987 12523 gene locus_tag LOCUS_05370 11987 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12502 12852 gene locus_tag LOCUS_05380 12502 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05380 >Feature sequence030 364 185 gene locus_tag LOCUS_05390 364 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1130 2263 gene locus_tag LOCUS_05400 1130 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2319 2519 gene locus_tag LOCUS_05410 2319 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2538 3020 gene locus_tag LOCUS_05420 2538 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3293 3964 gene locus_tag LOCUS_05430 gene ruvA 3293 3964 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_05430 4012 4281 gene locus_tag LOCUS_05440 gene rpsO 4012 4281 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124905.1 protein_id gnl|my_center|LOCUS_05440 4448 4732 gene locus_tag LOCUS_05450 4448 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4943 4779 gene locus_tag LOCUS_05460 4943 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8647 5039 gene locus_tag LOCUS_05470 8647 5039 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124903.1 protein_id gnl|my_center|LOCUS_05470 8934 9686 gene locus_tag LOCUS_05480 8934 9686 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892378.1 protein_id gnl|my_center|LOCUS_05480 10515 9715 gene locus_tag LOCUS_05490 10515 9715 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_05490 11827 10661 gene locus_tag LOCUS_05500 11827 10661 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_05500 11900 12292 gene locus_tag LOCUS_05510 11900 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 12418 13047 gene locus_tag LOCUS_05520 12418 13047 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence031 1819 815 gene locus_tag LOCUS_05530 1819 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5438 1854 gene locus_tag LOCUS_05540 gene smc 5438 1854 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011127215.1 protein_id gnl|my_center|LOCUS_05540 5597 6103 gene locus_tag LOCUS_05550 5597 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6178 6516 gene locus_tag LOCUS_05560 6178 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7297 7623 gene locus_tag LOCUS_05570 7297 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8891 7689 gene locus_tag LOCUS_05580 8891 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 9093 9983 gene locus_tag LOCUS_05590 gene fabD 9093 9983 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124314.1 protein_id gnl|my_center|LOCUS_05590 9991 10695 gene locus_tag LOCUS_05600 9991 10695 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892123.1 protein_id gnl|my_center|LOCUS_05600 11227 10649 gene locus_tag LOCUS_05610 11227 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 11883 11224 gene locus_tag LOCUS_05620 gene tsaB 11883 11224 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124317.1 protein_id gnl|my_center|LOCUS_05620 12149 11901 gene locus_tag LOCUS_05630 12149 11901 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence032 172 651 gene locus_tag LOCUS_05640 172 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1401 1114 gene locus_tag LOCUS_05650 1401 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1614 1447 gene locus_tag LOCUS_05660 1614 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2056 2556 gene locus_tag LOCUS_05670 gene sodN 2056 2556 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_05670 2553 2927 gene locus_tag LOCUS_05680 2553 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3735 3262 gene locus_tag LOCUS_05690 3735 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3958 5520 gene locus_tag LOCUS_05700 gene psbB 3958 5520 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_05700 5453 5632 gene locus_tag LOCUS_05710 5453 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5827 6291 gene locus_tag LOCUS_05720 gene nrdR 5827 6291 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_05720 6383 7531 gene locus_tag LOCUS_05730 6383 7531 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124506.1 protein_id gnl|my_center|LOCUS_05730 7567 8349 gene locus_tag LOCUS_05740 7567 8349 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_05740 8415 9653 gene locus_tag LOCUS_05750 gene metK 8415 9653 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124504.1 protein_id gnl|my_center|LOCUS_05750 9673 10926 gene locus_tag LOCUS_05760 9673 10926 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124503.1 protein_id gnl|my_center|LOCUS_05760 10948 12399 gene locus_tag LOCUS_05770 10948 12399 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence033 249 37 gene locus_tag LOCUS_05780 249 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 616 2229 gene locus_tag LOCUS_05790 616 2229 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891763.1 protein_id gnl|my_center|LOCUS_05790 3252 2293 gene locus_tag LOCUS_05800 3252 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4304 3360 gene locus_tag LOCUS_05810 4304 3360 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125514.1 protein_id gnl|my_center|LOCUS_05810 5984 4443 gene locus_tag LOCUS_05820 5984 4443 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125515.1 protein_id gnl|my_center|LOCUS_05820 6455 7606 gene locus_tag LOCUS_05830 gene mnmA 6455 7606 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125516.1 protein_id gnl|my_center|LOCUS_05830 7629 7704 gene locus_tag LOCUS_t00090 7629 7704 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7722 11072 gene locus_tag LOCUS_05840 gene drmD 7722 11072 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083686.1 protein_id gnl|my_center|LOCUS_05840 11164 11406 gene locus_tag LOCUS_05850 11164 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 11403 12224 gene locus_tag LOCUS_05860 11403 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence034 1563 1150 gene locus_tag LOCUS_05870 1563 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2035 1793 gene locus_tag LOCUS_05880 2035 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3169 2060 gene locus_tag LOCUS_05890 gene mraY 3169 2060 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126027.1 protein_id gnl|my_center|LOCUS_05890 3510 3223 gene locus_tag LOCUS_05900 3510 3223 CDS product DUF3134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126026.1 protein_id gnl|my_center|LOCUS_05900 3553 3777 gene locus_tag LOCUS_05910 3553 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3782 4981 gene locus_tag LOCUS_05920 3782 4981 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126024.1 protein_id gnl|my_center|LOCUS_05920 5435 4989 gene locus_tag LOCUS_05930 gene rpsF 5435 4989 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094588953.1 protein_id gnl|my_center|LOCUS_05930 5947 5456 gene locus_tag LOCUS_05940 5947 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126022.1 protein_id gnl|my_center|LOCUS_05940 6864 5974 gene locus_tag LOCUS_05950 6864 5974 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_05950 6987 8918 gene locus_tag LOCUS_05960 gene dnaK 6987 8918 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126020.1 protein_id gnl|my_center|LOCUS_05960 10284 9208 gene locus_tag LOCUS_05970 10284 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 10404 10634 gene locus_tag LOCUS_05980 10404 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 11016 10807 gene locus_tag LOCUS_05990 11016 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11614 10910 gene locus_tag LOCUS_06000 11614 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence035 1960 125 gene locus_tag LOCUS_06010 1960 125 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_06010 3359 1950 gene locus_tag LOCUS_06020 gene clpX 3359 1950 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125966.1 protein_id gnl|my_center|LOCUS_06020 4912 3461 gene locus_tag LOCUS_06030 gene tig 4912 3461 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_06030 5048 6148 gene locus_tag LOCUS_06040 5048 6148 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125963.1 protein_id gnl|my_center|LOCUS_06040 6145 7080 gene locus_tag LOCUS_06050 gene dapA 6145 7080 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125962.1 protein_id gnl|my_center|LOCUS_06050 7089 9119 gene locus_tag LOCUS_06060 7089 9119 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125961.1 protein_id gnl|my_center|LOCUS_06060 9168 9977 gene locus_tag LOCUS_06070 9168 9977 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125864.1 protein_id gnl|my_center|LOCUS_06070 9990 11231 gene locus_tag LOCUS_06080 gene recA 9990 11231 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_06080 11733 11485 gene locus_tag LOCUS_06090 11733 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence036 312 650 gene locus_tag LOCUS_06100 312 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 832 617 gene locus_tag LOCUS_06110 832 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2285 1305 gene locus_tag LOCUS_06120 2285 1305 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124417.1 protein_id gnl|my_center|LOCUS_06120 2992 2324 gene locus_tag LOCUS_06130 2992 2324 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866396.1 protein_id gnl|my_center|LOCUS_06130 2991 3182 gene locus_tag LOCUS_06140 2991 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3553 3230 gene locus_tag LOCUS_06150 3553 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_06150 3644 4417 gene locus_tag LOCUS_06160 3644 4417 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_06160 4466 4771 gene locus_tag LOCUS_06170 gene gatC 4466 4771 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124420.1 protein_id gnl|my_center|LOCUS_06170 5685 4768 gene locus_tag LOCUS_06180 5685 4768 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124421.1 protein_id gnl|my_center|LOCUS_06180 5984 7672 gene locus_tag LOCUS_06190 5984 7672 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 protein_id gnl|my_center|LOCUS_06190 8079 8088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8332 8250 gene locus_tag LOCUS_t00100 8332 8250 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8498 9490 gene locus_tag LOCUS_06200 8498 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9626 9853 gene locus_tag LOCUS_06210 9626 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10109 10369 gene locus_tag LOCUS_06220 gene purS 10109 10369 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125005.1 protein_id gnl|my_center|LOCUS_06220 10371 11042 gene locus_tag LOCUS_06230 gene purQ 10371 11042 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125006.1 protein_id gnl|my_center|LOCUS_06230 11643 11035 gene locus_tag LOCUS_06240 11643 11035 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence037 1499 954 gene locus_tag LOCUS_06250 1499 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3208 2006 gene locus_tag LOCUS_06260 3208 2006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_06260 3694 5748 gene locus_tag LOCUS_06270 3694 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_06270 5735 6940 gene locus_tag LOCUS_06280 5735 6940 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_06280 7017 7382 gene locus_tag LOCUS_06290 7017 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8009 7716 gene locus_tag LOCUS_06300 8009 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8192 8470 gene locus_tag LOCUS_06310 8192 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 8373 9230 gene locus_tag LOCUS_06320 8373 9230 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 9806 9276 gene locus_tag LOCUS_06330 gene ilvN 9806 9276 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125403.1 protein_id gnl|my_center|LOCUS_06330 10708 9839 gene locus_tag LOCUS_06340 10708 9839 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125402.1 protein_id gnl|my_center|LOCUS_06340 10749 11078 gene locus_tag LOCUS_06350 10749 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11197 11409 gene locus_tag LOCUS_06360 11197 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence038 612 70 gene locus_tag LOCUS_06370 612 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1313 693 gene locus_tag LOCUS_06380 1313 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 1569 1333 gene locus_tag LOCUS_06390 1569 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 1665 3461 gene locus_tag LOCUS_06400 1665 3461 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124619.1 protein_id gnl|my_center|LOCUS_06400 3483 4259 gene locus_tag LOCUS_06410 gene tatC 3483 4259 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124617.1 protein_id gnl|my_center|LOCUS_06410 4581 4288 gene locus_tag LOCUS_06420 4581 4288 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_06420 4738 5274 gene locus_tag LOCUS_06430 4738 5274 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124615.1 protein_id gnl|my_center|LOCUS_06430 5317 6252 gene locus_tag LOCUS_06440 gene petA 5317 6252 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_06440 6334 7191 gene locus_tag LOCUS_06450 gene lgt 6334 7191 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124613.1 protein_id gnl|my_center|LOCUS_06450 7218 7985 gene locus_tag LOCUS_06460 gene cobM 7218 7985 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124612.1 protein_id gnl|my_center|LOCUS_06460 8236 8934 gene locus_tag LOCUS_06470 8236 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 9009 9428 gene locus_tag LOCUS_06480 9009 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10330 9491 gene locus_tag LOCUS_06490 10330 9491 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126006.1 protein_id gnl|my_center|LOCUS_06490 11790 10327 gene locus_tag LOCUS_06500 11790 10327 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126005.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence039 890 1963 gene locus_tag LOCUS_06510 gene galE 890 1963 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_06510 1966 3315 gene locus_tag LOCUS_06520 gene hisS 1966 3315 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124931.1 protein_id gnl|my_center|LOCUS_06520 3488 3291 gene locus_tag LOCUS_06530 3488 3291 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124486.1 protein_id gnl|my_center|LOCUS_06530 4041 3781 gene locus_tag LOCUS_06540 gene psbE 4041 3781 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124483.1 protein_id gnl|my_center|LOCUS_06540 5145 4144 gene locus_tag LOCUS_06550 5145 4144 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124482.1 protein_id gnl|my_center|LOCUS_06550 5679 5200 gene locus_tag LOCUS_06560 5679 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5807 6169 gene locus_tag LOCUS_06570 5807 6169 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124480.1 protein_id gnl|my_center|LOCUS_06570 6282 7049 gene locus_tag LOCUS_06580 gene nuoB 6282 7049 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124479.1 protein_id gnl|my_center|LOCUS_06580 7046 7591 gene locus_tag LOCUS_06590 7046 7591 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124478.1 protein_id gnl|my_center|LOCUS_06590 8209 7625 gene locus_tag LOCUS_06600 8209 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8894 8418 gene locus_tag LOCUS_06610 8894 8418 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328877.1 protein_id gnl|my_center|LOCUS_06610 10417 9074 gene locus_tag LOCUS_06620 gene gorA 10417 9074 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124722.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence040 1376 426 gene locus_tag LOCUS_06630 1376 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2451 4757 gene locus_tag LOCUS_06640 gene priA 2451 4757 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124651.1 protein_id gnl|my_center|LOCUS_06640 5641 4769 gene locus_tag LOCUS_06650 gene argB 5641 4769 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124653.1 protein_id gnl|my_center|LOCUS_06650 6195 5653 gene locus_tag LOCUS_06660 6195 5653 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124654.1 protein_id gnl|my_center|LOCUS_06660 6194 6481 gene locus_tag LOCUS_06670 6194 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6907 6503 gene locus_tag LOCUS_06680 6907 6503 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124656.1 protein_id gnl|my_center|LOCUS_06680 7118 7909 gene locus_tag LOCUS_06690 7118 7909 CDS product precorrin-6A/cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923208.1 protein_id gnl|my_center|LOCUS_06690 7909 8241 gene locus_tag LOCUS_06700 7909 8241 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_06700 9301 8264 gene locus_tag LOCUS_06710 9301 8264 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_06710 9678 9298 gene locus_tag LOCUS_06720 9678 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06720 10609 9728 gene locus_tag LOCUS_06730 10609 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 11105 10686 gene locus_tag LOCUS_06740 gene psb27 11105 10686 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_06740 <12096 11124 gene locus_tag LOCUS_06750 <12096 11124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124662.1:proline--tRNA ligase >Feature sequence041 150 455 gene locus_tag LOCUS_06760 150 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 422 619 gene locus_tag LOCUS_06770 422 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 797 1411 gene locus_tag LOCUS_06780 797 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1380 1754 gene locus_tag LOCUS_06790 1380 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1670 2272 gene locus_tag LOCUS_06800 1670 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2298 4064 gene locus_tag LOCUS_06810 gene argS 2298 4064 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124367.1 protein_id gnl|my_center|LOCUS_06810 4073 4750 gene locus_tag LOCUS_06820 4073 4750 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_06820 5273 4863 gene locus_tag LOCUS_06830 5273 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06830 6035 6134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6727 6455 gene locus_tag LOCUS_06840 6727 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6874 7053 gene locus_tag LOCUS_06850 6874 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7117 8250 gene locus_tag LOCUS_06860 7117 8250 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124366.1 protein_id gnl|my_center|LOCUS_06860 8493 9527 gene locus_tag LOCUS_06870 8493 9527 CDS product chlorophyll a/b binding light-harvesting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921141.1 protein_id gnl|my_center|LOCUS_06870 10033 9614 gene locus_tag LOCUS_06880 10033 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10812 10414 gene locus_tag LOCUS_06890 10812 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11414 11175 gene locus_tag LOCUS_06900 11414 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence042 233 1312 gene locus_tag LOCUS_06910 233 1312 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_06910 1457 1801 gene locus_tag LOCUS_06920 1457 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1813 2139 gene locus_tag LOCUS_06930 1813 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2172 2837 gene locus_tag LOCUS_06940 gene cysC 2172 2837 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124345.1 protein_id gnl|my_center|LOCUS_06940 2887 3588 gene locus_tag LOCUS_06950 gene queC 2887 3588 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_06950 3675 4145 gene locus_tag LOCUS_06960 gene ndk 3675 4145 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892097.1 protein_id gnl|my_center|LOCUS_06960 5296 4121 gene locus_tag LOCUS_06970 gene thiO 5296 4121 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124206.1 protein_id gnl|my_center|LOCUS_06970 5685 5293 gene locus_tag LOCUS_06980 gene gcvH 5685 5293 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_06980 7136 5883 gene locus_tag LOCUS_06990 7136 5883 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_06990 7259 8224 gene locus_tag LOCUS_07000 7259 8224 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_07000 8951 8211 gene locus_tag LOCUS_07010 8951 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892573.