>Feature sequence0001 420 166 gene locus_tag LOCUS_00010 420 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 568 422 gene locus_tag LOCUS_00020 568 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 816 628 gene locus_tag LOCUS_00030 816 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3530 909 gene locus_tag LOCUS_00040 3530 909 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971451.1 protein_id gnl|my_center|LOCUS_00040 4634 3600 gene locus_tag LOCUS_00050 4634 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4881 4756 gene locus_tag LOCUS_00060 4881 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5018 4869 gene locus_tag LOCUS_00070 5018 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5418 5074 gene locus_tag LOCUS_00080 5418 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6984 6805 gene locus_tag LOCUS_00090 6984 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8995 7238 gene locus_tag LOCUS_00100 8995 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9519 9010 gene locus_tag LOCUS_00110 9519 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9778 9542 gene locus_tag LOCUS_00120 9778 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10164 9886 gene locus_tag LOCUS_00130 10164 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10354 10142 gene locus_tag LOCUS_00140 10354 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12236 10365 gene locus_tag LOCUS_00150 12236 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16251 12292 gene locus_tag LOCUS_00160 16251 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18660 16267 gene locus_tag LOCUS_00170 18660 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19286 18672 gene locus_tag LOCUS_00180 19286 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19749 19288 gene locus_tag LOCUS_00190 19749 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22227 19828 gene locus_tag LOCUS_00200 22227 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22846 22241 gene locus_tag LOCUS_00210 22846 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24025 23003 gene locus_tag LOCUS_00220 24025 23003 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391061.1 protein_id gnl|my_center|LOCUS_00220 24999 24121 gene locus_tag LOCUS_00230 24999 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26650 25058 gene locus_tag LOCUS_00240 26650 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27117 26662 gene locus_tag LOCUS_00250 27117 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27425 27129 gene locus_tag LOCUS_00260 27425 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27676 27428 gene locus_tag LOCUS_00270 27676 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28738 27842 gene locus_tag LOCUS_00280 28738 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28946 28728 gene locus_tag LOCUS_00290 28946 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29233 28943 gene locus_tag LOCUS_00300 29233 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31394 29253 gene locus_tag LOCUS_00310 31394 29253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31688 31545 gene locus_tag LOCUS_00320 31688 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31813 31685 gene locus_tag LOCUS_00330 31813 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33513 31813 gene locus_tag LOCUS_00340 33513 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34058 33510 gene locus_tag LOCUS_00350 34058 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34581 34114 gene locus_tag LOCUS_00360 34581 34114 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_00360 34864 34592 gene locus_tag LOCUS_00370 34864 34592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 35313 34873 gene locus_tag LOCUS_00380 35313 34873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36076 35366 gene locus_tag LOCUS_00390 36076 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36471 36091 gene locus_tag LOCUS_00400 36471 36091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36634 36464 gene locus_tag LOCUS_00410 36634 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 37319 36621 gene locus_tag LOCUS_00420 37319 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 37479 37309 gene locus_tag LOCUS_00430 37479 37309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 <38691 37712 gene locus_tag LOCUS_00440 <38691 37712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000413053.1:DNA ligase >Feature sequence0002 410 565 gene locus_tag LOCUS_00450 410 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2218 554 gene locus_tag LOCUS_00460 2218 554 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140832957.1 protein_id gnl|my_center|LOCUS_00460 3282 2215 gene locus_tag LOCUS_00470 3282 2215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_00470 4407 3388 gene locus_tag LOCUS_00480 4407 3388 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_00480 5540 4503 gene locus_tag LOCUS_00490 5540 4503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_00490 6579 5821 gene locus_tag LOCUS_00500 6579 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6738 8084 gene locus_tag LOCUS_00510 6738 8084 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_00510 8297 9166 gene locus_tag LOCUS_00520 8297 9166 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965155.1 protein_id gnl|my_center|LOCUS_00520 9163 10011 gene locus_tag LOCUS_00530 9163 10011 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365054.1 protein_id gnl|my_center|LOCUS_00530 10067 11050 gene locus_tag LOCUS_00540 10067 11050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_00540 11047 11940 gene locus_tag LOCUS_00550 11047 11940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_00550 11950 12939 gene locus_tag LOCUS_00560 11950 12939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_00560 12932 13897 gene locus_tag LOCUS_00570 12932 13897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_00570 13942 15471 gene locus_tag LOCUS_00580 13942 15471 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00580 15549 16310 gene locus_tag LOCUS_00590 15549 16310 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_00590 16311 17387 gene locus_tag LOCUS_00600 16311 17387 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_00600 17389 18450 gene locus_tag LOCUS_00610 17389 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 18586 19563 gene locus_tag LOCUS_00620 18586 19563 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_00620 20022 19564 gene locus_tag LOCUS_00630 20022 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 20514 20032 gene locus_tag LOCUS_00640 20514 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 21472 20519 gene locus_tag LOCUS_00650 21472 20519 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_00650 22458 21460 gene locus_tag LOCUS_00660 22458 21460 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_00660 23740 22460 gene locus_tag LOCUS_00670 gene ablA 23740 22460 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_00670 24232 25533 gene locus_tag LOCUS_00680 24232 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 25730 26536 gene locus_tag LOCUS_00690 25730 26536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 26549 27415 gene locus_tag LOCUS_00700 26549 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 27424 28230 gene locus_tag LOCUS_00710 27424 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 28269 29030 gene locus_tag LOCUS_00720 28269 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 30579 29125 gene locus_tag LOCUS_00730 gene pyk 30579 29125 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963840.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0003 207 617 gene locus_tag LOCUS_00740 207 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 628 1977 gene locus_tag LOCUS_00750 628 1977 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_00750 4882 1931 gene locus_tag LOCUS_00760 4882 1931 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_00760 4928 5821 gene locus_tag LOCUS_00770 gene nfo 4928 5821 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 protein_id gnl|my_center|LOCUS_00770 6084 5875 gene locus_tag LOCUS_00780 6084 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 6001 6561 gene locus_tag LOCUS_00790 6001 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 7970 6558 gene locus_tag LOCUS_00800 7970 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9011 7983 gene locus_tag LOCUS_00810 9011 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 10252 9008 gene locus_tag LOCUS_00820 gene pepT 10252 9008 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_00820 11223 10366 gene locus_tag LOCUS_00830 11223 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 11809 11270 gene locus_tag LOCUS_00840 11809 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 12058 13278 gene locus_tag LOCUS_00850 12058 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13924 13283 gene locus_tag LOCUS_00860 13924 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13954 16017 gene locus_tag LOCUS_00870 13954 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 16147 16371 gene locus_tag LOCUS_00880 16147 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 18685 16937 gene locus_tag LOCUS_00890 18685 16937 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00890 20495 18708 gene locus_tag LOCUS_00900 gene nuoF 20495 18708 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_00900 20899 20495 gene locus_tag LOCUS_00910 20899 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_00910 21517 20933 gene locus_tag LOCUS_00920 21517 20933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865378.1 protein_id gnl|my_center|LOCUS_00920 22010 21537 gene locus_tag LOCUS_00930 22010 21537 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_00930 22188 22886 gene locus_tag LOCUS_00940 22188 22886 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_00940 23603 22827 gene locus_tag LOCUS_00950 23603 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 24759 23614 gene locus_tag LOCUS_00960 24759 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 <25908 25288 gene locus_tag LOCUS_00970 <25908 25288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402414.1:FadR/GntR family transcriptional regulator >Feature sequence0004 100 2205 gene locus_tag LOCUS_00980 100 2205 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_00980 2244 3167 gene locus_tag LOCUS_00990 gene rmgP 2244 3167 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_00990 3181 4053 gene locus_tag LOCUS_01000 3181 4053 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_01000 4251 4598 gene locus_tag LOCUS_01010 4251 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 4616 7117 gene locus_tag LOCUS_01020 4616 7117 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_01020 7330 7127 gene locus_tag LOCUS_01030 7330 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7510 8478 gene locus_tag LOCUS_01040 7510 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8540 8701 gene locus_tag LOCUS_01050 8540 8701 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_01050 8890 12261 gene locus_tag LOCUS_01060 8890 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 12356 12931 gene locus_tag LOCUS_01070 12356 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 13589 13104 gene locus_tag LOCUS_01080 13589 13104 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_01080 14899 13586 gene locus_tag LOCUS_01090 14899 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 15023 15808 gene locus_tag LOCUS_01100 15023 15808 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_01100 15850 17466 gene locus_tag LOCUS_01110 15850 17466 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_01110 17470 19236 gene locus_tag LOCUS_01120 17470 19236 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_01120 19233 20192 gene locus_tag LOCUS_01130 19233 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 21309 20284 gene locus_tag LOCUS_01140 gene mglC 21309 20284 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_01140 22830 21322 gene locus_tag LOCUS_01150 gene mglA 22830 21322 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883073.1 protein_id gnl|my_center|LOCUS_01150 23945 22926 gene locus_tag LOCUS_01160 gene mglB 23945 22926 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_01160 25538 24231 gene locus_tag LOCUS_01170 25538 24231 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence0005 468 1622 gene locus_tag LOCUS_01180 468 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 2805 1588 gene locus_tag LOCUS_01190 2805 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3442 2891 gene locus_tag LOCUS_01200 3442 2891 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_01200 3776 3399 gene locus_tag LOCUS_01210 3776 3399 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_01210 3980 5053 gene locus_tag LOCUS_01220 3980 5053 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_01220 6003 5041 gene locus_tag LOCUS_01230 6003 5041 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_01230 7860 6058 gene locus_tag LOCUS_01240 7860 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8573 7857 gene locus_tag LOCUS_01250 8573 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8663 9286 gene locus_tag LOCUS_01260 8663 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10792 9455 gene locus_tag LOCUS_01270 10792 9455 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_01270 10933 12030 gene locus_tag LOCUS_01280 10933 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 12931 12014 gene locus_tag LOCUS_01290 gene murB 12931 12014 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_01290 12983 14404 gene locus_tag LOCUS_01300 12983 14404 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_01300 14432 14950 gene locus_tag LOCUS_01310 14432 14950 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_01310 14954 15490 gene locus_tag LOCUS_01320 14954 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15599 18253 gene locus_tag LOCUS_01330 15599 18253 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_01330 18940 18494 gene locus_tag LOCUS_01340 18940 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 19385 18930 gene locus_tag LOCUS_01350 19385 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 20686 19388 gene locus_tag LOCUS_01360 20686 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 21070 20897 gene locus_tag LOCUS_01370 21070 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 22316 21165 gene locus_tag LOCUS_01380 gene cruC 22316 21165 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_01380 23071 22313 gene locus_tag LOCUS_01390 23071 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 24336 23074 gene locus_tag LOCUS_01400 24336 23074 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_01400 <24920 24326 gene locus_tag LOCUS_01410 <24920 24326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681876.1:endopeptidase La >Feature sequence0006 917 165 gene locus_tag LOCUS_01420 917 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 1569 904 gene locus_tag LOCUS_01430 gene deoC 1569 904 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_01430 1698 2660 gene locus_tag LOCUS_01440 1698 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2998 2810 gene locus_tag LOCUS_01450 2998 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2928 3536 gene locus_tag LOCUS_01460 2928 3536 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_01460 4920 3514 gene locus_tag LOCUS_01470 4920 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5077 5162 gene locus_tag LOCUS_t00010 5077 5162 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5208 5296 gene locus_tag LOCUS_t00020 5208 5296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5318 5391 gene locus_tag LOCUS_t00030 5318 5391 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5420 5506 gene locus_tag LOCUS_t00040 5420 5506 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5556 5642 gene locus_tag LOCUS_t00050 5556 5642 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6643 5765 gene locus_tag LOCUS_01480 6643 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7016 8707 gene locus_tag LOCUS_01490 gene dnaX 7016 8707 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_01490 8739 9056 gene locus_tag LOCUS_01500 8739 9056 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420010.1 protein_id gnl|my_center|LOCUS_01500 9059 9205 gene locus_tag LOCUS_01510 9059 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9323 9649 gene locus_tag LOCUS_01520 9323 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 10464 9748 gene locus_tag LOCUS_01530 gene djlA 10464 9748 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546924.1 protein_id gnl|my_center|LOCUS_01530 11936 10512 gene locus_tag LOCUS_01540 11936 10512 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_01540 13148 12216 gene locus_tag LOCUS_01550 13148 12216 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_01550 13274 15088 gene locus_tag LOCUS_01560 13274 15088 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_01560 15136 16461 gene locus_tag LOCUS_01570 15136 16461 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_01570 16503 17687 gene locus_tag LOCUS_01580 gene nagA 16503 17687 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_01580 17705 19150 gene locus_tag LOCUS_01590 17705 19150 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_01590 19160 19891 gene locus_tag LOCUS_01600 19160 19891 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_01600 <20734 19878 gene locus_tag LOCUS_01610 <20734 19878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682387.1:FprA family A-type flavoprotein >Feature sequence0007 242 72 gene locus_tag LOCUS_01620 242 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 402 644 gene locus_tag LOCUS_01630 402 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1355 696 gene locus_tag LOCUS_01640 gene rnhB 1355 696 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_01640 1440 4289 gene locus_tag LOCUS_01650 1440 4289 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_01650 4352 5686 gene locus_tag LOCUS_01660 gene ffh 4352 5686 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_01660 5712 5978 gene locus_tag LOCUS_01670 gene rpsP 5712 5978 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_01670 5995 6228 gene locus_tag LOCUS_01680 5995 6228 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_01680 6231 6737 gene locus_tag LOCUS_01690 6231 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6734 7486 gene locus_tag LOCUS_01700 gene trmD 6734 7486 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_01700 7473 7829 gene locus_tag LOCUS_01710 gene rplS 7473 7829 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_01710 7947 8444 gene locus_tag LOCUS_01720 7947 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8441 8938 gene locus_tag LOCUS_01730 gene coaD 8441 8938 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_01730 9145 9330 gene locus_tag LOCUS_01740 9145 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9356 9595 gene locus_tag LOCUS_01750 gene acpP 9356 9595 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_01750 9692 10354 gene locus_tag LOCUS_01760 gene rnc 9692 10354 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_01760 11682 10321 gene locus_tag LOCUS_01770 11682 10321 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_01770 11817 14948 gene locus_tag LOCUS_01780 gene ileS 11817 14948 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_01780 14953 15831 gene locus_tag LOCUS_01790 14953 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 15847 16029 gene locus_tag LOCUS_01800 15847 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 16033 17022 gene locus_tag LOCUS_01810 gene trpS 16033 17022 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_01810 17198 18352 gene locus_tag LOCUS_01820 17198 18352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975069.1 protein_id gnl|my_center|LOCUS_01820 18413 20215 gene locus_tag LOCUS_01830 18413 20215 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence0008 324 1331 gene locus_tag LOCUS_01840 324 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2572 1319 gene locus_tag LOCUS_01850 2572 1319 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_01850 3357 2572 gene locus_tag LOCUS_01860 3357 2572 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_01860 4379 3357 gene locus_tag LOCUS_01870 gene ltaE 4379 3357 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_01870 5989 4487 gene locus_tag LOCUS_01880 5989 4487 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656717.1 protein_id gnl|my_center|LOCUS_01880 6444 7001 gene locus_tag LOCUS_01890 6444 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8222 7125 gene locus_tag LOCUS_01900 8222 7125 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_01900 9268 8222 gene locus_tag LOCUS_01910 9268 8222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_01910 10884 9280 gene locus_tag LOCUS_01920 10884 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11824 10895 gene locus_tag LOCUS_01930 gene oppB 11824 10895 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 protein_id gnl|my_center|LOCUS_01930 12127 13473 gene locus_tag LOCUS_01940 gene rimO 12127 13473 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_01940 13466 15754 gene locus_tag LOCUS_01950 13466 15754 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_01950 15756 16586 gene locus_tag LOCUS_01960 15756 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 16735 17163 gene locus_tag LOCUS_01970 gene rplM 16735 17163 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_01970 17178 17591 gene locus_tag LOCUS_01980 gene rpsI 17178 17591 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656683.1 protein_id gnl|my_center|LOCUS_01980 17730 18191 gene locus_tag LOCUS_01990 17730 18191 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957973.1 protein_id gnl|my_center|LOCUS_01990 18330 18992 gene locus_tag LOCUS_02000 18330 18992 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_02000 19201 19824 gene locus_tag LOCUS_02010 19201 19824 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence0009 716 644 gene locus_tag LOCUS_t00060 716 644 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1013 2116 gene locus_tag LOCUS_02020 gene ugpC 1013 2116 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_02020 2704 2195 gene locus_tag LOCUS_02030 2704 2195 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_02030 4190 2886 gene locus_tag LOCUS_02040 4190 2886 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_02040 4538 4383 gene locus_tag LOCUS_02050 4538 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4625 5641 gene locus_tag LOCUS_02060 4625 5641 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_02060 5919 7283 gene locus_tag LOCUS_02070 5919 7283 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_02070 7601 8341 gene locus_tag LOCUS_02080 7601 8341 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_02080 9392 8625 gene locus_tag LOCUS_02090 9392 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11192 9639 gene locus_tag LOCUS_02100 gene guaA 11192 9639 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817253.1 protein_id gnl|my_center|LOCUS_02100 11771 11250 gene locus_tag LOCUS_02110 11771 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12559 11786 gene locus_tag LOCUS_02120 12559 11786 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791620.1 protein_id gnl|my_center|LOCUS_02120 14004 12556 gene locus_tag LOCUS_02130 14004 12556 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682198.1 protein_id gnl|my_center|LOCUS_02130 14722 13988 gene locus_tag LOCUS_02140 14722 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 16454 14736 gene locus_tag LOCUS_02150 16454 14736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_02150 18240 16456 gene locus_tag LOCUS_02160 18240 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18621 19664 gene locus_tag LOCUS_02170 18621 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence0010 3 530 gene locus_tag LOCUS_02180 3 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 539 928 gene locus_tag LOCUS_02190 539 928 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_02190 1750 989 gene locus_tag LOCUS_02200 1750 989 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_02200 2731 2000 gene locus_tag LOCUS_02210 2731 2000 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729568.1 protein_id gnl|my_center|LOCUS_02210 3591 2809 gene locus_tag LOCUS_02220 3591 2809 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_02220 4511 3588 gene locus_tag LOCUS_02230 4511 3588 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_02230 5809 4520 gene locus_tag LOCUS_02240 5809 4520 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 protein_id gnl|my_center|LOCUS_02240 6339 5806 gene locus_tag LOCUS_02250 6339 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7413 6409 gene locus_tag LOCUS_02260 gene dctP 7413 6409 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382874.1 protein_id gnl|my_center|LOCUS_02260 8206 7754 gene locus_tag LOCUS_02270 8206 7754 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 protein_id gnl|my_center|LOCUS_02270 8441 8878 gene locus_tag LOCUS_02280 8441 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9836 8922 gene locus_tag LOCUS_02290 9836 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10789 9995 gene locus_tag LOCUS_02300 10789 9995 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_02300 11207 12169 gene locus_tag LOCUS_02310 11207 12169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_02310 12244 13746 gene locus_tag LOCUS_02320 12244 13746 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397820.1 protein_id gnl|my_center|LOCUS_02320 13743 14780 gene locus_tag LOCUS_02330 13743 14780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_02330 14777 15775 gene locus_tag LOCUS_02340 14777 15775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727843.1 protein_id gnl|my_center|LOCUS_02340 15880 17589 gene locus_tag LOCUS_02350 15880 17589 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_02350 17558 18766 gene locus_tag LOCUS_02360 17558 18766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence0011 4065 2455 gene locus_tag LOCUS_02370 4065 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5775 4351 gene locus_tag LOCUS_02380 5775 4351 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440013.1 protein_id gnl|my_center|LOCUS_02380 5705 5959 gene locus_tag LOCUS_02390 5705 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7187 6069 gene locus_tag LOCUS_02400 7187 6069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_02400 8245 7256 gene locus_tag LOCUS_02410 8245 7256 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808773.1 protein_id gnl|my_center|LOCUS_02410 9534 8626 gene locus_tag LOCUS_02420 9534 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 10299 9535 gene locus_tag LOCUS_02430 10299 9535 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 protein_id gnl|my_center|LOCUS_02430 11231 10491 gene locus_tag LOCUS_02440 11231 10491 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399661.1 protein_id gnl|my_center|LOCUS_02440 11380 13992 gene locus_tag LOCUS_02450 11380 13992 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989583.1 protein_id gnl|my_center|LOCUS_02450 14667 14191 gene locus_tag LOCUS_02460 14667 14191 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_02460 16199 14664 gene locus_tag LOCUS_02470 16199 14664 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_02470 16409 17320 gene locus_tag LOCUS_02480 16409 17320 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 protein_id gnl|my_center|LOCUS_02480 17372 19270 gene locus_tag LOCUS_02490 17372 19270 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence0012 1914 1345 gene locus_tag LOCUS_02500 1914 1345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_02500 3207 1927 gene locus_tag LOCUS_02510 gene glnA 3207 1927 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_02510 3949 3224 gene locus_tag LOCUS_02520 3949 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_02520 5178 3946 gene locus_tag LOCUS_02530 5178 3946 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_02530 5608 5180 gene locus_tag LOCUS_02540 5608 5180 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392805.1 protein_id gnl|my_center|LOCUS_02540 7123 5618 gene locus_tag LOCUS_02550 7123 5618 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941895.1 protein_id gnl|my_center|LOCUS_02550 8239 7136 gene locus_tag LOCUS_02560 8239 7136 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_02560 8550 10640 gene locus_tag LOCUS_02570 8550 10640 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_02570 10802 11728 gene locus_tag LOCUS_02580 10802 11728 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456666.1 protein_id gnl|my_center|LOCUS_02580 11731 13743 gene locus_tag LOCUS_02590 11731 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 13853 14500 gene locus_tag LOCUS_02600 13853 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 14497 14871 gene locus_tag LOCUS_02610 14497 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 15020 16060 gene locus_tag LOCUS_02620 gene argC 15020 16060 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 protein_id gnl|my_center|LOCUS_02620 16074 17309 gene locus_tag LOCUS_02630 gene argJ 16074 17309 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_02630 17309 18193 gene locus_tag LOCUS_02640 gene argB 17309 18193 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_02640 18194 19393 gene locus_tag LOCUS_02650 18194 19393 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence0013 1545 757 gene locus_tag LOCUS_02660 1545 757 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_02660 3899 1542 gene locus_tag LOCUS_02670 3899 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 4555 3974 gene locus_tag LOCUS_02680 4555 3974 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_02680 5340 4777 gene locus_tag LOCUS_02690 gene efp 5340 4777 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671939.1 protein_id gnl|my_center|LOCUS_02690 6341 5370 gene locus_tag LOCUS_02700 6341 5370 CDS product tRNA synthetase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680171.1 protein_id gnl|my_center|LOCUS_02700 6409 7740 gene locus_tag LOCUS_02710 gene mnmE 6409 7740 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_02710 7742 9553 gene locus_tag LOCUS_02720 gene mnmG 7742 9553 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657592.1 protein_id gnl|my_center|LOCUS_02720 9546 10205 gene locus_tag LOCUS_02730 gene rsmG 9546 10205 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202905.1 protein_id gnl|my_center|LOCUS_02730 10251 13166 gene locus_tag LOCUS_02740 10251 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13225 14037 gene locus_tag LOCUS_02750 13225 14037 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518967.1 protein_id gnl|my_center|LOCUS_02750 14744 14034 gene locus_tag LOCUS_02760 14744 14034 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 protein_id gnl|my_center|LOCUS_02760 15520 14762 gene locus_tag LOCUS_02770 15520 14762 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_02770 16738 15533 gene locus_tag LOCUS_02780 16738 15533 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_02780 17943 16741 gene locus_tag LOCUS_02790 17943 16741 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_02790 <19041 18008 gene locus_tag LOCUS_02800 <19041 18008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087218.1:amino acid ABC transporter substrate-binding protein >Feature sequence0014 106 1419 gene locus_tag LOCUS_02810 106 1419 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_02810 2148 1684 gene locus_tag LOCUS_02820 gene mscL 2148 1684 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_02820 2361 3542 gene locus_tag LOCUS_02830 2361 3542 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_02830 3647 4564 gene locus_tag LOCUS_02840 3647 4564 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_02840 4566 5468 gene locus_tag LOCUS_02850 4566 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5465 6244 gene locus_tag LOCUS_02860 5465 6244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_02860 6241 7014 gene locus_tag LOCUS_02870 gene livF 6241 7014 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176347.1 protein_id gnl|my_center|LOCUS_02870 7076 7720 gene locus_tag LOCUS_02880 7076 7720 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_02880 7721 8716 gene locus_tag LOCUS_02890 7721 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9034 8816 gene locus_tag LOCUS_02900 gene infA 9034 8816 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_02900 10487 9105 gene locus_tag LOCUS_02910 10487 9105 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_02910 10712 12235 gene locus_tag LOCUS_02920 10712 12235 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_02920 12272 12655 gene locus_tag LOCUS_02930 gene gcvH 12272 12655 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_02930 12718 14073 gene locus_tag LOCUS_02940 gene gcvPA 12718 14073 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990102.1 protein_id gnl|my_center|LOCUS_02940 14070 15521 gene locus_tag LOCUS_02950 gene gcvPB 14070 15521 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_02950 15769 17232 gene locus_tag LOCUS_02960 15769 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence0015 1598 690 gene locus_tag LOCUS_02970 1598 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1748 2245 gene locus_tag LOCUS_02980 1748 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2864 2376 gene locus_tag LOCUS_02990 2864 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3159 4382 gene locus_tag LOCUS_03000 3159 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4461 5309 gene locus_tag LOCUS_03010 4461 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5935 5699 gene locus_tag LOCUS_03020 5935 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6372 7202 gene locus_tag LOCUS_03030 6372 7202 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947409.1 protein_id gnl|my_center|LOCUS_03030 7785 7267 gene locus_tag LOCUS_03040 7785 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8542 7895 gene locus_tag LOCUS_03050 8542 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 9450 8539 gene locus_tag LOCUS_03060 9450 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 10335 9604 gene locus_tag LOCUS_03070 10335 9604 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814197.1 protein_id gnl|my_center|LOCUS_03070 12046 10511 gene locus_tag LOCUS_03080 12046 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15135 12043 gene locus_tag LOCUS_03090 15135 12043 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03090 16238 15150 gene locus_tag LOCUS_03100 gene vmeJ 16238 15150 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_03100 16602 17537 gene locus_tag LOCUS_03110 16602 17537 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462012.1 protein_id gnl|my_center|LOCUS_03110 18478 17693 gene locus_tag LOCUS_03120 18478 17693 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence0016 262 1779 gene locus_tag LOCUS_03130 gene glpK 262 1779 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731139.1 protein_id gnl|my_center|LOCUS_03130 1780 2601 gene locus_tag LOCUS_03140 gene cdaA 1780 2601 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_03140 2588 2992 gene locus_tag LOCUS_03150 2588 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2992 3369 gene locus_tag LOCUS_03160 2992 3369 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_03160 3356 4201 gene locus_tag LOCUS_03170 gene truA 3356 4201 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_03170 4194 4946 gene locus_tag LOCUS_03180 4194 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4943 6916 gene locus_tag LOCUS_03190 gene priA 4943 6916 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_03190 6987 7463 gene locus_tag LOCUS_03200 gene def 6987 7463 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_03200 7460 8404 gene locus_tag LOCUS_03210 gene fmt 7460 8404 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_03210 8479 10641 gene locus_tag LOCUS_03220 8479 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03220 10641 11636 gene locus_tag LOCUS_03230 10641 11636 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880377.1 protein_id gnl|my_center|LOCUS_03230 11615 12154 gene locus_tag LOCUS_03240 11615 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12132 12995 gene locus_tag LOCUS_03250 12132 12995 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_03250 12988 13512 gene locus_tag LOCUS_03260 12988 13512 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_03260 13880 13578 gene locus_tag LOCUS_03270 13880 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13801 14529 gene locus_tag LOCUS_03280 gene fkpA 13801 14529 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838241.1 protein_id gnl|my_center|LOCUS_03280 15225 14530 gene locus_tag LOCUS_03290 15225 14530 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120609.1 protein_id gnl|my_center|LOCUS_03290 