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence043 757 1209 gene locus_tag LOCUS_07020 757 1209 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125092.1 protein_id gnl|my_center|LOCUS_07020 2181 1246 gene locus_tag LOCUS_07030 2181 1246 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_07030 3837 2203 gene locus_tag LOCUS_07040 gene ribBA 3837 2203 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_07040 4247 3864 gene locus_tag LOCUS_07050 4247 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5305 4298 gene locus_tag LOCUS_07060 5305 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5464 6282 gene locus_tag LOCUS_07070 5464 6282 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124635.1 protein_id gnl|my_center|LOCUS_07070 7530 6283 gene locus_tag LOCUS_07080 gene moeA 7530 6283 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 protein_id gnl|my_center|LOCUS_07080 7875 7555 gene locus_tag LOCUS_07090 7875 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8155 8577 gene locus_tag LOCUS_07100 8155 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 8480 8489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8505 9221 gene locus_tag LOCUS_07110 8505 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9483 9226 gene locus_tag LOCUS_07120 9483 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 10402 9491 gene locus_tag LOCUS_07130 gene rsmI 10402 9491 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866376.1 protein_id gnl|my_center|LOCUS_07130 10452 11312 gene locus_tag LOCUS_07140 10452 11312 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence044 636 953 gene locus_tag LOCUS_07150 636 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 929 1537 gene locus_tag LOCUS_07160 929 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07160 1480 1710 gene locus_tag LOCUS_07170 1480 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 2065 2247 gene locus_tag LOCUS_07180 2065 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124402.1 protein_id gnl|my_center|LOCUS_07180 4452 2290 gene locus_tag LOCUS_07190 gene dnaG 4452 2290 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124909.1 protein_id gnl|my_center|LOCUS_07190 4470 6650 gene locus_tag LOCUS_07200 gene glyS 4470 6650 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124983.1 protein_id gnl|my_center|LOCUS_07200 7990 6608 gene locus_tag LOCUS_07210 gene chlP 7990 6608 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124984.1 protein_id gnl|my_center|LOCUS_07210 8132 8869 gene locus_tag LOCUS_07220 8132 8869 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124985.1 protein_id gnl|my_center|LOCUS_07220 8875 10683 gene locus_tag LOCUS_07230 gene typA 8875 10683 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124986.1 protein_id gnl|my_center|LOCUS_07230 10696 11094 gene locus_tag LOCUS_07240 10696 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11421 11212 gene locus_tag LOCUS_07250 11421 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11742 11491 gene locus_tag LOCUS_07260 11742 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence045 317 18 gene locus_tag LOCUS_07270 317 18 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_07270 1361 441 gene locus_tag LOCUS_07280 gene prmA 1361 441 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125586.1 protein_id gnl|my_center|LOCUS_07280 2979 1405 gene locus_tag LOCUS_07290 gene serA 2979 1405 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125587.1 protein_id gnl|my_center|LOCUS_07290 3049 3540 gene locus_tag LOCUS_07300 3049 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125588.1 protein_id gnl|my_center|LOCUS_07300 3540 4286 gene locus_tag LOCUS_07310 3540 4286 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057995.1 protein_id gnl|my_center|LOCUS_07310 4355 4426 gene locus_tag LOCUS_t00110 4355 4426 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4975 6018 gene locus_tag LOCUS_07320 gene argC 4975 6018 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125096.1 protein_id gnl|my_center|LOCUS_07320 6616 6038 gene locus_tag LOCUS_07330 gene purN 6616 6038 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_07330 6998 6714 gene locus_tag LOCUS_07340 6998 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124395.1 protein_id gnl|my_center|LOCUS_07340 8013 7003 gene locus_tag LOCUS_07350 8013 7003 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_07350 8112 8699 gene locus_tag LOCUS_07360 8112 8699 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124703.1 protein_id gnl|my_center|LOCUS_07360 8989 8723 gene locus_tag LOCUS_07370 8989 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9311 9081 gene locus_tag LOCUS_07380 9311 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9480 10943 gene locus_tag LOCUS_07390 9480 10943 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_07390 10937 11254 gene locus_tag LOCUS_07400 10937 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence046 2926 1940 gene locus_tag LOCUS_07410 2926 1940 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_07410 2925 3494 gene locus_tag LOCUS_07420 2925 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3709 4110 gene locus_tag LOCUS_07430 3709 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4866 4267 gene locus_tag LOCUS_07440 gene recR 4866 4267 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328872.1 protein_id gnl|my_center|LOCUS_07440 4957 6498 gene locus_tag LOCUS_07450 4957 6498 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124646.1 protein_id gnl|my_center|LOCUS_07450 6883 6392 gene locus_tag LOCUS_07460 6883 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07460 7511 7149 gene locus_tag LOCUS_07470 7511 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 7606 8772 gene locus_tag LOCUS_07480 7606 8772 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_07480 9089 8811 gene locus_tag LOCUS_07490 9089 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9487 9086 gene locus_tag LOCUS_07500 9487 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07500 11231 10467 gene locus_tag LOCUS_07510 11231 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence047 1981 344 gene locus_tag LOCUS_07520 1981 344 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125246.1 protein_id gnl|my_center|LOCUS_07520 4135 2699 gene locus_tag LOCUS_07530 gene cysS 4135 2699 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125387.1 protein_id gnl|my_center|LOCUS_07530 7178 4227 gene locus_tag LOCUS_07540 gene polA 7178 4227 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125386.1 protein_id gnl|my_center|LOCUS_07540 7965 7192 gene locus_tag LOCUS_07550 gene rnc 7965 7192 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125911.1 protein_id gnl|my_center|LOCUS_07550 8413 8490 gene locus_tag LOCUS_t00120 8413 8490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8560 8895 gene locus_tag LOCUS_07560 8560 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125910.1 protein_id gnl|my_center|LOCUS_07560 10750 9080 gene locus_tag LOCUS_07570 10750 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence048 290 90 gene locus_tag LOCUS_07580 290 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1440 565 gene locus_tag LOCUS_07590 1440 565 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_07590 2316 1447 gene locus_tag LOCUS_07600 2316 1447 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_07600 2380 2886 gene locus_tag LOCUS_07610 2380 2886 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_07610 4050 2947 gene locus_tag LOCUS_07620 gene prfA 4050 2947 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125832.1 protein_id gnl|my_center|LOCUS_07620 4326 4093 gene locus_tag LOCUS_07630 gene rpmE 4326 4093 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_07630 4754 4335 gene locus_tag LOCUS_07640 gene rpsI 4754 4335 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125834.1 protein_id gnl|my_center|LOCUS_07640 5206 4757 gene locus_tag LOCUS_07650 gene rplM 5206 4757 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125835.1 protein_id gnl|my_center|LOCUS_07650 6082 5234 gene locus_tag LOCUS_07660 gene truA 6082 5234 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125836.1 protein_id gnl|my_center|LOCUS_07660 6392 6042 gene locus_tag LOCUS_07670 gene rplQ 6392 6042 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_07670 7410 6436 gene locus_tag LOCUS_07680 7410 6436 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125838.1 protein_id gnl|my_center|LOCUS_07680 7807 7415 gene locus_tag LOCUS_07690 gene rpsK 7807 7415 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125839.1 protein_id gnl|my_center|LOCUS_07690 8235 7870 gene locus_tag LOCUS_07700 gene rpsM 8235 7870 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125840.1 protein_id gnl|my_center|LOCUS_07700 9045 8467 gene locus_tag LOCUS_07710 9045 8467 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125842.1 protein_id gnl|my_center|LOCUS_07710 10364 9042 gene locus_tag LOCUS_07720 gene secY 10364 9042 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125843.1 protein_id gnl|my_center|LOCUS_07720 10753 10421 gene locus_tag LOCUS_07730 10753 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence049 <1 761 gene locus_tag LOCUS_07740 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000614886.1:site-specific DNA-methyltransferase 1614 2258 gene locus_tag LOCUS_07750 1614 2258 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124494.1 protein_id gnl|my_center|LOCUS_07750 3159 2242 gene locus_tag LOCUS_07760 3159 2242 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_07760 3234 4553 gene locus_tag LOCUS_07770 3234 4553 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_07770 4871 5224 gene locus_tag LOCUS_07780 4871 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5116 5727 gene locus_tag LOCUS_07790 gene tmk 5116 5727 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124307.1 protein_id gnl|my_center|LOCUS_07790 5734 6711 gene locus_tag LOCUS_07800 5734 6711 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141432.1 protein_id gnl|my_center|LOCUS_07800 7513 6680 gene locus_tag LOCUS_07810 7513 6680 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124305.1 protein_id gnl|my_center|LOCUS_07810 8001 10079 gene locus_tag LOCUS_07820 8001 10079 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336961.1 protein_id gnl|my_center|LOCUS_07820 10185 10670 gene locus_tag LOCUS_07830 10185 10670 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124962.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence050 116 571 gene locus_tag LOCUS_07840 gene aroQ 116 571 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124539.1 protein_id gnl|my_center|LOCUS_07840 558 1175 gene locus_tag LOCUS_07850 558 1175 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124540.1 protein_id gnl|my_center|LOCUS_07850 1267 2022 gene locus_tag LOCUS_07860 1267 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2682 2053 gene locus_tag LOCUS_07870 gene lexA 2682 2053 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_07870 3721 2795 gene locus_tag LOCUS_07880 gene argF 3721 2795 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125488.1 protein_id gnl|my_center|LOCUS_07880 5539 3746 gene locus_tag LOCUS_07890 gene ftsH 5539 3746 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125489.1 protein_id gnl|my_center|LOCUS_07890 6802 5711 gene locus_tag LOCUS_07900 gene ribD 6802 5711 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125490.1 protein_id gnl|my_center|LOCUS_07900 9273 6802 gene locus_tag LOCUS_07910 9273 6802 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_07910 9882 9295 gene locus_tag LOCUS_07920 9882 9295 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124515.1 protein_id gnl|my_center|LOCUS_07920 10703 9879 gene locus_tag LOCUS_07930 gene prmC 10703 9879 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124514.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence051 713 1198 gene locus_tag LOCUS_07940 713 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3128 1815 gene locus_tag LOCUS_07950 3128 1815 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_07950 3347 3766 gene locus_tag LOCUS_07960 3347 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3763 6312 gene locus_tag LOCUS_07970 3763 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6314 7708 gene locus_tag LOCUS_07980 6314 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7727 9304 gene locus_tag LOCUS_07990 7727 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9308 10339 gene locus_tag LOCUS_08000 9308 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence052 709 942 gene locus_tag LOCUS_08010 709 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1207 992 gene locus_tag LOCUS_08020 1207 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3333 1312 gene locus_tag LOCUS_08030 3333 1312 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124234.1 protein_id gnl|my_center|LOCUS_08030 3697 3359 gene locus_tag LOCUS_08040 3697 3359 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124235.1 protein_id gnl|my_center|LOCUS_08040 4514 3732 gene locus_tag LOCUS_08050 4514 3732 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_08050 4999 4544 gene locus_tag LOCUS_08060 4999 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5279 5518 gene locus_tag LOCUS_08070 5279 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5805 5515 gene locus_tag LOCUS_08080 5805 5515 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125552.1 protein_id gnl|my_center|LOCUS_08080 6677 5982 gene locus_tag LOCUS_08090 6677 5982 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125553.1 protein_id gnl|my_center|LOCUS_08090 6809 8809 gene locus_tag LOCUS_08100 6809 8809 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039698.1 protein_id gnl|my_center|LOCUS_08100 8931 8859 gene locus_tag LOCUS_t00130 8931 8859 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8933 10303 gene locus_tag LOCUS_08110 8933 10303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125555.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence053 582 220 gene locus_tag LOCUS_08120 582 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1683 829 gene locus_tag LOCUS_08130 1683 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1946 1680 gene locus_tag LOCUS_08140 gene clpS 1946 1680 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125804.1 protein_id gnl|my_center|LOCUS_08140 3294 2059 gene locus_tag LOCUS_08150 3294 2059 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_08150 3371 6004 gene locus_tag LOCUS_08160 3371 6004 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_08160 6132 8204 gene locus_tag LOCUS_08170 6132 8204 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_08170 8164 8907 gene locus_tag LOCUS_08180 8164 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9379 8804 gene locus_tag LOCUS_08190 9379 8804 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892520.1 protein_id gnl|my_center|LOCUS_08190 9430 10371 gene locus_tag LOCUS_08200 gene pheA 9430 10371 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125810.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence054 832 221 gene locus_tag LOCUS_08210 832 221 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_08210 1906 938 gene locus_tag LOCUS_08220 1906 938 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_08220 3577 1991 gene locus_tag LOCUS_08230 3577 1991 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_08230 3899 3621 gene locus_tag LOCUS_08240 3899 3621 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_08240 4292 3906 gene locus_tag LOCUS_08250 4292 3906 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_08250 5635 4313 gene locus_tag LOCUS_08260 5635 4313 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891691.1 protein_id gnl|my_center|LOCUS_08260 6083 7432 gene locus_tag LOCUS_08270 gene aroA 6083 7432 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923230.1 protein_id gnl|my_center|LOCUS_08270 8509 7682 gene locus_tag LOCUS_08280 8509 7682 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124289.1 protein_id gnl|my_center|LOCUS_08280 9080 8499 gene locus_tag LOCUS_08290 gene purE 9080 8499 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141251.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence055 764 2050 gene locus_tag LOCUS_08300 gene dnaN 764 2050 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124156.1 protein_id gnl|my_center|LOCUS_08300 3422 2073 gene locus_tag LOCUS_08310 3422 2073 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124357.1 protein_id gnl|my_center|LOCUS_08310 3595 4494 gene locus_tag LOCUS_08320 gene menA 3595 4494 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124356.1 protein_id gnl|my_center|LOCUS_08320 4500 5489 gene locus_tag LOCUS_08330 4500 5489 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_08330 5507 6772 gene locus_tag LOCUS_08340 5507 6772 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124354.1 protein_id gnl|my_center|LOCUS_08340 7983 8987 gene locus_tag LOCUS_08350 7983 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10127 9693 gene locus_tag LOCUS_08360 10127 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08360 >Feature sequence056 <1 1483 gene locus_tag LOCUS_08370 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011129373.1:HAD family hydrolase 1776 1576 gene locus_tag LOCUS_08380 1776 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08380 2139 1792 gene locus_tag LOCUS_08390 2139 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08390 2434 2270 gene locus_tag LOCUS_08400 2434 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2643 3137 gene locus_tag LOCUS_08410 2643 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08410 3140 4957 gene locus_tag LOCUS_08420 3140 4957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124716.1 protein_id gnl|my_center|LOCUS_08420 5049 6341 gene locus_tag LOCUS_08430 5049 6341 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_08430 6346 6804 gene locus_tag LOCUS_08440 6346 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839539.1 protein_id gnl|my_center|LOCUS_08440 6901 9726 gene locus_tag LOCUS_08450 6901 9726 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_08450 9723 9944 gene locus_tag LOCUS_08460 9723 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence057 2086 3393 gene locus_tag LOCUS_08470 2086 3393 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125302.1 protein_id gnl|my_center|LOCUS_08470 3541 3768 gene locus_tag LOCUS_08480 3541 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3761 5377 gene locus_tag LOCUS_08490 3761 5377 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125304.1 protein_id gnl|my_center|LOCUS_08490 5386 6408 gene locus_tag LOCUS_08500 5386 6408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125305.1 protein_id gnl|my_center|LOCUS_08500 9687 6451 gene locus_tag LOCUS_08510 9687 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence058 165 476 gene locus_tag LOCUS_08520 165 476 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_08520 466 819 gene locus_tag LOCUS_08530 466 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2112 820 gene locus_tag LOCUS_08540 2112 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2425 3072 gene locus_tag LOCUS_08550 2425 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6519 3331 gene locus_tag LOCUS_08560 6519 3331 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_08560 7262 6516 gene locus_tag LOCUS_08570 7262 6516 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932365.1 protein_id gnl|my_center|LOCUS_08570 8066 7719 gene locus_tag LOCUS_08580 8066 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8820 8320 gene locus_tag LOCUS_08590 8820 8320 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_08590 9992 8817 gene locus_tag LOCUS_08600 9992 8817 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence059 960 1862 gene locus_tag LOCUS_08610 960 1862 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_08610 2271 1885 gene locus_tag LOCUS_08620 2271 1885 CDS product CAAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125871.1 protein_id gnl|my_center|LOCUS_08620 2319 2891 gene locus_tag LOCUS_08630 2319 2891 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125872.1 protein_id gnl|my_center|LOCUS_08630 2888 4084 gene locus_tag LOCUS_08640 gene moeB 2888 4084 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_08640 4314 5489 gene locus_tag LOCUS_08650 gene thrC 4314 5489 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_08650 5528 5803 gene locus_tag LOCUS_08660 5528 5803 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_08660 6965 6267 gene locus_tag LOCUS_08670 6965 6267 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125518.1 protein_id gnl|my_center|LOCUS_08670 7966 7007 gene locus_tag LOCUS_08680 7966 7007 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057334.1 protein_id gnl|my_center|LOCUS_08680 8320 8099 gene locus_tag LOCUS_08690 gene thiS 8320 8099 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_08690 9414 8317 gene locus_tag LOCUS_08700 9414 8317 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_08700 9441 9611 gene locus_tag LOCUS_08710 9441 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence060 507 1454 gene locus_tag LOCUS_08720 gene miaA 507 1454 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_08720 1511 2215 gene locus_tag LOCUS_08730 gene infC 1511 2215 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125947.1 protein_id gnl|my_center|LOCUS_08730 2285 3277 gene locus_tag LOCUS_08740 2285 3277 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125948.1 protein_id gnl|my_center|LOCUS_08740 3320 4105 gene locus_tag LOCUS_08750 gene cysE 3320 4105 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125949.1 protein_id gnl|my_center|LOCUS_08750 6971 4122 gene locus_tag LOCUS_08760 gene secA 6971 4122 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125950.1 protein_id gnl|my_center|LOCUS_08760 7165 7650 gene locus_tag LOCUS_08770 7165 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 7747 7676 gene locus_tag LOCUS_t00140 7747 7676 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8333 7842 gene locus_tag LOCUS_08780 gene ribH 8333 7842 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125952.1 protein_id gnl|my_center|LOCUS_08780 8611 8369 gene locus_tag LOCUS_08790 8611 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence061 1291 2103 gene locus_tag LOCUS_08800 1291 2103 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_08800 2129 2854 gene locus_tag LOCUS_08810 2129 2854 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124686.1 protein_id gnl|my_center|LOCUS_08810 2887 3939 gene locus_tag LOCUS_08820 2887 3939 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124687.1 protein_id gnl|my_center|LOCUS_08820 3948 4934 gene locus_tag LOCUS_08830 3948 4934 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124688.1 protein_id gnl|my_center|LOCUS_08830 5029 5730 gene locus_tag LOCUS_08840 5029 5730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124689.1 protein_id gnl|my_center|LOCUS_08840 5741 6538 gene locus_tag LOCUS_08850 5741 6538 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011128594.1 protein_id gnl|my_center|LOCUS_08850 7225 6542 gene locus_tag LOCUS_08860 7225 6542 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866401.1 protein_id gnl|my_center|LOCUS_08860 7288 8562 gene locus_tag LOCUS_08870 7288 8562 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124693.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence062 590 111 gene locus_tag LOCUS_08880 590 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2791 722 gene locus_tag LOCUS_08890 gene ligA 2791 722 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_08890 728 737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3347 2826 gene locus_tag LOCUS_08900 3347 2826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125989.1 protein_id gnl|my_center|LOCUS_08900 3346 3888 gene locus_tag LOCUS_08910 3346 3888 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125988.1 protein_id gnl|my_center|LOCUS_08910 4450 5004 gene locus_tag LOCUS_08920 4450 5004 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312755.1 protein_id gnl|my_center|LOCUS_08920 5034 5936 gene locus_tag LOCUS_08930 5034 5936 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206177.1 protein_id gnl|my_center|LOCUS_08930 8847 5890 gene locus_tag LOCUS_08940 gene uvrA 8847 5890 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866392.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence063 <1 680 gene locus_tag LOCUS_08950 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064703.1:DNA-processing protein DprA 922 3843 gene locus_tag LOCUS_08960 922 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5410 3857 gene locus_tag LOCUS_08970 5410 3857 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_08970 6505 5414 gene locus_tag LOCUS_08980 6505 5414 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125297.1 protein_id gnl|my_center|LOCUS_08980 7351 6593 gene locus_tag LOCUS_08990 7351 6593 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125296.1 protein_id gnl|my_center|LOCUS_08990 7755 7348 gene locus_tag LOCUS_09000 7755 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 8409 7882 gene locus_tag LOCUS_09010 8409 7882 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 protein_id gnl|my_center|LOCUS_09010 <9526 8436 gene locus_tag LOCUS_09020 <9526 8436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056513.1:dihydroorotase >Feature sequence064 968 399 gene locus_tag LOCUS_09030 968 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1085 1546 gene locus_tag LOCUS_09040 1085 1546 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_09040 1640 1945 gene locus_tag LOCUS_09050 1640 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2798 1884 gene locus_tag LOCUS_09060 2798 1884 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124295.1 protein_id gnl|my_center|LOCUS_09060 2994 3179 gene locus_tag LOCUS_09070 2994 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3858 3181 gene locus_tag LOCUS_09080 3858 3181 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124297.1 protein_id gnl|my_center|LOCUS_09080 4817 3858 gene locus_tag LOCUS_09090 gene cysK 4817 3858 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140800.1 protein_id gnl|my_center|LOCUS_09090 4960 5553 gene locus_tag LOCUS_09100 4960 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5860 5588 gene locus_tag LOCUS_09110 5860 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 6090 5863 gene locus_tag LOCUS_09120 6090 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 6642 6382 gene locus_tag LOCUS_09130 6642 6382 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125411.1 protein_id gnl|my_center|LOCUS_09130 8123 6642 gene locus_tag LOCUS_09140 8123 6642 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125410.1 protein_id gnl|my_center|LOCUS_09140 8506 8120 gene locus_tag LOCUS_09150 8506 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_09150 8564 9178 gene locus_tag LOCUS_09160 8564 9178 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence065 618 493 gene locus_tag LOCUS_09170 618 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1636 881 gene locus_tag LOCUS_09180 1636 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2469 1633 gene locus_tag LOCUS_09190 2469 1633 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_09190 3770 2607 gene locus_tag LOCUS_09200 3770 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3913 4617 gene locus_tag LOCUS_09210 3913 4617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125654.1 protein_id gnl|my_center|LOCUS_09210 4669 5445 gene locus_tag LOCUS_09220 4669 5445 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125652.1 protein_id gnl|my_center|LOCUS_09220 5585 6586 gene locus_tag LOCUS_09230 5585 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7878 6583 gene locus_tag LOCUS_09240 7878 6583 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_09240 8229 8390 gene locus_tag LOCUS_09250 8229 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8418 8846 gene locus_tag LOCUS_09260 8418 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence066 <1 1263 gene locus_tag LOCUS_09270 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_039737632.1:glycosyltransferase 1663 1448 gene locus_tag LOCUS_09280 1663 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2457 3239 gene locus_tag LOCUS_09290 2457 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3667 3326 gene locus_tag LOCUS_09300 3667 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3864 3664 gene locus_tag LOCUS_09310 3864 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4005 3877 gene locus_tag LOCUS_09320 4005 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4420 3977 gene locus_tag LOCUS_09330 4420 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4811 4512 gene locus_tag LOCUS_09340 4811 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5141 4836 gene locus_tag LOCUS_09350 5141 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09350 7755 5332 gene locus_tag LOCUS_09360 7755 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 <9389 7966 gene locus_tag LOCUS_09370 <9389 7966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058073.1:DNA mismatch repair protein MutS >Feature sequence067 1 231 gene locus_tag LOCUS_09380 1 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 237 707 gene locus_tag LOCUS_09390 237 707 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125452.1 protein_id gnl|my_center|LOCUS_09390 778 2043 gene locus_tag LOCUS_09400 gene yidC 778 2043 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125453.1 protein_id gnl|my_center|LOCUS_09400 2053 3561 gene locus_tag LOCUS_09410 2053 3561 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125454.1 protein_id gnl|my_center|LOCUS_09410 3771 4550 gene locus_tag LOCUS_09420 3771 4550 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125784.1 protein_id gnl|my_center|LOCUS_09420 4886 5098 gene locus_tag LOCUS_09430 4886 5098 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125783.1 protein_id gnl|my_center|LOCUS_09430 5114 5500 gene locus_tag LOCUS_09440 5114 5500 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125782.1 protein_id gnl|my_center|LOCUS_09440 5536 5916 gene locus_tag LOCUS_09450 5536 5916 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125781.1 protein_id gnl|my_center|LOCUS_09450 6582 5923 gene locus_tag LOCUS_09460 gene hisB 6582 5923 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124468.1 protein_id gnl|my_center|LOCUS_09460 9280 6617 gene locus_tag LOCUS_09470 gene ileS 9280 6617 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124423.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence068 795 364 gene locus_tag LOCUS_09480 795 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1056 1394 gene locus_tag LOCUS_09490 1056 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2086 3294 gene locus_tag LOCUS_09500 2086 3294 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124568.1 protein_id gnl|my_center|LOCUS_09500 3332 3676 gene locus_tag LOCUS_09510 3332 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5215 3719 gene locus_tag LOCUS_09520 5215 3719 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124567.1 protein_id gnl|my_center|LOCUS_09520 5569 5270 gene locus_tag LOCUS_09530 5569 5270 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124566.1 protein_id gnl|my_center|LOCUS_09530 5877 5566 gene locus_tag LOCUS_09540 5877 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5984 6550 gene locus_tag LOCUS_09550 gene rpsD 5984 6550 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124564.1 protein_id gnl|my_center|LOCUS_09550 6750 7247 gene locus_tag LOCUS_09560 6750 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7358 7609 gene locus_tag LOCUS_09570 7358 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence069 1572 31 gene locus_tag LOCUS_09580 1572 31 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125219.1 protein_id gnl|my_center|LOCUS_09580 2641 1676 gene locus_tag LOCUS_09590 gene thrB 2641 1676 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125218.1 protein_id gnl|my_center|LOCUS_09590 3698 2631 gene locus_tag LOCUS_09600 gene glk 3698 2631 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125217.1 protein_id gnl|my_center|LOCUS_09600 5506 3695 gene locus_tag LOCUS_09610 gene thrS 5506 3695 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058036.1 protein_id gnl|my_center|LOCUS_09610 5670 6113 gene locus_tag LOCUS_09620 5670 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6674 6120 gene locus_tag LOCUS_09630 6674 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7165 6977 gene locus_tag LOCUS_09640 7165 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7693 7373 gene locus_tag LOCUS_09650 7693 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7717 8436 gene locus_tag LOCUS_09660 7717 8436 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence070 3328 308 gene locus_tag LOCUS_09670 3328 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5370 3361 gene locus_tag LOCUS_09680 gene uvrB 5370 3361 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125958.1 protein_id gnl|my_center|LOCUS_09680 6161 5376 gene locus_tag LOCUS_09690 6161 5376 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_09690 6366 7310 gene locus_tag LOCUS_09700 6366 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8811 7597 gene locus_tag LOCUS_09710 8811 7597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039736.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence071 1501 1187 gene locus_tag LOCUS_09720 1501 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2105 2290 gene locus_tag LOCUS_09730 2105 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2402 2797 gene locus_tag LOCUS_09740 2402 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2733 3236 gene locus_tag LOCUS_09750 2733 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 3612 3800 gene locus_tag LOCUS_09760 3612 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5264 3966 gene locus_tag LOCUS_09770 5264 3966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_09770 5358 5900 gene locus_tag LOCUS_09780 5358 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6022 6417 gene locus_tag LOCUS_09790 6022 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 7041 6346 gene locus_tag LOCUS_09800 7041 6346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 protein_id gnl|my_center|LOCUS_09800 7161 7514 gene locus_tag LOCUS_09810 7161 7514 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence072 1717 5 gene locus_tag LOCUS_09820 1717 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2640 1714 gene locus_tag LOCUS_09830 2640 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3296 2637 gene locus_tag LOCUS_09840 gene tsf 3296 2637 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_09840 4072 3380 gene locus_tag LOCUS_09850 gene rpsB 4072 3380 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124977.1 protein_id gnl|my_center|LOCUS_09850 5132 4185 gene locus_tag LOCUS_09860 5132 4185 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124976.1 protein_id gnl|my_center|LOCUS_09860 5364 5161 gene locus_tag LOCUS_09870 5364 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6054 5788 gene locus_tag LOCUS_09880 6054 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7328 6021 gene locus_tag LOCUS_09890 7328 6021 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866390.1 protein_id gnl|my_center|LOCUS_09890 7351 7421 gene locus_tag LOCUS_t00150 7351 7421 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7559 7975 gene locus_tag LOCUS_09900 7559 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8154 7954 gene locus_tag LOCUS_09910 8154 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 8380 8066 gene locus_tag LOCUS_09920 8380 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence073 855 88 gene locus_tag LOCUS_09930 855 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1516 857 gene locus_tag LOCUS_09940 1516 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2634 1513 gene locus_tag LOCUS_09950 2634 1513 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_09950 2954 3112 gene locus_tag LOCUS_09960 2954 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3647 4009 gene locus_tag LOCUS_09970 3647 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4033 5127 gene locus_tag LOCUS_09980 4033 5127 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892200.1 protein_id gnl|my_center|LOCUS_09980 6267 5317 gene locus_tag LOCUS_09990 gene secF 6267 5317 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124920.1 protein_id gnl|my_center|LOCUS_09990 7856 6378 gene locus_tag LOCUS_10000 gene secD 7856 6378 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124919.1 protein_id gnl|my_center|LOCUS_10000 <8540 7858 gene locus_tag LOCUS_10010 <8540 7858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124918.1:pyruvate dehydrogenase complex E1 component subunit beta >Feature sequence074 921 307 gene locus_tag LOCUS_10020 921 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1199 3340 gene locus_tag LOCUS_10030 1199 3340 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_10030 3957 3625 gene locus_tag LOCUS_10040 3957 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4095 5663 gene locus_tag LOCUS_10050 4095 5663 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125802.1 protein_id gnl|my_center|LOCUS_10050 5676 6812 gene locus_tag LOCUS_10060 5676 6812 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124379.1 protein_id gnl|my_center|LOCUS_10060 7852 6857 gene locus_tag LOCUS_10070 gene holA 7852 6857 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125956.1 protein_id gnl|my_center|LOCUS_10070 7836 8474 gene locus_tag LOCUS_10080 7836 8474 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125955.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence075 1177 995 gene locus_tag LOCUS_10090 1177 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4179 1792 gene locus_tag LOCUS_10100 4179 1792 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124308.1 protein_id gnl|my_center|LOCUS_10100 4209 4754 gene locus_tag LOCUS_10110 4209 4754 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_10110 5208 4747 gene locus_tag LOCUS_10120 5208 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6281 5199 gene locus_tag LOCUS_10130 6281 5199 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126008.1 protein_id gnl|my_center|LOCUS_10130 6643 7068 gene locus_tag LOCUS_10140 6643 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125900.1 protein_id gnl|my_center|LOCUS_10140 7692 7090 gene locus_tag LOCUS_10150 7692 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 <8468 7710 gene locus_tag LOCUS_10160 <8468 7710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124469.1:enoyl-ACP reductase FabI >Feature sequence076 473 964 gene locus_tag LOCUS_10170 473 964 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_10170 999 1736 gene locus_tag LOCUS_10180 999 1736 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125241.1 protein_id gnl|my_center|LOCUS_10180 1736 2113 gene locus_tag LOCUS_10190 1736 2113 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_10190 2133 2519 gene locus_tag LOCUS_10200 2133 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3729 2530 gene locus_tag LOCUS_10210 3729 2530 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_10210 4251 4571 gene locus_tag LOCUS_10220 4251 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5267 5193 gene locus_tag LOCUS_t00160 5267 5193 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5312 5614 gene locus_tag LOCUS_10230 5312 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7692 5632 gene locus_tag LOCUS_10240 7692 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence077 <1 563 gene locus_tag LOCUS_10250 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124249.1:type III pantothenate kinase 1091 573 gene locus_tag LOCUS_10260 gene bcp 1091 573 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124248.1 protein_id gnl|my_center|LOCUS_10260 1103 1762 gene locus_tag LOCUS_10270 1103 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1924 4317 gene locus_tag LOCUS_10280 1924 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5240 4314 gene locus_tag LOCUS_10290 5240 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5523 5449 gene locus_tag LOCUS_t00170 5523 5449 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6260 5568 gene locus_tag LOCUS_10300 6260 5568 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_10300 6656 6369 gene locus_tag LOCUS_10310 6656 6369 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125332.1 protein_id gnl|my_center|LOCUS_10310 7608 6871 gene locus_tag LOCUS_10320 7608 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8278 8078 gene locus_tag LOCUS_10330 8278 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10330 >Feature sequence078 <1 2199 gene locus_tag LOCUS_10340 <1 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124400.1:endonuclease MutS2 3900 4598 gene locus_tag LOCUS_10350 3900 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4595 7246 gene locus_tag LOCUS_10360 4595 7246 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence079 286 1341 gene locus_tag LOCUS_10370 286 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2132 1377 gene locus_tag LOCUS_10380 2132 1377 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403999.1 protein_id gnl|my_center|LOCUS_10380 2570 2136 gene locus_tag LOCUS_10390 2570 2136 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_10390 3928 2588 gene locus_tag LOCUS_10400 3928 2588 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124477.1 protein_id gnl|my_center|LOCUS_10400 4360 4172 gene locus_tag LOCUS_10410 4360 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4274 4948 gene locus_tag LOCUS_10420 4274 4948 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124476.1 protein_id gnl|my_center|LOCUS_10420 4954 5940 gene locus_tag LOCUS_10430 4954 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7366 5999 gene locus_tag LOCUS_10440 7366 5999 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141064.1 protein_id gnl|my_center|LOCUS_10440 7936 7568 gene locus_tag LOCUS_10450 7936 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8142 7933 gene locus_tag LOCUS_10460 8142 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence080 1308 922 gene locus_tag LOCUS_10470 1308 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2318 1491 gene locus_tag LOCUS_10480 2318 1491 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124201.1 protein_id gnl|my_center|LOCUS_10480 5440 2315 gene locus_tag LOCUS_10490 5440 2315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124202.