15318 15938 gene locus_tag LOCUS_03300 15318 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 17706 15940 gene locus_tag LOCUS_03310 17706 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 18022 17717 gene locus_tag LOCUS_03320 18022 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 18350 18000 gene locus_tag LOCUS_03330 18350 18000 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence0017 1653 163 gene locus_tag LOCUS_03340 1653 163 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392150.1 protein_id gnl|my_center|LOCUS_03340 2753 1740 gene locus_tag LOCUS_03350 2753 1740 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_03350 4221 3082 gene locus_tag LOCUS_03360 4221 3082 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_03360 4283 4786 gene locus_tag LOCUS_03370 4283 4786 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_03370 5855 4776 gene locus_tag LOCUS_03380 5855 4776 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_03380 6585 5857 gene locus_tag LOCUS_03390 6585 5857 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_03390 8135 7305 gene locus_tag LOCUS_03400 8135 7305 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_03400 9264 8380 gene locus_tag LOCUS_03410 gene garR 9264 8380 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_03410 10214 9276 gene locus_tag LOCUS_03420 10214 9276 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_03420 11059 10211 gene locus_tag LOCUS_03430 11059 10211 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_03430 11843 11091 gene locus_tag LOCUS_03440 11843 11091 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877397.1 protein_id gnl|my_center|LOCUS_03440 12874 11846 gene locus_tag LOCUS_03450 12874 11846 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_03450 14303 12978 gene locus_tag LOCUS_03460 14303 12978 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_03460 15610 14318 gene locus_tag LOCUS_03470 15610 14318 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_03470 16132 15623 gene locus_tag LOCUS_03480 16132 15623 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693871.1 protein_id gnl|my_center|LOCUS_03480 17328 16327 gene locus_tag LOCUS_03490 17328 16327 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972883.1 protein_id gnl|my_center|LOCUS_03490 18330 17632 gene locus_tag LOCUS_03500 18330 17632 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence0018 1473 361 gene locus_tag LOCUS_03510 1473 361 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_03510 3112 1553 gene locus_tag LOCUS_03520 3112 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4112 3177 gene locus_tag LOCUS_03530 4112 3177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_03530 5055 4123 gene locus_tag LOCUS_03540 5055 4123 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_03540 8359 5138 gene locus_tag LOCUS_03550 8359 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 8678 9703 gene locus_tag LOCUS_03560 8678 9703 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_03560 9670 11139 gene locus_tag LOCUS_03570 9670 11139 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_03570 11154 12677 gene locus_tag LOCUS_03580 11154 12677 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_03580 12692 14095 gene locus_tag LOCUS_03590 gene uxaC 12692 14095 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_03590 14100 14888 gene locus_tag LOCUS_03600 gene kdgR 14100 14888 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 protein_id gnl|my_center|LOCUS_03600 14938 15912 gene locus_tag LOCUS_03610 14938 15912 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_03610 15923 16270 gene locus_tag LOCUS_03620 15923 16270 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_03620 16951 16592 gene locus_tag LOCUS_03630 16951 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 17709 17086 gene locus_tag LOCUS_03640 17709 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence0019 313 1422 gene locus_tag LOCUS_03650 313 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1437 2693 gene locus_tag LOCUS_03660 1437 2693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_03660 2761 3501 gene locus_tag LOCUS_03670 2761 3501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_03670 4381 3680 gene locus_tag LOCUS_03680 4381 3680 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_03680 4469 5131 gene locus_tag LOCUS_03690 4469 5131 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_03690 5215 6360 gene locus_tag LOCUS_03700 5215 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 6548 6907 gene locus_tag LOCUS_03710 6548 6907 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940111.1 protein_id gnl|my_center|LOCUS_03710 7364 6897 gene locus_tag LOCUS_03720 7364 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7477 8265 gene locus_tag LOCUS_03730 7477 8265 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_03730 9508 8267 gene locus_tag LOCUS_03740 9508 8267 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_03740 10439 9513 gene locus_tag LOCUS_03750 10439 9513 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_03750 10658 11128 gene locus_tag LOCUS_03760 10658 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 12861 11101 gene locus_tag LOCUS_03770 12861 11101 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_03770 12917 14677 gene locus_tag LOCUS_03780 12917 14677 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_03780 15416 14805 gene locus_tag LOCUS_03790 15416 14805 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_03790 16573 15413 gene locus_tag LOCUS_03800 16573 15413 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_03800 16994 16632 gene locus_tag LOCUS_03810 16994 16632 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943200.1 protein_id gnl|my_center|LOCUS_03810 <17707 16987 gene locus_tag LOCUS_03820 <17707 16987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812070.1:5'/3'-nucleotidase SurE >Feature sequence0020 2823 940 gene locus_tag LOCUS_03830 2823 940 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943766.1 protein_id gnl|my_center|LOCUS_03830 3538 3086 gene locus_tag LOCUS_03840 3538 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4901 3531 gene locus_tag LOCUS_03850 4901 3531 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_03850 6570 5056 gene locus_tag LOCUS_03860 6570 5056 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 protein_id gnl|my_center|LOCUS_03860 7078 6590 gene locus_tag LOCUS_03870 7078 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8117 7143 gene locus_tag LOCUS_03880 8117 7143 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813864.1 protein_id gnl|my_center|LOCUS_03880 10231 8354 gene locus_tag LOCUS_03890 10231 8354 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_03890 10483 11019 gene locus_tag LOCUS_03900 10483 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12203 11190 gene locus_tag LOCUS_03910 12203 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13365 12451 gene locus_tag LOCUS_03920 gene mscS 13365 12451 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_03920 15341 13458 gene locus_tag LOCUS_03930 gene htpG 15341 13458 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_03930 15445 16575 gene locus_tag LOCUS_03940 15445 16575 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113009.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence0021 5354 4281 gene locus_tag LOCUS_03950 5354 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8038 5717 gene locus_tag LOCUS_03960 8038 5717 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_03960 8840 8148 gene locus_tag LOCUS_03970 8840 8148 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03970 9727 9002 gene locus_tag LOCUS_03980 9727 9002 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_03980 11622 9784 gene locus_tag LOCUS_03990 gene yidC 11622 9784 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_03990 12654 12334 gene locus_tag LOCUS_04000 12654 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13735 12644 gene locus_tag LOCUS_04010 gene recF 13735 12644 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_04010 14841 13735 gene locus_tag LOCUS_04020 gene dnaN 14841 13735 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_04020 16480 15056 gene locus_tag LOCUS_04030 gene dnaA 16480 15056 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence0022 267 800 gene locus_tag LOCUS_04040 267 800 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_04040 826 1392 gene locus_tag LOCUS_04050 826 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1512 2864 gene locus_tag LOCUS_04060 1512 2864 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_04060 2837 3505 gene locus_tag LOCUS_04070 2837 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5115 3727 gene locus_tag LOCUS_04080 gene asnS 5115 3727 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_04080 5428 7347 gene locus_tag LOCUS_04090 5428 7347 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_04090 7473 7808 gene locus_tag LOCUS_04100 7473 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7808 8581 gene locus_tag LOCUS_04110 7808 8581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462308.1 protein_id gnl|my_center|LOCUS_04110 8578 10419 gene locus_tag LOCUS_04120 8578 10419 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_04120 10422 11546 gene locus_tag LOCUS_04130 10422 11546 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_04130 11556 12092 gene locus_tag LOCUS_04140 11556 12092 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_04140 12104 13621 gene locus_tag LOCUS_04150 12104 13621 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 protein_id gnl|my_center|LOCUS_04150 14685 13636 gene locus_tag LOCUS_04160 14685 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15011 15376 gene locus_tag LOCUS_04170 15011 15376 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_04170 15373 15789 gene locus_tag LOCUS_04180 15373 15789 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence0023 2125 521 gene locus_tag LOCUS_04190 2125 521 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_04190 3464 2289 gene locus_tag LOCUS_04200 3464 2289 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_04200 4442 3513 gene locus_tag LOCUS_04210 4442 3513 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_04210 4560 4979 gene locus_tag LOCUS_04220 4560 4979 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_04220 6234 5026 gene locus_tag LOCUS_04230 6234 5026 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_04230 7636 6344 gene locus_tag LOCUS_04240 7636 6344 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_04240 7837 9594 gene locus_tag LOCUS_04250 7837 9594 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_04250 11071 9698 gene locus_tag LOCUS_04260 gene argH 11071 9698 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_04260 11184 12116 gene locus_tag LOCUS_04270 11184 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12154 12318 gene locus_tag LOCUS_04280 12154 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 12414 13532 gene locus_tag LOCUS_04290 12414 13532 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533416.1 protein_id gnl|my_center|LOCUS_04290 13773 14645 gene locus_tag LOCUS_04300 13773 14645 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_04300 15118 14798 gene locus_tag LOCUS_04310 gene trxA 15118 14798 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_04310 16040 15396 gene locus_tag LOCUS_04320 16040 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 <16607 16037 gene locus_tag LOCUS_04330 <16607 16037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143485796.1:phytoene/squalene synthase family protein >Feature sequence0024 <1 1837 gene locus_tag LOCUS_04340 <1 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481936.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL 2054 2683 gene locus_tag LOCUS_04350 2054 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3692 2664 gene locus_tag LOCUS_04360 3692 2664 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_04360 4562 3810 gene locus_tag LOCUS_04370 4562 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5876 4740 gene locus_tag LOCUS_04380 5876 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6041 6646 gene locus_tag LOCUS_04390 6041 6646 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_04390 6685 7614 gene locus_tag LOCUS_04400 6685 7614 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_04400 8526 7615 gene locus_tag LOCUS_04410 8526 7615 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_04410 8667 8978 gene locus_tag LOCUS_04420 8667 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9532 8975 gene locus_tag LOCUS_04430 9532 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9763 9839 gene locus_tag LOCUS_t00070 9763 9839 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12054 9889 gene locus_tag LOCUS_04440 12054 9889 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_04440 12169 12948 gene locus_tag LOCUS_04450 12169 12948 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679190.1 protein_id gnl|my_center|LOCUS_04450 12941 13351 gene locus_tag LOCUS_04460 12941 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 13411 13956 gene locus_tag LOCUS_04470 13411 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 13953 14579 gene locus_tag LOCUS_04480 13953 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 14572 15309 gene locus_tag LOCUS_04490 gene lptB 14572 15309 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence0025 218 448 gene locus_tag LOCUS_04500 218 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 561 1832 gene locus_tag LOCUS_04510 561 1832 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_04510 1829 2212 gene locus_tag LOCUS_04520 1829 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2830 2246 gene locus_tag LOCUS_04530 2830 2246 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_04530 3507 2827 gene locus_tag LOCUS_04540 3507 2827 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_04540 4588 3572 gene locus_tag LOCUS_04550 4588 3572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_04550 5282 4626 gene locus_tag LOCUS_04560 5282 4626 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812251.1 protein_id gnl|my_center|LOCUS_04560 6325 5642 gene locus_tag LOCUS_04570 6325 5642 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_04570 7478 6318 gene locus_tag LOCUS_04580 7478 6318 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_04580 7752 8909 gene locus_tag LOCUS_04590 gene carA 7752 8909 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880225.1 protein_id gnl|my_center|LOCUS_04590 8906 12124 gene locus_tag LOCUS_04600 gene carB 8906 12124 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958126.1 protein_id gnl|my_center|LOCUS_04600 12191 13987 gene locus_tag LOCUS_04610 gene aspS 12191 13987 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence0026 379 1299 gene locus_tag LOCUS_04620 379 1299 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_04620 1361 2938 gene locus_tag LOCUS_04630 1361 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3004 4107 gene locus_tag LOCUS_04640 3004 4107 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_04640 4376 5458 gene locus_tag LOCUS_04650 4376 5458 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_04650 5571 7091 gene locus_tag LOCUS_04660 5571 7091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_04660 7088 8209 gene locus_tag LOCUS_04670 7088 8209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_04670 8211 9143 gene locus_tag LOCUS_04680 8211 9143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_04680 9161 9991 gene locus_tag LOCUS_04690 9161 9991 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_04690 9988 10458 gene locus_tag LOCUS_04700 9988 10458 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_04700 10458 11159 gene locus_tag LOCUS_04710 10458 11159 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302777.1 protein_id gnl|my_center|LOCUS_04710 11162 11869 gene locus_tag LOCUS_04720 11162 11869 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_04720 11859 12767 gene locus_tag LOCUS_04730 11859 12767 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_04730 13403 12813 gene locus_tag LOCUS_04740 13403 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 14256 13474 gene locus_tag LOCUS_04750 14256 13474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_04750 15071 14319 gene locus_tag LOCUS_04760 15071 14319 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence0027 <1 804 gene locus_tag LOCUS_04770 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766155.1:dihydrolipoyl dehydrogenase 830 3286 gene locus_tag LOCUS_04780 830 3286 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_04780 3306 4625 gene locus_tag LOCUS_04790 3306 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4635 5795 gene locus_tag LOCUS_04800 4635 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5805 7064 gene locus_tag LOCUS_04810 5805 7064 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_04810 7067 8491 gene locus_tag LOCUS_04820 7067 8491 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_04820 8769 9800 gene locus_tag LOCUS_04830 8769 9800 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_04830 10919 9855 gene locus_tag LOCUS_04840 10919 9855 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362455.1 protein_id gnl|my_center|LOCUS_04840 11940 10939 gene locus_tag LOCUS_04850 11940 10939 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_04850 12048 13184 gene locus_tag LOCUS_04860 12048 13184 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_04860 14440 13193 gene locus_tag LOCUS_04870 14440 13193 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0028 1588 572 gene locus_tag LOCUS_04880 1588 572 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836037.1 protein_id gnl|my_center|LOCUS_04880 2381 1641 gene locus_tag LOCUS_04890 2381 1641 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_04890 2600 3442 gene locus_tag LOCUS_04900 2600 3442 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119646.1 protein_id gnl|my_center|LOCUS_04900 3462 4907 gene locus_tag LOCUS_04910 gene gnd 3462 4907 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_04910 5069 6103 gene locus_tag LOCUS_04920 5069 6103 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_04920 6121 7188 gene locus_tag LOCUS_04930 6121 7188 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_04930 8319 7444 gene locus_tag LOCUS_04940 8319 7444 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_04940 10797 8464 gene locus_tag LOCUS_04950 10797 8464 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_04950 11716 10814 gene locus_tag LOCUS_04960 11716 10814 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_04960 12882 11713 gene locus_tag LOCUS_04970 12882 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 13663 12884 gene locus_tag LOCUS_04980 13663 12884 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728936.1 protein_id gnl|my_center|LOCUS_04980 14640 13660 gene locus_tag LOCUS_04990 gene yjfF 14640 13660 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972860.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence0029 525 25 gene locus_tag LOCUS_05000 gene yiaM 525 25 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 protein_id gnl|my_center|LOCUS_05000 1611 592 gene locus_tag LOCUS_05010 1611 592 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_05010 3044 1635 gene locus_tag LOCUS_05020 gene allB 3044 1635 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 protein_id gnl|my_center|LOCUS_05020 3403 3331 gene locus_tag LOCUS_t00080 3403 3331 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3543 4283 gene locus_tag LOCUS_05030 3543 4283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_05030 4268 5002 gene locus_tag LOCUS_05040 4268 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5146 5703 gene locus_tag LOCUS_05050 5146 5703 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_05050 6216 5704 gene locus_tag LOCUS_05060 gene ptsN 6216 5704 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310177.1 protein_id gnl|my_center|LOCUS_05060 7770 6283 gene locus_tag LOCUS_05070 gene gltA 7770 6283 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_05070 8622 7774 gene locus_tag LOCUS_05080 8622 7774 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_05080 8854 9198 gene locus_tag LOCUS_05090 8854 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9807 9373 gene locus_tag LOCUS_05100 9807 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 10606 10268 gene locus_tag LOCUS_05110 10606 10268 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496603.1 protein_id gnl|my_center|LOCUS_05110 14378 10692 gene locus_tag LOCUS_05120 14378 10692 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_05120 <15011 14387 gene locus_tag LOCUS_05130 <15011 14387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436062.1:phosphoribosylamine--glycine ligase >Feature sequence0030 1089 4028 gene locus_tag LOCUS_05140 1089 4028 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_05140 4729 4025 gene locus_tag LOCUS_05150 4729 4025 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004200.1 protein_id gnl|my_center|LOCUS_05150 5145 4804 gene locus_tag LOCUS_05160 5145 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6194 5142 gene locus_tag LOCUS_05170 6194 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7484 6198 gene locus_tag LOCUS_05180 7484 6198 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969381.1 protein_id gnl|my_center|LOCUS_05180 7957 7481 gene locus_tag LOCUS_05190 7957 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 9052 8030 gene locus_tag LOCUS_05200 9052 8030 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969379.1 protein_id gnl|my_center|LOCUS_05200 10051 9101 gene locus_tag LOCUS_05210 10051 9101 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_05210 10866 10048 gene locus_tag LOCUS_05220 10866 10048 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_05220 11534 10866 gene locus_tag LOCUS_05230 11534 10866 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_05230 13783 13094 gene locus_tag LOCUS_05240 13783 13094 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_05240 <14590 13783 gene locus_tag LOCUS_05250 <14590 13783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679930.1:DNA topoisomerase IV subunit A >Feature sequence0031 1 1149 gene locus_tag LOCUS_05260 1 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2267 1269 gene locus_tag LOCUS_05270 2267 1269 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_05270 3482 2424 gene locus_tag LOCUS_05280 3482 2424 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764574.1 protein_id gnl|my_center|LOCUS_05280 4556 3501 gene locus_tag LOCUS_05290 4556 3501 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_05290 5337 4543 gene locus_tag LOCUS_05300 5337 4543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_05300 6350 5364 gene locus_tag LOCUS_05310 6350 5364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116562.1 protein_id gnl|my_center|LOCUS_05310 7885 6365 gene locus_tag LOCUS_05320 7885 6365 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_05320 8923 7895 gene locus_tag LOCUS_05330 8923 7895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 protein_id gnl|my_center|LOCUS_05330 10052 9012 gene locus_tag LOCUS_05340 10052 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11313 10096 gene locus_tag LOCUS_05350 11313 10096 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_05350 11627 12985 gene locus_tag LOCUS_05360 gene glpK 11627 12985 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229157.1 protein_id gnl|my_center|LOCUS_05360 12996 13382 gene locus_tag LOCUS_05370 12996 13382 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence0032 1017 2267 gene locus_tag LOCUS_05380 gene pcnB 1017 2267 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_05380 3136 2264 gene locus_tag LOCUS_05390 3136 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_05390 3222 4532 gene locus_tag LOCUS_05400 gene rsxC 3222 4532 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_05400 4529 5623 gene locus_tag LOCUS_05410 4529 5623 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_05410 5620 6177 gene locus_tag LOCUS_05420 5620 6177 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_05420 6174 6806 gene locus_tag LOCUS_05430 6174 6806 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_05430 6808 7401 gene locus_tag LOCUS_05440 gene rsxA 6808 7401 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_05440 7412 8212 gene locus_tag LOCUS_05450 7412 8212 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_05450 8215 10119 gene locus_tag LOCUS_05460 8215 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10187 11239 gene locus_tag LOCUS_05470 gene prfB 10187 11239 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014540570.1 protein_id gnl|my_center|LOCUS_05470 11242 12519 gene locus_tag LOCUS_05480 11242 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 12538 13407 gene locus_tag LOCUS_05490 gene ftsY 12538 13407 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0033 2 1267 gene locus_tag LOCUS_05500 2 1267 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957021.1 protein_id gnl|my_center|LOCUS_05500 1425 2660 gene locus_tag LOCUS_05510 1425 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 2806 4314 gene locus_tag LOCUS_05520 2806 4314 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_05520 4546 4617 gene locus_tag LOCUS_t00090 4546 4617 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4666 5634 gene locus_tag LOCUS_05530 4666 5634 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 protein_id gnl|my_center|LOCUS_05530 5673 6461 gene locus_tag LOCUS_05540 5673 6461 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681579.1 protein_id gnl|my_center|LOCUS_05540 6458 7153 gene locus_tag LOCUS_05550 6458 7153 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_05550 7150 7488 gene locus_tag LOCUS_05560 7150 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7488 8486 gene locus_tag LOCUS_05570 7488 8486 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840103.1 protein_id gnl|my_center|LOCUS_05570 9114 8506 gene locus_tag LOCUS_05580 9114 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_05580 9689 9111 gene locus_tag LOCUS_05590 9689 9111 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678721.1 protein_id gnl|my_center|LOCUS_05590 9738 10727 gene locus_tag LOCUS_05600 gene rsgA 9738 10727 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_05600 10708 13062 gene locus_tag LOCUS_05610 10708 13062 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_05610 13173 13541 gene locus_tag LOCUS_05620 13173 13541 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813604.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence0034 800 312 gene locus_tag LOCUS_05630 800 312 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 protein_id gnl|my_center|LOCUS_05630 1914 901 gene locus_tag LOCUS_05640 1914 901 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 protein_id gnl|my_center|LOCUS_05640 2154 3218 gene locus_tag LOCUS_05650 2154 3218 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298484.1 protein_id gnl|my_center|LOCUS_05650 3286 4545 gene locus_tag LOCUS_05660 3286 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5046 4576 gene locus_tag LOCUS_05670 5046 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6166 5060 gene locus_tag LOCUS_05680 gene nqrF 6166 5060 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 protein_id gnl|my_center|LOCUS_05680 6770 6177 gene locus_tag LOCUS_05690 gene nqrE 6770 6177 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_05690 7375 6767 gene locus_tag LOCUS_05700 7375 6767 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 protein_id gnl|my_center|LOCUS_05700 7970 7377 gene locus_tag LOCUS_05710 7970 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8941 7967 gene locus_tag LOCUS_05720 8941 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 10059 9073 gene locus_tag LOCUS_05730 10059 9073 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_05730 10855 10391 gene locus_tag LOCUS_05740 10855 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 12687 11371 gene locus_tag LOCUS_05750 12687 11371 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 protein_id gnl|my_center|LOCUS_05750 <13770 12692 gene locus_tag LOCUS_05760 <13770 12692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002384673.1:adenine deaminase C-terminal domain-containing protein >Feature sequence0035 998 168 gene locus_tag LOCUS_05770 998 168 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_05770 2488 1013 gene locus_tag LOCUS_05780 2488 1013 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_05780 3345 2485 gene locus_tag LOCUS_05790 3345 2485 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944134.1 protein_id gnl|my_center|LOCUS_05790 3601 4413 gene locus_tag LOCUS_05800 3601 4413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160784.1 protein_id gnl|my_center|LOCUS_05800 4418 5266 gene locus_tag LOCUS_05810 4418 5266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775424.1 protein_id gnl|my_center|LOCUS_05810 5334 6470 gene locus_tag LOCUS_05820 5334 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6533 7813 gene locus_tag LOCUS_05830 6533 7813 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_05830 7831 8871 gene locus_tag LOCUS_05840 gene purR 7831 8871 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 protein_id gnl|my_center|LOCUS_05840 8868 10025 gene locus_tag LOCUS_05850 gene nagA 8868 10025 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_05850 10018 11193 gene locus_tag LOCUS_05860 10018 11193 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_05860 11197 12366 gene locus_tag LOCUS_05870 gene manA 11197 12366 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263541.1 protein_id gnl|my_center|LOCUS_05870 12370 13527 gene locus_tag LOCUS_05880 gene fba 12370 13527 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0036 1322 1143 gene locus_tag LOCUS_05890 1322 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2454 1414 gene locus_tag LOCUS_05900 2454 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4336 2507 gene locus_tag LOCUS_05910 4336 2507 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_05910 5038 4490 gene locus_tag LOCUS_05920 5038 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5151 6509 gene locus_tag LOCUS_05930 5151 6509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_05930 6577 8829 gene locus_tag LOCUS_05940 6577 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9438 8935 gene locus_tag LOCUS_05950 9438 8935 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837205.1 protein_id gnl|my_center|LOCUS_05950 10706 9687 gene locus_tag LOCUS_05960 gene asd 10706 9687 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_05960 11508 10867 gene locus_tag LOCUS_05970 11508 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12968 11505 gene locus_tag LOCUS_05980 12968 11505 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_05980 13220 13294 gene locus_tag LOCUS_t00100 13220 13294 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0037 1466 633 gene locus_tag LOCUS_05990 gene ygfM 1466 633 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572441.1 protein_id gnl|my_center|LOCUS_05990 2851 1463 gene locus_tag LOCUS_06000 2851 1463 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_06000 4601 3384 gene locus_tag LOCUS_06010 4601 3384 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 protein_id gnl|my_center|LOCUS_06010 5970 4648 gene locus_tag LOCUS_06020 gene ssnA 5970 4648 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705208.1 protein_id gnl|my_center|LOCUS_06020 9214 5981 gene locus_tag LOCUS_06030 gene ygfK 9214 5981 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502365.1 protein_id gnl|my_center|LOCUS_06030 9636 11102 gene locus_tag LOCUS_06040 9636 11102 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_06040 11171 12412 gene locus_tag LOCUS_06050 11171 12412 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_06050 12548 13021 gene locus_tag LOCUS_06060 12548 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 13027 13111 gene locus_tag LOCUS_t00110 13027 13111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0038 <1 759 gene locus_tag LOCUS_06070 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467681.1:[citrate (pro-3S)-lyase] ligase 1424 735 gene locus_tag LOCUS_06080 1424 735 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_06080 1502 3763 gene locus_tag LOCUS_06090 1502 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3853 4857 gene locus_tag LOCUS_06100 3853 4857 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_06100 4919 5383 gene locus_tag LOCUS_06110 4919 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5394 6902 gene locus_tag LOCUS_06120 5394 6902 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869091.1 protein_id gnl|my_center|LOCUS_06120 6921 7211 gene locus_tag LOCUS_06130 gene citD 6921 7211 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 protein_id gnl|my_center|LOCUS_06130 7213 8094 gene locus_tag LOCUS_06140 gene citE 7213 8094 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 protein_id gnl|my_center|LOCUS_06140 8105 9658 gene locus_tag LOCUS_06150 gene citF 8105 9658 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663293.1 protein_id gnl|my_center|LOCUS_06150 9661 10170 gene locus_tag LOCUS_06160 gene citX 9661 10170 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236063.1 protein_id gnl|my_center|LOCUS_06160 10178 11053 gene locus_tag LOCUS_06170 gene citG 10178 11053 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154857.1 protein_id gnl|my_center|LOCUS_06170 12635 11127 gene locus_tag LOCUS_06180 12635 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 <13492 12863 gene locus_tag LOCUS_06190 <13492 12863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963714.1:CPBP family intramembrane metalloprotease >Feature sequence0039 433 1665 gene locus_tag LOCUS_06200 gene icd 433 1665 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123165.1 protein_id gnl|my_center|LOCUS_06200 2322 1657 gene locus_tag LOCUS_06210 2322 1657 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288638.1 protein_id gnl|my_center|LOCUS_06210 3604 2309 gene locus_tag LOCUS_06220 3604 2309 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_06220 3889 4194 gene locus_tag LOCUS_06230 3889 4194 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_06230 4191 4934 gene locus_tag LOCUS_06240 4191 4934 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_06240 5401 4931 gene locus_tag LOCUS_06250 5401 4931 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_06250 6693 5473 gene locus_tag LOCUS_06260 6693 5473 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_06260 6964 7695 gene locus_tag LOCUS_06270 6964 7695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_06270 7695 9359 gene locus_tag LOCUS_06280 7695 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 10012 9332 gene locus_tag LOCUS_06290 10012 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 11084 10089 gene locus_tag LOCUS_06300 gene hflC 11084 10089 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_06300 12061 11081 gene locus_tag LOCUS_06310 gene hflK 12061 11081 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0040 623 177 gene locus_tag LOCUS_06320 623 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2040 613 gene locus_tag LOCUS_06330 gene tilS 2040 613 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_06330 2572 2009 gene locus_tag LOCUS_06340 gene pth 2572 2009 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_06340 3210 2569 gene locus_tag LOCUS_06350 3210 2569 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_06350 3465 3391 gene locus_tag LOCUS_t00120 3465 3391 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3794 3510 gene locus_tag LOCUS_06360 gene spoVG 3794 3510 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_06360 4708 3830 gene locus_tag LOCUS_06370 gene ispE 4708 3830 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_06370 5604 4873 gene locus_tag LOCUS_06380 5604 4873 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_06380 5655 6461 gene locus_tag LOCUS_06390 5655 6461 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416645.1 protein_id gnl|my_center|LOCUS_06390 6793 6371 gene locus_tag LOCUS_06400 6793 6371 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 protein_id gnl|my_center|LOCUS_06400 7071 8780 gene locus_tag LOCUS_06410 7071 8780 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_06410 8804 10093 gene locus_tag LOCUS_06420 8804 10093 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_06420 10136 11185 gene locus_tag LOCUS_06430 gene mtnA 10136 11185 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025237.1 protein_id gnl|my_center|LOCUS_06430 11484 12845 gene locus_tag LOCUS_06440 gene gdhA 11484 12845 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence0041 16 294 gene locus_tag LOCUS_06450 16 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1146 262 