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence081 595 1416 gene locus_tag LOCUS_10500 gene folP 595 1416 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_10500 2054 1395 gene locus_tag LOCUS_10510 2054 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125057.1 protein_id gnl|my_center|LOCUS_10510 2836 2048 gene locus_tag LOCUS_10520 gene dapB 2836 2048 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125056.1 protein_id gnl|my_center|LOCUS_10520 3599 3087 gene locus_tag LOCUS_10530 3599 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124632.1 protein_id gnl|my_center|LOCUS_10530 4840 3728 gene locus_tag LOCUS_10540 4840 3728 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891726.1 protein_id gnl|my_center|LOCUS_10540 5156 4878 gene locus_tag LOCUS_10550 5156 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5336 6100 gene locus_tag LOCUS_10560 5336 6100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124630.1 protein_id gnl|my_center|LOCUS_10560 6914 6084 gene locus_tag LOCUS_10570 gene map 6914 6084 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124629.1 protein_id gnl|my_center|LOCUS_10570 6980 7306 gene locus_tag LOCUS_10580 6980 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 7589 8053 gene locus_tag LOCUS_10590 gene rplS 7589 8053 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124627.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence082 410 99 gene locus_tag LOCUS_10600 gene groES 410 99 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_10600 556 2142 gene locus_tag LOCUS_10610 gene atpD 556 2142 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125741.1 protein_id gnl|my_center|LOCUS_10610 2214 2627 gene locus_tag LOCUS_10620 gene atpC 2214 2627 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125742.1 protein_id gnl|my_center|LOCUS_10620 3065 3274 gene locus_tag LOCUS_10630 3065 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4003 3422 gene locus_tag LOCUS_10640 4003 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125272.1 protein_id gnl|my_center|LOCUS_10640 4219 5349 gene locus_tag LOCUS_10650 4219 5349 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125273.1 protein_id gnl|my_center|LOCUS_10650 5426 5499 gene locus_tag LOCUS_t00180 5426 5499 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6091 5585 gene locus_tag LOCUS_10660 6091 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6445 7758 gene locus_tag LOCUS_10670 gene bioA 6445 7758 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125776.1 protein_id gnl|my_center|LOCUS_10670 8002 7763 gene locus_tag LOCUS_10680 8002 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence083 <1 1475 gene locus_tag LOCUS_10690 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125985.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1638 1417 gene locus_tag LOCUS_10700 1638 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1903 1667 gene locus_tag LOCUS_10710 1903 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2248 3150 gene locus_tag LOCUS_10720 2248 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4427 3591 gene locus_tag LOCUS_10730 4427 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6409 4922 gene locus_tag LOCUS_10740 6409 4922 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537795.1 protein_id gnl|my_center|LOCUS_10740 7101 6433 gene locus_tag LOCUS_10750 7101 6433 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_10750 <8006 7167 gene locus_tag LOCUS_10760 <8006 7167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125405.1:photosystem I assembly protein Ycf4 >Feature sequence084 3569 6535 gene locus_tag LOCUS_10770 3569 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6547 7488 gene locus_tag LOCUS_10780 gene cas1 6547 7488 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10780 7537 7842 gene locus_tag LOCUS_10790 gene cas2 7537 7842 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence085 1050 256 gene locus_tag LOCUS_10800 gene pstB 1050 256 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_10800 1999 1076 gene locus_tag LOCUS_10810 gene pstA 1999 1076 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124750.1 protein_id gnl|my_center|LOCUS_10810 3020 1992 gene locus_tag LOCUS_10820 gene pstC 3020 1992 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_10820 4113 3118 gene locus_tag LOCUS_10830 gene pstS 4113 3118 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125725.1 protein_id gnl|my_center|LOCUS_10830 4317 6533 gene locus_tag LOCUS_10840 gene dnaK 4317 6533 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125090.1 protein_id gnl|my_center|LOCUS_10840 6518 7450 gene locus_tag LOCUS_10850 6518 7450 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125091.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence086 1667 1200 gene locus_tag LOCUS_10860 gene rimP 1667 1200 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920953.1 protein_id gnl|my_center|LOCUS_10860 1847 2614 gene locus_tag LOCUS_10870 gene cpdA 1847 2614 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073647.1 protein_id gnl|my_center|LOCUS_10870 2636 3859 gene locus_tag LOCUS_10880 2636 3859 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125795.1 protein_id gnl|my_center|LOCUS_10880 3925 4647 gene locus_tag LOCUS_10890 gene rpiA 3925 4647 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125794.1 protein_id gnl|my_center|LOCUS_10890 5971 4652 gene locus_tag LOCUS_10900 gene hisD 5971 4652 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125793.1 protein_id gnl|my_center|LOCUS_10900 6038 6352 gene locus_tag LOCUS_10910 gene rpsT 6038 6352 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125792.1 protein_id gnl|my_center|LOCUS_10910 6345 7232 gene locus_tag LOCUS_10920 6345 7232 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125791.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence087 1887 85 gene locus_tag LOCUS_10930 1887 85 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_10930 2640 7784 gene locus_tag LOCUS_10940 2640 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence088 <1 922 gene locus_tag LOCUS_10950 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124460.1:Gfo/Idh/MocA family oxidoreductase 1183 1282 gene locus_tag LOCUS_t00190 1183 1282 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2949 1828 gene locus_tag LOCUS_10960 gene tgt 2949 1828 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124458.1 protein_id gnl|my_center|LOCUS_10960 3081 3764 gene locus_tag LOCUS_10970 gene cobS 3081 3764 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866397.1 protein_id gnl|my_center|LOCUS_10970 4891 3761 gene locus_tag LOCUS_10980 4891 3761 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124456.1 protein_id gnl|my_center|LOCUS_10980 5076 5444 gene locus_tag LOCUS_10990 5076 5444 CDS product DUF3155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124455.1 protein_id gnl|my_center|LOCUS_10990 5796 5996 gene locus_tag LOCUS_11000 5796 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6485 6754 gene locus_tag LOCUS_11010 6485 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6709 7539 gene locus_tag LOCUS_11020 6709 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence089 108 563 gene locus_tag LOCUS_11030 108 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1327 701 gene locus_tag LOCUS_11040 1327 701 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126003.1 protein_id gnl|my_center|LOCUS_11040 2964 1324 gene locus_tag LOCUS_11050 2964 1324 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126002.1 protein_id gnl|my_center|LOCUS_11050 3877 3098 gene locus_tag LOCUS_11060 3877 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4445 4059 gene locus_tag LOCUS_11070 4445 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6610 4820 gene locus_tag LOCUS_11080 gene aspS 6610 4820 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126001.1 protein_id gnl|my_center|LOCUS_11080 6837 7091 gene locus_tag LOCUS_11090 6837 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7395 7541 gene locus_tag LOCUS_11100 7395 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7584 7766 gene locus_tag LOCUS_11110 7584 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence090 648 283 gene locus_tag LOCUS_11120 648 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 599 1132 gene locus_tag LOCUS_11130 gene moaB 599 1132 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036101.1 protein_id gnl|my_center|LOCUS_11130 2112 1117 gene locus_tag LOCUS_11140 gene moaA 2112 1117 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_11140 2758 2093 gene locus_tag LOCUS_11150 2758 2093 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921285.1 protein_id gnl|my_center|LOCUS_11150 3033 4580 gene locus_tag LOCUS_11160 3033 4580 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_11160 4604 6748 gene locus_tag LOCUS_11170 4604 6748 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_11170 6833 7345 gene locus_tag LOCUS_11180 6833 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence091 770 1381 gene locus_tag LOCUS_11190 770 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2490 1411 gene locus_tag LOCUS_11200 gene queA 2490 1411 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124557.1 protein_id gnl|my_center|LOCUS_11200 2542 2913 gene locus_tag LOCUS_11210 2542 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2933 4282 gene locus_tag LOCUS_11220 2933 4282 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124577.1 protein_id gnl|my_center|LOCUS_11220 6418 4286 gene locus_tag LOCUS_11230 6418 4286 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124578.1 protein_id gnl|my_center|LOCUS_11230 7428 6469 gene locus_tag LOCUS_11240 gene chlG 7428 6469 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124579.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence092 722 90 gene locus_tag LOCUS_11250 gene rpsE 722 90 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125845.1 protein_id gnl|my_center|LOCUS_11250 1087 722 gene locus_tag LOCUS_11260 gene rplR 1087 722 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_11260 1663 1124 gene locus_tag LOCUS_11270 gene rplF 1663 1124 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125847.1 protein_id gnl|my_center|LOCUS_11270 2094 1693 gene locus_tag LOCUS_11280 gene rpsH 2094 1693 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125848.1 protein_id gnl|my_center|LOCUS_11280 2666 2115 gene locus_tag LOCUS_11290 gene rplE 2666 2115 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125849.1 protein_id gnl|my_center|LOCUS_11290 3075 2737 gene locus_tag LOCUS_11300 gene rplX 3075 2737 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152557460.1 protein_id gnl|my_center|LOCUS_11300 3440 3075 gene locus_tag LOCUS_11310 gene rplN 3440 3075 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125851.1 protein_id gnl|my_center|LOCUS_11310 3702 3454 gene locus_tag LOCUS_11320 gene rpsQ 3702 3454 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125852.1 protein_id gnl|my_center|LOCUS_11320 3944 3708 gene locus_tag LOCUS_11330 3944 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4434 3958 gene locus_tag LOCUS_11340 4434 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5184 4450 gene locus_tag LOCUS_11350 gene rpsC 5184 4450 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125855.1 protein_id gnl|my_center|LOCUS_11350 5555 5199 gene locus_tag LOCUS_11360 gene rplV 5555 5199 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125856.1 protein_id gnl|my_center|LOCUS_11360 5843 5568 gene locus_tag LOCUS_11370 gene rpsS 5843 5568 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125857.1 protein_id gnl|my_center|LOCUS_11370 6733 5870 gene locus_tag LOCUS_11380 gene rplB 6733 5870 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125858.1 protein_id gnl|my_center|LOCUS_11380 7050 6745 gene locus_tag LOCUS_11390 7050 6745 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125859.1 protein_id gnl|my_center|LOCUS_11390 <7579 7043 gene locus_tag LOCUS_11400 <7579 7043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055937.1:50S ribosomal protein L4 >Feature sequence093 1092 124 gene locus_tag LOCUS_11410 1092 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1842 1291 gene locus_tag LOCUS_11420 1842 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1909 2262 gene locus_tag LOCUS_11430 1909 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2269 7092 gene locus_tag LOCUS_11440 2269 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence094 3 164 gene locus_tag LOCUS_11450 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 199 2103 gene locus_tag LOCUS_11460 199 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3526 3654 gene locus_tag LOCUS_11470 3526 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3973 4653 gene locus_tag LOCUS_11480 3973 4653 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142786.1 protein_id gnl|my_center|LOCUS_11480 5388 4666 gene locus_tag LOCUS_11490 5388 4666 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124974.1 protein_id gnl|my_center|LOCUS_11490 6561 5389 gene locus_tag LOCUS_11500 gene devC 6561 5389 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124973.1 protein_id gnl|my_center|LOCUS_11500 <7465 6570 gene locus_tag LOCUS_11510 <7465 6570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124972.1:ABC exporter membrane fusion protein >Feature sequence095 1428 319 gene locus_tag LOCUS_11520 gene aroB 1428 319 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125161.1 protein_id gnl|my_center|LOCUS_11520 1465 2340 gene locus_tag LOCUS_11530 1465 2340 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_11530 2341 3513 gene locus_tag LOCUS_11540 2341 3513 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125160.1 protein_id gnl|my_center|LOCUS_11540 4023 3733 gene locus_tag LOCUS_11550 4023 3733 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125069.1 protein_id gnl|my_center|LOCUS_11550 4410 4105 gene locus_tag LOCUS_11560 gene clpS 4410 4105 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_11560 5166 4849 gene locus_tag LOCUS_11570 5166 4849 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125063.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence096 521 919 gene locus_tag LOCUS_11580 521 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 930 1838 gene locus_tag LOCUS_11590 930 1838 CDS product DUF3086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125558.1 protein_id gnl|my_center|LOCUS_11590 1842 2471 gene locus_tag LOCUS_11600 gene plsY 1842 2471 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125559.1 protein_id gnl|my_center|LOCUS_11600 3330 2503 gene locus_tag LOCUS_11610 gene proC 3330 2503 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124548.1 protein_id gnl|my_center|LOCUS_11610 4048 3407 gene locus_tag LOCUS_11620 4048 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4888 4178 gene locus_tag LOCUS_11630 4888 4178 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140704.1 protein_id gnl|my_center|LOCUS_11630 5259 4993 gene locus_tag LOCUS_11640 5259 4993 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124545.1 protein_id gnl|my_center|LOCUS_11640 6241 5318 gene locus_tag LOCUS_11650 6241 5318 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124544.1 protein_id gnl|my_center|LOCUS_11650 <7377 6458 gene locus_tag LOCUS_11660 <7377 6458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124543.1:ribosome biogenesis GTPase Der >Feature sequence097 433 1215 gene locus_tag LOCUS_11670 433 1215 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125339.1 protein_id gnl|my_center|LOCUS_11670 1343 2455 gene locus_tag LOCUS_11680 1343 2455 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056984.1 protein_id gnl|my_center|LOCUS_11680 2561 2788 gene locus_tag LOCUS_11690 2561 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2816 4024 gene locus_tag LOCUS_11700 2816 4024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406250.1 protein_id gnl|my_center|LOCUS_11700 5042 4242 gene locus_tag LOCUS_11710 5042 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5524 5114 gene locus_tag LOCUS_11720 5524 5114 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125222.1 protein_id gnl|my_center|LOCUS_11720 6852 5545 gene locus_tag LOCUS_11730 6852 5545 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence098 4993 3641 gene locus_tag LOCUS_11740 4993 3641 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124556.1 protein_id gnl|my_center|LOCUS_11740 5078 5659 gene locus_tag LOCUS_11750 5078 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5686 6405 gene locus_tag LOCUS_11760 5686 6405 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125333.1 protein_id gnl|my_center|LOCUS_11760 6830 6582 gene locus_tag LOCUS_11770 6830 6582 CDS product DUF6447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125050.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence099 1088 252 gene locus_tag LOCUS_11780 1088 252 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124250.1 protein_id gnl|my_center|LOCUS_11780 1267 1100 gene locus_tag LOCUS_11790 1267 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1244 2317 gene locus_tag LOCUS_11800 1244 2317 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_11800 2314 3006 gene locus_tag LOCUS_11810 2314 3006 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_11810 3029 4819 gene locus_tag LOCUS_11820 3029 4819 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124252.1 protein_id gnl|my_center|LOCUS_11820 4831 5568 gene locus_tag LOCUS_11830 gene bchM 4831 5568 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124348.1 protein_id gnl|my_center|LOCUS_11830 6002 7195 gene locus_tag LOCUS_11840 6002 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence100 1190 1606 gene locus_tag LOCUS_11850 1190 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1978 3606 gene locus_tag LOCUS_11860 1978 3606 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124328.1 protein_id gnl|my_center|LOCUS_11860 3647 4525 gene locus_tag LOCUS_11870 3647 4525 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124329.1 protein_id gnl|my_center|LOCUS_11870 4576 5754 gene locus_tag LOCUS_11880 4576 5754 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892127.1 protein_id gnl|my_center|LOCUS_11880 6682 5726 gene locus_tag LOCUS_11890 6682 5726 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124331.1 protein_id gnl|my_center|LOCUS_11890 6758 7033 gene locus_tag LOCUS_11900 6758 7033 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124332.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence101 49 696 gene locus_tag LOCUS_11910 gene thyX 49 696 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124428.1 protein_id gnl|my_center|LOCUS_11910 1435 725 gene locus_tag LOCUS_11920 gene larB 1435 725 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125503.1 protein_id gnl|my_center|LOCUS_11920 1920 1423 gene locus_tag LOCUS_11930 1920 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 2661 1948 gene locus_tag LOCUS_11940 2661 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11940 3104 2661 gene locus_tag LOCUS_11950 3104 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4050 3184 gene locus_tag LOCUS_11960 gene era 4050 3184 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_11960 4296 4823 gene locus_tag LOCUS_11970 4296 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_11970 5337 4867 gene locus_tag LOCUS_11980 5337 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5485 6921 gene locus_tag LOCUS_11990 gene ahcY 5485 6921 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125935.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence102 358 663 gene locus_tag LOCUS_12000 358 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2761 734 gene locus_tag LOCUS_12010 2761 734 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125458.1 protein_id gnl|my_center|LOCUS_12010 3374 3087 gene locus_tag LOCUS_12020 gene rpsN 3374 3087 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125457.1 protein_id gnl|my_center|LOCUS_12020 3494 3904 gene locus_tag LOCUS_12030 3494 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4143 3916 gene locus_tag LOCUS_12040 4143 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4753 4145 gene locus_tag LOCUS_12050 gene def 4753 4145 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124236.1 protein_id gnl|my_center|LOCUS_12050 4902 6686 gene locus_tag LOCUS_12060 4902 6686 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124237.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence103 1065 145 gene locus_tag LOCUS_12070 1065 145 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124374.1 protein_id gnl|my_center|LOCUS_12070 2014 1139 gene locus_tag LOCUS_12080 gene ylqF 2014 1139 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124375.1 protein_id gnl|my_center|LOCUS_12080 2517 2068 gene locus_tag LOCUS_12090 2517 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2563 3396 gene locus_tag LOCUS_12100 2563 3396 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125744.1 protein_id gnl|my_center|LOCUS_12100 5317 4289 gene locus_tag LOCUS_12110 gene hrcA 5317 4289 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_12110 5464 6633 gene locus_tag LOCUS_12120 5464 6633 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence104 229 1731 gene locus_tag LOCUS_12130 229 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1728 3320 gene locus_tag LOCUS_12140 1728 3320 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_12140 3607 4572 gene locus_tag LOCUS_12150 3607 4572 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125937.1 protein_id gnl|my_center|LOCUS_12150 6377 4569 gene locus_tag LOCUS_12160 gene pyk 6377 4569 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_12160 6928 6620 gene locus_tag LOCUS_12170 6928 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence105 1093 359 gene locus_tag LOCUS_12180 gene upp 1093 359 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_12180 1085 1594 gene locus_tag LOCUS_12190 1085 1594 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 protein_id gnl|my_center|LOCUS_12190 1734 2333 gene locus_tag LOCUS_12200 1734 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2361 3488 gene locus_tag LOCUS_12210 gene cobW 2361 3488 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125003.1 protein_id gnl|my_center|LOCUS_12210 3669 4856 gene locus_tag LOCUS_12220 3669 4856 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_12220 4860 5207 gene locus_tag LOCUS_12230 4860 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5282 6022 gene locus_tag LOCUS_12240 gene hypB 5282 6022 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence106 6 335 gene locus_tag LOCUS_12250 6 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 443 667 gene locus_tag LOCUS_12260 443 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1091 3130 gene locus_tag LOCUS_12270 1091 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4784 3114 gene locus_tag LOCUS_12280 4784 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4815 5279 gene locus_tag LOCUS_12290 4815 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5276 5467 gene locus_tag LOCUS_12300 5276 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5643 6653 gene locus_tag LOCUS_12310 5643 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence107 <1 1179 gene locus_tag LOCUS_12320 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036892385.1:alanine--glyoxylate aminotransferase family protein 1540 1100 gene locus_tag LOCUS_12330 1540 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1703 3013 gene locus_tag LOCUS_12340 1703 3013 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125187.1 protein_id gnl|my_center|LOCUS_12340 3140 5317 gene locus_tag LOCUS_12350 3140 5317 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_12350 5314 6357 gene locus_tag LOCUS_12360 5314 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence108 773 348 gene locus_tag LOCUS_12370 773 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1782 766 gene locus_tag LOCUS_12380 1782 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124527.1 protein_id gnl|my_center|LOCUS_12380 1843 2814 gene locus_tag LOCUS_12390 1843 2814 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124161.1 protein_id gnl|my_center|LOCUS_12390 2867 5398 gene locus_tag LOCUS_12400 2867 5398 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124160.1 protein_id gnl|my_center|LOCUS_12400 6366 5392 gene locus_tag LOCUS_12410 6366 5392 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence109 1904 2698 gene locus_tag LOCUS_12420 gene gloB 1904 2698 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_12420 2802 3626 gene locus_tag LOCUS_12430 2802 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3650 4861 gene locus_tag LOCUS_12440 gene larC 3650 4861 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_12440 4879 5763 gene locus_tag LOCUS_12450 4879 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence110 859 404 gene locus_tag LOCUS_12460 859 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2198 948 gene locus_tag LOCUS_12470 gene argJ 2198 948 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124209.1 protein_id gnl|my_center|LOCUS_12470 3268 3603 gene locus_tag LOCUS_12480 3268 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 5023 5664 gene locus_tag LOCUS_12490 gene coaE 5023 5664 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_12490 <6619 5672 gene locus_tag LOCUS_12500 <6619 5672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058226.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence111 121 1248 gene locus_tag LOCUS_12510 121 1248 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143662.1 protein_id gnl|my_center|LOCUS_12510 1281 1700 gene locus_tag LOCUS_12520 1281 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1742 2011 gene locus_tag LOCUS_12530 1742 2011 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_12530 2260 2060 gene locus_tag LOCUS_12540 2260 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2387 2785 gene locus_tag LOCUS_12550 2387 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3171 4559 gene locus_tag LOCUS_12560 gene trxB 3171 4559 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125397.1 protein_id gnl|my_center|LOCUS_12560 4826 4560 gene locus_tag LOCUS_12570 gene infA 4826 4560 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125398.1 protein_id gnl|my_center|LOCUS_12570 <6615 4901 gene locus_tag LOCUS_12580 <6615 4901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125817.1:glutamate synthase large subunit >Feature sequence112 114 506 gene locus_tag LOCUS_12590 114 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 790 1926 gene locus_tag LOCUS_12600 790 1926 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125385.1 protein_id gnl|my_center|LOCUS_12600 2712 1954 gene locus_tag LOCUS_12610 2712 1954 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_12610 4319 2790 gene locus_tag LOCUS_12620 4319 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5218 4334 gene locus_tag LOCUS_12630 5218 4334 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175909.1 protein_id gnl|my_center|LOCUS_12630 5886 5389 gene locus_tag LOCUS_12640 5886 5389 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_12640 6503 5940 gene locus_tag LOCUS_12650 6503 5940 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence113 153 413 gene locus_tag LOCUS_12660 153 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 721 452 gene locus_tag LOCUS_12670 721 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 922 1866 gene locus_tag LOCUS_12680 922 1866 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_12680 1940 2815 gene locus_tag LOCUS_12690 1940 2815 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_12690 3529 2828 gene locus_tag LOCUS_12700 gene nth 3529 2828 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12700 4623 3529 gene locus_tag LOCUS_12710 4623 3529 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125456.1 protein_id gnl|my_center|LOCUS_12710 4570 4995 gene locus_tag LOCUS_12720 4570 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5455 5724 gene locus_tag LOCUS_12730 5455 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence114 1490 219 gene locus_tag LOCUS_12740 gene radA 1490 219 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_12740 1468 1665 gene locus_tag LOCUS_12750 1468 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1825 2676 gene locus_tag LOCUS_12760 1825 2676 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_12760 2894 4069 gene locus_tag LOCUS_12770 gene plsX 2894 4069 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124312.1 protein_id gnl|my_center|LOCUS_12770 4107 5120 gene locus_tag LOCUS_12780 4107 5120 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence115 879 199 gene locus_tag LOCUS_12790 879 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1751 897 gene locus_tag LOCUS_12800 1751 897 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_12800 2315 1827 gene locus_tag LOCUS_12810 gene cpcA 2315 1827 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_12810 2876 2358 gene locus_tag LOCUS_12820 2876 2358 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_12820 3843 3187 gene locus_tag LOCUS_12830 3843 3187 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141193.1 protein_id gnl|my_center|LOCUS_12830 4406 3876 gene locus_tag LOCUS_12840 4406 3876 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141192.1 protein_id gnl|my_center|LOCUS_12840 5027 4758 gene locus_tag LOCUS_12850 5027 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5685 5008 gene locus_tag LOCUS_12860 5685 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 6131 5811 gene locus_tag LOCUS_12870 6131 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12870 >Feature sequence116 221 1420 gene locus_tag LOCUS_12880 221 1420 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_12880 1433 2035 gene locus_tag LOCUS_12890 1433 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2103 3623 gene locus_tag LOCUS_12900 2103 3623 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_12900 3843 4562 gene locus_tag LOCUS_12910 3843 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4559 5566 gene locus_tag LOCUS_12920 4559 5566 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_12920 5575 6004 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgcggattgcggcccttcctcggtttgctacact 6005 6014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6130 6437 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgcggattgcggcccttcctcggtttgctacact >Feature sequence117 1006 164 gene locus_tag LOCUS_12930 gene recO 1006 164 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124550.1 protein_id gnl|my_center|LOCUS_12930 1739 1017 gene locus_tag LOCUS_12940 gene deoC 1739 1017 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228499.1 protein_id gnl|my_center|LOCUS_12940 2335 1739 gene locus_tag LOCUS_12950 gene raiA 2335 1739 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124552.1 protein_id gnl|my_center|LOCUS_12950 2395 3075 gene locus_tag LOCUS_12960 gene lipB 2395 3075 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124553.1 protein_id gnl|my_center|LOCUS_12960 3047 5053 gene locus_tag LOCUS_12970 3047 5053 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923202.1 protein_id gnl|my_center|LOCUS_12970 5334 5534 gene locus_tag LOCUS_12980 5334 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5714 6235 gene locus_tag LOCUS_12990 5714 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence118 <1 734 gene locus_tag LOCUS_13000 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125400.1:NmrA family NAD(P)-binding protein 1431 766 gene locus_tag LOCUS_13010 1431 766 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892153.1 protein_id gnl|my_center|LOCUS_13010 2975 1563 gene locus_tag LOCUS_13020 2975 1563 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124253.1 protein_id gnl|my_center|LOCUS_13020 3681 3046 gene locus_tag LOCUS_13030 3681 3046 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_13030 3855 5054 gene locus_tag LOCUS_13040 3855 5054 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 protein_id gnl|my_center|LOCUS_13040 5051 5701 gene locus_tag LOCUS_13050 5051 5701 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence119 505 882 gene locus_tag LOCUS_13060 505 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1790 2062 gene locus_tag LOCUS_13070 1790 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3165 2047 gene locus_tag LOCUS_13080 3165 2047 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125940.1 protein_id gnl|my_center|LOCUS_13080 3597 4619 gene locus_tag LOCUS_13090 3597 4619 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_13090 6036 4663 gene locus_tag LOCUS_13100 gene mgtE 6036 4663 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence120 1177 728 gene locus_tag LOCUS_13110 1177 728 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125177.1 protein_id gnl|my_center|LOCUS_13110 1217 1903 gene locus_tag LOCUS_13120 1217 1903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125178.1 protein_id gnl|my_center|LOCUS_13120 1917 2828 gene locus_tag LOCUS_13130 gene hslO 1917 2828 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125179.1 protein_id gnl|my_center|LOCUS_13130 3489 2815 gene locus_tag LOCUS_13140 3489 2815 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence121 810 1157 gene locus_tag LOCUS_13150 810 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2530 1523 gene locus_tag LOCUS_13160 2530 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3551 2832 gene locus_tag LOCUS_13170 3551 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4441 3698 gene locus_tag LOCUS_13180 gene fabG 4441 3698 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124607.1 protein_id gnl|my_center|LOCUS_13180 4785 4543 gene locus_tag LOCUS_13190 4785 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence122 1570 218 gene locus_tag LOCUS_13200 1570 218 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124625.1 protein_id gnl|my_center|LOCUS_13200 2185 1592 gene locus_tag LOCUS_13210 2185 1592 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_13210 2697 3410 gene locus_tag LOCUS_13220 2697 3410 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_13220 3415 4047 gene locus_tag LOCUS_13230 gene nusB 3415 4047 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124164.1 protein_id gnl|my_center|LOCUS_13230 4361 5761 gene locus_tag LOCUS_13240 4361 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence123 5180 1455 gene locus_tag LOCUS_13250 5180 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5094 5468 gene locus_tag LOCUS_13260 5094 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence124 <1 625 gene locus_tag LOCUS_13270 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164923256.1:DUF3172 domain-containing protein 1601 600 gene locus_tag LOCUS_13280 1601 600 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124325.1 protein_id gnl|my_center|LOCUS_13280 1727 3733 gene locus_tag LOCUS_13290 1727 3733 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124327.1 protein_id gnl|my_center|LOCUS_13290 3815 4186 gene locus_tag LOCUS_13300 3815 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4883 5341 gene locus_tag LOCUS_13310 4883 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5470 5306 gene locus_tag LOCUS_13320 5470 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5477 5899 gene locus_tag LOCUS_13330 5477 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence125 <1 1577 gene locus_tag LOCUS_13340 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125098.1:glucose-6-phosphate isomerase 1686 1596 gene locus_tag LOCUS_t00200 1686 1596 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2833 1703 gene locus_tag LOCUS_13350 gene alr 2833 1703 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_13350 4201 3050 gene locus_tag LOCUS_13360 gene wecB 4201 3050 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_13360 4460 4236 gene locus_tag LOCUS_13370 4460 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5518 4457 gene locus_tag LOCUS_13380 gene tsaD 5518 4457 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124623.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence126 2133 820 gene locus_tag LOCUS_13390 2133 820 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125968.1 protein_id gnl|my_center|LOCUS_13390 2257 2457 gene locus_tag LOCUS_13400 gene rpmI 2257 2457 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_13400 2504 2848 gene locus_tag LOCUS_13410 gene rplT 2504 2848 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_13410 2871 3407 gene locus_tag LOCUS_13420 2871 3407 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125972.1 protein_id gnl|my_center|LOCUS_13420 3427 4242 gene locus_tag LOCUS_13430 3427 4242 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055920.1 protein_id gnl|my_center|LOCUS_13430 4252 4536 gene locus_tag LOCUS_13440 4252 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4557 5765 gene locus_tag LOCUS_13450 4557 5765 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence127 272 1096 gene locus_tag LOCUS_13460 gene sufC 272 1096 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_13460 1093 2385 gene locus_tag LOCUS_13470 1093 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2382 3671 gene locus_tag LOCUS_13480 2382 3671 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_13480 4675 4028 gene locus_tag LOCUS_13490 4675 4028 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_13490 <5977 4672 gene locus_tag LOCUS_13500 <5977 4672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068364.1:ATP-binding protein >Feature sequence128 143 1258 gene locus_tag LOCUS_13510 143 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2395 1259 gene locus_tag LOCUS_13520 2395 1259 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124592.1 protein_id gnl|my_center|LOCUS_13520 2974 2408 gene locus_tag LOCUS_13530 2974 2408 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_13530 3045 3716 gene locus_tag LOCUS_13540 3045 3716 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124593.1 protein_id gnl|my_center|LOCUS_13540 4134 3742 gene locus_tag LOCUS_13550 4134 3742 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124594.1 protein_id gnl|my_center|LOCUS_13550 4776 4153 gene locus_tag LOCUS_13560 4776 4153 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124595.1 protein_id gnl|my_center|LOCUS_13560 <5903 4849 gene locus_tag LOCUS_13570 <5903 4849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124596.1:cytochrome c oxidase subunit I >Feature sequence129 534 184 gene locus_tag LOCUS_13580 534 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 848 561 gene locus_tag LOCUS_13590 848 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 2169 781 gene locus_tag LOCUS_13600 2169 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 3364 2186 gene locus_tag LOCUS_13610 3364 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 3736 3365 gene locus_tag LOCUS_13620 3736 3365 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_13620 3971 3729 gene locus_tag LOCUS_13630 3971 3729 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_13630 4178 4378 gene locus_tag LOCUS_13640 4178 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5400 5221 gene locus_tag LOCUS_13650 5400 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5784 5650 gene locus_tag LOCUS_13660 5784 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence130 <1 3245 gene locus_tag LOCUS_13670 <1 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041670058.1:RecQ family ATP-dependent DNA helicase 3711 3262 gene locus_tag LOCUS_13680 3711 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5575 5499 gene locus_tag LOCUS_t00210 5575 5499 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 414 340 gene locus_tag LOCUS_t00220 414 340 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1703 471 gene locus_tag LOCUS_13690 1703 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2467 2928 gene locus_tag LOCUS_13700 2467 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4347 2845 gene locus_tag LOCUS_13710 4347 2845 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124371.1 protein_id