gene locus_tag LOCUS_06460 1146 262 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_06460 1111 1254 gene locus_tag LOCUS_06470 1111 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1369 2658 gene locus_tag LOCUS_06480 gene murA 1369 2658 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_06480 3261 3473 gene locus_tag LOCUS_06490 3261 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3519 3740 gene locus_tag LOCUS_06500 3519 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06500 3789 5822 gene locus_tag LOCUS_06510 gene feoB 3789 5822 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_06510 7200 6091 gene locus_tag LOCUS_06520 7200 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8108 7311 gene locus_tag LOCUS_06530 8108 7311 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_06530 9541 8105 gene locus_tag LOCUS_06540 9541 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 9702 10571 gene locus_tag LOCUS_06550 gene lgt 9702 10571 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_06550 10582 12357 gene locus_tag LOCUS_06560 10582 12357 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence0042 1346 345 gene locus_tag LOCUS_06570 1346 345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 protein_id gnl|my_center|LOCUS_06570 2853 1339 gene locus_tag LOCUS_06580 2853 1339 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046033648.1 protein_id gnl|my_center|LOCUS_06580 3947 2934 gene locus_tag LOCUS_06590 gene rhaS 3947 2934 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973083.1 protein_id gnl|my_center|LOCUS_06590 5100 4021 gene locus_tag LOCUS_06600 5100 4021 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975469.1 protein_id gnl|my_center|LOCUS_06600 6347 5097 gene locus_tag LOCUS_06610 6347 5097 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_06610 6492 7298 gene locus_tag LOCUS_06620 6492 7298 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_06620 7720 7295 gene locus_tag LOCUS_06630 7720 7295 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_06630 7827 9653 gene locus_tag LOCUS_06640 gene fucI 7827 9653 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_06640 10641 9766 gene locus_tag LOCUS_06650 10641 9766 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975186.1 protein_id gnl|my_center|LOCUS_06650 11478 10651 gene locus_tag LOCUS_06660 11478 10651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_06660 12961 11471 gene locus_tag LOCUS_06670 12961 11471 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0043 1315 698 gene locus_tag LOCUS_06680 gene scpB 1315 698 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_06680 2289 1330 gene locus_tag LOCUS_06690 2289 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3467 2364 gene locus_tag LOCUS_06700 gene recA 3467 2364 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_06700 3978 3541 gene locus_tag LOCUS_06710 gene dtd 3978 3541 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_06710 4613 3975 gene locus_tag LOCUS_06720 gene rpe 4613 3975 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_06720 4779 5327 gene locus_tag LOCUS_06730 4779 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5602 8322 gene locus_tag LOCUS_06740 gene greA 5602 8322 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_06740 8524 9081 gene locus_tag LOCUS_06750 8524 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9165 9842 gene locus_tag LOCUS_06760 9165 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 11431 9935 gene locus_tag LOCUS_06770 gene murJ 11431 9935 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889824.1 protein_id gnl|my_center|LOCUS_06770 12584 11460 gene locus_tag LOCUS_06780 gene tgt 12584 11460 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence0044 2592 1363 gene locus_tag LOCUS_06790 2592 1363 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_06790 3596 2559 gene locus_tag LOCUS_06800 3596 2559 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_06800 4884 3586 gene locus_tag LOCUS_06810 4884 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102087.1 protein_id gnl|my_center|LOCUS_06810 6013 4877 gene locus_tag LOCUS_06820 6013 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 7152 6178 gene locus_tag LOCUS_06830 7152 6178 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_06830 8135 7149 gene locus_tag LOCUS_06840 8135 7149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_06840 9037 8150 gene locus_tag LOCUS_06850 9037 8150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_06850 9953 9030 gene locus_tag LOCUS_06860 9953 9030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_06860 11643 10081 gene locus_tag LOCUS_06870 11643 10081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_06870 12766 11723 gene locus_tag LOCUS_06880 12766 11723 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence0045 1624 344 gene locus_tag LOCUS_06890 1624 344 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_06890 2558 1641 gene locus_tag LOCUS_06900 2558 1641 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929933.1 protein_id gnl|my_center|LOCUS_06900 3522 2620 gene locus_tag LOCUS_06910 gene dapA 3522 2620 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169452.1 protein_id gnl|my_center|LOCUS_06910 4417 3593 gene locus_tag LOCUS_06920 4417 3593 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582910.1 protein_id gnl|my_center|LOCUS_06920 5587 4427 gene locus_tag LOCUS_06930 5587 4427 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_06930 5863 5597 gene locus_tag LOCUS_06940 5863 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6931 5867 gene locus_tag LOCUS_06950 6931 5867 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_06950 8435 6942 gene locus_tag LOCUS_06960 8435 6942 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_06960 8952 8449 gene locus_tag LOCUS_06970 8952 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10075 9110 gene locus_tag LOCUS_06980 10075 9110 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809854.1 protein_id gnl|my_center|LOCUS_06980 11160 10246 gene locus_tag LOCUS_06990 11160 10246 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_06990 12079 11267 gene locus_tag LOCUS_07000 gene iolO 12079 11267 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_07000 12744 12076 gene locus_tag LOCUS_07010 gene rpe 12744 12076 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0046 1804 1001 gene locus_tag LOCUS_07020 1804 1001 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_07020 2877 1801 gene locus_tag LOCUS_07030 gene arsB 2877 1801 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_07030 3278 2940 gene locus_tag LOCUS_07040 3278 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4049 3357 gene locus_tag LOCUS_07050 4049 3357 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461616.1 protein_id gnl|my_center|LOCUS_07050 4599 4042 gene locus_tag LOCUS_07060 4599 4042 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272758.1 protein_id gnl|my_center|LOCUS_07060 5062 4637 gene locus_tag LOCUS_07070 5062 4637 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_07070 5544 5783 gene locus_tag LOCUS_07080 5544 5783 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_07080 5783 6151 gene locus_tag LOCUS_07090 gene anvM 5783 6151 CDS product anaerobic/virulence modulator AnvM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092971.1 protein_id gnl|my_center|LOCUS_07090 6153 7337 gene locus_tag LOCUS_07100 6153 7337 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546326.1 protein_id gnl|my_center|LOCUS_07100 7392 8300 gene locus_tag LOCUS_07110 7392 8300 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317368.1 protein_id gnl|my_center|LOCUS_07110 8329 8811 gene locus_tag LOCUS_07120 8329 8811 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_07120 8808 9344 gene locus_tag LOCUS_07130 8808 9344 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_07130 10588 9434 gene locus_tag LOCUS_07140 10588 9434 CDS product IS1595-like element ISSsu9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_07140 11090 11458 gene locus_tag LOCUS_07150 11090 11458 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_07150 11489 11791 gene locus_tag LOCUS_07160 11489 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11805 12287 gene locus_tag LOCUS_07170 11805 12287 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_07170 12284 12814 gene locus_tag LOCUS_07180 12284 12814 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071747924.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0047 2179 1073 gene locus_tag LOCUS_07190 gene dnaN 2179 1073 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_07190 3817 2396 gene locus_tag LOCUS_07200 gene dnaA 3817 2396 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_07200 4017 6050 gene locus_tag LOCUS_07210 gene gyrB 4017 6050 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_07210 6065 8638 gene locus_tag LOCUS_07220 gene gyrA 6065 8638 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_07220 9362 9135 gene locus_tag LOCUS_07230 9362 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9471 10241 gene locus_tag LOCUS_07240 9471 10241 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_07240 10222 11172 gene locus_tag LOCUS_07250 10222 11172 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_07250 11191 12141 gene locus_tag LOCUS_07260 11191 12141 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence0048 373 612 gene locus_tag LOCUS_07270 373 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 563 1426 gene locus_tag LOCUS_07280 gene hisG 563 1426 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_07280 1436 2743 gene locus_tag LOCUS_07290 gene hisD 1436 2743 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_07290 2740 3834 gene locus_tag LOCUS_07300 gene hisC 2740 3834 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_07300 3831 4973 gene locus_tag LOCUS_07310 gene hisB 3831 4973 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_07310 4970 5563 gene locus_tag LOCUS_07320 gene hisH 4970 5563 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_07320 5563 6297 gene locus_tag LOCUS_07330 gene hisA 5563 6297 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_07330 6287 7069 gene locus_tag LOCUS_07340 gene hisF 6287 7069 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_07340 7081 7689 gene locus_tag LOCUS_07350 gene hisIE 7081 7689 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_07350 8351 7890 gene locus_tag LOCUS_07360 8351 7890 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 protein_id gnl|my_center|LOCUS_07360 10529 8904 gene locus_tag LOCUS_07370 10529 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 11464 10502 gene locus_tag LOCUS_07380 11464 10502 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111818.1 protein_id gnl|my_center|LOCUS_07380 11918 11478 gene locus_tag LOCUS_07390 11918 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0049 291 1178 gene locus_tag LOCUS_07400 291 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1197 4685 gene locus_tag LOCUS_07410 gene dnaE 1197 4685 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_07410 4725 5381 gene locus_tag LOCUS_07420 4725 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5384 7474 gene locus_tag LOCUS_07430 gene recG 5384 7474 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_07430 7861 8748 gene locus_tag LOCUS_07440 7861 8748 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_07440 8762 9736 gene locus_tag LOCUS_07450 8762 9736 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_07450 9797 11692 gene locus_tag LOCUS_07460 9797 11692 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_07460 11685 12419 gene locus_tag LOCUS_07470 11685 12419 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence0050 1779 670 gene locus_tag LOCUS_07480 1779 670 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_07480 2530 1808 gene locus_tag LOCUS_07490 2530 1808 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682394.1 protein_id gnl|my_center|LOCUS_07490 3912 2830 gene locus_tag LOCUS_07500 3912 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4114 5052 gene locus_tag LOCUS_07510 4114 5052 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_07510 5054 5404 gene locus_tag LOCUS_07520 5054 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_07520 5388 6095 gene locus_tag LOCUS_07530 5388 6095 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_07530 6439 6675 gene locus_tag LOCUS_07540 6439 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7530 7766 gene locus_tag LOCUS_07550 7530 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8786 8076 gene locus_tag LOCUS_07560 8786 8076 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 protein_id gnl|my_center|LOCUS_07560 9087 8872 gene locus_tag LOCUS_07570 9087 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8996 9601 gene locus_tag LOCUS_07580 8996 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9598 11814 gene locus_tag LOCUS_07590 9598 11814 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_07590 11985 12057 gene locus_tag LOCUS_t00130 11985 12057 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12076 12149 gene locus_tag LOCUS_t00140 12076 12149 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12212 12286 gene locus_tag LOCUS_t00150 12212 12286 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0051 2738 1911 gene locus_tag LOCUS_07600 2738 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4125 2752 gene locus_tag LOCUS_07610 4125 2752 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_07610 4712 4425 gene locus_tag LOCUS_07620 4712 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4932 5885 gene locus_tag LOCUS_07630 4932 5885 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389891.1 protein_id gnl|my_center|LOCUS_07630 5882 6814 gene locus_tag LOCUS_07640 5882 6814 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947621.1 protein_id gnl|my_center|LOCUS_07640 6811 7719 gene locus_tag LOCUS_07650 6811 7719 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 protein_id gnl|my_center|LOCUS_07650 9039 7711 gene locus_tag LOCUS_07660 gene xylA 9039 7711 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_07660 10528 9050 gene locus_tag LOCUS_07670 gene xylB 10528 9050 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_07670 10617 11408 gene locus_tag LOCUS_07680 10617 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 <11940 11413 gene locus_tag LOCUS_07690 <11940 11413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246357.1:ribokinase >Feature sequence0052 <1 507 gene locus_tag LOCUS_07700 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262600.1:GGDEF domain-containing protein 3394 824 gene locus_tag LOCUS_07710 gene xdh 3394 824 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 protein_id gnl|my_center|LOCUS_07710 4638 3694 gene locus_tag LOCUS_07720 4638 3694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_07720 5738 4635 gene locus_tag LOCUS_07730 5738 4635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07730 7260 5722 gene locus_tag LOCUS_07740 7260 5722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_07740 8375 7341 gene locus_tag LOCUS_07750 8375 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9510 8614 gene locus_tag LOCUS_07760 gene lacC 9510 8614 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_07760 9989 9507 gene locus_tag LOCUS_07770 9989 9507 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_07770 10914 9982 gene locus_tag LOCUS_07780 10914 9982 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939111.1 protein_id gnl|my_center|LOCUS_07780 11598 11095 gene locus_tag LOCUS_07790 11598 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence0053 1137 319 gene locus_tag LOCUS_07800 1137 319 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454862.1 protein_id gnl|my_center|LOCUS_07800 2011 1139 gene locus_tag LOCUS_07810 2011 1139 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861597.1 protein_id gnl|my_center|LOCUS_07810 3351 2080 gene locus_tag LOCUS_07820 3351 2080 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507458.1 protein_id gnl|my_center|LOCUS_07820 4466 3531 gene locus_tag LOCUS_07830 4466 3531 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_07830 5163 4456 gene locus_tag LOCUS_07840 5163 4456 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_07840 5870 5166 gene locus_tag LOCUS_07850 5870 5166 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302777.1 protein_id gnl|my_center|LOCUS_07850 6346 5867 gene locus_tag LOCUS_07860 6346 5867 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 protein_id gnl|my_center|LOCUS_07860 7164 6334 gene locus_tag LOCUS_07870 7164 6334 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_07870 8145 7213 gene locus_tag LOCUS_07880 8145 7213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_07880 9292 8147 gene locus_tag LOCUS_07890 9292 8147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_07890 10809 9289 gene locus_tag LOCUS_07900 10809 9289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_07900 11812 10922 gene locus_tag LOCUS_07910 11812 10922 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence0054 265 2373 gene locus_tag LOCUS_07920 gene fusA 265 2373 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_07920 2527 3234 gene locus_tag LOCUS_07930 2527 3234 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_07930 3434 4321 gene locus_tag LOCUS_07940 3434 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4514 5524 gene locus_tag LOCUS_07950 4514 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5844 5650 gene locus_tag LOCUS_07960 5844 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6463 7536 gene locus_tag LOCUS_07970 6463 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7717 8490 gene locus_tag LOCUS_07980 7717 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8670 8500 gene locus_tag LOCUS_07990 8670 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9334 8627 gene locus_tag LOCUS_08000 9334 8627 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_08000 10081 9344 gene locus_tag LOCUS_08010 10081 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11259 10078 gene locus_tag LOCUS_08020 11259 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence0055 330 1277 gene locus_tag LOCUS_08030 330 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1274 2698 gene locus_tag LOCUS_08040 1274 2698 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_08040 2749 2958 gene locus_tag LOCUS_08050 2749 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2955 3611 gene locus_tag LOCUS_08060 2955 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3747 5468 gene locus_tag LOCUS_08070 3747 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5949 5506 gene locus_tag LOCUS_08080 5949 5506 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133920.1 protein_id gnl|my_center|LOCUS_08080 6167 7033 gene locus_tag LOCUS_08090 6167 7033 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_08090 7030 7836 gene locus_tag LOCUS_08100 7030 7836 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_08100 7839 9185 gene locus_tag LOCUS_08110 7839 9185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_08110 9199 9336 gene locus_tag LOCUS_08120 9199 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9763 9326 gene locus_tag LOCUS_08130 gene cueR 9763 9326 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_08130 9995 10855 gene locus_tag LOCUS_08140 9995 10855 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 protein_id gnl|my_center|LOCUS_08140 10852 11268 gene locus_tag LOCUS_08150 10852 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence0056 841 1530 gene locus_tag LOCUS_08160 841 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1910 3061 gene locus_tag LOCUS_08170 1910 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3471 3067 gene locus_tag LOCUS_08180 3471 3067 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_08180 3908 3483 gene locus_tag LOCUS_08190 3908 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5401 3905 gene locus_tag LOCUS_08200 5401 3905 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_08200 5610 6650 gene locus_tag LOCUS_08210 5610 6650 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 protein_id gnl|my_center|LOCUS_08210 6626 8341 gene locus_tag LOCUS_08220 6626 8341 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146673.1 protein_id gnl|my_center|LOCUS_08220 8331 9392 gene locus_tag LOCUS_08230 8331 9392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867920.1 protein_id gnl|my_center|LOCUS_08230 9449 10012 gene locus_tag LOCUS_08240 9449 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 10009 10977 gene locus_tag LOCUS_08250 10009 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence0057 1183 1914 gene locus_tag LOCUS_08260 1183 1914 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_08260 3231 1978 gene locus_tag LOCUS_08270 3231 1978 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_08270 4049 3291 gene locus_tag LOCUS_08280 4049 3291 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_08280 4005 4160 gene locus_tag LOCUS_08290 4005 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4138 4278 gene locus_tag LOCUS_08300 4138 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4407 6632 gene locus_tag LOCUS_08310 4407 6632 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_08310 7126 6650 gene locus_tag LOCUS_08320 7126 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8419 7196 gene locus_tag LOCUS_08330 8419 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8794 9681 gene locus_tag LOCUS_08340 8794 9681 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_08340 10750 9764 gene locus_tag LOCUS_08350 10750 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence0058 1082 231 gene locus_tag LOCUS_08360 1082 231 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_08360 1976 1089 gene locus_tag LOCUS_08370 1976 1089 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_08370 3357 2053 gene locus_tag LOCUS_08380 3357 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5388 3517 gene locus_tag LOCUS_08390 gene malZ 5388 3517 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_08390 5592 7070 gene locus_tag LOCUS_08400 5592 7070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_08400 7127 8035 gene locus_tag LOCUS_08410 7127 8035 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_08410 8037 8918 gene locus_tag LOCUS_08420 8037 8918 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_08420 9003 10730 gene locus_tag LOCUS_08430 9003 10730 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence0059 609 1208 gene locus_tag LOCUS_08440 609 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1474 2079 gene locus_tag LOCUS_08450 1474 2079 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531723.1 protein_id gnl|my_center|LOCUS_08450 3752 2076 gene locus_tag LOCUS_08460 gene asnB 3752 2076 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_08460 5027 3831 gene locus_tag LOCUS_08470 5027 3831 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_08470 5911 5024 gene locus_tag LOCUS_08480 gene argB 5911 5024 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_08480 7131 5911 gene locus_tag LOCUS_08490 gene argJ 7131 5911 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_08490 8181 7141 gene locus_tag LOCUS_08500 gene argC 8181 7141 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_08500 8965 8279 gene locus_tag LOCUS_08510 8965 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9366 8998 gene locus_tag LOCUS_08520 9366 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10016 9363 gene locus_tag LOCUS_08530 10016 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <10791 10078 gene locus_tag LOCUS_08540 <10791 10078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949077.1:diguanylate cyclase >Feature sequence0060 <1 3462 gene locus_tag LOCUS_08550 <1 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680361.1:DNA-directed RNA polymerase subunit beta 3478 7761 gene locus_tag LOCUS_08560 gene rpoC 3478 7761 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680359.1 protein_id gnl|my_center|LOCUS_08560 7932 8306 gene locus_tag LOCUS_08570 gene rpsL 7932 8306 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_08570 8322 8792 gene locus_tag LOCUS_08580 gene rpsG 8322 8792 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_08580 9191 10381 gene locus_tag LOCUS_08590 gene tuf 9191 10381 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_08590 10445 10753 gene locus_tag LOCUS_08600 gene rpsJ 10445 10753 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence0061 358 897 gene locus_tag LOCUS_08610 358 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 890 1183 gene locus_tag LOCUS_08620 890 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1185 1601 gene locus_tag LOCUS_08630 1185 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1993 1667 gene locus_tag LOCUS_08640 1993 1667 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_08640 2405 1977 gene locus_tag LOCUS_08650 2405 1977 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_08650 2668 2919 gene locus_tag LOCUS_08660 2668 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2921 4231 gene locus_tag LOCUS_08670 2921 4231 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_08670 5215 4355 gene locus_tag LOCUS_08680 5215 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6066 5218 gene locus_tag LOCUS_08690 6066 5218 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_08690 7008 6076 gene locus_tag LOCUS_08700 7008 6076 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_08700 8486 7176 gene locus_tag LOCUS_08710 8486 7176 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975844.1 protein_id gnl|my_center|LOCUS_08710 9055 8666 gene locus_tag LOCUS_08720 9055 8666 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_08720 9172 9396 gene locus_tag LOCUS_08730 9172 9396 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0062 698 75 gene locus_tag LOCUS_08740 698 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 787 2589 gene locus_tag LOCUS_08750 787 2589 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_08750 2589 4562 gene locus_tag LOCUS_08760 2589 4562 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08760 4565 5257 gene locus_tag LOCUS_08770 4565 5257 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_08770 8276 5328 gene locus_tag LOCUS_08780 8276 5328 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_08780 8510 9847 gene locus_tag LOCUS_08790 gene gdhA 8510 9847 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_08790 10454 9963 gene locus_tag LOCUS_08800 10454 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0063 1945 680 gene locus_tag LOCUS_08810 1945 680 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_08810 3606 1948 gene locus_tag LOCUS_08820 gene lnt 3606 1948 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679415.1 protein_id gnl|my_center|LOCUS_08820 3962 3642 gene locus_tag LOCUS_08830 3962 3642 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_08830 4325 4044 gene locus_tag LOCUS_08840 gene rpsT 4325 4044 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_08840 5591 4449 gene locus_tag LOCUS_08850 5591 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5790 6572 gene locus_tag LOCUS_08860 5790 6572 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_08860 6569 7570 gene locus_tag LOCUS_08870 gene dusB 6569 7570 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_08870 7629 8885 gene locus_tag LOCUS_08880 gene purD 7629 8885 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_08880 9543 9061 gene locus_tag LOCUS_08890 9543 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10094 9540 gene locus_tag LOCUS_08900 10094 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10338 10087 gene locus_tag LOCUS_08910 10338 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence0064 1359 103 gene locus_tag LOCUS_08920 1359 103 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_08920 2153 1356 gene locus_tag LOCUS_08930 2153 1356 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_08930 3142 2150 gene locus_tag LOCUS_08940 gene uxuA 3142 2150 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_08940 3972 3127 gene locus_tag LOCUS_08950 3972 3127 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_08950 4754 3972 gene locus_tag LOCUS_08960 gene fabG 4754 3972 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_08960 6048 4768 gene locus_tag LOCUS_08970 6048 4768 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_08970 6587 6045 gene locus_tag LOCUS_08980 6587 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 7678 6671 gene locus_tag LOCUS_08990 gene siaP 7678 6671 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 protein_id gnl|my_center|LOCUS_08990 8647 7715 gene locus_tag LOCUS_09000 8647 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 10024 8681 gene locus_tag LOCUS_09010 10024 8681 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_09010 10388 10182 gene locus_tag LOCUS_09020 10388 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence0065 485 1036 gene locus_tag LOCUS_09030 485 1036 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_09030 2517 1033 gene locus_tag LOCUS_09040 2517 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3616 2576 gene locus_tag LOCUS_09050 3616 2576 CDS product dihydroorotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679913.1 protein_id gnl|my_center|LOCUS_09050 5340 3613 gene locus_tag LOCUS_09060 5340 3613 CDS product dihydroorotate dehydrogenase/oxidoreductase, FAD-binding inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682296.1 protein_id gnl|my_center|LOCUS_09060 6218 5337 gene locus_tag LOCUS_09070 gene pyrF 6218 5337 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957153.1 protein_id gnl|my_center|LOCUS_09070 6974 6276 gene locus_tag LOCUS_09080 6974 6276 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682319.1 protein_id gnl|my_center|LOCUS_09080 8600 6993 gene locus_tag LOCUS_09090 8600 6993 CDS product bifunctional aspartate carbamoyltransferase catalytic subunit/aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666669.1 protein_id gnl|my_center|LOCUS_09090 <10436 8781 gene locus_tag LOCUS_09100 <10436 8781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144294.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence0066 1731 1105 gene locus_tag LOCUS_09110 1731 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1825 3264 gene locus_tag LOCUS_09120 1825 3264 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_09120 3779 3348 gene locus_tag LOCUS_09130 3779 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3960 4139 gene locus_tag LOCUS_09140 3960 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5078 4059 gene locus_tag LOCUS_09150 gene argF 5078 4059 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_09150 6034 5228 gene locus_tag LOCUS_09160 6034 5228 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_09160 6743 6081 gene locus_tag LOCUS_09170 6743 6081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720279.1 protein_id gnl|my_center|LOCUS_09170 7756 6740 gene locus_tag LOCUS_09180 7756 6740 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_09180 10005 8026 gene locus_tag LOCUS_09190 10005 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0067 1324 968 gene locus_tag LOCUS_09200 1324 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1722 1363 gene locus_tag LOCUS_09210 gene rplT 1722 1363 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_09210 1932 1735 gene locus_tag LOCUS_09220 gene rpmI 1932 1735 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556787.1 protein_id gnl|my_center|LOCUS_09220 2567 2019 gene locus_tag LOCUS_09230 gene infC 2567 2019 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_09230 3734 2742 gene locus_tag LOCUS_09240 3734 2742 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_09240 4646 3840 gene locus_tag LOCUS_09250 4646 3840 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_09250 4830 5744 gene locus_tag LOCUS_09260 4830 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_09260 6499 5765 gene locus_tag LOCUS_09270 6499 5765 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_09270 6856 7350 gene locus_tag LOCUS_09280 6856 7350 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_09280 7484 9319 gene locus_tag LOCUS_09290 gene crtH 7484 9319 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence0068 216 1130 gene locus_tag LOCUS_09300 216 1130 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_09300 1226 1885 gene locus_tag LOCUS_09310 1226 1885 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_09310 1991 2968 gene locus_tag LOCUS_09320 gene ydjG 1991 2968 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723717.1 protein_id gnl|my_center|LOCUS_09320 3098 4897 gene locus_tag LOCUS_09330 gene glmS 3098 4897 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_09330 6117 5020 gene locus_tag LOCUS_09340 6117 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6767 6114 gene locus_tag LOCUS_09350 6767 6114 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_09350 7090 7980 gene locus_tag LOCUS_09360 7090 7980 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_09360 7977 8894 gene locus_tag LOCUS_09370 7977 8894 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_09370 8904 10184 gene locus_tag LOCUS_09380 8904 10184 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533134.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence0069 614 1831 gene locus_tag LOCUS_09390 614 1831 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_09390 3984 2023 gene locus_tag LOCUS_09400 3984 2023 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_09400 4472 3945 gene locus_tag LOCUS_09410 4472 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5467 4478 gene locus_tag LOCUS_09420 5467 4478 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_09420 5587 6606 gene locus_tag LOCUS_09430 5587 6606 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 protein_id gnl|my_center|LOCUS_09430 7836 6595 gene locus_tag LOCUS_09440 7836 6595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_09440 8109 9602 gene locus_tag LOCUS_09450 gene pnbA 8109 9602 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence0070 437 1027 gene locus_tag LOCUS_09460 437 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1886 990 gene locus_tag LOCUS_09470 1886 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2945 1968 gene locus_tag LOCUS_09480 2945 1968 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_09480 3991 2945 gene locus_tag LOCUS_09490 3991 2945 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798120.1 protein_id gnl|my_center|LOCUS_09490 5197 4079 gene locus_tag LOCUS_09500 5197 4079 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_09500 5407 5877 gene locus_tag LOCUS_09510 5407 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6006 6353 gene locus_tag LOCUS_09520 6006 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6438 7940 gene locus_tag LOCUS_09530 6438 7940 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_09530 7946 8887 gene locus_tag LOCUS_09540 7946 8887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774051.1 protein_id gnl|my_center|LOCUS_09540 9096 9170 gene locus_tag LOCUS_t00160 9096 9170 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0071 615 172 gene locus_tag LOCUS_09550 615 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1801 752 gene locus_tag LOCUS_09560 1801 752 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_09560 1975 3348 gene locus_tag LOCUS_09570 1975 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3917 3345 gene locus_tag LOCUS_09580 gene mocA 3917 3345 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 protein_id gnl|my_center|LOCUS_09580 3966 4694 gene locus_tag LOCUS_09590 3966 4694 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_09590 5026 4691 gene locus_tag LOCUS_09600 5026 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7735 5225 gene locus_tag LOCUS_09610 7735 5225 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_09610 7928 8001 gene locus_tag LOCUS_t00170 7928 8001 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8063 8242 gene locus_tag LOCUS_09620 gene rpmG 8063 8242 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_09620 8272 8348 gene locus_tag LOCUS_t00180 8272 8348 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8386 8565 gene locus_tag LOCUS_09630 8386 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 8575 9135 gene locus_tag LOCUS_09640 gene nusG 8575 9135 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_09640 9316 9747 gene locus_tag LOCUS_09650 gene rplK 9316 9747 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence0072 <1 807 gene locus_tag LOCUS_09660 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001973414.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1100 3946 gene locus_tag LOCUS_09670 1100 3946 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_09670 3950 5806 gene locus_tag LOCUS_09680 3950 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5998 6855 gene locus_tag LOCUS_09690 5998 6855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_09690 7619 6852 gene locus_tag LOCUS_09700 7619 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8599 7625 gene locus_tag LOCUS_09710 8599 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8649 8855 gene locus_tag LOCUS_09720 8649 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence0073 770 1057 gene locus_tag LOCUS_09730 770 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1401 2846 gene locus_tag LOCUS_09740 1401 2846 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986715.1 protein_id gnl|my_center|LOCUS_09740 3271 3092 gene locus_tag LOCUS_09750 3271 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3855 3385 gene locus_tag LOCUS_09760 gene ispF 3855 3385 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_09760 4661 3852 gene locus_tag LOCUS_09770 4661 3852 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680203.1 protein_id gnl|my_center|LOCUS_09770 5070 4663 gene locus_tag LOCUS_09780 5070 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5299 6798 gene locus_tag LOCUS_09790 gene malQ 5299 6798 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_09790 7760 6795 gene locus_tag LOCUS_09800 7760 6795 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706765.1 protein_id gnl|my_center|LOCUS_09800 7809 8525 gene locus_tag LOCUS_09810 7809 8525 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_09810 8677 9498 gene locus_tag LOCUS_09820 gene thyX 8677 9498 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0074 630 1361 gene locus_tag LOCUS_09830 630 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1819 2841 gene locus_tag LOCUS_09840 1819 2841 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567469.1 protein_id gnl|my_center|LOCUS_09840 2872 3957 gene locus_tag LOCUS_09850 2872 3957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_09850 3970 5649 gene locus_tag LOCUS_09860 3970 5649 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064852.1 protein_id gnl|my_center|LOCUS_09860 5883 7658 gene locus_tag LOCUS_09870 5883 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7882 7703 gene locus_tag LOCUS_09880 7882 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8904 7900 gene locus_tag LOCUS_09890 8904 7900 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0075 8 346 gene locus_tag LOCUS_09900 8 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 597 1574 gene locus_tag LOCUS_09910 597 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1917 2573 gene locus_tag LOCUS_09920 1917 2573 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_09920 3630 2578 gene locus_tag LOCUS_09930 3630 2578 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_09930 4637 3708 gene locus_tag LOCUS_09940 4637 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6669 5221 gene locus_tag LOCUS_09950 6669 5221 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_09950 8908 7016 gene locus_tag LOCUS_09960 8908 7016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_09960 <9756 8908 gene locus_tag LOCUS_09970 <9756 8908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389612.1:ABC transporter ATP-binding protein >Feature sequence0076 5 1822 gene locus_tag LOCUS_09980 gene gyrB 5 1822 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_09980 1837 4404 gene locus_tag LOCUS_09990 gene gyrA 1837 4404 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_09990 5336 5109 gene locus_tag LOCUS_10000 5336 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 5444 6211 gene locus_tag LOCUS_10010 5444 6211 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_10010 6195 7148 gene locus_tag LOCUS_10020 6195 7148 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_10020 7169 8119 gene locus_tag LOCUS_10030 7169 8119 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_10030 8144 9505 gene locus_tag LOCUS_10040 gene radA 8144 9505 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0077 2 721 gene locus_tag LOCUS_10050 2 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 730 1455 gene locus_tag LOCUS_10060 gene trmB 730 1455 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_10060 1668 1471 gene locus_tag LOCUS_10070 1668 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1774 2388 gene locus_tag LOCUS_10080 1774 2388 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_10080 2381 3373 gene locus_tag LOCUS_10090 2381 3373 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_10090 4479 3634 gene locus_tag LOCUS_10100 4479 3634 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_10100 5114 4476 gene locus_tag LOCUS_10110 5114 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_10110 7537 5507 gene locus_tag LOCUS_10120 7537 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 8439 7597 gene locus_tag LOCUS_10130 8439 7597 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770593.1 protein_id gnl|my_center|LOCUS_10130 9350 8442 gene locus_tag LOCUS_10140 9350 8442 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence0078 524 237 gene locus_tag LOCUS_10150 524 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1489 521 gene locus_tag LOCUS_10160 1489 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3257 1479 gene locus_tag LOCUS_10170 3257 1479 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_10170 3850 3254 gene locus_tag LOCUS_10180 3850 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4165 3863 gene locus_tag LOCUS_10190 4165 3863 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_10190 4515 4168 gene locus_tag LOCUS_10200 4515 4168 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887341.1 protein_id gnl|my_center|LOCUS_10200 6530 4539 gene locus_tag LOCUS_10210 6530 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7630 6527 gene locus_tag LOCUS_10220 7630 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7955 7638 gene locus_tag LOCUS_10230 7955 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 <9383 8039 gene locus_tag LOCUS_10240 <9383 8039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436250.1:pyruvate kinase >Feature sequence0079 529 1182 gene locus_tag LOCUS_10250 529 1182 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356006.1 protein_id gnl|my_center|LOCUS_10250 1197 1895 gene locus_tag LOCUS_10260 1197 1895 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704944.1 protein_id gnl|my_center|LOCUS_10260 1907 2638 gene locus_tag LOCUS_10270 1907 2638 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009277.1 protein_id gnl|my_center|LOCUS_10270 2783 3346 gene locus_tag LOCUS_10280 gene rsmD 2783 3346 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_10280 3336 4169 gene locus_tag LOCUS_10290 3336 4169 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_10290 5163 4150 gene locus_tag LOCUS_10300 5163 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702854.1 protein_id gnl|my_center|LOCUS_10300 5456 5169 gene locus_tag LOCUS_10310 5456 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5988 5449 gene locus_tag LOCUS_10320 gene lspA 5988 5449 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_10320 6766 6014 gene locus_tag LOCUS_10330 6766 6014 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_10330 6790 8853 gene locus_tag LOCUS_10340 6790 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence0080 1030 515 gene locus_tag LOCUS_10350 1030 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2865 1234 gene locus_tag LOCUS_10360 gene groL 2865 1234 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_10360 3849 2983 gene locus_tag LOCUS_10370 3849 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10370 4547 3846 gene locus_tag LOCUS_10380 4547 3846 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_10380 4776 5054 gene locus_tag LOCUS_10390 4776 5054 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938553.1 protein_id gnl|my_center|LOCUS_10390 5417 5175 gene locus_tag LOCUS_10400 5417 5175 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994065.1 protein_id gnl|my_center|LOCUS_10400 7273 5411 gene locus_tag LOCUS_10410 7273 5411 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974668.1 protein_id gnl|my_center|LOCUS_10410 7824 7273 gene locus_tag LOCUS_10420 7824 7273 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786942.1 protein_id gnl|my_center|LOCUS_10420 7997 8467 gene locus_tag LOCUS_10430 7997 8467 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence0081 515 718 gene locus_tag LOCUS_10440 515 718 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724468.1 protein_id gnl|my_center|LOCUS_10440 3223 719 gene locus_tag LOCUS_10450 3223 719 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_10450 3585 3232 gene locus_tag LOCUS_10460 3585 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4351 4917 gene locus_tag LOCUS_10470 4351 4917 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 protein_id gnl|my_center|LOCUS_10470 6083 5010 gene locus_tag LOCUS_10480 6083 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7537 6179 gene locus_tag LOCUS_10490 7537 6179 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10490 7715 9079 gene locus_tag LOCUS_10500 7715 9079 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0082 360 133 gene locus_tag LOCUS_10510 360 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1096 365 gene locus_tag LOCUS_10520 1096 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1860 1096 gene locus_tag LOCUS_10530 1860 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2119 1847 gene locus_tag LOCUS_10540 2119 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2437 2144 gene locus_tag LOCUS_10550 2437 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2574 2434 gene locus_tag LOCUS_10560 2574 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3707 2532 gene locus_tag LOCUS_10570 3707 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4087 3704 gene locus_tag LOCUS_10580 4087 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4620 4099 gene locus_tag LOCUS_10590 4620 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5108 4617 gene locus_tag LOCUS_10600 5108 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5541 5086 gene locus_tag LOCUS_10610 5541 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6287 5538 gene locus_tag LOCUS_10620 6287 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6994 6287 gene locus_tag LOCUS_10630 6994 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7332 6991 gene locus_tag LOCUS_10640 7332 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8037 7858 gene locus_tag LOCUS_10650 8037 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8230 8018 gene locus_tag LOCUS_10660 8230 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 8413 8688 gene locus_tag LOCUS_10670 8413 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence0083 519 331 gene locus_tag LOCUS_10680 519 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 556 1209 gene locus_tag LOCUS_10690 556 1209 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339535.1 protein_id gnl|my_center|LOCUS_10690 2700 1564 gene locus_tag LOCUS_10700 2700 1564 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099990916.1 protein_id gnl|my_center|LOCUS_10700 3081 2812 gene locus_tag LOCUS_10710 3081 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3230 3144 gene locus_tag LOCUS_t00190 3230 3144 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3357 5420 gene locus_tag LOCUS_10720 3357 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6511 5417 gene locus_tag LOCUS_10730 6511 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6661 7125 gene locus_tag LOCUS_10740 6661 7125 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869875.1 protein_id gnl|my_center|LOCUS_10740 7185 8720 gene locus_tag LOCUS_10750 gene cls 7185 8720 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0084 <1 847 gene locus_tag LOCUS_10760 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868866.1:ABC transporter ATP-binding protein 1073 2821 gene locus_tag LOCUS_10770 1073 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2958 4925 gene locus_tag LOCUS_10780 2958 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4928 6982 gene locus_tag LOCUS_10790 4928 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8070 7168 gene locus_tag LOCUS_10800 8070 7168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_10800 <9032 8070 gene locus_tag LOCUS_10810 <9032 8070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682259.1:ABC transporter permease >Feature sequence0085 1118 108 gene locus_tag LOCUS_10820 1118 108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_10820 2026 1130 gene locus_tag LOCUS_10830 2026 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3065 2019 gene locus_tag LOCUS_10840 3065 2019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_10840 4120 3062 gene locus_tag LOCUS_10850 4120 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4315 5304 gene locus_tag LOCUS_10860 4315 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 7517 5523 gene locus_tag LOCUS_10870 gene tkt 7517 5523 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 protein_id gnl|my_center|LOCUS_10870 8636 7767 gene locus_tag LOCUS_10880 8636 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0086 3 614 gene locus_tag LOCUS_10890 3 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1905 580 gene locus_tag LOCUS_10900 gene murD 1905 580 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_10900 2517 4205 gene locus_tag LOCUS_10910 2517 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4368 4649 gene locus_tag LOCUS_10920 4368 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4674 5150 gene locus_tag LOCUS_10930 gene ssb 4674 5150 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_10930 5194 5487 gene locus_tag LOCUS_10940 5194 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 5491 6462 gene locus_tag LOCUS_10950 5491 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6474 7109 gene locus_tag LOCUS_10960 6474 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 7114 8499 gene locus_tag LOCUS_10970 gene dnaB 7114 8499 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence0087 3 524 gene locus_tag LOCUS_10980 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 626 1990 gene locus_tag LOCUS_10990 626 1990 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107578.1 protein_id gnl|my_center|LOCUS_10990 3280 2177 gene locus_tag LOCUS_11000 3280 2177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 protein_id gnl|my_center|LOCUS_11000 5529 3292 gene locus_tag LOCUS_11010 5529 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6690 5608 gene locus_tag LOCUS_11020 6690 5608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067486.1 protein_id gnl|my_center|LOCUS_11020 7461 6817 gene locus_tag LOCUS_11030 7461 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8770 7808 gene locus_tag LOCUS_11040 8770 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence0088 433 888 gene locus_tag LOCUS_11050 gene fabZ 433 888 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_11050 901 2112 gene locus_tag LOCUS_11060 901 2112 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_11060 2282 2593 gene locus_tag LOCUS_11070 2282 2593 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_11070 2606 2935 gene locus_tag LOCUS_11080 2606 2935 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679295.1 protein_id gnl|my_center|LOCUS_11080 3458 4117 gene locus_tag LOCUS_11090 3458 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4750 4124 gene locus_tag LOCUS_11100 4750 4124 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647883.1 protein_id gnl|my_center|LOCUS_11100 6032 4743 gene locus_tag LOCUS_11110 6032 4743 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 protein_id gnl|my_center|LOCUS_11110 7239 6124 gene locus_tag LOCUS_11120 7239 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7990 7304 gene locus_tag LOCUS_11130 7990 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 <8927 7997 gene locus_tag LOCUS_11140 <8927 7997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020479965.1:plasmid pRiA4b ORF-3 family protein >Feature sequence0089 242 754 gene locus_tag LOCUS_11150 242 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 964 1143 gene locus_tag LOCUS_11160 964 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2663 1248 gene locus_tag LOCUS_11170 2663 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4109 2673 gene locus_tag LOCUS_11180 4109 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4944 4183 gene locus_tag LOCUS_11190 4944 4183 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_11190 6222 4948 gene locus_tag LOCUS_11200 6222 4948 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677985.1 protein_id gnl|my_center|LOCUS_11200 7108 6335 gene locus_tag LOCUS_11210 7108 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 <8874 7126 gene locus_tag LOCUS_11220 <8874 7126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082809.1:sodium-translocating pyrophosphatase >Feature sequence0090 <1 613 gene locus_tag LOCUS_11230 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356610.1:cysteine synthase A 655 1077 gene locus_tag LOCUS_11240 655 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1119 1874 gene locus_tag LOCUS_11250 1119 1874 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_11250 1871 3598 gene locus_tag LOCUS_11260 1871 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4452 3595 gene locus_tag LOCUS_11270 4452 3595 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_11270 4558 5199 gene locus_tag LOCUS_11280 4558 5199 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_11280 5199 5588 gene locus_tag LOCUS_11290 5199 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6195 5563 gene locus_tag LOCUS_11300 6195 5563 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11300 7574 6309 gene locus_tag LOCUS_11310 7574 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 7901 7704 gene locus_tag LOCUS_11320 7901 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7803 8312 gene locus_tag LOCUS_11330 7803 8312 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_11330 8793 8362 gene locus_tag LOCUS_11340 8793 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence0091 <1 514 gene locus_tag LOCUS_11350 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190793.1:cysteine desulfurase family protein 492 812 gene locus_tag LOCUS_11360 492 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1026 2258 gene locus_tag LOCUS_11370 1026 2258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139310338.1 protein_id gnl|my_center|LOCUS_11370 2442 3671 gene locus_tag LOCUS_11380 2442 3671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139310338.1 protein_id gnl|my_center|LOCUS_11380 6695 3858 gene locus_tag LOCUS_11390 6695 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 7004 7681 gene locus_tag LOCUS_11400 7004 7681 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_11400 7944 7774 gene locus_tag LOCUS_11410 7944 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8391 7987 gene locus_tag LOCUS_11420 8391 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11420 8720 8388 gene locus_tag LOCUS_11430 8720 8388 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870269.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence0092 546 136 gene locus_tag LOCUS_11440 546 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1139 561 gene locus_tag LOCUS_11450 1139 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1720 1136 gene locus_tag LOCUS_11460 1720 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2327 1689 gene locus_tag LOCUS_11470 gene nadD 2327 1689 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 protein_id gnl|my_center|LOCUS_11470 3419 2337 gene locus_tag LOCUS_11480 gene obgE 3419 2337 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_11480 3714 3463 gene locus_tag LOCUS_11490 gene rpmA 3714 3463 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_11490 4041 3727 gene locus_tag LOCUS_11500 gene rplU 4041 3727 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_11500 4186 4761 gene locus_tag LOCUS_11510 4186 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6525 4762 gene locus_tag LOCUS_11520 gene argS 6525 4762 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_11520 7549 6575 gene locus_tag LOCUS_11530 7549 6575 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_11530 7621 8007 gene locus_tag LOCUS_11540 7621 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8015 8182 gene locus_tag LOCUS_11550 8015 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8179 8376 gene locus_tag LOCUS_11560 8179 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence0093 1 375 gene locus_tag LOCUS_11570 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 384 1094 gene locus_tag LOCUS_11580 384 1094 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_11580 1078 1560 gene locus_tag LOCUS_11590 1078 1560 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_11590 1571 2023 gene locus_tag LOCUS_11600 1571 2023 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_11600 2209 3240 gene locus_tag LOCUS_11610 2209 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4450 3266 gene locus_tag LOCUS_11620 4450 3266 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_11620 5144 4464 gene locus_tag LOCUS_11630 5144 4464 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948496.1 protein_id gnl|my_center|LOCUS_11630 5492 6388 gene locus_tag LOCUS_11640 5492 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6388 7662 gene locus_tag LOCUS_11650 6388 7662 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence0094 20 229 gene locus_tag LOCUS_11660 gene rpsU 20 229 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_11660 434 1327 gene locus_tag LOCUS_11670 434 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1327 2409 gene locus_tag LOCUS_11680 gene serC 1327 2409 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181767.1 protein_id gnl|my_center|LOCUS_11680 2413 2871 gene locus_tag LOCUS_11690 2413 2871 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_11690 3034 4026 gene locus_tag LOCUS_11700 3034 4026 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_11700 4029 5168 gene locus_tag LOCUS_11710 4029 5168 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 protein_id gnl|my_center|LOCUS_11710 5171 5818 gene locus_tag LOCUS_11720 5171 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 7623 5815 gene locus_tag LOCUS_11730 gene mutL 7623 5815 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439573.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0095 238 1527 gene locus_tag LOCUS_11740 238 1527 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_11740 1636 2646 gene locus_tag LOCUS_11750 1636 2646 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_11750 2752 3978 gene locus_tag LOCUS_11760 2752 3978 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_11760 3996 4367 gene locus_tag LOCUS_11770 3996 4367 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_11770 4545 4793 gene locus_tag LOCUS_11780 4545 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5454 4891 gene locus_tag LOCUS_11790 5454 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6823 5624 gene locus_tag LOCUS_11800 gene ygeW 6823 5624 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_11800 <8642 6926 gene locus_tag LOCUS_11810 <8642 6926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206817476.1:molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit >Feature sequence0096 1282 575 gene locus_tag LOCUS_11820 gene deoD 1282 575 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_11820 1394 3739 gene locus_tag LOCUS_11830 1394 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3754 3963 gene locus_tag LOCUS_11840 3754 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4617 4330 gene locus_tag LOCUS_11850 4617 4330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640927.1 protein_id gnl|my_center|LOCUS_11850 6334 4661 gene locus_tag LOCUS_11860 gene recN 6334 4661 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_11860 7190 6327 gene locus_tag LOCUS_11870 7190 6327 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_11870 8231 7200 gene locus_tag LOCUS_11880 8231 7200 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence0097 1353 67 gene locus_tag LOCUS_11890 1353 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2375 1350 gene locus_tag LOCUS_11900 gene purM 2375 1350 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_11900 3816 2362 gene locus_tag LOCUS_11910 gene purF 3816 2362 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_11910 4529 3816 gene locus_tag LOCUS_11920 4529 3816 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817239.1 protein_id gnl|my_center|LOCUS_11920 5047 4556 gene locus_tag LOCUS_11930 gene purE 5047 4556 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_11930 5644 5228 gene locus_tag LOCUS_11940 5644 5228 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_11940 7272 5662 gene locus_tag LOCUS_11950 7272 5662 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_11950 7372 7563 gene locus_tag LOCUS_11960 7372 7563 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_11960 8525 7557 gene locus_tag LOCUS_11970 gene amrS 8525 7557 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence0098 1070 102 gene locus_tag LOCUS_11980 1070 102 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_11980 1863 1120 gene locus_tag LOCUS_11990 1863 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2537 1866 gene locus_tag LOCUS_12000 2537 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3304 2534 gene locus_tag LOCUS_12010 3304 2534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_12010 4277 3297 gene locus_tag LOCUS_12020 4277 3297 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_12020 5149 4274 gene locus_tag LOCUS_12030 5149 4274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_12030 5405 5890 gene locus_tag LOCUS_12040 gene rnhA 5405 5890 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015471.1 protein_id gnl|my_center|LOCUS_12040 5887 6441 gene locus_tag LOCUS_12050 5887 6441 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_12050 6438 6983 gene locus_tag LOCUS_12060 6438 6983 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_12060 7527 6949 gene locus_tag LOCUS_12070 7527 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 <8505 7527 gene locus_tag LOCUS_12080 <8505 7527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671073.1:uracil phosphoribosyltransferase >Feature sequence0099 63 989 gene locus_tag LOCUS_12090 gene ispG 63 989 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12090 979 3813 gene locus_tag LOCUS_12100 gene uvrA 979 3813 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_12100 3908 6946 gene locus_tag LOCUS_12110 3908 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6955 7944 gene locus_tag LOCUS_12120 6955 7944 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0100 1346 324 gene locus_tag LOCUS_12130 1346 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2704 1343 gene locus_tag LOCUS_12140 2704 1343 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_12140 3591 2758 gene locus_tag LOCUS_12150 3591 2758 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973683.1 protein_id gnl|my_center|LOCUS_12150 4483 3581 gene locus_tag LOCUS_12160 4483 3581 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 protein_id gnl|my_center|LOCUS_12160 5815 4517 gene locus_tag LOCUS_12170 5815 4517 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973685.1 protein_id gnl|my_center|LOCUS_12170 5968 6153 gene locus_tag LOCUS_12180 5968 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7611 6172 gene locus_tag LOCUS_12190 7611 6172 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_12190 <8186 7608 gene locus_tag LOCUS_12200 <8186 7608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210046.1:ABC transporter permease >Feature sequence0101 1073 600 gene locus_tag LOCUS_12210 1073 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1489 1115 gene locus_tag LOCUS_12220 1489 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1625 3379 gene locus_tag LOCUS_12230 1625 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3638 3348 gene locus_tag LOCUS_12240 3638 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4588 3635 gene locus_tag LOCUS_12250 4588 3635 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800998.1 protein_id gnl|my_center|LOCUS_12250 5334 4585 gene locus_tag LOCUS_12260 5334 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6232 5423 gene locus_tag LOCUS_12270 6232 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 6432 7529 gene locus_tag LOCUS_12280 6432 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <8166 7495 gene locus_tag LOCUS_12290 <8166 7495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390018.1:nucleoside-diphosphate kinase >Feature sequence0102 <1 862 gene locus_tag LOCUS_12300 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002657321.1:cytidine deaminase 862 2136 gene locus_tag LOCUS_12310 862 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2138 2665 gene locus_tag LOCUS_12320 2138 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2672 3217 gene locus_tag LOCUS_12330 2672 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3660 3214 gene locus_tag LOCUS_12340 gene rpiB 3660 3214 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_12340 3773 5407 gene locus_tag LOCUS_12350 3773 5407 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_12350 7432 5408 gene locus_tag LOCUS_12360 7432 5408 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_12360 <8077 7417 gene locus_tag LOCUS_12370 <8077 7417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680454.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence0103 2116 767 gene locus_tag LOCUS_12380 2116 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3752 2472 gene locus_tag LOCUS_12390 3752 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5368 3749 gene locus_tag LOCUS_12400 5368 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6224 5583 gene locus_tag LOCUS_12410 6224 5583 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_12410 7742 6555 gene locus_tag LOCUS_12420 7742 6555 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0104 1366 491 gene locus_tag LOCUS_12430 1366 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3021 1366 gene locus_tag LOCUS_12440 3021 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3659 3021 gene locus_tag LOCUS_12450 3659 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3861 3718 gene locus_tag LOCUS_12460 3861 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4370 3918 gene locus_tag LOCUS_12470 4370 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5415 4381 gene locus_tag LOCUS_12480 5415 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6173 5430 gene locus_tag LOCUS_12490 6173 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6493 6191 gene locus_tag LOCUS_12500 6493 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <7986 6493 gene locus_tag LOCUS_12510 <7986 6493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956899.1:portal protein >Feature sequence0105 462 746 gene locus_tag LOCUS_12520 462 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1911 772 gene locus_tag LOCUS_12530 1911 772 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530689.1 protein_id gnl|my_center|LOCUS_12530 2832 1984 gene locus_tag LOCUS_12540 2832 1984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775424.1 protein_id gnl|my_center|LOCUS_12540 3651 2836 gene locus_tag LOCUS_12550 3651 2836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971601.1 protein_id gnl|my_center|LOCUS_12550 4039 4527 gene locus_tag LOCUS_12560 4039 4527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_12560 4506 5474 gene locus_tag LOCUS_12570 4506 5474 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 protein_id gnl|my_center|LOCUS_12570 5779 6897 gene locus_tag LOCUS_12580 5779 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7957 7247 gene locus_tag LOCUS_12590 7957 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence0106 <1 771 gene locus_tag LOCUS_12600 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393607.1:carbamate kinase 782 1324 gene locus_tag LOCUS_12610 782 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2494 1280 gene locus_tag LOCUS_12620 2494 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2660 3409 gene locus_tag LOCUS_12630 2660 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3444 5609 gene locus_tag LOCUS_12640 gene recJ 3444 5609 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_12640 5806 7095 gene locus_tag LOCUS_12650 5806 7095 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_12650 7095 7805 gene locus_tag LOCUS_12660 7095 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence0107 <1 1950 gene locus_tag LOCUS_12670 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000380861.1:sulfoquinovosidase 2998 1943 gene locus_tag LOCUS_12680 2998 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3056 3475 gene locus_tag LOCUS_12690 3056 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3468 4151 gene locus_tag LOCUS_12700 3468 4151 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_12700 5030 4107 gene locus_tag LOCUS_12710 5030 4107 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_12710 6656 5049 gene locus_tag LOCUS_12720 6656 5049 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_12720 7378 6653 gene locus_tag LOCUS_12730 7378 6653 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_12730 <7894 7380 gene locus_tag LOCUS_12740 <7894 7380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082566.1:mannonate dehydratase >Feature sequence0108 <1 601 gene locus_tag LOCUS_12750 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082991.1:galactose mutarotase 707 1735 gene locus_tag LOCUS_12760 707 1735 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_12760 1860 3761 gene locus_tag LOCUS_12770 1860 3761 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_12770 3922 6354 gene locus_tag LOCUS_12780 3922 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6390 7532 gene locus_tag LOCUS_12790 6390 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0109 1039 728 gene locus_tag LOCUS_12800 1039 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1752 1036 gene locus_tag LOCUS_12810 1752 1036 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_12810 1827 2591 gene locus_tag LOCUS_12820 1827 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3718 2708 gene locus_tag LOCUS_12830 3718 2708 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_12830 4735 3767 gene locus_tag LOCUS_12840 4735 3767 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_12840 5236 4841 gene locus_tag LOCUS_12850 5236 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5449 6213 gene locus_tag LOCUS_12860 5449 6213 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_12860 6213 6851 gene locus_tag LOCUS_12870 gene plsY 6213 6851 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0110 625 80 gene locus_tag LOCUS_12880 625 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1478 690 gene locus_tag LOCUS_12890 1478 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1703 2959 gene locus_tag LOCUS_12900 1703 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3421 3047 gene locus_tag LOCUS_12910 3421 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4062 3421 gene locus_tag LOCUS_12920 4062 3421 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_12920 4269 5132 gene locus_tag LOCUS_12930 4269 5132 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_12930 6037 5129 gene locus_tag LOCUS_12940 6037 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6759 6103 gene locus_tag LOCUS_12950 6759 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7028 7645 gene locus_tag LOCUS_12960 7028 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence0111 298 765 gene locus_tag LOCUS_12970 gene ybaK 298 765 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_12970 1649 762 gene locus_tag LOCUS_12980 1649 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2962 1652 gene locus_tag LOCUS_12990 2962 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4082 2964 gene locus_tag LOCUS_13000 gene gcvT 4082 2964 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_13000 4499 4104 gene locus_tag LOCUS_13010 4499 4104 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_13010 5385 4606 gene locus_tag LOCUS_13020 5385 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6220 5576 gene locus_tag LOCUS_13030 6220 5576 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_13030 7011 6217 gene locus_tag LOCUS_13040 7011 6217 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_13040 7598 7008 gene locus_tag LOCUS_13050 7598 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0112 >Feature sequence0113 <1 1182 gene locus_tag LOCUS_13060 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933516.1:methionine synthase 1187 2140 gene locus_tag LOCUS_13070 gene metF 1187 2140 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_13070 2164 2583 gene locus_tag LOCUS_13080 2164 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3237 2575 gene locus_tag LOCUS_13090 3237 2575 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_13090 3316 5226 gene locus_tag LOCUS_13100 3316 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5228 5761 gene locus_tag LOCUS_13110 5228 5761 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_13110 5974 7503 gene locus_tag LOCUS_13120 5974 7503 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence0114 2980 2450 gene locus_tag LOCUS_13130 gene pth 2980 2450 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_13130 3017 3325 gene locus_tag LOCUS_13140 3017 3325 CDS product NIF3 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_13140 3334 4494 gene locus_tag LOCUS_13150 3334 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4491 4904 gene locus_tag LOCUS_13160 4491 4904 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140937.1 protein_id gnl|my_center|LOCUS_13160 4908 5696 gene locus_tag LOCUS_13170 4908 5696 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence0115 421 38 gene locus_tag LOCUS_13180 421 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 549 1400 gene locus_tag LOCUS_13190 549 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1839 1372 gene locus_tag LOCUS_13200 1839 1372 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_13200 2647 1931 gene locus_tag LOCUS_13210 2647 1931 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582999.1 protein_id gnl|my_center|LOCUS_13210 3836 2640 gene locus_tag LOCUS_13220 3836 2640 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793088.1 protein_id gnl|my_center|LOCUS_13220 3835 5139 gene locus_tag LOCUS_13230 3835 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5212 5997 gene locus_tag LOCUS_13240 5212 5997 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459817.