gnl|my_center|LOCUS_13710 4699 5787 gene locus_tag LOCUS_13720 4699 5787 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence132 1461 643 gene locus_tag LOCUS_13730 gene rsmG 1461 643 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125779.1 protein_id gnl|my_center|LOCUS_13730 2199 1507 gene locus_tag LOCUS_13740 2199 1507 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_13740 2865 3110 gene locus_tag LOCUS_13750 2865 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3832 3107 gene locus_tag LOCUS_13760 3832 3107 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932199.1 protein_id gnl|my_center|LOCUS_13760 4895 3843 gene locus_tag LOCUS_13770 4895 3843 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892609.1 protein_id gnl|my_center|LOCUS_13770 5167 4898 gene locus_tag LOCUS_13780 5167 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5456 5136 gene locus_tag LOCUS_13790 5456 5136 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence133 1450 2 gene locus_tag LOCUS_13800 1450 2 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_13800 2022 1447 gene locus_tag LOCUS_13810 2022 1447 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124472.1 protein_id gnl|my_center|LOCUS_13810 2602 2093 gene locus_tag LOCUS_13820 2602 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2873 2619 gene locus_tag LOCUS_13830 2873 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3075 2878 gene locus_tag LOCUS_13840 3075 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3374 3210 gene locus_tag LOCUS_13850 3374 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5006 4641 gene locus_tag LOCUS_13860 5006 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence134 374 568 gene locus_tag LOCUS_13870 374 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1017 1616 gene locus_tag LOCUS_13880 1017 1616 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866406.1 protein_id gnl|my_center|LOCUS_13880 1903 1613 gene locus_tag LOCUS_13890 1903 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2763 2023 gene locus_tag LOCUS_13900 gene nadA 2763 2023 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_13900 2791 2890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2906 3760 gene locus_tag LOCUS_13910 2906 3760 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_13910 4283 4696 gene locus_tag LOCUS_13920 4283 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 4828 5613 gene locus_tag LOCUS_13930 4828 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence135 451 939 gene locus_tag LOCUS_13940 451 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1010 1723 gene locus_tag LOCUS_13950 1010 1723 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015424.1 protein_id gnl|my_center|LOCUS_13950 1720 2475 gene locus_tag LOCUS_13960 1720 2475 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125897.1 protein_id gnl|my_center|LOCUS_13960 2500 2799 gene locus_tag LOCUS_13970 2500 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3536 2817 gene locus_tag LOCUS_13980 3536 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3760 4017 gene locus_tag LOCUS_13990 3760 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5091 4087 gene locus_tag LOCUS_14000 gene hemB 5091 4087 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124398.1 protein_id gnl|my_center|LOCUS_14000 <5755 5160 gene locus_tag LOCUS_14010 <5755 5160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056135.1:DnaJ C-terminal domain-containing protein >Feature sequence136 979 2 gene locus_tag LOCUS_14020 979 2 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_14020 978 1511 gene locus_tag LOCUS_14030 978 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1846 2004 gene locus_tag LOCUS_14040 1846 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3056 2034 gene locus_tag LOCUS_14050 3056 2034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124185.1 protein_id gnl|my_center|LOCUS_14050 3420 3049 gene locus_tag LOCUS_14060 3420 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3978 3448 gene locus_tag LOCUS_14070 3978 3448 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125631.1 protein_id gnl|my_center|LOCUS_14070 4088 4264 gene locus_tag LOCUS_14080 4088 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4318 4512 gene locus_tag LOCUS_14090 4318 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4509 5126 gene locus_tag LOCUS_14100 4509 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence137 280 1173 gene locus_tag LOCUS_14110 280 1173 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125982.1 protein_id gnl|my_center|LOCUS_14110 1145 1600 gene locus_tag LOCUS_14120 gene rplI 1145 1600 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125983.1 protein_id gnl|my_center|LOCUS_14120 1637 3052 gene locus_tag LOCUS_14130 gene dnaB 1637 3052 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125984.1 protein_id gnl|my_center|LOCUS_14130 3939 3049 gene locus_tag LOCUS_14140 3939 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence138 778 194 gene locus_tag LOCUS_14150 gene rsmD 778 194 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_14150 1431 787 gene locus_tag LOCUS_14160 gene hisH 1431 787 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125292.1 protein_id gnl|my_center|LOCUS_14160 2453 1428 gene locus_tag LOCUS_14170 2453 1428 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_14170 2814 2488 gene locus_tag LOCUS_14180 gene trxA 2814 2488 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_14180 4025 2862 gene locus_tag LOCUS_14190 4025 2862 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence139 3936 217 gene locus_tag LOCUS_14200 3936 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3935 4792 gene locus_tag LOCUS_14210 gene nadC 3935 4792 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124368.1 protein_id gnl|my_center|LOCUS_14210 4893 5351 gene locus_tag LOCUS_14220 4893 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence140 <1 1471 gene locus_tag LOCUS_14230 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057958.1:NAD(P)H-quinone oxidoreductase subunit F 1476 3071 gene locus_tag LOCUS_14240 1476 3071 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_14240 3061 4218 gene locus_tag LOCUS_14250 3061 4218 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_14250 4223 4483 gene locus_tag LOCUS_14260 4223 4483 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124711.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence141 1642 5 gene locus_tag LOCUS_14270 1642 5 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125023.1 protein_id gnl|my_center|LOCUS_14270 2142 1663 gene locus_tag LOCUS_14280 2142 1663 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_14280 2942 2184 gene locus_tag LOCUS_14290 gene hisA 2942 2184 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892343.1 protein_id gnl|my_center|LOCUS_14290 3020 3967 gene locus_tag LOCUS_14300 3020 3967 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence142 147 1847 gene locus_tag LOCUS_14310 147 1847 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892179.1 protein_id gnl|my_center|LOCUS_14310 3211 1880 gene locus_tag LOCUS_14320 gene eno 3211 1880 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124390.1 protein_id gnl|my_center|LOCUS_14320 3290 4057 gene locus_tag LOCUS_14330 3290 4057 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124349.1 protein_id gnl|my_center|LOCUS_14330 <5463 4054 gene locus_tag LOCUS_14340 <5463 4054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527044.1:tetratricopeptide repeat protein >Feature sequence143 701 1012 gene locus_tag LOCUS_14350 701 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1055 1345 gene locus_tag LOCUS_14360 1055 1345 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 protein_id gnl|my_center|LOCUS_14360 1576 3825 gene locus_tag LOCUS_14370 1576 3825 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125140.1 protein_id gnl|my_center|LOCUS_14370 4784 3822 gene locus_tag LOCUS_14380 gene arsS 4784 3822 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_14380 <5389 4754 gene locus_tag LOCUS_14390 <5389 4754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125287.1:DUF1957 domain-containing protein >Feature sequence144 <1 836 gene locus_tag LOCUS_14400 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267865.1:abortive infection family protein 2188 1712 gene locus_tag LOCUS_14410 2188 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2651 2178 gene locus_tag LOCUS_14420 2651 2178 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_14420 3936 2908 gene locus_tag LOCUS_14430 3936 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14430 >Feature sequence145 565 74 gene locus_tag LOCUS_14440 565 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3479 858 gene locus_tag LOCUS_14450 gene leuS 3479 858 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_14450 3493 4695 gene locus_tag LOCUS_14460 3493 4695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125192.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence146 1059 2699 gene locus_tag LOCUS_14470 1059 2699 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125286.1 protein_id gnl|my_center|LOCUS_14470 3454 2666 gene locus_tag LOCUS_14480 3454 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3954 3451 gene locus_tag LOCUS_14490 3954 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4740 3961 gene locus_tag LOCUS_14500 4740 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 >Feature sequence147 1456 3393 gene locus_tag LOCUS_14510 gene dxs 1456 3393 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125080.1 protein_id gnl|my_center|LOCUS_14510 3739 3479 gene locus_tag LOCUS_14520 gene psaK 3739 3479 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_14520 4162 3842 gene locus_tag LOCUS_14530 4162 3842 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_14530 4476 4168 gene locus_tag LOCUS_14540 4476 4168 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence148 1950 1330 gene locus_tag LOCUS_14550 1950 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2154 2480 gene locus_tag LOCUS_14560 2154 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3610 2588 gene locus_tag LOCUS_14570 3610 2588 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_14570 3959 3669 gene locus_tag LOCUS_14580 3959 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4404 4616 gene locus_tag LOCUS_14590 4404 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence149 1029 532 gene locus_tag LOCUS_14600 1029 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 1243 2709 gene locus_tag LOCUS_14610 gene zds 1243 2709 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124291.1 protein_id gnl|my_center|LOCUS_14610 2711 3163 gene locus_tag LOCUS_14620 2711 3163 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124290.1 protein_id gnl|my_center|LOCUS_14620 3221 3718 gene locus_tag LOCUS_14630 3221 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3779 4783 gene locus_tag LOCUS_14640 3779 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence150 590 940 gene locus_tag LOCUS_14650 590 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1328 1005 gene locus_tag LOCUS_14660 1328 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1932 1318 gene locus_tag LOCUS_14670 1932 1318 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892147.1 protein_id gnl|my_center|LOCUS_14670 2013 3317 gene locus_tag LOCUS_14680 2013 3317 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_14680 3326 4003 gene locus_tag LOCUS_14690 gene trmB 3326 4003 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_14690 4007 4264 gene locus_tag LOCUS_14700 4007 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence151 886 3429 gene locus_tag LOCUS_14710 886 3429 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125259.1 protein_id gnl|my_center|LOCUS_14710 3445 4641 gene locus_tag LOCUS_14720 3445 4641 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125260.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence152 370 56 gene locus_tag LOCUS_14730 370 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2104 647 gene locus_tag LOCUS_14740 2104 647 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_14740 2569 2120 gene locus_tag LOCUS_14750 2569 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2633 3514 gene locus_tag LOCUS_14760 gene xth 2633 3514 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124637.1 protein_id gnl|my_center|LOCUS_14760 3558 4862 gene locus_tag LOCUS_14770 gene hemL 3558 4862 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124636.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence153 770 276 gene locus_tag LOCUS_14780 770 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1522 767 gene locus_tag LOCUS_14790 1522 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1629 1543 gene locus_tag LOCUS_t00230 1629 1543 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3994 1721 gene locus_tag LOCUS_14800 gene nrdJ 3994 1721 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892211.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence154 554 249 gene locus_tag LOCUS_14810 554 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1247 765 gene locus_tag LOCUS_14820 1247 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1861 1244 gene locus_tag LOCUS_14830 1861 1244 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405961.1 protein_id gnl|my_center|LOCUS_14830 4467 1882 gene locus_tag LOCUS_14840 gene gyrA 4467 1882 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892286.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence155 <1 2375 gene locus_tag LOCUS_14850 <1 2375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125771.1:DEAD/DEAH box helicase 2807 2571 gene locus_tag LOCUS_14860 2807 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125112.1 protein_id gnl|my_center|LOCUS_14860 2961 3362 gene locus_tag LOCUS_14870 2961 3362 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125357.1 protein_id gnl|my_center|LOCUS_14870 4256 3408 gene locus_tag LOCUS_14880 4256 3408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence156 1116 214 gene locus_tag LOCUS_14890 1116 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1768 1481 gene locus_tag LOCUS_14900 1768 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2391 1900 gene locus_tag LOCUS_14910 2391 1900 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125828.1 protein_id gnl|my_center|LOCUS_14910 3020 3268 gene locus_tag LOCUS_14920 3020 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4202 3210 gene locus_tag LOCUS_14930 4202 3210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_14930 <4798 4258 gene locus_tag LOCUS_14940 <4798 4258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125824.1:C40 family peptidase >Feature sequence157 159 317 gene locus_tag LOCUS_14950 159 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 835 2529 gene locus_tag LOCUS_14960 835 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2547 2635 gene locus_tag LOCUS_t00240 2547 2635 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3678 4004 gene locus_tag LOCUS_14970 3678 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4266 4436 gene locus_tag LOCUS_14980 4266 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence158 250 2145 gene locus_tag LOCUS_14990 gene htpG 250 2145 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125086.1 protein_id gnl|my_center|LOCUS_14990 2238 2387 gene locus_tag LOCUS_15000 2238 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3534 2701 gene locus_tag LOCUS_15010 3534 2701 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_15010 3925 3545 gene locus_tag LOCUS_15020 3925 3545 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_15020 3991 4078 gene locus_tag LOCUS_t00250 3991 4078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <4667 4129 gene locus_tag LOCUS_15030 <4667 4129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125111.1:methionine synthase >Feature sequence159 935 1690 gene locus_tag LOCUS_15040 935 1690 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_15040 2853 1732 gene locus_tag LOCUS_15050 2853 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4037 2850 gene locus_tag LOCUS_15060 4037 2850 CDS product F420-0:Gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921060.1 protein_id gnl|my_center|LOCUS_15060 4576 4034 gene locus_tag LOCUS_15070 4576 4034 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125022.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence160 <1 769 gene locus_tag LOCUS_15080 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125015.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase 766 1893 gene locus_tag LOCUS_15090 gene leuB 766 1893 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125014.1 protein_id gnl|my_center|LOCUS_15090 1940 2842 gene locus_tag LOCUS_15100 1940 2842 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_15100 2898 3761 gene locus_tag LOCUS_15110 2898 3761 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence161 814 86 gene locus_tag LOCUS_15120 814 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1309 1554 gene locus_tag LOCUS_15130 1309 1554 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124572.1 protein_id gnl|my_center|LOCUS_15130 1614 2978 gene locus_tag LOCUS_15140 gene serS 1614 2978 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125455.1 protein_id gnl|my_center|LOCUS_15140 2834 2737 gene locus_tag LOCUS_t00260 2834 2737 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4389 2953 gene locus_tag LOCUS_15150 gene mqo 4389 2953 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence162 2302 530 gene locus_tag LOCUS_15160 gene ilvB 2302 530 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124680.1 protein_id gnl|my_center|LOCUS_15160 3675 2512 gene locus_tag LOCUS_15170 gene hemH 3675 2512 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124679.1 protein_id gnl|my_center|LOCUS_15170 4537 3776 gene locus_tag LOCUS_15180 gene urtD 4537 3776 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence163 600 1325 gene locus_tag LOCUS_15190 600 1325 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_15190 1337 2350 gene locus_tag LOCUS_15200 1337 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence164 777 211 gene locus_tag LOCUS_15210 777 211 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530136.1 protein_id gnl|my_center|LOCUS_15210 935 1603 gene locus_tag LOCUS_15220 935 1603 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_15220 1596 2855 gene locus_tag LOCUS_15230 1596 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2884 3078 gene locus_tag LOCUS_15240 2884 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3161 4567 gene locus_tag LOCUS_15250 3161 4567 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920942.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence165 494 2677 gene locus_tag LOCUS_15260 gene ppk1 494 2677 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126011.1 protein_id gnl|my_center|LOCUS_15260 3872 2679 gene locus_tag LOCUS_15270 3872 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124347.1 protein_id gnl|my_center|LOCUS_15270 4118 3873 gene locus_tag LOCUS_15280 4118 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4356 4111 gene locus_tag LOCUS_15290 4356 4111 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259332.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence166 2479 497 gene locus_tag LOCUS_15300 2479 497 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892411.1 protein_id gnl|my_center|LOCUS_15300 2714 3619 gene locus_tag LOCUS_15310 gene folD 2714 3619 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125282.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence167 304 846 gene locus_tag LOCUS_15320 gene frr 304 846 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_15320 2033 858 gene locus_tag LOCUS_15330 2033 858 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_15330 3113 2616 gene locus_tag LOCUS_15340 3113 2616 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124734.1 protein_id gnl|my_center|LOCUS_15340 3146 3484 gene locus_tag LOCUS_15350 3146 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4166 3453 gene locus_tag LOCUS_15360 gene ubiE 4166 3453 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124582.