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence0116 2262 1375 gene locus_tag LOCUS_13250 2262 1375 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_13250 3179 2271 gene locus_tag LOCUS_13260 3179 2271 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_13260 4820 3243 gene locus_tag LOCUS_13270 4820 3243 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_13270 5965 4904 gene locus_tag LOCUS_13280 5965 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 <7555 5992 gene locus_tag LOCUS_13290 <7555 5992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000831067.1:sensor histidine kinase >Feature sequence0117 584 1564 gene locus_tag LOCUS_13300 584 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1687 1863 gene locus_tag LOCUS_13310 1687 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1958 3424 gene locus_tag LOCUS_13320 gene murC 1958 3424 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656222.1 protein_id gnl|my_center|LOCUS_13320 3424 4293 gene locus_tag LOCUS_13330 3424 4293 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_13330 4303 4821 gene locus_tag LOCUS_13340 4303 4821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_13340 4833 5321 gene locus_tag LOCUS_13350 4833 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5392 5595 gene locus_tag LOCUS_13360 5392 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5561 6505 gene locus_tag LOCUS_13370 gene miaA 5561 6505 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence0118 651 1625 gene locus_tag LOCUS_13380 651 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2061 3191 gene locus_tag LOCUS_13390 2061 3191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_13390 3200 4120 gene locus_tag LOCUS_13400 3200 4120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_13400 4117 4920 gene locus_tag LOCUS_13410 4117 4920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_13410 4956 6014 gene locus_tag LOCUS_13420 4956 6014 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0119 257 445 gene locus_tag LOCUS_13430 257 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 433 771 gene locus_tag LOCUS_13440 433 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 728 874 gene locus_tag LOCUS_13450 728 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 867 1034 gene locus_tag LOCUS_13460 867 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1795 1226 gene locus_tag LOCUS_13470 1795 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2015 1830 gene locus_tag LOCUS_13480 2015 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2323 2012 gene locus_tag LOCUS_13490 2323 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2694 2335 gene locus_tag LOCUS_13500 2694 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4442 2691 gene locus_tag LOCUS_13510 4442 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4974 4597 gene locus_tag LOCUS_13520 4974 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7392 5002 gene locus_tag LOCUS_13530 7392 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence0120 343 1305 gene locus_tag LOCUS_13540 343 1305 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793088.1 protein_id gnl|my_center|LOCUS_13540 1532 2842 gene locus_tag LOCUS_13550 1532 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2845 3786 gene locus_tag LOCUS_13560 2845 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3798 6962 gene locus_tag LOCUS_13570 3798 6962 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_13570 6959 7231 gene locus_tag LOCUS_13580 6959 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656352.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0121 <1 966 gene locus_tag LOCUS_13590 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679362.1:s-methyl-5-thioribose-1-phosphate isomerase 963 1673 gene locus_tag LOCUS_13600 gene mtnP 963 1673 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460452.1 protein_id gnl|my_center|LOCUS_13600 1676 2197 gene locus_tag LOCUS_13610 1676 2197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965861.1 protein_id gnl|my_center|LOCUS_13610 3114 2161 gene locus_tag LOCUS_13620 gene metA 3114 2161 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_13620 4406 3105 gene locus_tag LOCUS_13630 4406 3105 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_13630 5609 5361 gene locus_tag LOCUS_13640 5609 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5514 6254 gene locus_tag LOCUS_13650 5514 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 7313 6696 gene locus_tag LOCUS_13660 7313 6696 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0122 1331 1894 gene locus_tag LOCUS_13670 1331 1894 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323418.1 protein_id gnl|my_center|LOCUS_13670 3228 1966 gene locus_tag LOCUS_13680 3228 1966 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656686.1 protein_id gnl|my_center|LOCUS_13680 4497 3310 gene locus_tag LOCUS_13690 4497 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5330 4494 gene locus_tag LOCUS_13700 5330 4494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_13700 5515 6405 gene locus_tag LOCUS_13710 5515 6405 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_13710 <7299 6458 gene locus_tag LOCUS_13720 <7299 6458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081315.1:magnesium/cobalt transporter CorA >Feature sequence0123 249 953 gene locus_tag LOCUS_13730 249 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 925 1737 gene locus_tag LOCUS_13740 925 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1748 3001 gene locus_tag LOCUS_13750 1748 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3218 4243 gene locus_tag LOCUS_13760 3218 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence0124 353 997 gene locus_tag LOCUS_13770 353 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1648 1025 gene locus_tag LOCUS_13780 1648 1025 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657101.1 protein_id gnl|my_center|LOCUS_13780 2422 1664 gene locus_tag LOCUS_13790 gene map 2422 1664 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_13790 2861 2400 gene locus_tag LOCUS_13800 gene nusB 2861 2400 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889684.1 protein_id gnl|my_center|LOCUS_13800 3910 2864 gene locus_tag LOCUS_13810 3910 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4382 3969 gene locus_tag LOCUS_13820 4382 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4807 4457 gene locus_tag LOCUS_13830 4807 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5578 4826 gene locus_tag LOCUS_13840 gene tpiA 5578 4826 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_13840 6758 5580 gene locus_tag LOCUS_13850 6758 5580 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255334.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0125 499 2478 gene locus_tag LOCUS_13860 499 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2586 3932 gene locus_tag LOCUS_13870 2586 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388159.1 protein_id gnl|my_center|LOCUS_13870 4112 5083 gene locus_tag LOCUS_13880 4112 5083 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_13880 5865 5080 gene locus_tag LOCUS_13890 5865 5080 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0126 1244 771 gene locus_tag LOCUS_13900 1244 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1346 2053 gene locus_tag LOCUS_13910 1346 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2056 3084 gene locus_tag LOCUS_13920 2056 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3089 7060 gene locus_tag LOCUS_13930 3089 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0127 2052 2510 gene locus_tag LOCUS_13940 2052 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2520 3857 gene locus_tag LOCUS_13950 2520 3857 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_13950 3889 4881 gene locus_tag LOCUS_13960 gene galE 3889 4881 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_13960 5060 4986 gene locus_tag LOCUS_t00200 5060 4986 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <7224 5181 gene locus_tag LOCUS_13970 <7224 5181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903241.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence0128 2757 826 gene locus_tag LOCUS_13980 gene speA 2757 826 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_13980 3319 2960 gene locus_tag LOCUS_13990 3319 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3618 4442 gene locus_tag LOCUS_14000 3618 4442 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 protein_id gnl|my_center|LOCUS_14000 5046 4510 gene locus_tag LOCUS_14010 5046 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5199 6224 gene locus_tag LOCUS_14020 5199 6224 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_14020 6248 6427 gene locus_tag LOCUS_14030 6248 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7157 6570 gene locus_tag LOCUS_14040 7157 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence0129 800 243 gene locus_tag LOCUS_14050 gene hpt 800 243 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_14050 991 1506 gene locus_tag LOCUS_14060 991 1506 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14060 1590 3602 gene locus_tag LOCUS_14070 1590 3602 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_14070 3667 5202 gene locus_tag LOCUS_14080 3667 5202 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_14080 5202 6899 gene locus_tag LOCUS_14090 gene pheT 5202 6899 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence0130 2483 648 gene locus_tag LOCUS_14100 gene typA 2483 648 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_14100 3725 2538 gene locus_tag LOCUS_14110 3725 2538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994132.1 protein_id gnl|my_center|LOCUS_14110 4417 4001 gene locus_tag LOCUS_14120 4417 4001 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_14120 4725 4414 gene locus_tag LOCUS_14130 4725 4414 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_14130 5756 4746 gene locus_tag LOCUS_14140 5756 4746 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_14140 6040 5741 gene locus_tag LOCUS_14150 6040 5741 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 protein_id gnl|my_center|LOCUS_14150 <7199 6327 gene locus_tag LOCUS_14160 <7199 6327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000260509.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence0131 3 1148 gene locus_tag LOCUS_14170 3 1148 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_14170 1145 2338 gene locus_tag LOCUS_14180 gene thiI 1145 2338 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_14180 2440 5364 gene locus_tag LOCUS_14190 2440 5364 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_14190 5364 6644 gene locus_tag LOCUS_14200 5364 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 >Feature sequence0132 222 401 gene locus_tag LOCUS_14210 222 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 710 2224 gene locus_tag LOCUS_14220 710 2224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257246.1 protein_id gnl|my_center|LOCUS_14220 2939 4450 gene locus_tag LOCUS_14230 2939 4450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257246.1 protein_id gnl|my_center|LOCUS_14230 4447 5415 gene locus_tag LOCUS_14240 4447 5415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095091852.1 protein_id gnl|my_center|LOCUS_14240 5415 6245 gene locus_tag LOCUS_14250 5415 6245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence0133 1860 136 gene locus_tag LOCUS_14260 1860 136 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_14260 2941 1865 gene locus_tag LOCUS_14270 2941 1865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_14270 4049 3021 gene locus_tag LOCUS_14280 4049 3021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976081.1 protein_id gnl|my_center|LOCUS_14280 6346 4142 gene locus_tag LOCUS_14290 6346 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 6554 6889 gene locus_tag LOCUS_14300 6554 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0134 13 339 gene locus_tag LOCUS_14310 13 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1040 462 gene locus_tag LOCUS_14320 1040 462 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_14320 1327 1037 gene locus_tag LOCUS_14330 1327 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1554 2624 gene locus_tag LOCUS_14340 1554 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3764 2841 gene locus_tag LOCUS_14350 3764 2841 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_14350 4966 3791 gene locus_tag LOCUS_14360 4966 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5661 4963 gene locus_tag LOCUS_14370 5661 4963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_14370 6811 5645 gene locus_tag LOCUS_14380 6811 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence0135 <1 1097 gene locus_tag LOCUS_14390 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257157.1:ABC transporter substrate-binding protein 1081 2025 gene locus_tag LOCUS_14400 1081 2025 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14400 2374 2742 gene locus_tag LOCUS_14410 2374 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3775 2828 gene locus_tag LOCUS_14420 3775 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4500 3772 gene locus_tag LOCUS_14430 4500 3772 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_14430 5407 4511 gene locus_tag LOCUS_14440 5407 4511 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_14440 6299 5397 gene locus_tag LOCUS_14450 6299 5397 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_14450 <6912 6376 gene locus_tag LOCUS_14460 <6912 6376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929215.1:ABC transporter substrate-binding protein >Feature sequence0136 1861 734 gene locus_tag LOCUS_14470 1861 734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_14470 2550 2350 gene locus_tag LOCUS_14480 2550 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2920 2534 gene locus_tag LOCUS_14490 2920 2534 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_14490 3698 2910 gene locus_tag LOCUS_14500 3698 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4600 3695 gene locus_tag LOCUS_14510 4600 3695 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_14510 4915 6276 gene locus_tag LOCUS_14520 4915 6276 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0137 23 757 gene locus_tag LOCUS_14530 23 757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 protein_id gnl|my_center|LOCUS_14530 747 1568 gene locus_tag LOCUS_14540 747 1568 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_14540 1582 2493 gene locus_tag LOCUS_14550 1582 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2546 3745 gene locus_tag LOCUS_14560 2546 3745 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068797.1 protein_id gnl|my_center|LOCUS_14560 3929 4924 gene locus_tag LOCUS_14570 3929 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5021 5272 gene locus_tag LOCUS_14580 5021 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5269 5814 gene locus_tag LOCUS_14590 5269 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence0138 831 115 gene locus_tag LOCUS_14600 831 115 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945278.1 protein_id gnl|my_center|LOCUS_14600 2309 843 gene locus_tag LOCUS_14610 gene xylB 2309 843 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_14610 3073 2306 gene locus_tag LOCUS_14620 gene hpaI 3073 2306 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 protein_id gnl|my_center|LOCUS_14620 4389 3097 gene locus_tag LOCUS_14630 4389 3097 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_14630 4916 4389 gene locus_tag LOCUS_14640 4916 4389 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 protein_id gnl|my_center|LOCUS_14640 5992 4991 gene locus_tag LOCUS_14650 5992 4991 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392308.1 protein_id gnl|my_center|LOCUS_14650 <6846 6347 gene locus_tag LOCUS_14660 <6846 6347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000813985.1:argininosuccinate lyase >Feature sequence0139 1071 715 gene locus_tag LOCUS_14670 1071 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 973 2052 gene locus_tag LOCUS_14680 973 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2053 2523 gene locus_tag LOCUS_14690 gene smpB 2053 2523 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_14690 2989 2753 gene locus_tag LOCUS_14700 2989 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3300 2944 gene locus_tag LOCUS_14710 3300 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4238 5452 gene locus_tag LOCUS_14720 4238 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 <6841 5449 gene locus_tag LOCUS_14730 <6841 5449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814441.1:excinuclease ABC subunit UvrA >Feature sequence0140 1019 111 gene locus_tag LOCUS_14740 1019 111 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_14740 2140 1016 gene locus_tag LOCUS_14750 2140 1016 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894435.1 protein_id gnl|my_center|LOCUS_14750 3006 2164 gene locus_tag LOCUS_14760 3006 2164 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898776.1 protein_id gnl|my_center|LOCUS_14760 3896 3003 gene locus_tag LOCUS_14770 3896 3003 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_14770 5273 3936 gene locus_tag LOCUS_14780 5273 3936 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_14780 6397 5429 gene locus_tag LOCUS_14790 6397 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0141 257 736 gene locus_tag LOCUS_14800 257 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1835 891 gene locus_tag LOCUS_14810 1835 891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168154.1 protein_id gnl|my_center|LOCUS_14810 3272 1899 gene locus_tag LOCUS_14820 3272 1899 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456667.1 protein_id gnl|my_center|LOCUS_14820 3651 4835 gene locus_tag LOCUS_14830 3651 4835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210801.1 protein_id gnl|my_center|LOCUS_14830 4828 5994 gene locus_tag LOCUS_14840 gene osmV 4828 5994 CDS product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 protein_id gnl|my_center|LOCUS_14840 5963 6745 gene locus_tag LOCUS_14850 5963 6745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889398.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0142 251 1273 gene locus_tag LOCUS_14860 251 1273 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_14860 1286 2296 gene locus_tag LOCUS_14870 1286 2296 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040464.1 protein_id gnl|my_center|LOCUS_14870 2367 2861 gene locus_tag LOCUS_14880 2367 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2874 4364 gene locus_tag LOCUS_14890 2874 4364 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_14890 4361 5512 gene locus_tag LOCUS_14900 4361 5512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_14900 5518 6615 gene locus_tag LOCUS_14910 5518 6615 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence0143 290 1219 gene locus_tag LOCUS_14920 290 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2352 1252 gene locus_tag LOCUS_14930 2352 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_14930 2532 2966 gene locus_tag LOCUS_14940 2532 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3145 3072 gene locus_tag LOCUS_t00210 3145 3072 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3328 4902 gene locus_tag LOCUS_14950 3328 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5012 6091 gene locus_tag LOCUS_14960 5012 6091 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0144 179 358 gene locus_tag LOCUS_14970 179 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 355 717 gene locus_tag LOCUS_14980 355 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 714 1055 gene locus_tag LOCUS_14990 714 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1052 1201 gene locus_tag LOCUS_15000 1052 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1198 1389 gene locus_tag LOCUS_15010 1198 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1399 1581 gene locus_tag LOCUS_15020 1399 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1687 2052 gene locus_tag LOCUS_15030 1687 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2062 2379 gene locus_tag LOCUS_15040 2062 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2357 2572 gene locus_tag LOCUS_15050 2357 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2569 2790 gene locus_tag LOCUS_15060 2569 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2780 2941 gene locus_tag LOCUS_15070 2780 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2938 3168 gene locus_tag LOCUS_15080 2938 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3169 3336 gene locus_tag LOCUS_15090 3169 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3315 3581 gene locus_tag LOCUS_15100 3315 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3560 3898 gene locus_tag LOCUS_15110 3560 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4239 4856 gene locus_tag LOCUS_15120 gene thyX 4239 4856 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_15120 4837 5361 gene locus_tag LOCUS_15130 4837 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5361 5798 gene locus_tag LOCUS_15140 gene dut 5361 5798 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_15140 5801 6286 gene locus_tag LOCUS_15150 5801 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0145 66 1001 gene locus_tag LOCUS_15160 66 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2441 2737 gene locus_tag LOCUS_15170 2441 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2734 3348 gene locus_tag LOCUS_15180 2734 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3345 3878 gene locus_tag LOCUS_15190 3345 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3905 4198 gene locus_tag LOCUS_15200 3905 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5133 4243 gene locus_tag LOCUS_15210 gene speB 5133 4243 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_15210 6285 5143 gene locus_tag LOCUS_15220 gene nspC 6285 5143 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0146 988 134 gene locus_tag LOCUS_15230 988 134 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_15230 1887 985 gene locus_tag LOCUS_15240 1887 985 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_15240 3257 1911 gene locus_tag LOCUS_15250 3257 1911 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_15250 5232 3304 gene locus_tag LOCUS_15260 5232 3304 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 protein_id gnl|my_center|LOCUS_15260 5520 6557 gene locus_tag LOCUS_15270 gene ccpA 5520 6557 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0147 822 268 gene locus_tag LOCUS_15280 822 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1529 834 gene locus_tag LOCUS_15290 1529 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2201 1611 gene locus_tag LOCUS_15300 2201 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3257 2226 gene locus_tag LOCUS_15310 3257 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3883 3275 gene locus_tag LOCUS_15320 gene lpoB 3883 3275 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_15320 4207 5520 gene locus_tag LOCUS_15330 4207 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5723 5571 gene locus_tag LOCUS_15340 5723 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0148 124 1179 gene locus_tag LOCUS_15350 124 1179 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463707.1 protein_id gnl|my_center|LOCUS_15350 1176 2336 gene locus_tag LOCUS_15360 1176 2336 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_15360 2347 3177 gene locus_tag LOCUS_15370 2347 3177 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_15370 3168 4325 gene locus_tag LOCUS_15380 gene nagA 3168 4325 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_15380 4322 5479 gene locus_tag LOCUS_15390 gene fba 4322 5479 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_15390 5479 6339 gene locus_tag LOCUS_15400 5479 6339 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944134.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence0149 1220 453 gene locus_tag LOCUS_15410 1220 453 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_15410 1359 1210 gene locus_tag LOCUS_15420 1359 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1427 1972 gene locus_tag LOCUS_15430 1427 1972 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_15430 1985 2704 gene locus_tag LOCUS_15440 1985 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3375 2701 gene locus_tag LOCUS_15450 3375 2701 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_15450 4258 3518 gene locus_tag LOCUS_15460 4258 3518 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_15460 5111 4251 gene locus_tag LOCUS_15470 5111 4251 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_15470 6092 5304 gene locus_tag LOCUS_15480 6092 5304 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence0150 1930 746 gene locus_tag LOCUS_15490 1930 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2530 1940 gene locus_tag LOCUS_15500 2530 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2728 3612 gene locus_tag LOCUS_15510 gene folD 2728 3612 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_15510 3609 4904 gene locus_tag LOCUS_15520 gene miaB 3609 4904 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_15520 4957 5766 gene locus_tag LOCUS_15530 4957 5766 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0151 517 4491 gene locus_tag LOCUS_15540 517 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4523 5584 gene locus_tag LOCUS_15550 4523 5584 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073726.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence0152 163 417 gene locus_tag LOCUS_15560 163 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 430 648 gene locus_tag LOCUS_15570 430 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 645 935 gene locus_tag LOCUS_15580 645 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 955 1161 gene locus_tag LOCUS_15590 955 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1198 1638 gene locus_tag LOCUS_15600 1198 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1635 2117 gene locus_tag LOCUS_15610 1635 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2212 3141 gene locus_tag LOCUS_15620 gene dcm 2212 3141 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734158.1 protein_id gnl|my_center|LOCUS_15620 3941 3195 gene locus_tag LOCUS_15630 3941 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4139 4318 gene locus_tag LOCUS_15640 4139 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4469 6070 gene locus_tag LOCUS_15650 4469 6070 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence0153 545 2899 gene locus_tag LOCUS_15660 545 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2896 3657 gene locus_tag LOCUS_15670 2896 3657 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_15670 3657 4880 gene locus_tag LOCUS_15680 3657 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4918 5835 gene locus_tag LOCUS_15690 4918 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6215 5832 gene locus_tag LOCUS_15700 6215 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0154 1429 530 gene locus_tag LOCUS_15710 1429 530 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_15710 2788 1493 gene locus_tag LOCUS_15720 2788 1493 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_15720 3012 3206 gene locus_tag LOCUS_15730 3012 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3263 3943 gene locus_tag LOCUS_15740 3263 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3945 5420 gene locus_tag LOCUS_15750 gene crtI 3945 5420 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_15750 5420 6112 gene locus_tag LOCUS_15760 5420 6112 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0155 406 816 gene locus_tag LOCUS_15770 406 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556699.1 protein_id gnl|my_center|LOCUS_15770 1979 1137 gene locus_tag LOCUS_15780 1979 1137 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792714.1 protein_id gnl|my_center|LOCUS_15780 2047 3984 gene locus_tag LOCUS_15790 2047 3984 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_15790 4384 3959 gene locus_tag LOCUS_15800 4384 3959 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_15800 5720 4452 gene locus_tag LOCUS_15810 5720 4452 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_15810 6436 5777 gene locus_tag LOCUS_15820 6436 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence0156 <1 844 gene locus_tag LOCUS_15830 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086363.1:GntP family permease 918 1574 gene locus_tag LOCUS_15840 918 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2190 1585 gene locus_tag LOCUS_15850 2190 1585 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_15850 3455 2499 gene locus_tag LOCUS_15860 3455 2499 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_15860 3947 4585 gene locus_tag LOCUS_15870 3947 4585 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_15870 5667 4582 gene locus_tag LOCUS_15880 5667 4582 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_15880 5841 6353 gene locus_tag LOCUS_15890 5841 6353 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence0157 1865 1140 gene locus_tag LOCUS_15900 1865 1140 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_15900 5364 1942 gene locus_tag LOCUS_15910 5364 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 <6468 5584 gene locus_tag LOCUS_15920 <6468 5584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933733.1:FAD-dependent oxidoreductase >Feature sequence0158 307 2 gene locus_tag LOCUS_15930 gene yhbY 307 2 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417663.1 protein_id gnl|my_center|LOCUS_15930 2236 485 gene locus_tag LOCUS_15940 2236 485 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_15940 2495 2668 gene locus_tag LOCUS_15950 2495 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2809 3021 gene locus_tag LOCUS_15960 2809 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3018 3956 gene locus_tag LOCUS_15970 3018 3956 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_15970 4810 4076 gene locus_tag LOCUS_15980 4810 4076 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 protein_id gnl|my_center|LOCUS_15980 5923 4898 gene locus_tag LOCUS_15990 5923 4898 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_15990 6456 5950 gene locus_tag LOCUS_16000 6456 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence0159 <1 1219 gene locus_tag LOCUS_16010 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948690.1:FAD-binding oxidoreductase 1322 5551 gene locus_tag LOCUS_16020 1322 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6178 5789 gene locus_tag LOCUS_16030 6178 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0160 <1 849 gene locus_tag LOCUS_16040 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288004.1:response regulator 846 2609 gene locus_tag LOCUS_16050 846 2609 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_16050 2606 3553 gene locus_tag LOCUS_16060 2606 3553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_16060 3800 3645 gene locus_tag LOCUS_16070 3800 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4941 3922 gene locus_tag LOCUS_16080 gene mglC 4941 3922 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_16080 <6426 4951 gene locus_tag LOCUS_16090 <6426 4951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903113.1:galactose/methyl galactoside ABC transporter ATP-binding protein MglA >Feature sequence0161 218 1564 gene locus_tag LOCUS_16100 218 1564 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_16100 1589 2962 gene locus_tag LOCUS_16110 1589 2962 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 protein_id gnl|my_center|LOCUS_16110 3041 3113 gene locus_tag LOCUS_t00220 3041 3113 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3146 3219 gene locus_tag LOCUS_t00230 3146 3219 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4795 3581 gene locus_tag LOCUS_16120 4795 3581 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_16120 5008 6075 gene locus_tag LOCUS_16130 5008 6075 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_16130 6358 6191 gene locus_tag LOCUS_16140 6358 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0162 3274 2876 gene locus_tag LOCUS_16150 3274 2876 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_16150 3339 4832 gene locus_tag LOCUS_16160 gene gtfA 3339 4832 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_16160 4892 5827 gene locus_tag LOCUS_16170 4892 5827 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_16170 6282 5818 gene locus_tag LOCUS_16180 6282 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence0163 314 1840 gene locus_tag LOCUS_16190 314 1840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_16190 1824 2888 gene locus_tag LOCUS_16200 1824 2888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_16200 2881 3759 gene locus_tag LOCUS_16210 2881 3759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_16210 3763 5952 gene locus_tag LOCUS_16220 3763 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6119 6310 gene locus_tag LOCUS_16230 6119 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0164 179 1411 gene locus_tag LOCUS_16240 gene ftsZ 179 1411 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_16240 1414 2310 gene locus_tag LOCUS_16250 1414 2310 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_16250 2310 3062 gene locus_tag LOCUS_16260 2310 3062 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_16260 3096 3989 gene locus_tag LOCUS_16270 3096 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4006 4884 gene locus_tag LOCUS_16280 gene xerC 4006 4884 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_16280 4877 5413 gene locus_tag LOCUS_16290 gene hslV 4877 5413 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence0165 4058 2820 gene locus_tag LOCUS_16300 4058 2820 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_16300 4308 4670 gene locus_tag LOCUS_16310 4308 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 4651 5076 gene locus_tag LOCUS_16320 4651 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5842 5087 gene locus_tag LOCUS_16330 5842 5087 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213632.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0166 1558 770 gene locus_tag LOCUS_16340 1558 770 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 protein_id gnl|my_center|LOCUS_16340 2542 1580 gene locus_tag LOCUS_16350 2542 1580 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_16350 3823 2696 gene locus_tag LOCUS_16360 3823 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5168 3789 gene locus_tag LOCUS_16370 5168 3789 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_16370 <6344 5168 gene locus_tag LOCUS_16380 <6344 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582707.1:tripartite tricarboxylate transporter permease >Feature sequence0167 <1 648 gene locus_tag LOCUS_16390 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694011.1:peptidase T 648 1610 gene locus_tag LOCUS_16400 648 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1715 3016 gene locus_tag LOCUS_16410 1715 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3716 3006 gene locus_tag LOCUS_16420 3716 3006 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682054.1 protein_id gnl|my_center|LOCUS_16420 4513 3713 gene locus_tag LOCUS_16430 gene nfo 4513 3713 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273042.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence0168 1002 331 gene locus_tag LOCUS_16440 1002 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1803 1045 gene locus_tag LOCUS_16450 1803 1045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_16450 2776 1796 gene locus_tag LOCUS_16460 2776 1796 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819447.1 protein_id gnl|my_center|LOCUS_16460 3654 2773 gene locus_tag LOCUS_16470 3654 2773 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_16470 3945 4400 gene locus_tag LOCUS_16480 gene rnhA 3945 4400 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931354.1 protein_id gnl|my_center|LOCUS_16480 4487 4960 gene locus_tag LOCUS_16490 4487 4960 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_16490 4957 5502 gene locus_tag LOCUS_16500 4957 5502 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_16500 6058 5447 gene locus_tag LOCUS_16510 6058 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence0169 <1 640 gene locus_tag LOCUS_16520 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989870.1:alpha-mannosidase 708 1031 gene locus_tag LOCUS_16530 708 1031 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_16530 2608 1118 gene locus_tag LOCUS_16540 2608 1118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_16540 4109 2586 gene locus_tag LOCUS_16550 4109 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 4333 5334 gene locus_tag LOCUS_16560 4333 5334 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_16560 5459 5950 gene locus_tag LOCUS_16570 5459 5950 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence0170 553 119 gene locus_tag LOCUS_16580 553 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 892 3408 gene locus_tag LOCUS_16590 gene leuS 892 3408 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_16590 4044 3580 gene locus_tag LOCUS_16600 4044 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5372 4164 gene locus_tag LOCUS_16610 5372 4164 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_16610 6199 5417 gene locus_tag LOCUS_16620 6199 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0171 1885 5358 gene locus_tag LOCUS_16630 1885 5358 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680941.1 protein_id gnl|my_center|LOCUS_16630 5404 5973 gene locus_tag LOCUS_16640 5404 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence0172 2799 3395 gene locus_tag LOCUS_16650 2799 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4112 3384 gene locus_tag LOCUS_16660 4112 3384 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091542811.1 protein_id gnl|my_center|LOCUS_16660 4495 4983 gene locus_tag LOCUS_16670 4495 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4958 5875 gene locus_tag LOCUS_16680 4958 5875 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0173 160 1437 gene locus_tag LOCUS_16690 160 1437 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_16690 2978 1641 gene locus_tag LOCUS_16700 2978 1641 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_16700 3355 2975 gene locus_tag LOCUS_16710 3355 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4644 3346 gene locus_tag LOCUS_16720 4644 3346 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_16720 <6183 4700 gene locus_tag LOCUS_16730 <6183 4700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001124831.1:NAD-dependent DNA ligase LigA >Feature sequence0174 2927 1665 gene locus_tag LOCUS_16740 2927 1665 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656686.1 protein_id gnl|my_center|LOCUS_16740 4025 3009 gene locus_tag LOCUS_16750 4025 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4915 4082 gene locus_tag LOCUS_16760 4915 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5946 4906 gene locus_tag LOCUS_16770 gene corA 5946 4906 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence0175 615 199 gene locus_tag LOCUS_16780 615 199 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582698.1 protein_id gnl|my_center|LOCUS_16780 913 1410 gene locus_tag LOCUS_16790 gene nuoE 913 1410 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_16790 1407 4568 gene locus_tag LOCUS_16800 1407 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0176 74 1084 gene locus_tag LOCUS_16810 74 1084 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838101.1 protein_id gnl|my_center|LOCUS_16810 1131 2411 gene locus_tag LOCUS_16820 1131 2411 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258588.1 protein_id gnl|my_center|LOCUS_16820 2478 3557 gene locus_tag LOCUS_16830 2478 3557 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_16830 3557 4462 gene locus_tag LOCUS_16840 3557 4462 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence0177 500 336 gene locus_tag LOCUS_16850 500 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1837 1316 gene locus_tag LOCUS_16860 1837 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2207 1842 gene locus_tag LOCUS_16870 2207 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2641 2204 gene locus_tag LOCUS_16880 2641 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0178 962 441 gene locus_tag LOCUS_16890 962 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1461 976 gene locus_tag LOCUS_16900 1461 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1974 1513 gene locus_tag LOCUS_16910 1974 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2701 1952 gene locus_tag LOCUS_16920 2701 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3252 2704 gene locus_tag LOCUS_16930 3252 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3578 3249 gene locus_tag LOCUS_16940 3578 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3893 3606 gene locus_tag LOCUS_16950 3893 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4609 3845 gene locus_tag LOCUS_16960 4609 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5488 4616 gene locus_tag LOCUS_16970 5488 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5988 5485 gene locus_tag LOCUS_16980 5988 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence0179 766 398 gene locus_tag LOCUS_16990 766 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 898 1317 gene locus_tag LOCUS_17000 898 1317 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_17000 1314 2429 gene locus_tag LOCUS_17010 1314 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2433 3116 gene locus_tag LOCUS_17020 2433 3116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_17020 3113 4372 gene locus_tag LOCUS_17030 3113 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4385 5620 gene locus_tag LOCUS_17040 4385 5620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095708.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0180 <1 628 gene locus_tag LOCUS_17050 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956849.1:DNA polymerase IV 775 1173 gene locus_tag LOCUS_17060 775 1173 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015574.1 protein_id gnl|my_center|LOCUS_17060 1409 1191 gene locus_tag LOCUS_17070 1409 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1559 1416 gene locus_tag LOCUS_17080 1559 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2739 1585 gene locus_tag LOCUS_17090 2739 1585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_17090 3568 2741 gene locus_tag LOCUS_17100 3568 2741 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_17100 3780 3613 gene locus_tag LOCUS_17110 3780 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3703 4194 gene locus_tag LOCUS_17120 gene trmL 3703 4194 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_17120 4191 4991 gene locus_tag LOCUS_17130 gene proC 4191 4991 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0181 <1 695 gene locus_tag LOCUS_17140 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368503.1:phosphonate ABC transporter ATP-binding protein 698 1495 gene locus_tag LOCUS_17150 gene phnE 698 1495 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_17150 1495 2307 gene locus_tag LOCUS_17160 gene phnE 1495 2307 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_17160 2352 3341 gene locus_tag LOCUS_17170 gene phnD 2352 3341 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_17170 3402 4160 gene locus_tag LOCUS_17180 3402 4160 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_17180 5307 4189 gene locus_tag LOCUS_17190 5307 4189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence0182 1271 1912 gene locus_tag LOCUS_17200 1271 1912 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529167.1 protein_id gnl|my_center|LOCUS_17200 1917 2258 gene locus_tag LOCUS_17210 1917 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2271 2660 gene locus_tag LOCUS_17220 gene aroH 2271 2660 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_17220 2921 3955 gene locus_tag LOCUS_17230 2921 3955 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974105.1 protein_id gnl|my_center|LOCUS_17230 4038 4589 gene locus_tag LOCUS_17240 4038 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence0183 2285 1218 gene locus_tag LOCUS_17250 2285 1218 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_17250 3477 2305 gene locus_tag LOCUS_17260 3477 2305 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_17260 4711 3464 gene locus_tag LOCUS_17270 4711 3464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174149.1 protein_id gnl|my_center|LOCUS_17270 5711 4719 gene locus_tag LOCUS_17280 5711 4719 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400821.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0184 <1 729 gene locus_tag LOCUS_17290 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976088.1:DctP family TRAP transporter solute-binding subunit 815 1321 gene locus_tag LOCUS_17300 815 1321 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566024.1 protein_id gnl|my_center|LOCUS_17300 1322 2596 gene locus_tag LOCUS_17310 1322 2596 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_17310 3757 2723 gene locus_tag LOCUS_17320 3757 2723 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_17320 5081 3792 gene locus_tag LOCUS_17330 5081 3792 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_17330 5539 5081 gene locus_tag LOCUS_17340 5539 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence0185 1611 124 gene locus_tag LOCUS_17350 1611 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4080 1867 gene locus_tag LOCUS_17360 4080 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5143 4070 gene locus_tag LOCUS_17370 5143 4070 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724021.1 protein_id gnl|my_center|LOCUS_17370 5798 5136 gene locus_tag LOCUS_17380 5798 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0186 <1 1019 gene locus_tag LOCUS_17390 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393520.1:LacI family DNA-binding transcriptional regulator 1056 2318 gene locus_tag LOCUS_17400 1056 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2610 2287 gene locus_tag LOCUS_17410 2610 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2781 3041 gene locus_tag LOCUS_17420 2781 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3041 3421 gene locus_tag LOCUS_17430 3041 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3507 4442 gene locus_tag LOCUS_17440 3507 4442 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_17440 4545 4988 gene locus_tag LOCUS_17450 4545 4988 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence0187 951 2219 gene locus_tag LOCUS_17460 951 2219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172898.1 protein_id gnl|my_center|LOCUS_17460 2287 3186 gene locus_tag LOCUS_17470 2287 3186 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315207.1 protein_id gnl|my_center|LOCUS_17470 3183 4007 gene locus_tag LOCUS_17480 3183 4007 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0188 2431 1439 gene locus_tag LOCUS_17490 gene ilvC 2431 1439 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_17490 3022 2492 gene locus_tag LOCUS_17500 gene ilvN 3022 2492 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_17500 3450 5264 gene locus_tag LOCUS_17510 3450 5264 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence0189 <1 836 gene locus_tag LOCUS_17520 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902212.1:TRAP transporter large permease 863 1594 gene locus_tag LOCUS_17530 863 1594 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_17530 2967 1807 gene locus_tag LOCUS_17540 2967 1807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_17540 5338 3179 gene locus_tag LOCUS_17550 5338 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0190 129 776 gene locus_tag LOCUS_17560 129 776 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_17560 1322 963 gene locus_tag LOCUS_17570 1322 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4133 1464 gene locus_tag LOCUS_17580 4133 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4702 4136 gene locus_tag LOCUS_17590 4702 4136 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 protein_id gnl|my_center|LOCUS_17590 5622 4738 gene locus_tag LOCUS_17600 5622 4738 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_17600 5841 5719 gene locus_tag LOCUS_17610 5841 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence0191 1376 486 gene locus_tag LOCUS_17620 1376 486 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_17620 1679 2329 gene locus_tag LOCUS_17630 1679 2329 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_17630 2326 3423 gene locus_tag LOCUS_17640 2326 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4382 3420 gene locus_tag LOCUS_17650 gene ydjG 4382 3420 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723698.1 protein_id gnl|my_center|LOCUS_17650 5293 4379 gene locus_tag LOCUS_17660 5293 4379 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_17660 <5842 5290 gene locus_tag LOCUS_17670 <5842 5290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393497.1:aspartate/glutamate racemase family protein >Feature sequence0192 459 1445 gene locus_tag LOCUS_17680 459 1445 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733043.1 protein_id gnl|my_center|LOCUS_17680 1454 1717 gene locus_tag LOCUS_17690 1454 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2972 1746 gene locus_tag LOCUS_17700 2972 1746 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944154.1 protein_id gnl|my_center|LOCUS_17700 3515 3072 gene locus_tag LOCUS_17710 3515 3072 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_17710 3737 4222 gene locus_tag LOCUS_17720 3737 4222 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_17720 4219 4752 gene locus_tag LOCUS_17730 4219 4752 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_17730 5475 4756 gene locus_tag LOCUS_17740 5475 4756 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence0193 401 1087 gene locus_tag LOCUS_17750 gene walR 401 1087 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971872.1 protein_id gnl|my_center|LOCUS_17750 1204 2238 gene locus_tag LOCUS_17760 1204 2238 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_17760 2330 4039 gene locus_tag LOCUS_17770 2330 4039 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 protein_id gnl|my_center|LOCUS_17770 4020 5153 gene locus_tag LOCUS_17780 4020 5153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 protein_id gnl|my_center|LOCUS_17780 <5804 5190 gene locus_tag LOCUS_17790 <5804 5190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272304.1:histidine kinase >Feature sequence0194 1837 812 gene locus_tag LOCUS_17800 1837 812 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_17800 1791 1928 gene locus_tag LOCUS_17810 1791 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2303 2914 gene locus_tag LOCUS_17820 2303 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4460 3108 gene locus_tag LOCUS_17830 gene zwf 4460 3108 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445335.1 protein_id gnl|my_center|LOCUS_17830 5120 4464 gene locus_tag LOCUS_17840 5120 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 <5804 5187 gene locus_tag LOCUS_17850 <5804 5187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016932.1:2-hydroxyacyl-CoA dehydratase >Feature sequence0195 350 1501 gene locus_tag LOCUS_17860 350 1501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_17860 1574 1948 gene locus_tag LOCUS_17870 gene fra 1574 1948 CDS product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 protein_id gnl|my_center|LOCUS_17870 2437 2649 gene locus_tag LOCUS_17880 2437 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17880 3898 2816 gene locus_tag LOCUS_17890 gene rlmN 3898 2816 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_17890 5504 3912 gene locus_tag LOCUS_17900 5504 3912 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence0196 2 1531 gene locus_tag LOCUS_17910 gene nagZ 2 1531 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_17910 1541 2020 gene locus_tag LOCUS_17920 1541 2020 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527000.1 protein_id gnl|my_center|LOCUS_17920 2017 3204 gene locus_tag LOCUS_17930 gene anmK 2017 3204 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_17930 3387 4928 gene locus_tag LOCUS_17940 3387 4928 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence0197 1145 33 gene locus_tag LOCUS_17950 gene dgaE 1145 33 CDS product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_17950 2216 1158 gene locus_tag LOCUS_17960 2216 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3205 2222 gene locus_tag LOCUS_17970 3205 2222 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_17970 4175 3195 gene locus_tag LOCUS_17980 4175 3195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_17980 5041 4172 gene locus_tag LOCUS_17990 5041 4172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_17990 5450 5052 gene locus_tag LOCUS_18000 5450 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence0198 2162 918 gene locus_tag LOCUS_18010 2162 918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_18010 3671 2175 gene locus_tag LOCUS_18020 gene gguA 3671 2175 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_18020 4497 3976 gene locus_tag LOCUS_18030 4497 3976 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 protein_id gnl|my_center|LOCUS_18030 5597 4593 gene locus_tag LOCUS_18040 5597 4593 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence0199 68 835 gene locus_tag LOCUS_18050 68 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 855 1880 gene locus_tag LOCUS_18060 855 1880 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_18060 2532 1858 gene locus_tag LOCUS_18070 2532 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4767 2536 gene locus_tag LOCUS_18080 gene rlmKL 4767 2536 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017709633.1 protein_id gnl|my_center|LOCUS_18080 <5671 4764 gene locus_tag LOCUS_18090 <5671 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003642088.1:Hsp33 family molecular chaperone HslO >Feature sequence0200 43 1248 gene locus_tag LOCUS_18100 gene xylB 43 1248 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_18100 1277 2824 gene locus_tag LOCUS_18110 gene xylB 1277 2824 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_18110 2817 3206 gene locus_tag LOCUS_18120 2817 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3209 4207 gene locus_tag LOCUS_18130 3209 4207 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057648430.1 protein_id gnl|my_center|LOCUS_18130 4212 5174 gene locus_tag LOCUS_18140 gene rbsK 4212 5174 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_18140 5171 5521 gene locus_tag LOCUS_18150 5171 5521 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0201 202 345 gene locus_tag LOCUS_18160 202 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 345 692 gene locus_tag LOCUS_18170 345 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 689 1102 gene locus_tag LOCUS_18180 689 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1089 1487 gene locus_tag LOCUS_18190 1089 1487 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403769.1 protein_id gnl|my_center|LOCUS_18190 1484 1864 gene locus_tag LOCUS_18200 1484 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1867 2598 gene locus_tag LOCUS_18210 1867 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2609 2938 gene locus_tag LOCUS_18220 2609 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963386.1 protein_id gnl|my_center|LOCUS_18220 3007 3216 gene locus_tag LOCUS_18230 3007 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence0202 1620 352 gene locus_tag LOCUS_18240 1620 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1820 1747 gene locus_tag LOCUS_t00240 1820 1747 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2756 2034 gene locus_tag LOCUS_18250 2756 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2868 3806 gene locus_tag LOCUS_18260 2868 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4481 3825 gene locus_tag LOCUS_18270 4481 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence0203 1380 757 gene locus_tag LOCUS_18280 gene grpE 1380 757 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_18280 3150 1552 gene locus_tag LOCUS_18290 3150 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3875 3168 gene locus_tag LOCUS_18300 3875 3168 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_18300 5434 3878 gene locus_tag LOCUS_18310 gene der 5434 3878 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence0204 25 1029 gene locus_tag LOCUS_18320 25 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3368 1026 gene locus_tag LOCUS_18330 3368 1026 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679111.1 protein_id gnl|my_center|LOCUS_18330 3464 4708 gene locus_tag LOCUS_18340 3464 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence0205 608 1744 gene locus_tag LOCUS_18350 608 1744 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_18350 2592 1876 gene locus_tag LOCUS_18360 2592 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2920 2720 gene locus_tag LOCUS_18370 2920 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2820 3995 gene locus_tag LOCUS_18380 2820 3995 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_18380 4059 4559 gene locus_tag LOCUS_18390 4059 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0206 <1 1557 gene locus_tag LOCUS_18400 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965634.1:phospho-sugar mutase 1558 2337 gene locus_tag LOCUS_18410 1558 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2370 3794 gene locus_tag LOCUS_18420 2370 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3763 4632 gene locus_tag LOCUS_18430 gene rsmA 3763 4632 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_18430 <5530 4607 gene locus_tag LOCUS_18440 <5530 4607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202731.1:MATE family efflux transporter >Feature sequence0207 <1 559 gene locus_tag LOCUS_18450 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534144.1:L-glyceraldehyde 3-phosphate reductase 892 3588 gene locus_tag LOCUS_18460 892 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3930 4976 gene locus_tag LOCUS_18470 3930 4976 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660662.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence0208 2460 550 gene locus_tag LOCUS_18480 2460 550 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_18480 3527 2532 gene locus_tag LOCUS_18490 3527 2532 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_18490 3978 3556 gene locus_tag LOCUS_18500 3978 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5100 3988 gene locus_tag LOCUS_18510 5100 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence0209 462 731 gene locus_tag LOCUS_18520 462 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1121 2167 gene locus_tag LOCUS_18530 1121 2167 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_18530 2365 3861 gene locus_tag LOCUS_18540 2365 3861 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222918.1 protein_id gnl|my_center|LOCUS_18540 4928 3906 gene locus_tag LOCUS_18550 4928 3906 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_18550 5500 5066 gene locus_tag LOCUS_18560 5500 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence0210 118 1866 gene locus_tag LOCUS_18570 118 1866 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_18570 4041 1984 gene locus_tag LOCUS_18580 4041 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4126 4668 gene locus_tag LOCUS_18590 4126 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0211 238 783 gene locus_tag LOCUS_18600 238 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2849 780 gene locus_tag LOCUS_18610 gene uvrB 2849 780 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_18610 4144 2852 gene locus_tag LOCUS_18620 4144 2852 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_18620 5155 4184 gene locus_tag LOCUS_18630 5155 4184 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583161.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence0212 818 1603 gene locus_tag LOCUS_18640 gene tcyJ 818 1603 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378649.1 protein_id gnl|my_center|LOCUS_18640 1619 2287 gene locus_tag LOCUS_18650 1619 2287 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461612.1 protein_id gnl|my_center|LOCUS_18650 2280 3047 gene locus_tag LOCUS_18660 2280 3047 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616927.1 protein_id gnl|my_center|LOCUS_18660 3068 3730 gene locus_tag LOCUS_18670 3068 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3830 4333 gene locus_tag LOCUS_18680 3830 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5265 4315 gene locus_tag LOCUS_18690 5265 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence0213 395 853 gene locus_tag LOCUS_18700 395 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 876 1835 gene locus_tag LOCUS_18710 876 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1841 2290 gene locus_tag LOCUS_18720 1841 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2517 4841 gene locus_tag LOCUS_18730 2517 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence0214 <1 850 gene locus_tag LOCUS_18740 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922507.1:arylsulfatase 957 3200 gene locus_tag LOCUS_18750 957 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4245 3358 gene locus_tag LOCUS_18760 4245 3358 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 protein_id gnl|my_center|LOCUS_18760 4562 5179 gene locus_tag LOCUS_18770 4562 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942932.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence0215 11 331 gene locus_tag LOCUS_18780 11 331 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_18780 364 2016 gene locus_tag LOCUS_18790 gene lnt 364 2016 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679415.1 protein_id gnl|my_center|LOCUS_18790 2025 3290 gene locus_tag LOCUS_18800 2025 3290 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081038.1 protein_id gnl|my_center|LOCUS_18800 3440 5302 gene locus_tag LOCUS_18810 3440 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0216 17 1222 gene locus_tag LOCUS_18820 17 1222 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_18820 1226 2341 gene locus_tag LOCUS_18830 gene nspC 1226 2341 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_18830 2351 3208 gene locus_tag LOCUS_18840 gene speB 2351 3208 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_18840 3610 3185 gene locus_tag LOCUS_18850 3610 3185 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_18850 4167 3613 gene locus_tag LOCUS_18860 4167 3613 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_18860 5092 4265 gene locus_tag LOCUS_18870 5092 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0217 1 309 gene locus_tag LOCUS_18880 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 338 1876 gene locus_tag LOCUS_18890 gene murJ 338 1876 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889824.1 protein_id gnl|my_center|LOCUS_18890 3514 1811 gene locus_tag LOCUS_18900 3514 1811 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_18900 <5393 3581 gene locus_tag LOCUS_18910 <5393 3581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673498.1:transcription elongation factor GreA >Feature sequence0218 241 2322 gene locus_tag LOCUS_18920 gene fusA 241 2322 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682245.1 protein_id gnl|my_center|LOCUS_18920 2570 2977 gene locus_tag LOCUS_18930 2570 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3991 3134 gene locus_tag LOCUS_18940 3991 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3933 4262 gene locus_tag LOCUS_18950 3933 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5232 4312 gene locus_tag LOCUS_18960 gene chbR 5232 4312 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366186.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence0219 1152 847 gene locus_tag LOCUS_18970 1152 847 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891186.1 protein_id gnl|my_center|LOCUS_18970 1891 1235 gene locus_tag LOCUS_18980 1891 1235 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028029.1 protein_id gnl|my_center|LOCUS_18980 2082 1888 gene locus_tag LOCUS_18990 2082 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2695 2084 gene locus_tag LOCUS_19000 2695 2084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 protein_id gnl|my_center|LOCUS_19000 3788 2697 gene locus_tag LOCUS_19010 3788 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4469 3792 gene locus_tag LOCUS_19020 4469 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5197 4466 gene locus_tag LOCUS_19030 5197 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0220 212 1714 gene locus_tag LOCUS_19040 gene glpK 212 1714 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_19040 1724 2545 gene locus_tag LOCUS_19050 gene cdaA 1724 2545 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_19050 2532 2936 gene locus_tag LOCUS_19060 2532 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2936 3310 gene locus_tag LOCUS_19070 2936 3310 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_19070 3297 4145 gene locus_tag LOCUS_19080 gene truA 3297 4145 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_19080 4135 4881 gene locus_tag LOCUS_19090 4135 4881 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence0221 1661 186 gene locus_tag LOCUS_19100 gene crtI 1661 186 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061143.1 protein_id gnl|my_center|LOCUS_19100 1742 2446 gene locus_tag LOCUS_19110 1742 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2436 3914 gene locus_tag LOCUS_19120 gene crtI 2436 3914 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_19120 3916 4596 gene locus_tag LOCUS_19130 3916 4596 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_19130 5081 4680 gene locus_tag LOCUS_19140 5081 4680 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788957.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence0222 1916 183 gene locus_tag LOCUS_19150 1916 183 CDS product dihydroorotate dehydrogenase/oxidoreductase, FAD-binding inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682296.1 protein_id gnl|my_center|LOCUS_19150 2779 1913 gene locus_tag LOCUS_19160 gene pyrF 2779 1913 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957153.1 protein_id gnl|my_center|LOCUS_19160 3491 2793 gene locus_tag LOCUS_19170 3491 2793 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682319.1 protein_id gnl|my_center|LOCUS_19170 5116 3509 gene locus_tag LOCUS_19180 5116 3509 CDS product bifunctional aspartate carbamoyltransferase catalytic subunit/aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666669.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence0223 59 835 gene locus_tag LOCUS_19190 59 835 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680051.1 protein_id gnl|my_center|LOCUS_19190 849 1376 gene locus_tag LOCUS_19200 gene lspA 849 1376 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_19200 1360 1647 gene locus_tag LOCUS_19210 1360 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1653 2669 gene locus_tag LOCUS_19220 1653 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3492 2662 gene locus_tag LOCUS_19230 3492 2662 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_19230 4045 3482 gene locus_tag LOCUS_19240 gene rsmD 4045 3482 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_19240 5323 4103 gene locus_tag LOCUS_19250 5323 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence0224 3990 2596 gene locus_tag LOCUS_19260 3990 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4854 4075 gene locus_tag LOCUS_19270 4854 4075 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296669.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0225 804 289 gene locus_tag LOCUS_19280 804 289 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_19280 1577 1002 gene locus_tag LOCUS_19290 1577 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1831 1580 gene locus_tag LOCUS_19300 1831 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2032 4395 gene locus_tag LOCUS_19310 2032 4395 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0226 748 107 gene locus_tag LOCUS_19320 748 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 910 1554 gene locus_tag LOCUS_19330 910 1554 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937896.1 protein_id gnl|my_center|LOCUS_19330 1651 2217 gene locus_tag LOCUS_19340 1651 2217 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_19340 3933 2644 gene locus_tag LOCUS_19350 3933 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4667 3921 gene locus_tag LOCUS_19360 4667 3921 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence0227 477 941 gene locus_tag LOCUS_19370 gene nrdR 477 941 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_19370 2093 942 gene locus_tag LOCUS_19380 2093 942 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_19380 2139 2630 gene locus_tag LOCUS_19390 2139 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2633 3175 gene locus_tag LOCUS_19400 2633 3175 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687349.1 protein_id gnl|my_center|LOCUS_19400 3162 4214 gene locus_tag LOCUS_19410 gene aroC 3162 4214 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence0228 <1 829 gene locus_tag LOCUS_19420 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680776.1:DEAD/DEAH box helicase 826 2724 gene locus_tag LOCUS_19430 826 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4205 2721 gene locus_tag LOCUS_19440 4205 2721 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence0229 1200 298 gene locus_tag LOCUS_19450 1200 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1376 2959 gene locus_tag LOCUS_19460 1376 2959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_19460 3042 3998 gene locus_tag LOCUS_19470 3042 3998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_19470 4002 4868 gene locus_tag LOCUS_19480 4002 4868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095723.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence0230 109 585 gene locus_tag LOCUS_19490 109 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2613 826 gene locus_tag LOCUS_19500 2613 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3168 4511 gene locus_tag LOCUS_19510 3168 4511 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_19510 4924 4631 gene locus_tag LOCUS_19520 4924 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 5201 4956 gene locus_tag LOCUS_19530 5201 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence0231 40 567 gene locus_tag LOCUS_19540 40 567 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933072.1 protein_id gnl|my_center|LOCUS_19540 569 1618 gene locus_tag LOCUS_19550 gene aroC 569 1618 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209711.1 protein_id gnl|my_center|LOCUS_19550 1618 3279 gene locus_tag LOCUS_19560 1618 3279 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_19560 3267 5156 gene locus_tag LOCUS_19570 3267 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0232 <1 763 gene locus_tag LOCUS_19580 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861634.1:ABC transporter ATP-binding protein 763 1740 gene locus_tag LOCUS_19590 763 1740 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_19590 1807 3555 gene locus_tag LOCUS_19600 1807 3555 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_19600 3552 5087 gene locus_tag LOCUS_19610 3552 5087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence0233 1910 1140 gene locus_tag LOCUS_19620 1910 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3142 1907 gene locus_tag LOCUS_19630 gene ftsW 3142 1907 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_19630 4097 3150 gene locus_tag LOCUS_19640 gene mraY 4097 3150 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597928.1 protein_id gnl|my_center|LOCUS_19640 <5185 4107 gene locus_tag LOCUS_19650 <5185 4107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678687.