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence168 725 420 gene locus_tag LOCUS_15370 725 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3685 1055 gene locus_tag LOCUS_15380 gene clpB 3685 1055 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_15380 4261 3812 gene locus_tag LOCUS_15390 4261 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence169 1530 1102 gene locus_tag LOCUS_15400 1530 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2383 2051 gene locus_tag LOCUS_15410 2383 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2563 3420 gene locus_tag LOCUS_15420 gene rsmA 2563 3420 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_15420 3417 4379 gene locus_tag LOCUS_15430 gene ispE 3417 4379 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124916.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence170 217 2040 gene locus_tag LOCUS_15440 217 2040 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125957.1 protein_id gnl|my_center|LOCUS_15440 2262 3533 gene locus_tag LOCUS_15450 2262 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15450 3442 3771 gene locus_tag LOCUS_15460 3442 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 >Feature sequence171 1205 57 gene locus_tag LOCUS_15470 1205 57 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_15470 1305 2477 gene locus_tag LOCUS_15480 gene cbiD 1305 2477 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124192.1 protein_id gnl|my_center|LOCUS_15480 2612 4243 gene locus_tag LOCUS_15490 gene guaA 2612 4243 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence172 657 729 gene locus_tag LOCUS_t00270 657 729 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1832 768 gene locus_tag LOCUS_15500 1832 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3366 3124 gene locus_tag LOCUS_15510 3366 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 4007 3573 gene locus_tag LOCUS_15520 4007 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence173 667 903 gene locus_tag LOCUS_15530 667 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 958 1584 gene locus_tag LOCUS_15540 958 1584 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_15540 2829 1621 gene locus_tag LOCUS_15550 2829 1621 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124376.1 protein_id gnl|my_center|LOCUS_15550 2913 3296 gene locus_tag LOCUS_15560 2913 3296 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence174 98 835 gene locus_tag LOCUS_15570 98 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1594 1974 gene locus_tag LOCUS_15580 1594 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124195.1 protein_id gnl|my_center|LOCUS_15580 1974 3782 gene locus_tag LOCUS_15590 gene mrdA 1974 3782 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124196.1 protein_id gnl|my_center|LOCUS_15590 3855 4148 gene locus_tag LOCUS_15600 3855 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence175 2801 1374 gene locus_tag LOCUS_15610 2801 1374 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081447092.1 protein_id gnl|my_center|LOCUS_15610 3970 2819 gene locus_tag LOCUS_15620 3970 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence176 1035 1044 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2738 1560 gene locus_tag LOCUS_15630 2738 1560 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_15630 3457 2744 gene locus_tag LOCUS_15640 3457 2744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_15640 4243 3476 gene locus_tag LOCUS_15650 4243 3476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence177 2104 491 gene locus_tag LOCUS_15660 2104 491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039710.1 protein_id gnl|my_center|LOCUS_15660 1141 1072 gene locus_tag LOCUS_t00280 1141 1072 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2611 2171 gene locus_tag LOCUS_15670 2611 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2822 4135 gene locus_tag LOCUS_15680 2822 4135 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124461.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence178 344 204 gene locus_tag LOCUS_15690 344 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 862 542 gene locus_tag LOCUS_15700 862 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1280 915 gene locus_tag LOCUS_15710 1280 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2971 1277 gene locus_tag LOCUS_15720 2971 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 3752 3003 gene locus_tag LOCUS_15730 3752 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15730 >Feature sequence179 278 2086 gene locus_tag LOCUS_15740 gene lepA 278 2086 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124574.1 protein_id gnl|my_center|LOCUS_15740 <4282 2836 gene locus_tag LOCUS_15750 <4282 2836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124960.1:GMC family oxidoreductase >Feature sequence180 1597 464 gene locus_tag LOCUS_15760 1597 464 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124599.1 protein_id gnl|my_center|LOCUS_15760 2526 1669 gene locus_tag LOCUS_15770 2526 1669 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_15770 2713 3564 gene locus_tag LOCUS_15780 2713 3564 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891713.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence181 2290 1385 gene locus_tag LOCUS_15790 2290 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3212 2313 gene locus_tag LOCUS_15800 3212 2313 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480256.1 protein_id gnl|my_center|LOCUS_15800 <4219 3305 gene locus_tag LOCUS_15810 <4219 3305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057189.1:ferredoxin--nitrite reductase >Feature sequence182 139 381 gene locus_tag LOCUS_15820 139 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 318 572 gene locus_tag LOCUS_15830 318 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 928 1320 gene locus_tag LOCUS_15840 928 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1230 1838 gene locus_tag LOCUS_15850 1230 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2095 2424 gene locus_tag LOCUS_15860 2095 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2597 2875 gene locus_tag LOCUS_15870 2597 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3008 3208 gene locus_tag LOCUS_15880 3008 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence183 <1 1151 gene locus_tag LOCUS_15890 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125749.1:NAD+ synthase 2122 1157 gene locus_tag LOCUS_15900 2122 1157 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_15900 2738 2151 gene locus_tag LOCUS_15910 2738 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2872 3459 gene locus_tag LOCUS_15920 2872 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence184 640 569 gene locus_tag LOCUS_t00290 640 569 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 748 1281 gene locus_tag LOCUS_15930 748 1281 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_15930 1311 1430 gene locus_tag LOCUS_15940 1311 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1459 2973 gene locus_tag LOCUS_15950 gene crtH 1459 2973 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence185 <1 581 gene locus_tag LOCUS_15960 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125388.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase 2698 2126 gene locus_tag LOCUS_15970 2698 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2965 2705 gene locus_tag LOCUS_15980 2965 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3191 4144 gene locus_tag LOCUS_15990 3191 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 >Feature sequence186 610 1425 gene locus_tag LOCUS_16000 610 1425 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_16000 1732 1391 gene locus_tag LOCUS_16010 1732 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2021 2227 gene locus_tag LOCUS_16020 2021 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2473 2246 gene locus_tag LOCUS_16030 2473 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2533 3651 gene locus_tag LOCUS_16040 2533 3651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125033.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence187 434 204 gene locus_tag LOCUS_16050 434 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1047 460 gene locus_tag LOCUS_16060 1047 460 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124647.1 protein_id gnl|my_center|LOCUS_16060 1475 1122 gene locus_tag LOCUS_16070 1475 1122 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125208.1 protein_id gnl|my_center|LOCUS_16070 2070 1489 gene locus_tag LOCUS_16080 gene lepB 2070 1489 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125207.1 protein_id gnl|my_center|LOCUS_16080 2179 4041 gene locus_tag LOCUS_16090 gene menD 2179 4041 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125206.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence188 2686 1763 gene locus_tag LOCUS_16100 2686 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 1790 1799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2941 3144 gene locus_tag LOCUS_16110 2941 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3187 3585 gene locus_tag LOCUS_16120 3187 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence189 951 409 gene locus_tag LOCUS_16130 951 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2890 977 gene locus_tag LOCUS_16140 2890 977 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126032.1 protein_id gnl|my_center|LOCUS_16140 3268 3699 gene locus_tag LOCUS_16150 3268 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence190 138 314 gene locus_tag LOCUS_16160 138 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 371 442 gene locus_tag LOCUS_t00300 371 442 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 476 4078 gene locus_tag LOCUS_16170 476 4078 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence191 169 1230 gene locus_tag LOCUS_16180 169 1230 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124828.1 protein_id gnl|my_center|LOCUS_16180 1227 2135 gene locus_tag LOCUS_16190 1227 2135 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124827.1 protein_id gnl|my_center|LOCUS_16190 2128 3171 gene locus_tag LOCUS_16200 2128 3171 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124826.1 protein_id gnl|my_center|LOCUS_16200 3207 3980 gene locus_tag LOCUS_16210 3207 3980 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence192 3751 3542 gene locus_tag LOCUS_16220 3751 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence193 1135 1875 gene locus_tag LOCUS_16230 1135 1875 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125198.1 protein_id gnl|my_center|LOCUS_16230 2718 2924 gene locus_tag LOCUS_16240 2718 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3878 2952 gene locus_tag LOCUS_16250 3878 2952 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence194 <1 1355 gene locus_tag LOCUS_16260 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125181.1:peptide chain release factor 3 1421 1819 gene locus_tag LOCUS_16270 1421 1819 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_16270 1907 3763 gene locus_tag LOCUS_16280 1907 3763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124211.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence195 528 2864 gene locus_tag LOCUS_16290 528 2864 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124372.1 protein_id gnl|my_center|LOCUS_16290 3261 3404 gene locus_tag LOCUS_16300 3261 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence196 969 1640 gene locus_tag LOCUS_16310 969 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2939 1644 gene locus_tag LOCUS_16320 2939 1644 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_16320 <3992 2929 gene locus_tag LOCUS_16330 <3992 2929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057962.1:MraY family glycosyltransferase >Feature sequence197 1322 963 gene locus_tag LOCUS_16340 1322 963 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_16340 1634 1332 gene locus_tag LOCUS_16350 gene ureA 1634 1332 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_16350 1960 3063 gene locus_tag LOCUS_16360 1960 3063 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_16360 3129 3908 gene locus_tag LOCUS_16370 3129 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence198 1236 586 gene locus_tag LOCUS_16380 1236 586 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125889.1 protein_id gnl|my_center|LOCUS_16380 1334 1849 gene locus_tag LOCUS_16390 1334 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2126 2389 gene locus_tag LOCUS_16400 2126 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3494 2673 gene locus_tag LOCUS_16410 3494 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence199 654 1217 gene locus_tag LOCUS_16420 654 1217 CDS product DUF3611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125497.1 protein_id gnl|my_center|LOCUS_16420 2017 1214 gene locus_tag LOCUS_16430 gene surE 2017 1214 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125496.1 protein_id gnl|my_center|LOCUS_16430 2104 3117 gene locus_tag LOCUS_16440 gene pheS 2104 3117 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125495.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence200 781 422 gene locus_tag LOCUS_16450 781 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2928 1168 gene locus_tag LOCUS_16460 2928 1168 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124880.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence201 <3913 2321 gene locus_tag LOCUS_16470 <3913 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125136.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence202 1336 929 gene locus_tag LOCUS_16480 1336 929 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 protein_id gnl|my_center|LOCUS_16480 1731 1384 gene locus_tag LOCUS_16490 1731 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3262 1781 gene locus_tag LOCUS_16500 gene gatA 3262 1781 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124902.1 protein_id gnl|my_center|LOCUS_16500 3568 3329 gene locus_tag LOCUS_16510 3568 3329 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124901.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence203 62 715 gene locus_tag LOCUS_16520 gene cbiT 62 715 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_16520 712 1596 gene locus_tag LOCUS_16530 712 1596 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125263.1 protein_id gnl|my_center|LOCUS_16530 2167 1490 gene locus_tag LOCUS_16540 2167 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2268 3266 gene locus_tag LOCUS_16550 2268 3266 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892408.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence204 732 1370 gene locus_tag LOCUS_16560 732 1370 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125031.1 protein_id gnl|my_center|LOCUS_16560 1444 2550 gene locus_tag LOCUS_16570 gene gcvT 1444 2550 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126000.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence205 <1 595 gene locus_tag LOCUS_16580 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124401.1:GTPase ObgE 1413 598 gene locus_tag LOCUS_16590 1413 598 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124270.1 protein_id gnl|my_center|LOCUS_16590 2756 1422 gene locus_tag LOCUS_16600 2756 1422 CDS product PucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124501.1 protein_id gnl|my_center|LOCUS_16600 3606 2665 gene locus_tag LOCUS_16610 3606 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence206 69 1064 gene locus_tag LOCUS_16620 69 1064 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125746.1 protein_id gnl|my_center|LOCUS_16620 1061 2431 gene locus_tag LOCUS_16630 1061 2431 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125747.1 protein_id gnl|my_center|LOCUS_16630 2428 3057 gene locus_tag LOCUS_16640 2428 3057 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125748.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence207 1408 2331 gene locus_tag LOCUS_16650 gene lipA 1408 2331 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125251.1 protein_id gnl|my_center|LOCUS_16650 2769 3134 gene locus_tag LOCUS_16660 2769 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 >Feature sequence208 795 1568 gene locus_tag LOCUS_16670 795 1568 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_16670 1605 3230 gene locus_tag LOCUS_16680 1605 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence209 2398 1022 gene locus_tag LOCUS_16690 gene mnmE 2398 1022 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124369.1 protein_id gnl|my_center|LOCUS_16690 2765 2571 gene locus_tag LOCUS_16700 2765 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence210 782 42 gene locus_tag LOCUS_16710 782 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1354 767 gene locus_tag LOCUS_16720 1354 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2632 1577 gene locus_tag LOCUS_16730 2632 1577 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124944.1 protein_id gnl|my_center|LOCUS_16730 3052 2702 gene locus_tag LOCUS_16740 3052 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 <3580 3052 gene locus_tag LOCUS_16750 <3580 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125945.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence211 397 44 gene locus_tag LOCUS_16760 397 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 503 1279 gene locus_tag LOCUS_16770 503 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1426 2073 gene locus_tag LOCUS_16780 gene rdgB 1426 2073 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_16780 2356 2033 gene locus_tag LOCUS_16790 2356 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2517 2726 gene locus_tag LOCUS_16800 2517 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence212 1987 899 gene locus_tag LOCUS_16810 1987 899 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125009.1 protein_id gnl|my_center|LOCUS_16810 3276 3016 gene locus_tag LOCUS_16820 3276 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence213 1813 1151 gene locus_tag LOCUS_16830 1813 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16830 2199 1834 gene locus_tag LOCUS_16840 2199 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 <3546 2540 gene locus_tag LOCUS_16850 <3546 2540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124204.1:biosynthetic arginine decarboxylase >Feature sequence214 <1 701 gene locus_tag LOCUS_16860 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124352.1:NAD(P)H-quinone oxidoreductase subunit H 2532 1363 gene locus_tag LOCUS_16870 2532 1363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_16870 3401 2652 gene locus_tag LOCUS_16880 gene cobI 3401 2652 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124541.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence215 879 2147 gene locus_tag LOCUS_16890 879 2147 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125529.1 protein_id gnl|my_center|LOCUS_16890 3177 2158 gene locus_tag LOCUS_16900 3177 2158 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence216 1075 593 gene locus_tag LOCUS_16910 1075 593 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_16910 1138 1626 gene locus_tag LOCUS_16920 gene coaD 1138 1626 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125104.1 protein_id gnl|my_center|LOCUS_16920 1644 2537 gene locus_tag LOCUS_16930 1644 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence217 <1 1172 gene locus_tag LOCUS_16940 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013191710.1:phosphoglucosamine mutase 2581 1160 gene locus_tag LOCUS_16950 gene glnA 2581 1160 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125190.1 protein_id gnl|my_center|LOCUS_16950 2791 3309 gene locus_tag LOCUS_16960 gene apcB 2791 3309 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence218 282 1013 gene locus_tag LOCUS_16970 282 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1606 1097 gene locus_tag LOCUS_16980 gene scpB 1606 1097 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923281.1 protein_id gnl|my_center|LOCUS_16980 3179 1644 gene locus_tag LOCUS_16990 gene ilvA 3179 1644 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125079.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence219 127 300 gene locus_tag LOCUS_17000 127 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 297 791 gene locus_tag LOCUS_17010 297 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 784 1317 gene locus_tag LOCUS_17020 784 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1301 1999 gene locus_tag LOCUS_17030 1301 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2428 2066 gene locus_tag LOCUS_17040 2428 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence220 746 755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 772 1998 gene locus_tag LOCUS_17050 772 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1979 2950 gene locus_tag LOCUS_17060 1979 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence221 1148 513 gene locus_tag LOCUS_17070 1148 513 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_17070 2556 1273 gene locus_tag LOCUS_17080 2556 1273 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125543.