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence0234 2686 1805 gene locus_tag LOCUS_19660 2686 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2988 2689 gene locus_tag LOCUS_19670 2988 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3511 2993 gene locus_tag LOCUS_19680 3511 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4233 3526 gene locus_tag LOCUS_19690 4233 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4678 4217 gene locus_tag LOCUS_19700 4678 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0235 1769 1014 gene locus_tag LOCUS_19710 1769 1014 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_19710 2322 1858 gene locus_tag LOCUS_19720 2322 1858 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_19720 2419 3612 gene locus_tag LOCUS_19730 2419 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence0236 1521 2474 gene locus_tag LOCUS_19740 1521 2474 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_19740 2484 3455 gene locus_tag LOCUS_19750 2484 3455 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_19750 3524 5104 gene locus_tag LOCUS_19760 3524 5104 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence0237 427 996 gene locus_tag LOCUS_19770 427 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1016 2620 gene locus_tag LOCUS_19780 1016 2620 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_19780 2663 2737 gene locus_tag LOCUS_t00250 2663 2737 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3401 2793 gene locus_tag LOCUS_19790 3401 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence0238 366 1631 gene locus_tag LOCUS_19800 gene lysA 366 1631 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_19800 1631 2044 gene locus_tag LOCUS_19810 gene ybgC 1631 2044 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_19810 3039 2041 gene locus_tag LOCUS_19820 3039 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3164 3754 gene locus_tag LOCUS_19830 3164 3754 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205219106.1 protein_id gnl|my_center|LOCUS_19830 4581 3772 gene locus_tag LOCUS_19840 4581 3772 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence0239 1543 104 gene locus_tag LOCUS_19850 1543 104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_19850 2489 1737 gene locus_tag LOCUS_19860 2489 1737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_19860 4862 2508 gene locus_tag LOCUS_19870 4862 2508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence0240 218 1738 gene locus_tag LOCUS_19880 gene gguA 218 1738 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_19880 1725 2765 gene locus_tag LOCUS_19890 1725 2765 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_19890 2812 3720 gene locus_tag LOCUS_19900 2812 3720 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_19900 3881 4254 gene locus_tag LOCUS_tm00010 3881 4254 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0241 871 239 gene locus_tag LOCUS_19910 871 239 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_19910 1113 2345 gene locus_tag LOCUS_19920 1113 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2419 3339 gene locus_tag LOCUS_19930 2419 3339 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067605.1 protein_id gnl|my_center|LOCUS_19930 3341 4177 gene locus_tag LOCUS_19940 3341 4177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence0242 2110 377 gene locus_tag LOCUS_19950 gene ptsP 2110 377 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_19950 2186 2743 gene locus_tag LOCUS_19960 2186 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3491 2703 gene locus_tag LOCUS_19970 3491 2703 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 protein_id gnl|my_center|LOCUS_19970 4216 3491 gene locus_tag LOCUS_19980 4216 3491 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_19980 5046 4300 gene locus_tag LOCUS_19990 5046 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence0243 485 1690 gene locus_tag LOCUS_20000 485 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3567 1897 gene locus_tag LOCUS_20010 3567 1897 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_20010 3609 4718 gene locus_tag LOCUS_20020 3609 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0244 1115 195 gene locus_tag LOCUS_20030 1115 195 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459744.1 protein_id gnl|my_center|LOCUS_20030 1765 1193 gene locus_tag LOCUS_20040 1765 1193 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_20040 2784 1840 gene locus_tag LOCUS_20050 2784 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4043 2799 gene locus_tag LOCUS_20060 4043 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4977 4096 gene locus_tag LOCUS_20070 4977 4096 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0245 1418 201 gene locus_tag LOCUS_20080 1418 201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_20080 3969 1468 gene locus_tag LOCUS_20090 3969 1468 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391006.1 protein_id gnl|my_center|LOCUS_20090 <5002 4453 gene locus_tag LOCUS_20100 <5002 4453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766346.1:NADP-specific glutamate dehydrogenase >Feature sequence0246 2310 781 gene locus_tag LOCUS_20110 2310 781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_20110 3444 2329 gene locus_tag LOCUS_20120 3444 2329 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_20120 4165 3458 gene locus_tag LOCUS_20130 gene deoC 4165 3458 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_20130 4950 4168 gene locus_tag LOCUS_20140 4950 4168 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence0247 <1 1190 gene locus_tag LOCUS_20150 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393493.1:dihydropyrimidinase 1310 2479 gene locus_tag LOCUS_20160 1310 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2479 3756 gene locus_tag LOCUS_20170 2479 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3759 4280 gene locus_tag LOCUS_20180 3759 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4287 4832 gene locus_tag LOCUS_20190 4287 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence0248 343 1614 gene locus_tag LOCUS_20200 343 1614 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021916.1 protein_id gnl|my_center|LOCUS_20200 2211 2570 gene locus_tag LOCUS_20210 2211 2570 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_20210 2657 3016 gene locus_tag LOCUS_20220 2657 3016 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943770.1 protein_id gnl|my_center|LOCUS_20220 2994 3851 gene locus_tag LOCUS_20230 2994 3851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272561.1 protein_id gnl|my_center|LOCUS_20230 3848 4726 gene locus_tag LOCUS_20240 3848 4726 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461117.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence0249 912 373 gene locus_tag LOCUS_20250 912 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1855 1082 gene locus_tag LOCUS_20260 gene deoR 1855 1082 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237057.1 protein_id gnl|my_center|LOCUS_20260 2120 2785 gene locus_tag LOCUS_20270 2120 2785 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_20270 2838 3836 gene locus_tag LOCUS_20280 2838 3836 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence0250 2269 3927 gene locus_tag LOCUS_20290 2269 3927 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_20290 4456 4821 gene locus_tag LOCUS_20300 4456 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence0251 1591 227 gene locus_tag LOCUS_20310 1591 227 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_20310 4805 1659 gene locus_tag LOCUS_20320 4805 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence0252 >Feature sequence0253 2143 1385 gene locus_tag LOCUS_20330 2143 1385 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_20330 2559 2146 gene locus_tag LOCUS_20340 2559 2146 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_20340 3716 2556 gene locus_tag LOCUS_20350 3716 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4057 3725 gene locus_tag LOCUS_20360 4057 3725 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_20360 4093 4623 gene locus_tag LOCUS_20370 gene pth 4093 4623 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence0254 1638 142 gene locus_tag LOCUS_20380 1638 142 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_20380 2479 1649 gene locus_tag LOCUS_20390 2479 1649 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_20390 3378 2491 gene locus_tag LOCUS_20400 3378 2491 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972872.1 protein_id gnl|my_center|LOCUS_20400 4752 3445 gene locus_tag LOCUS_20410 4752 3445 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence0255 184 1869 gene locus_tag LOCUS_20420 184 1869 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_20420 1887 3380 gene locus_tag LOCUS_20430 gene uxaE 1887 3380 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_20430 4023 3415 gene locus_tag LOCUS_20440 4023 3415 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_20440 <4830 4020 gene locus_tag LOCUS_20450 <4830 4020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933651.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence0256 <1 857 gene locus_tag LOCUS_20460 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726997.1:extracellular solute-binding protein 926 1813 gene locus_tag LOCUS_20470 926 1813 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530241.1 protein_id gnl|my_center|LOCUS_20470 1806 2654 gene locus_tag LOCUS_20480 1806 2654 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_20480 2666 4171 gene locus_tag LOCUS_20490 2666 4171 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107895.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence0257 319 1644 gene locus_tag LOCUS_20500 gene aceF 319 1644 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_20500 1680 3062 gene locus_tag LOCUS_20510 gene lpdA 1680 3062 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_20510 3765 3241 gene locus_tag LOCUS_20520 3765 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence0258 1963 488 gene locus_tag LOCUS_20530 1963 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2435 1974 gene locus_tag LOCUS_20540 2435 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4047 2446 gene locus_tag LOCUS_20550 gene xylB 4047 2446 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 protein_id gnl|my_center|LOCUS_20550 4722 4060 gene locus_tag LOCUS_20560 4722 4060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358596.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence0259 488 222 gene locus_tag LOCUS_20570 gene rpsO 488 222 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_20570 1318 485 gene locus_tag LOCUS_20580 1318 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2206 1319 gene locus_tag LOCUS_20590 2206 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2552 2196 gene locus_tag LOCUS_20600 2552 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4309 2549 gene locus_tag LOCUS_20610 4309 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence0260 1721 465 gene locus_tag LOCUS_20620 gene tyrS 1721 465 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682133.1 protein_id gnl|my_center|LOCUS_20620 3055 1718 gene locus_tag LOCUS_20630 3055 1718 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_20630 4541 3060 gene locus_tag LOCUS_20640 gene gltX 4541 3060 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665196.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence0261 150 410 gene locus_tag LOCUS_20650 150 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 700 1266 gene locus_tag LOCUS_20660 700 1266 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_20660 1367 2131 gene locus_tag LOCUS_20670 1367 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence0262 <1 2084 gene locus_tag LOCUS_20680 <1 2084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184045897.1:type I-U CRISPR-associated protein Csx17 2103 3128 gene locus_tag LOCUS_20690 2103 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3589 3723 gene locus_tag LOCUS_20700 3589 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4088 3876 gene locus_tag LOCUS_20710 4088 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 4622 4774 gene locus_tag LOCUS_20720 4622 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence0263 1617 616 gene locus_tag LOCUS_20730 gene pta 1617 616 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_20730 1728 2900 gene locus_tag LOCUS_20740 1728 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2942 3679 gene locus_tag LOCUS_20750 2942 3679 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence0264 1230 439 gene locus_tag LOCUS_20760 1230 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1376 1227 gene locus_tag LOCUS_20770 1376 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1783 1430 gene locus_tag LOCUS_20780 1783 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2173 1835 gene locus_tag LOCUS_20790 2173 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2554 2351 gene locus_tag LOCUS_20800 2554 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2753 2538 gene locus_tag LOCUS_20810 2753 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3177 2737 gene locus_tag LOCUS_20820 3177 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3308 3180 gene locus_tag LOCUS_20830 3308 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3566 3375 gene locus_tag LOCUS_20840 3566 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3735 3568 gene locus_tag LOCUS_20850 3735 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4111 3716 gene locus_tag LOCUS_20860 gene ssb 4111 3716 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_20860 4457 4101 gene locus_tag LOCUS_20870 4457 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence0265 156 620 gene locus_tag LOCUS_20880 156 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 676 2826 gene locus_tag LOCUS_20890 676 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3393 4442 gene locus_tag LOCUS_20900 3393 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence0266 1461 802 gene locus_tag LOCUS_20910 1461 802 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_20910 1677 2774 gene locus_tag LOCUS_20920 gene araD 1677 2774 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_20920 2809 4143 gene locus_tag LOCUS_20930 2809 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence0267 887 306 gene locus_tag LOCUS_20940 887 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1665 889 gene locus_tag LOCUS_20950 1665 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2546 1707 gene locus_tag LOCUS_20960 2546 1707 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 protein_id gnl|my_center|LOCUS_20960 2769 2560 gene locus_tag LOCUS_20970 2769 2560 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 protein_id gnl|my_center|LOCUS_20970 2865 2938 gene locus_tag LOCUS_t00260 2865 2938 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4340 2982 gene locus_tag LOCUS_20980 gene melA 4340 2982 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312416.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence0268 31 2073 gene locus_tag LOCUS_20990 31 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2093 2911 gene locus_tag LOCUS_21000 2093 2911 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_21000 3282 4061 gene locus_tag LOCUS_21010 3282 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence0269 30 1319 gene locus_tag LOCUS_21020 gene dnaB 30 1319 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_21020 2697 1309 gene locus_tag LOCUS_21030 gene rseP 2697 1309 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_21030 3809 2694 gene locus_tag LOCUS_21040 3809 2694 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989733.1 protein_id gnl|my_center|LOCUS_21040 4656 3817 gene locus_tag LOCUS_21050 4656 3817 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence0270 2312 1425 gene locus_tag LOCUS_21060 2312 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2847 2296 gene locus_tag LOCUS_21070 2847 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence0271 1283 399 gene locus_tag LOCUS_21080 1283 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21080 1934 1287 gene locus_tag LOCUS_21090 1934 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21090 2127 1882 gene locus_tag LOCUS_21100 2127 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2104 3066 gene locus_tag LOCUS_21110 2104 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0272 1120 302 gene locus_tag LOCUS_21120 1120 302 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_21120 2046 1114 gene locus_tag LOCUS_21130 2046 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2695 2027 gene locus_tag LOCUS_21140 2695 2027 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531950.1 protein_id gnl|my_center|LOCUS_21140 3099 2716 gene locus_tag LOCUS_21150 3099 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4306 3110 gene locus_tag LOCUS_21160 4306 3110 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0273 2220 1282 gene locus_tag LOCUS_21170 gene trxB 2220 1282 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722610.1 protein_id gnl|my_center|LOCUS_21170 2923 2213 gene locus_tag LOCUS_21180 gene tsaB 2923 2213 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_21180 3339 2920 gene locus_tag LOCUS_21190 gene tsaE 3339 2920 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_21190 4595 3339 gene locus_tag LOCUS_21200 4595 3339 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0274 1228 368 gene locus_tag LOCUS_21210 1228 368 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_21210 2457 1225 gene locus_tag LOCUS_21220 2457 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2929 2489 gene locus_tag LOCUS_21230 2929 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3270 4388 gene locus_tag LOCUS_21240 3270 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0275 <1 1138 gene locus_tag LOCUS_21250 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393603.1:response regulator 1433 1110 gene locus_tag LOCUS_21260 1433 1110 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_21260 2500 1430 gene locus_tag LOCUS_21270 2500 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 <4620 2497 gene locus_tag LOCUS_21280 <4620 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027462.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence0276 1195 272 gene locus_tag LOCUS_21290 gene hslO 1195 272 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 protein_id gnl|my_center|LOCUS_21290 3174 1207 gene locus_tag LOCUS_21300 gene ftsH 3174 1207 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_21300 3291 3995 gene locus_tag LOCUS_21310 3291 3995 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence0277 661 308 gene locus_tag LOCUS_21320 661 308 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532856.1 protein_id gnl|my_center|LOCUS_21320 1385 876 gene locus_tag LOCUS_21330 gene folK 1385 876 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_21330 1747 1382 gene locus_tag LOCUS_21340 gene folB 1747 1382 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_21340 2463 1759 gene locus_tag LOCUS_21350 2463 1759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_21350 3130 2471 gene locus_tag LOCUS_21360 gene folE 3130 2471 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_21360 3707 4540 gene locus_tag LOCUS_21370 3707 4540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence0278 >Feature sequence0279 712 1155 gene locus_tag LOCUS_21380 712 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1771 1280 gene locus_tag LOCUS_21390 1771 1280 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_21390 2651 1764 gene locus_tag LOCUS_21400 gene xdhB 2651 1764 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_21400 <4582 2664 gene locus_tag LOCUS_21410 <4582 2664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393458.1:xanthine dehydrogenase molybdenum-binding subunit XdhA >Feature sequence0280 2528 993 gene locus_tag LOCUS_21420 2528 993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_21420 3721 2618 gene locus_tag LOCUS_21430 3721 2618 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_21430 <4581 3904 gene locus_tag LOCUS_21440 <4581 3904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108784.1:Cof-type HAD-IIB family hydrolase >Feature sequence0281 442 1539 gene locus_tag LOCUS_21450 442 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1544 2359 gene locus_tag LOCUS_21460 1544 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3155 2376 gene locus_tag LOCUS_21470 3155 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4494 3172 gene locus_tag LOCUS_21480 4494 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence0282 259 852 gene locus_tag LOCUS_21490 259 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1231 1160 gene locus_tag LOCUS_t00270 1231 1160 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1411 2922 gene locus_tag LOCUS_21500 1411 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3111 3395 gene locus_tag LOCUS_21510 3111 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3392 4411 gene locus_tag LOCUS_21520 gene tsaD 3392 4411 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0283 130 750 gene locus_tag LOCUS_21530 130 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 750 2420 gene locus_tag LOCUS_21540 750 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2867 2499 gene locus_tag LOCUS_21550 2867 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3399 2860 gene locus_tag LOCUS_21560 3399 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3743 3396 gene locus_tag LOCUS_21570 3743 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4422 3760 gene locus_tag LOCUS_21580 4422 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence0284 <1 714 gene locus_tag LOCUS_21590 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477517.1:bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase 1675 704 gene locus_tag LOCUS_21600 1675 704 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_21600 3076 1694 gene locus_tag LOCUS_21610 3076 1694 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101332.1 protein_id gnl|my_center|LOCUS_21610 3239 3670 gene locus_tag LOCUS_21620 gene fucU 3239 3670 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648572.1 protein_id gnl|my_center|LOCUS_21620 4420 3713 gene locus_tag LOCUS_21630 4420 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0285 111 695 gene locus_tag LOCUS_21640 111 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1273 692 gene locus_tag LOCUS_21650 1273 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2090 1275 gene locus_tag LOCUS_21660 2090 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2363 2436 gene locus_tag LOCUS_t00280 2363 2436 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3871 2513 gene locus_tag LOCUS_21670 3871 2513 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence0286 1864 236 gene locus_tag LOCUS_21680 1864 236 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_21680 2286 1936 gene locus_tag LOCUS_21690 gene tnpB 2286 1936 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973424.1 protein_id gnl|my_center|LOCUS_21690 2636 2286 gene locus_tag LOCUS_21700 2636 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4255 2960 gene locus_tag LOCUS_21710 4255 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence0287 209 1570 gene locus_tag LOCUS_21720 209 1570 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_21720 1617 2801 gene locus_tag LOCUS_21730 gene nagA 1617 2801 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_21730 2827 4272 gene locus_tag LOCUS_21740 2827 4272 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence0288 42 575 gene locus_tag LOCUS_21750 42 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1014 760 gene locus_tag LOCUS_21760 1014 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1156 989 gene locus_tag LOCUS_21770 1156 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1439 1131 gene locus_tag LOCUS_21780 1439 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1888 1436 gene locus_tag LOCUS_21790 1888 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3095 1938 gene locus_tag LOCUS_21800 3095 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3598 3083 gene locus_tag LOCUS_21810 3598 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4408 3611 gene locus_tag LOCUS_21820 4408 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence0289 250 1545 gene locus_tag LOCUS_21830 250 1545 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_21830 1560 2294 gene locus_tag LOCUS_21840 1560 2294 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_21840 2412 3584 gene locus_tag LOCUS_21850 2412 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence0290 1670 426 gene locus_tag LOCUS_21860 gene dpaL 1670 426 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 protein_id gnl|my_center|LOCUS_21860 3162 2110 gene locus_tag LOCUS_21870 3162 2110 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_21870 4022 3276 gene locus_tag LOCUS_21880 gene gpmA 4022 3276 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence0291 1753 470 gene locus_tag LOCUS_21890 1753 470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978245.1 protein_id gnl|my_center|LOCUS_21890 1916 2863 gene locus_tag LOCUS_21900 1916 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence0292 1326 2543 gene locus_tag LOCUS_21910 1326 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2524 3447 gene locus_tag LOCUS_21920 2524 3447 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972872.1 protein_id gnl|my_center|LOCUS_21920 3449 4300 gene locus_tag LOCUS_21930 3449 4300 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0293 2367 394 gene locus_tag LOCUS_21940 2367 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3297 2551 gene locus_tag LOCUS_21950 3297 2551 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_21950 4324 3359 gene locus_tag LOCUS_21960 4324 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence0294 <1 1277 gene locus_tag LOCUS_21970 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679753.1:M3 family oligoendopeptidase 1261 2418 gene locus_tag LOCUS_21980 1261 2418 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_21980 2415 4325 gene locus_tag LOCUS_21990 2415 4325 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence0295 <1 930 gene locus_tag LOCUS_22000 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705335.1:mannose-6-phosphate isomerase, class I 993 2069 gene locus_tag LOCUS_22010 993 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence0296 1648 785 gene locus_tag LOCUS_22020 1648 785 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_22020 1956 4091 gene locus_tag LOCUS_22030 1956 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence0297 1460 171 gene locus_tag LOCUS_22040 1460 171 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974048.1 protein_id gnl|my_center|LOCUS_22040 3260 1506 gene locus_tag LOCUS_22050 gene glmM 3260 1506 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095196.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence0298 27 257 gene locus_tag LOCUS_22060 27 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 259 1518 gene locus_tag LOCUS_22070 259 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1515 2345 gene locus_tag LOCUS_22080 gene pstB 1515 2345 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_22080 2366 3064 gene locus_tag LOCUS_22090 gene phoU 2366 3064 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_22090 <4368 3073 gene locus_tag LOCUS_22100 <4368 3073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein >Feature sequence0299 1538 2764 gene locus_tag LOCUS_22110 1538 2764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_22110 3405 2761 gene locus_tag LOCUS_22120 3405 2761 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_22120 <4336 3454 gene locus_tag LOCUS_22130 <4336 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722692.1:magnesium transporter CorA family protein >Feature sequence0300 304 1056 gene locus_tag LOCUS_22140 gene pxpB 304 1056 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 protein_id gnl|my_center|LOCUS_22140 1053 2009 gene locus_tag LOCUS_22150 1053 2009 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_22150 2012 2770 gene locus_tag LOCUS_22160 2012 2770 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_22160 2793 4085 gene locus_tag LOCUS_22170 2793 4085 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence0301 518 1051 gene locus_tag LOCUS_22180 518 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1574 1879 gene locus_tag LOCUS_22190 1574 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2104 2508 gene locus_tag LOCUS_22200 2104 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2499 3767 gene locus_tag LOCUS_22210 2499 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence0302 1 303 gene locus_tag LOCUS_22220 1 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 669 373 gene locus_tag LOCUS_22230 669 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 906 1889 gene locus_tag LOCUS_22240 gene hprK 906 1889 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_22240 1889 2152 gene locus_tag LOCUS_22250 1889 2152 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_22250 2156 2776 gene locus_tag LOCUS_22260 gene lexA 2156 2776 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_22260 2773 3804 gene locus_tag LOCUS_22270 2773 3804 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657937.1 protein_id gnl|my_center|LOCUS_22270 <4310 3801 gene locus_tag LOCUS_22280 <4310 3801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680446.1:excinuclease ABC subunit UvrC >Feature sequence0303 135 1223 gene locus_tag LOCUS_22290 135 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1231 2037 gene locus_tag LOCUS_22300 1231 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2149 2745 gene locus_tag LOCUS_22310 2149 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2745 3419 gene locus_tag LOCUS_22320 2745 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3409 4191 gene locus_tag LOCUS_22330 3409 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0304 >Feature sequence0305 927 1310 gene locus_tag LOCUS_22340 927 1310 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_22340 1344 1886 gene locus_tag LOCUS_22350 1344 1886 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_22350 3292 2039 gene locus_tag LOCUS_22360 3292 2039 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926985.1 protein_id gnl|my_center|LOCUS_22360 <4297 3369 gene locus_tag LOCUS_22370 <4297 3369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence0306 >Feature sequence0307 209 685 gene locus_tag LOCUS_22380 209 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3020 849 gene locus_tag LOCUS_22390 3020 849 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_22390 <4287 3236 gene locus_tag LOCUS_22400 <4287 3236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022345.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence0308 934 260 gene locus_tag LOCUS_22410 934 260 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_22410 1791 934 gene locus_tag LOCUS_22420 gene ispH 1791 934 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_22420 3068 1863 gene locus_tag LOCUS_22430 gene secF 3068 1863 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_22430 <4280 3069 gene locus_tag LOCUS_22440 <4280 3069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681894.1:protein translocase subunit SecD >Feature sequence0309 943 1959 gene locus_tag LOCUS_22450 gene ebgR 943 1959 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704216.1 protein_id gnl|my_center|LOCUS_22450 <4276 2037 gene locus_tag LOCUS_22460 <4276 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679596.1:preprotein translocase subunit SecA >Feature sequence0310 541 2070 gene locus_tag LOCUS_22470 541 2070 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_22470 2102 2485 gene locus_tag LOCUS_22480 gene gcvH 2102 2485 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_22480 2544 3899 gene locus_tag LOCUS_22490 gene gcvPA 2544 3899 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence0311 <1 1251 gene locus_tag LOCUS_22500 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 1413 1341 gene locus_tag LOCUS_t00290 1413 1341 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1552 1839 gene locus_tag LOCUS_22510 1552 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1836 2855 gene locus_tag LOCUS_22520 gene tsaD 1836 2855 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_22520 2867 3400 gene locus_tag LOCUS_22530 2867 3400 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_22530 3610 4056 gene locus_tag LOCUS_22540 3610 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence0312 907 194 gene locus_tag LOCUS_22550 907 194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454383.1 protein_id gnl|my_center|LOCUS_22550 1587 904 gene locus_tag LOCUS_22560 1587 904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454384.1 protein_id gnl|my_center|LOCUS_22560 2432 1584 gene locus_tag LOCUS_22570 2432 1584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454385.1 protein_id gnl|my_center|LOCUS_22570 3034 2429 gene locus_tag LOCUS_22580 3034 2429 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_22580 3186 4118 gene locus_tag LOCUS_22590 3186 4118 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence0313 653 168 gene locus_tag LOCUS_22600 653 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1168 2001 gene locus_tag LOCUS_22610 1168 2001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_22610 1994 2788 gene locus_tag LOCUS_22620 1994 2788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_22620 2785 3798 gene locus_tag LOCUS_22630 2785 3798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence0314 1395 397 gene locus_tag LOCUS_22640 1395 397 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_22640 2918 1392 gene locus_tag LOCUS_22650 gene xylB 2918 1392 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_22650 3781 2915 gene locus_tag LOCUS_22660 3781 2915 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530860.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence0315 2098 101 gene locus_tag LOCUS_22670 2098 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3887 2175 gene locus_tag LOCUS_22680 3887 2175 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence0316 327 992 gene locus_tag LOCUS_22690 327 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 985 2184 gene locus_tag LOCUS_22700 gene xseA 985 2184 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_22700 2188 2394 gene locus_tag LOCUS_22710 2188 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2408 3277 gene locus_tag LOCUS_22720 gene purU 2408 3277 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0317 1122 814 gene locus_tag LOCUS_22730 1122 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1704 1132 gene locus_tag LOCUS_22740 1704 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1872 3551 gene locus_tag LOCUS_22750 1872 3551 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852428.1 protein_id gnl|my_center|LOCUS_22750 3548 3820 gene locus_tag LOCUS_22760 3548 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0318 459 148 gene locus_tag LOCUS_22770 gene rhaM 459 148 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_22770 1507 470 gene locus_tag LOCUS_22780 1507 470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974438.1 protein_id gnl|my_center|LOCUS_22780 2512 1511 gene locus_tag LOCUS_22790 2512 1511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973085.1 protein_id gnl|my_center|LOCUS_22790 4022 2505 gene locus_tag LOCUS_22800 4022 2505 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046033648.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence0319 1117 20 gene locus_tag LOCUS_22810 1117 20 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_22810 1597 3189 gene locus_tag LOCUS_22820 1597 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence0320 <1 946 gene locus_tag LOCUS_22830 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002658381.1:AI-2E family transporter 943 1827 gene locus_tag LOCUS_22840 943 1827 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_22840 2734 1814 gene locus_tag LOCUS_22850 2734 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence0321 169 1233 gene locus_tag LOCUS_22860 169 1233 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_22860 3754 1235 gene locus_tag LOCUS_22870 3754 1235 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence0322 3072 604 gene locus_tag LOCUS_22880 3072 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3982 3101 gene locus_tag LOCUS_22890 3982 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0323 499 212 gene locus_tag LOCUS_22900 499 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 392 1057 gene locus_tag LOCUS_22910 392 1057 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_22910 1076 2392 gene locus_tag LOCUS_22920 1076 2392 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_22920 2456 3343 gene locus_tag LOCUS_22930 2456 3343 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence0324 3031 1262 gene locus_tag LOCUS_22940 3031 1262 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462045.1 protein_id gnl|my_center|LOCUS_22940 3899 3015 gene locus_tag LOCUS_22950 gene lgt 3899 3015 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0325 2845 2360 gene locus_tag LOCUS_22960 2845 2360 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_22960 4046 2847 gene locus_tag LOCUS_22970 4046 2847 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049809.