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence222 2070 361 gene locus_tag LOCUS_17090 2070 361 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124672.1 protein_id gnl|my_center|LOCUS_17090 2460 2128 gene locus_tag LOCUS_17100 2460 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 <3404 2696 gene locus_tag LOCUS_17110 <3404 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124670.1:CPBP family intramembrane metalloprotease >Feature sequence223 942 2324 gene locus_tag LOCUS_17120 gene murF 942 2324 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125203.1 protein_id gnl|my_center|LOCUS_17120 2597 2842 gene locus_tag LOCUS_17130 2597 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17130 >Feature sequence224 500 204 gene locus_tag LOCUS_17140 500 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 910 497 gene locus_tag LOCUS_17150 910 497 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_17150 2921 1371 gene locus_tag LOCUS_17160 2921 1371 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_17160 3234 3046 gene locus_tag LOCUS_17170 3234 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence225 384 1667 gene locus_tag LOCUS_17180 384 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1936 2706 gene locus_tag LOCUS_17190 1936 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17190 2717 2875 gene locus_tag LOCUS_17200 2717 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence226 336 142 gene locus_tag LOCUS_17210 336 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence227 <1 839 gene locus_tag LOCUS_17220 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124683.1:Tab2/Atab2 family RNA-binding protein 839 1663 gene locus_tag LOCUS_17230 gene pgeF 839 1663 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_17230 2056 1688 gene locus_tag LOCUS_17240 2056 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3057 3299 gene locus_tag LOCUS_17250 3057 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence228 1746 175 gene locus_tag LOCUS_17260 1746 175 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818556.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence229 >Feature sequence230 1006 284 gene locus_tag LOCUS_17270 1006 284 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124925.1 protein_id gnl|my_center|LOCUS_17270 1063 2106 gene locus_tag LOCUS_17280 gene mnmH 1063 2106 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_17280 2131 2466 gene locus_tag LOCUS_17290 gene psb28 2131 2466 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124923.1 protein_id gnl|my_center|LOCUS_17290 <3306 2676 gene locus_tag LOCUS_17300 <3306 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000265858.1:PhoX family phosphatase >Feature sequence231 948 565 gene locus_tag LOCUS_17310 948 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1027 2160 gene locus_tag LOCUS_17320 1027 2160 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126019.1 protein_id gnl|my_center|LOCUS_17320 2787 2338 gene locus_tag LOCUS_17330 2787 2338 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124645.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence232 888 490 gene locus_tag LOCUS_17340 888 490 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119983.1 protein_id gnl|my_center|LOCUS_17340 1214 885 gene locus_tag LOCUS_17350 1214 885 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_17350 1758 1219 gene locus_tag LOCUS_17360 1758 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1835 2278 gene locus_tag LOCUS_17370 1835 2278 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_17370 3222 2428 gene locus_tag LOCUS_17380 3222 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence233 1028 702 gene locus_tag LOCUS_17390 1028 702 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_17390 1215 1039 gene locus_tag LOCUS_17400 1215 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 1334 1480 gene locus_tag LOCUS_17410 1334 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2453 1482 gene locus_tag LOCUS_17420 gene sds 2453 1482 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125194.1 protein_id gnl|my_center|LOCUS_17420 3272 2478 gene locus_tag LOCUS_17430 gene murI 3272 2478 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence234 1225 305 gene locus_tag LOCUS_17440 1225 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1804 1241 gene locus_tag LOCUS_17450 1804 1241 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125888.1 protein_id gnl|my_center|LOCUS_17450 2108 1893 gene locus_tag LOCUS_17460 2108 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2158 3231 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgctcaacgaaggccggggccgaaaccccggcgacac >Feature sequence235 374 153 gene locus_tag LOCUS_17470 374 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1881 1111 gene locus_tag LOCUS_17480 1881 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3050 1977 gene locus_tag LOCUS_17490 3050 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence236 534 722 gene locus_tag LOCUS_17500 534 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 731 1546 gene locus_tag LOCUS_17510 731 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2650 2414 gene locus_tag LOCUS_17520 2650 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence237 909 724 gene locus_tag LOCUS_17530 909 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1675 1337 gene locus_tag LOCUS_17540 1675 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 <3229 1704 gene locus_tag LOCUS_17550 <3229 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957294.1:ankyrin repeat domain-containing protein >Feature sequence238 598 407 gene locus_tag LOCUS_17560 598 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence239 1012 785 gene locus_tag LOCUS_17570 1012 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence240 88 15 gene locus_tag LOCUS_t00310 88 15 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 174 1868 gene locus_tag LOCUS_17580 174 1868 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124260.1 protein_id gnl|my_center|LOCUS_17580 2928 1882 gene locus_tag LOCUS_17590 2928 1882 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_17590 3082 3011 gene locus_tag LOCUS_t00320 3082 3011 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3167 3086 gene locus_tag LOCUS_t00330 3167 3086 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 <1 704 gene locus_tag LOCUS_17600 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124610.1:4-hydroxybenzoate polyprenyltransferase 717 1907 gene locus_tag LOCUS_17610 717 1907 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_17610 2806 2531 gene locus_tag LOCUS_17620 2806 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 >Feature sequence242 1337 2209 gene locus_tag LOCUS_17630 1337 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2256 2540 gene locus_tag LOCUS_17640 2256 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2669 2890 gene locus_tag LOCUS_17650 2669 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence243 1835 270 gene locus_tag LOCUS_17660 1835 270 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125895.1 protein_id gnl|my_center|LOCUS_17660 1865 2899 gene locus_tag LOCUS_17670 gene purM 1865 2899 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125894.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence244 1557 1234 gene locus_tag LOCUS_17680 1557 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1857 1630 gene locus_tag LOCUS_17690 1857 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2477 1857 gene locus_tag LOCUS_17700 2477 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence245 2198 540 gene locus_tag LOCUS_17710 2198 540 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124699.1 protein_id gnl|my_center|LOCUS_17710 <3097 2222 gene locus_tag LOCUS_17720 <3097 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124700.1:ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N >Feature sequence246 1309 425 gene locus_tag LOCUS_17730 1309 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence247 302 457 gene locus_tag LOCUS_17740 302 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 553 939 gene locus_tag LOCUS_17750 553 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2187 1420 gene locus_tag LOCUS_17760 2187 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2412 2221 gene locus_tag LOCUS_17770 2412 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 <3056 2416 gene locus_tag LOCUS_17780 <3056 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143072.1:AAA family ATPase note possible pseudo, internal stop codon >Feature sequence248 472 717 gene locus_tag LOCUS_17790 472 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1171 2682 gene locus_tag LOCUS_17800 1171 2682 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125564.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence249 2407 2679 gene locus_tag LOCUS_17810 2407 2679 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124895.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence250 1805 555 gene locus_tag LOCUS_17820 1805 555 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339591.1 protein_id gnl|my_center|LOCUS_17820 2362 1862 gene locus_tag LOCUS_17830 2362 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2787 2392 gene locus_tag LOCUS_17840 2787 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence251 <1 566 gene locus_tag LOCUS_17850 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053094604.1:ABC transporter ATP-binding protein 2205 574 gene locus_tag LOCUS_17860 2205 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2579 2115 gene locus_tag LOCUS_17870 2579 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence252 262 59 gene locus_tag LOCUS_17880 262 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 480 286 gene locus_tag LOCUS_17890 480 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence253 >Feature sequence254 1769 642 gene locus_tag LOCUS_17900 1769 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence255 1520 987 gene locus_tag LOCUS_17910 1520 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1895 1575 gene locus_tag LOCUS_17920 gene nuoK 1895 1575 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124336.1 protein_id gnl|my_center|LOCUS_17920 2518 1892 gene locus_tag LOCUS_17930 2518 1892 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence256 908 180 gene locus_tag LOCUS_17940 908 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1008 1466 gene locus_tag LOCUS_17950 1008 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1479 1916 gene locus_tag LOCUS_17960 1479 1916 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_17960 <2928 2006 gene locus_tag LOCUS_17970 <2928 2006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043786554.1:alpha/beta hydrolase >Feature sequence257 459 166 gene locus_tag LOCUS_17980 459 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 678 529 gene locus_tag LOCUS_17990 678 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 869 1114 gene locus_tag LOCUS_18000 869 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2818 1673 gene locus_tag LOCUS_18010 gene ruvB 2818 1673 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence258 1421 120 gene locus_tag LOCUS_18020 1421 120 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124272.1 protein_id gnl|my_center|LOCUS_18020 <2919 1602 gene locus_tag LOCUS_18030 <2919 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056221.1:argininosuccinate lyase >Feature sequence259 <1 509 gene locus_tag LOCUS_18040 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136429263.1:type I restriction-modification system subunit M note possible pseudo, frameshifted 1181 1354 gene locus_tag LOCUS_18050 1181 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2233 2646 gene locus_tag LOCUS_18060 2233 2646 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810333.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence260 <1 1403 gene locus_tag LOCUS_18070 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057590.1:excinuclease ABC subunit UvrC 2188 1421 gene locus_tag LOCUS_18080 2188 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence261 <1 1368 gene locus_tag LOCUS_18090 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124465.1:phosphoglucomutase/phosphomannomutase family protein >Feature sequence262 1740 1153 gene locus_tag LOCUS_18100 gene rimM 1740 1153 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_18100 1814 2134 gene locus_tag LOCUS_18110 1814 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence263 1411 1510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence264 >Feature sequence265 452 162 gene locus_tag LOCUS_18120 452 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence266 >Feature sequence267 <1 2130 gene locus_tag LOCUS_18130 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125055.1:magnesium chelatase subunit H 2206 2460 gene locus_tag LOCUS_18140 2206 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence268 511 882 gene locus_tag LOCUS_18150 511 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18150 1036 1287 gene locus_tag LOCUS_18160 1036 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18160 2001 1297 gene locus_tag LOCUS_18170 2001 1297 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_18170 <2803 2001 gene locus_tag LOCUS_18180 <2803 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056582.1:ATP-dependent DNA helicase RecG >Feature sequence269 1079 1798 gene locus_tag LOCUS_18190 gene bioD 1079 1798 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973493.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence270 572 54 gene locus_tag LOCUS_18200 572 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 653 572 gene locus_tag LOCUS_t00340 653 572 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 744 2120 gene locus_tag LOCUS_18210 gene accC 744 2120 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_18210 2448 2113 gene locus_tag LOCUS_18220 2448 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence271 1048 158 gene locus_tag LOCUS_18230 1048 158 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125446.1 protein_id gnl|my_center|LOCUS_18230 1276 2097 gene locus_tag LOCUS_18240 gene sppA 1276 2097 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125447.1 protein_id gnl|my_center|LOCUS_18240 2094 2477 gene locus_tag LOCUS_18250 gene aroH 2094 2477 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence272 265 399 gene locus_tag LOCUS_18260 265 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 682 473 gene locus_tag LOCUS_18270 682 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1307 789 gene locus_tag LOCUS_18280 1307 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence273 1 381 gene locus_tag LOCUS_18290 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 443 1561 gene locus_tag LOCUS_18300 gene carA 443 1561 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124897.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence274 2482 1976 gene locus_tag LOCUS_18310 2482 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence275 792 427 gene locus_tag LOCUS_18320 792 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 847 1083 gene locus_tag LOCUS_18330 gene rpmB 847 1083 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_18330 1137 2396 gene locus_tag LOCUS_18340 1137 2396 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124942.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence276 <1 599 gene locus_tag LOCUS_18350 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125523.1:dihydrolipoyl dehydrogenase 626 1540 gene locus_tag LOCUS_18360 gene trpC 626 1540 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125522.1 protein_id gnl|my_center|LOCUS_18360 2209 1517 gene locus_tag LOCUS_18370 2209 1517 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence277 <1 1070 gene locus_tag LOCUS_18380 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124467.1:carotenoid oxygenase family protein 1067 2485 gene locus_tag LOCUS_18390 1067 2485 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125528.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence278 560 1057 gene locus_tag LOCUS_18400 560 1057 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_18400 1718 1383 gene locus_tag LOCUS_18410 1718 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2426 1722 gene locus_tag LOCUS_18420 2426 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2605 2312 gene locus_tag LOCUS_18430 2605 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence279 381 878 gene locus_tag LOCUS_18440 381 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 896 1591 gene locus_tag LOCUS_18450 896 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 926 935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1731 1552 gene locus_tag LOCUS_18460 1731 1552 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140794.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence280 983 129 gene locus_tag LOCUS_18470 gene trpA 983 129 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124727.1 protein_id gnl|my_center|LOCUS_18470 1362 1012 gene locus_tag LOCUS_18480 1362 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1595 1359 gene locus_tag LOCUS_18490 1595 1359 CDS product NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124725.1 protein_id gnl|my_center|LOCUS_18490 1729 1656 gene locus_tag LOCUS_t00350 1729 1656 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1769 2035 gene locus_tag LOCUS_18500 1769 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence281 <1 622 gene locus_tag LOCUS_18510 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920827.1:alpha-E domain-containing protein 619 1500 gene locus_tag LOCUS_18520 619 1500 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence282 1385 1044 gene locus_tag LOCUS_18530 1385 1044 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_18530 <2641 1489 gene locus_tag LOCUS_18540 <2641 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124704.1:form I ribulose bisphosphate carboxylase large subunit >Feature sequence283 609 223 gene locus_tag LOCUS_18550 609 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2157 610 gene locus_tag LOCUS_18560 2157 610 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_18560 2631 2161 gene locus_tag LOCUS_18570 2631 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence284 558 1430 gene locus_tag LOCUS_18580 558 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2253 2408 gene locus_tag LOCUS_18590 2253 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence285 2616 1306 gene locus_tag LOCUS_18600 2616 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence286 1367 285 gene locus_tag LOCUS_18610 gene bchI 1367 285 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125298.1 protein_id gnl|my_center|LOCUS_18610 1527 1940 gene locus_tag LOCUS_18620 1527 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2168 2341 gene locus_tag LOCUS_18630 2168 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence287 328 621 gene locus_tag LOCUS_18640 328 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 871 1116 gene locus_tag LOCUS_18650 871 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence288 <1 1062 gene locus_tag LOCUS_18660 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225914010.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence289 452 799 gene locus_tag LOCUS_18670 gene rsfS 452 799 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_18670 829 1317 gene locus_tag LOCUS_18680 829 1317 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_18680 1342 2328 gene locus_tag LOCUS_18690 1342 2328 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125045.1 protein_id gnl|my_center|LOCUS_18690 2468 2543 gene locus_tag LOCUS_t00360 2468 2543 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 2 676 gene locus_tag LOCUS_18700 2 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 705 1526 gene locus_tag LOCUS_18710 gene cdaA 705 1526 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125256.1 protein_id gnl|my_center|LOCUS_18710 1527 2315 gene locus_tag LOCUS_18720 1527 2315 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125255.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence291 1723 857 gene locus_tag LOCUS_18730 1723 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence292 296 1135 gene locus_tag LOCUS_18740 296 1135 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124635.1 protein_id gnl|my_center|LOCUS_18740 1152 1670 gene locus_tag LOCUS_18750 1152 1670 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_18750