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence0326 155 643 gene locus_tag LOCUS_22980 155 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 647 2179 gene locus_tag LOCUS_22990 647 2179 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_22990 2179 2958 gene locus_tag LOCUS_23000 gene hpaI 2179 2958 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_23000 2969 4018 gene locus_tag LOCUS_23010 2969 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence0327 1 603 gene locus_tag LOCUS_23020 gene coaE 1 603 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081589.1 protein_id gnl|my_center|LOCUS_23020 632 1810 gene locus_tag LOCUS_23030 632 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2946 1813 gene locus_tag LOCUS_23040 2946 1813 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880259.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence0328 <1 1362 gene locus_tag LOCUS_23050 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393463.1:sensor histidine kinase 1326 2117 gene locus_tag LOCUS_23060 1326 2117 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094988.1 protein_id gnl|my_center|LOCUS_23060 2266 3699 gene locus_tag LOCUS_23070 2266 3699 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence0329 1465 728 gene locus_tag LOCUS_23080 gene fabG 1465 728 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_23080 2438 1467 gene locus_tag LOCUS_23090 gene fabD 2438 1467 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873664.1 protein_id gnl|my_center|LOCUS_23090 3382 2432 gene locus_tag LOCUS_23100 3382 2432 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_23100 3559 4008 gene locus_tag LOCUS_23110 gene accB 3559 4008 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence0330 189 329 gene locus_tag LOCUS_23120 189 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 352 624 gene locus_tag LOCUS_23130 352 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 940 587 gene locus_tag LOCUS_23140 940 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1416 937 gene locus_tag LOCUS_23150 1416 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 1811 1395 gene locus_tag LOCUS_23160 1811 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3729 1813 gene locus_tag LOCUS_23170 3729 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0331 519 220 gene locus_tag LOCUS_23180 519 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1547 1398 gene locus_tag LOCUS_23190 1547 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2552 2433 gene locus_tag LOCUS_23200 2552 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2935 2549 gene locus_tag LOCUS_23210 2935 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence0332 1226 426 gene locus_tag LOCUS_23220 1226 426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619789.1 protein_id gnl|my_center|LOCUS_23220 2152 1223 gene locus_tag LOCUS_23230 2152 1223 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122377.1 protein_id gnl|my_center|LOCUS_23230 2380 3516 gene locus_tag LOCUS_23240 2380 3516 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_23240 3530 3676 gene locus_tag LOCUS_23250 3530 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3783 3941 gene locus_tag LOCUS_23260 3783 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence0333 627 286 gene locus_tag LOCUS_23270 627 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1535 645 gene locus_tag LOCUS_23280 gene rsmH 1535 645 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_23280 1990 1535 gene locus_tag LOCUS_23290 gene mraZ 1990 1535 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_23290 3829 2234 gene locus_tag LOCUS_23300 3829 2234 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965710.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence0334 <1 567 gene locus_tag LOCUS_23310 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289151.1:TrkA family potassium uptake protein 1076 564 gene locus_tag LOCUS_23320 1076 564 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461525.1 protein_id gnl|my_center|LOCUS_23320 1233 2162 gene locus_tag LOCUS_23330 1233 2162 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_23330 2159 2947 gene locus_tag LOCUS_23340 2159 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2940 3806 gene locus_tag LOCUS_23350 2940 3806 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_23350 3811 3981 gene locus_tag LOCUS_23360 3811 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence0335 1037 381 gene locus_tag LOCUS_23370 1037 381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_23370 3341 1041 gene locus_tag LOCUS_23380 3341 1041 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584099.1 protein_id gnl|my_center|LOCUS_23380 3793 3425 gene locus_tag LOCUS_23390 3793 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4055 3983 gene locus_tag LOCUS_t00300 4055 3983 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0336 <1 692 gene locus_tag LOCUS_23400 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680521.1:lysine--tRNA ligase 773 1396 gene locus_tag LOCUS_23410 773 1396 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_23410 2483 1602 gene locus_tag LOCUS_23420 gene era 2483 1602 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_23420 2658 3236 gene locus_tag LOCUS_23430 2658 3236 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence0337 489 1697 gene locus_tag LOCUS_23440 489 1697 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_23440 1873 3507 gene locus_tag LOCUS_23450 1873 3507 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence0338 <1 835 gene locus_tag LOCUS_23460 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356594.1:nucleobase:cation symporter-2 family protein 839 1756 gene locus_tag LOCUS_23470 gene rihB 839 1756 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415422.1 protein_id gnl|my_center|LOCUS_23470 2373 1762 gene locus_tag LOCUS_23480 2373 1762 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225416.1 protein_id gnl|my_center|LOCUS_23480 3089 2370 gene locus_tag LOCUS_23490 gene deoD 3089 2370 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_23490 4000 3089 gene locus_tag LOCUS_23500 4000 3089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence0339 <1 805 gene locus_tag LOCUS_23510 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678892.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase 841 1122 gene locus_tag LOCUS_23520 gene spoVG 841 1122 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_23520 1171 1244 gene locus_tag LOCUS_t00310 1171 1244 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1408 2037 gene locus_tag LOCUS_23530 1408 2037 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_23530 2034 2597 gene locus_tag LOCUS_23540 gene pth 2034 2597 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_23540 2566 3999 gene locus_tag LOCUS_23550 2566 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence0340 604 2238 gene locus_tag LOCUS_23560 gene hcp 604 2238 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_23560 2721 3242 gene locus_tag LOCUS_23570 2721 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence0341 270 2300 gene locus_tag LOCUS_23580 270 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3936 2302 gene locus_tag LOCUS_23590 3936 2302 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence0342 1717 527 gene locus_tag LOCUS_23600 1717 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2237 1710 gene locus_tag LOCUS_23610 2237 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3291 2239 gene locus_tag LOCUS_23620 gene murG 3291 2239 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence0343 <1 672 gene locus_tag LOCUS_23630 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680556.1:glucose-6-phosphate isomerase 2373 796 gene locus_tag LOCUS_23640 2373 796 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_23640 2626 3063 gene locus_tag LOCUS_23650 2626 3063 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0344 310 140 gene locus_tag LOCUS_23660 310 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657037.1 protein_id gnl|my_center|LOCUS_23660 443 736 gene locus_tag LOCUS_23670 gene yidD 443 736 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262564.1 protein_id gnl|my_center|LOCUS_23670 1339 728 gene locus_tag LOCUS_23680 gene udk 1339 728 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655979.1 protein_id gnl|my_center|LOCUS_23680 2386 1355 gene locus_tag LOCUS_23690 2386 1355 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_23690 <3978 2478 gene locus_tag LOCUS_23700 <3978 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957093.1:translation elongation factor 4 >Feature sequence0345 528 1592 gene locus_tag LOCUS_23710 528 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1592 2017 gene locus_tag LOCUS_23720 1592 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2004 2321 gene locus_tag LOCUS_23730 2004 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2318 2638 gene locus_tag LOCUS_23740 2318 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2993 2694 gene locus_tag LOCUS_23750 2993 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 3234 2911 gene locus_tag LOCUS_23760 3234 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3484 3284 gene locus_tag LOCUS_23770 3484 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3815 3468 gene locus_tag LOCUS_23780 3815 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence0346 1834 3591 gene locus_tag LOCUS_23790 1834 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence0347 167 598 gene locus_tag LOCUS_23800 167 598 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263615.1 protein_id gnl|my_center|LOCUS_23800 616 1749 gene locus_tag LOCUS_23810 616 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1746 3011 gene locus_tag LOCUS_23820 1746 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3119 3556 gene locus_tag LOCUS_23830 3119 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence0348 557 1318 gene locus_tag LOCUS_23840 557 1318 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971078.1 protein_id gnl|my_center|LOCUS_23840 1473 3182 gene locus_tag LOCUS_23850 1473 3182 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence0349 967 236 gene locus_tag LOCUS_23860 967 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1964 1080 gene locus_tag LOCUS_23870 1964 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3357 2410 gene locus_tag LOCUS_23880 3357 2410 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_23880 <3944 3354 gene locus_tag LOCUS_23890 <3944 3354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430704.1:transketolase >Feature sequence0350 1110 205 gene locus_tag LOCUS_23900 1110 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2492 1122 gene locus_tag LOCUS_23910 2492 1122 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence0351 3208 2369 gene locus_tag LOCUS_23920 3208 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0352 885 52 gene locus_tag LOCUS_23930 885 52 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 protein_id gnl|my_center|LOCUS_23930 1778 900 gene locus_tag LOCUS_23940 1778 900 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_23940 3146 1845 gene locus_tag LOCUS_23950 3146 1845 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331252.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence0353 1486 179 gene locus_tag LOCUS_23960 1486 179 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_23960 2125 1502 gene locus_tag LOCUS_23970 2125 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2213 3628 gene locus_tag LOCUS_23980 gene sbcB 2213 3628 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_23980 3882 3625 gene locus_tag LOCUS_23990 3882 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence0354 1641 172 gene locus_tag LOCUS_24000 1641 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1880 3676 gene locus_tag LOCUS_24010 1880 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence0355 2 175 gene locus_tag LOCUS_24020 2 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 319 1407 gene locus_tag LOCUS_24030 319 1407 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_24030 2802 1552 gene locus_tag LOCUS_24040 2802 1552 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_24040 3281 3018 gene locus_tag LOCUS_24050 3281 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence0356 75 728 gene locus_tag LOCUS_24060 75 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 715 1629 gene locus_tag LOCUS_24070 715 1629 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658007.1 protein_id gnl|my_center|LOCUS_24070 1631 2230 gene locus_tag LOCUS_24080 1631 2230 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_24080 3674 2217 gene locus_tag LOCUS_24090 3674 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3784 3870 gene locus_tag LOCUS_t00320 3784 3870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0357 >Feature sequence0358 720 130 gene locus_tag LOCUS_24100 gene recR 720 130 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_24100 1037 723 gene locus_tag LOCUS_24110 1037 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2801 1047 gene locus_tag LOCUS_24120 2801 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence0359 1105 299 gene locus_tag LOCUS_24130 1105 299 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence0360 <1 932 gene locus_tag LOCUS_24140 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338051.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA 929 2035 gene locus_tag LOCUS_24150 929 2035 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_24150 2092 3666 gene locus_tag LOCUS_24160 2092 3666 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence0361 165 1547 gene locus_tag LOCUS_24170 165 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1544 2314 gene locus_tag LOCUS_24180 1544 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2317 3435 gene locus_tag LOCUS_24190 2317 3435 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence0362 840 2111 gene locus_tag LOCUS_24200 840 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2181 3059 gene locus_tag LOCUS_24210 2181 3059 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0363 433 1320 gene locus_tag LOCUS_24220 433 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2221 1283 gene locus_tag LOCUS_24230 2221 1283 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964913.1 protein_id gnl|my_center|LOCUS_24230 3339 2218 gene locus_tag LOCUS_24240 3339 2218 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence0364 272 1222 gene locus_tag LOCUS_24250 272 1222 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_24250 1240 1812 gene locus_tag LOCUS_24260 gene pgiA 1240 1812 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_24260 1820 2749 gene locus_tag LOCUS_24270 1820 2749 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066689.1 protein_id gnl|my_center|LOCUS_24270 2753 3379 gene locus_tag LOCUS_24280 2753 3379 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence0365 1122 151 gene locus_tag LOCUS_24290 1122 151 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_24290 2115 1126 gene locus_tag LOCUS_24300 2115 1126 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101846.1 protein_id gnl|my_center|LOCUS_24300 2852 2118 gene locus_tag LOCUS_24310 gene lsrF 2852 2118 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219792.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0366 <1 1237 gene locus_tag LOCUS_24320 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002665762.1:threonine--tRNA ligase 1298 3412 gene locus_tag LOCUS_24330 1298 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence0367 <1 552 gene locus_tag LOCUS_24340 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein note possible pseudo, internal stop codon 628 1431 gene locus_tag LOCUS_24350 628 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24350 >Feature sequence0368 1138 428 gene locus_tag LOCUS_24360 1138 428 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_24360 1253 1588 gene locus_tag LOCUS_24370 1253 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2529 1585 gene locus_tag LOCUS_24380 2529 1585 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367501.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence0369 2552 1323 gene locus_tag LOCUS_24390 2552 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2739 3527 gene locus_tag LOCUS_24400 2739 3527 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence0370 1355 438 gene locus_tag LOCUS_24410 gene dapA 1355 438 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583510.1 protein_id gnl|my_center|LOCUS_24410 2758 1490 gene locus_tag LOCUS_24420 2758 1490 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_24420 3541 2852 gene locus_tag LOCUS_24430 3541 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence0371 38 1852 gene locus_tag LOCUS_24440 38 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1849 2286 gene locus_tag LOCUS_24450 1849 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2423 2995 gene locus_tag LOCUS_24460 2423 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence0372 <1 1542 gene locus_tag LOCUS_24470 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673498.1:transcription elongation factor GreA 1618 3321 gene locus_tag LOCUS_24480 1618 3321 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence0373 264 743 gene locus_tag LOCUS_24490 264 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2563 794 gene locus_tag LOCUS_24500 2563 794 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 protein_id gnl|my_center|LOCUS_24500 3748 2567 gene locus_tag LOCUS_24510 3748 2567 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence0374 >Feature sequence0375 1481 534 gene locus_tag LOCUS_24520 1481 534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_24520 2554 1550 gene locus_tag LOCUS_24530 2554 1550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_24530 3084 2770 gene locus_tag LOCUS_24540 3084 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0376 688 996 gene locus_tag LOCUS_24550 688 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1017 1145 gene locus_tag LOCUS_24560 1017 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1142 1978 gene locus_tag LOCUS_24570 1142 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1975 2370 gene locus_tag LOCUS_24580 1975 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence0377 2288 3529 gene locus_tag LOCUS_24590 2288 3529 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769287.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence0378 3 1109 gene locus_tag LOCUS_24600 3 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1987 1331 gene locus_tag LOCUS_24610 1987 1331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_24610 2114 3067 gene locus_tag LOCUS_24620 2114 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence0379 1538 153 gene locus_tag LOCUS_24630 1538 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2544 1531 gene locus_tag LOCUS_24640 2544 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3029 3601 gene locus_tag LOCUS_24650 3029 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence0380 2765 2373 gene locus_tag LOCUS_24660 2765 2373 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203134.1 protein_id gnl|my_center|LOCUS_24660 3131 3409 gene locus_tag LOCUS_24670 3131 3409 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence0381 1418 2347 gene locus_tag LOCUS_24680 gene oppB 1418 2347 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence0382 687 403 gene locus_tag LOCUS_24690 687 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1077 688 gene locus_tag LOCUS_24700 1077 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1681 1157 gene locus_tag LOCUS_24710 1681 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2310 1594 gene locus_tag LOCUS_24720 2310 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2459 2310 gene locus_tag LOCUS_24730 2459 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2742 2464 gene locus_tag LOCUS_24740 2742 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3520 2756 gene locus_tag LOCUS_24750 3520 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0383 1288 371 gene locus_tag LOCUS_24760 1288 371 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676956.1 protein_id gnl|my_center|LOCUS_24760 2060 1281 gene locus_tag LOCUS_24770 gene accD 2060 1281 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672437.1 protein_id gnl|my_center|LOCUS_24770 3390 2050 gene locus_tag LOCUS_24780 3390 2050 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681761.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence0384 93 1751 gene locus_tag LOCUS_24790 93 1751 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_24790 1894 3339 gene locus_tag LOCUS_24800 1894 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence0385 215 1252 gene locus_tag LOCUS_24810 215 1252 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_24810 1390 1995 gene locus_tag LOCUS_24820 1390 1995 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_24820 3300 1978 gene locus_tag LOCUS_24830 3300 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence0386 3703 2693 gene locus_tag LOCUS_24840 3703 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0387 1651 1055 gene locus_tag LOCUS_24850 1651 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1763 1614 gene locus_tag LOCUS_24860 1763 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1861 2874 gene locus_tag LOCUS_24870 gene ccpA 1861 2874 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence0388 2298 460 gene locus_tag LOCUS_24880 2298 460 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_24880 2911 2300 gene locus_tag LOCUS_24890 2911 2300 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_24890 3571 2921 gene locus_tag LOCUS_24900 3571 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0389 <1 1698 gene locus_tag LOCUS_24910 <1 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039227.1:ATP-binding protein 1695 2873 gene locus_tag LOCUS_24920 1695 2873 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_24920 <3665 2898 gene locus_tag LOCUS_24930 <3665 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048169508.1:aldo/keto reductase >Feature sequence0390 474 698 gene locus_tag LOCUS_24940 474 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 698 1507 gene locus_tag LOCUS_24950 698 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1573 2838 gene locus_tag LOCUS_24960 1573 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2831 3262 gene locus_tag LOCUS_24970 2831 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence0391 1262 405 gene locus_tag LOCUS_24980 1262 405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_24980 2364 1252 gene locus_tag LOCUS_24990 2364 1252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_24990 3512 2433 gene locus_tag LOCUS_25000 3512 2433 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158337.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence0392 2031 1300 gene locus_tag LOCUS_25010 2031 1300 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_25010 2269 2018 gene locus_tag LOCUS_25020 2269 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 <3658 2272 gene locus_tag LOCUS_25030 <3658 2272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773625.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence0393 2487 670 gene locus_tag LOCUS_25040 gene lepA 2487 670 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_25040 <3650 2496 gene locus_tag LOCUS_25050 <3650 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002656600.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0394 1368 961 gene locus_tag LOCUS_25060 1368 961 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_25060 1492 2187 gene locus_tag LOCUS_25070 1492 2187 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_25070 2278 3123 gene locus_tag LOCUS_25080 2278 3123 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948267.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence0395 993 481 gene locus_tag LOCUS_25090 993 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1975 983 gene locus_tag LOCUS_25100 1975 983 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081416.1 protein_id gnl|my_center|LOCUS_25100 <3647 1984 gene locus_tag LOCUS_25110 <3647 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262603.1:patatin-like phospholipase family protein >Feature sequence0396 1118 2881 gene locus_tag LOCUS_25120 1118 2881 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_25120 2912 3607 gene locus_tag LOCUS_25130 gene araD 2912 3607 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence0397 <1 1011 gene locus_tag LOCUS_25140 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979761.1:4Fe-4S binding protein 1134 1015 gene locus_tag LOCUS_25150 1134 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1115 1471 gene locus_tag LOCUS_25160 1115 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2382 1417 gene locus_tag LOCUS_25170 2382 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25170 2951 2442 gene locus_tag LOCUS_25180 2951 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3428 2991 gene locus_tag LOCUS_25190 3428 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25190 >Feature sequence0398 1538 126 gene locus_tag LOCUS_25200 1538 126 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681576.1 protein_id gnl|my_center|LOCUS_25200 1793 2740 gene locus_tag LOCUS_25210 1793 2740 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence0399 166 1932 gene locus_tag LOCUS_25220 gene ade 166 1932 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_25220 2700 1945 gene locus_tag LOCUS_25230 2700 1945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066010.1 protein_id gnl|my_center|LOCUS_25230 <3626 2697 gene locus_tag LOCUS_25240 <3626 2697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460845.1:iron ABC transporter permease >Feature sequence0400 1080 793 gene locus_tag LOCUS_25250 1080 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1240 2247 gene locus_tag LOCUS_25260 gene pdxA 1240 2247 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_25260 2244 3440 gene locus_tag LOCUS_25270 2244 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence0401 1070 1330 gene locus_tag LOCUS_25280 1070 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2302 1271 gene locus_tag LOCUS_25290 2302 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3520 2486 gene locus_tag LOCUS_25300 3520 2486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence0402 <1 1011 gene locus_tag LOCUS_25310 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230588.1:alpha/beta hydrolase 1850 1008 gene locus_tag LOCUS_25320 1850 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2597 1917 gene locus_tag LOCUS_25330 2597 1917 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_25330 <3619 2768 gene locus_tag LOCUS_25340 <3619 2768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266701.1:TRAP transporter substrate-binding protein >Feature sequence0403 559 1200 gene locus_tag LOCUS_25350 559 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1206 2093 gene locus_tag LOCUS_25360 1206 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2105 2944 gene locus_tag LOCUS_25370 2105 2944 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080508.1 protein_id gnl|my_center|LOCUS_25370 <3615 3042 gene locus_tag LOCUS_25380 <3615 3042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964974.1:HD domain-containing protein >Feature sequence0404 52 3381 gene locus_tag LOCUS_25390 gene brxC 52 3381 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence0405 1255 14 gene locus_tag LOCUS_25400 1255 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2056 1334 gene locus_tag LOCUS_25410 2056 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence0406 <1 670 gene locus_tag LOCUS_25420 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924829.1:sigma-54 dependent transcriptional regulator 686 2401 gene locus_tag LOCUS_25430 686 2401 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_25430 2385 3542 gene locus_tag LOCUS_25440 2385 3542 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence0407 <1 1656 gene locus_tag LOCUS_25450 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965008.1:HAMP domain-containing sensor histidine kinase 2343 1663 gene locus_tag LOCUS_25460 gene phoU 2343 1663 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_25460 3182 2361 gene locus_tag LOCUS_25470 gene pstB 3182 2361 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence0408 1283 531 gene locus_tag LOCUS_25480 1283 531 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_25480 1845 1375 gene locus_tag LOCUS_25490 1845 1375 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_25490 1923 3119 gene locus_tag LOCUS_25500 1923 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0409 <1 790 gene locus_tag LOCUS_25510 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971286.1:phage major capsid protein 802 1203 gene locus_tag LOCUS_25520 802 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1255 1830 gene locus_tag LOCUS_25530 1255 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1827 2297 gene locus_tag LOCUS_25540 1827 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2281 2733 gene locus_tag LOCUS_25550 2281 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence0410 465 73 gene locus_tag LOCUS_25560 465 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 859 554 gene locus_tag LOCUS_25570 859 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1138 875 gene locus_tag LOCUS_25580 1138 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1449 1213 gene locus_tag LOCUS_25590 1449 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2571 1591 gene locus_tag LOCUS_25600 2571 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2800 2576 gene locus_tag LOCUS_25610 2800 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence0411 3003 2173 gene locus_tag LOCUS_25620 3003 2173 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_25620 <3594 3000 gene locus_tag LOCUS_25630 <3594 3000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112931.1:sugar ABC transporter permease >Feature sequence0412 1 423 gene locus_tag LOCUS_25640 1 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 511 2205 gene locus_tag LOCUS_25650 511 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2217 3299 gene locus_tag LOCUS_25660 2217 3299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence0413 1418 171 gene locus_tag LOCUS_25670 1418 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2842 1415 gene locus_tag LOCUS_25680 2842 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence0414 1416 382 gene locus_tag LOCUS_25690 gene asnA 1416 382 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_25690 1513 2130 gene locus_tag LOCUS_25700 1513 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence0415 88 15 gene locus_tag LOCUS_t00330 88 15 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 277 2790 gene locus_tag LOCUS_25710 277 2790 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_25710 3091 3327 gene locus_tag LOCUS_25720 3091 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence0416 636 2000 gene locus_tag LOCUS_25730 gene mnmE 636 2000 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence0417 376 900 gene locus_tag LOCUS_25740 376 900 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25740 1073 1861 gene locus_tag LOCUS_25750 1073 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2546 1854 gene locus_tag LOCUS_25760 2546 1854 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164405296.1 protein_id gnl|my_center|LOCUS_25760 2636 3244 gene locus_tag LOCUS_25770 2636 3244 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120379.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence0418 898 353 gene locus_tag LOCUS_25780 898 353 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_25780 <3548 953 gene locus_tag LOCUS_25790 <3548 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098161.1:beta-galactosidase >Feature sequence0419 >Feature sequence0420 542 2026 gene locus_tag LOCUS_25800 gene araA 542 2026 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082981.1 protein_id gnl|my_center|LOCUS_25800 3533 2112 gene locus_tag LOCUS_25810 3533 2112 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0421 207 1013 gene locus_tag LOCUS_25820 207 1013 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_25820 1016 2359 gene locus_tag LOCUS_25830 1016 2359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_25830 2356 3162 gene locus_tag LOCUS_25840 2356 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0422 1241 456 gene locus_tag LOCUS_25850 1241 456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_25850 1448 3004 gene locus_tag LOCUS_25860 1448 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3009 3488 gene locus_tag LOCUS_25870 3009 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence0423 76 489 gene locus_tag LOCUS_25880 76 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 476 1276 gene locus_tag LOCUS_25890 476 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1346 1798 gene locus_tag LOCUS_25900 gene ssb 1346 1798 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869403.1 protein_id gnl|my_center|LOCUS_25900 1770 2183 gene locus_tag LOCUS_25910 1770 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2161 2691 gene locus_tag LOCUS_25920 2161 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2684 2803 gene locus_tag LOCUS_25930 2684 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence0424 3044 1983 gene locus_tag LOCUS_25940 3044 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence0425 1189 65 gene locus_tag LOCUS_25950 1189 65 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_25950 1764 1192 gene locus_tag LOCUS_25960 1764 1192 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_25960 2840 1764 gene locus_tag LOCUS_25970 2840 1764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_25970 3195 2890 gene locus_tag LOCUS_25980 3195 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence0426 414 1397 gene locus_tag LOCUS_25990 414 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1426 2028 gene locus_tag LOCUS_26000 gene rdgB 1426 2028 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence0427 36 1409 gene locus_tag LOCUS_26010 36 1409 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_26010 1406 1627 gene locus_tag LOCUS_26020 1406 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1624 2034 gene locus_tag LOCUS_26030 1624 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2702 2112 gene locus_tag LOCUS_26040 2702 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296481.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence0428 <1 775 gene locus_tag LOCUS_26050 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249697.1:ABC transporter ATP-binding protein 772 1536 gene locus_tag LOCUS_26060 772 1536 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377902.1 protein_id gnl|my_center|LOCUS_26060 1547 2068 gene locus_tag LOCUS_26070 1547 2068 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099527.1 protein_id gnl|my_center|LOCUS_26070 2127 3467 gene locus_tag LOCUS_26080 2127 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence0429 <1 501 gene locus_tag LOCUS_26090 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679981.1:alpha/beta hydrolase 504 1745 gene locus_tag LOCUS_26100 504 1745 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_26100 2545 1742 gene locus_tag LOCUS_26110 2545 1742 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_26110 2639 3103 gene locus_tag LOCUS_26120 2639 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3488 3093 gene locus_tag LOCUS_26130 3488 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence0430 <1 514 gene locus_tag LOCUS_26140 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869442.1:DRTGG domain-containing protein 516 938 gene locus_tag LOCUS_26150 516 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 935 2272 gene locus_tag LOCUS_26160 935 2272 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_26160 <3492 2235 gene locus_tag LOCUS_26170 <3492 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002665373.1:insulinase family protein >Feature sequence0431 <1 904 gene locus_tag LOCUS_26180 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775184.1:glycoside hydrolase family 88 protein 924 2351 gene locus_tag LOCUS_26190 924 2351 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0432 219 797 gene locus_tag LOCUS_26200 gene grpE 219 797 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064038.1 protein_id gnl|my_center|LOCUS_26200 882 2810 gene locus_tag LOCUS_26210 gene dnaK 882 2810 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence0433 144 1028 gene locus_tag LOCUS_26220 144 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1039 2445 gene locus_tag LOCUS_26230 1039 2445 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence0434 88 753 gene locus_tag LOCUS_26240 88 753 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_26240 1974 745 gene locus_tag LOCUS_26250 gene icd 1974 745 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108123.1 protein_id gnl|my_center|LOCUS_26250 <3481 1974 gene locus_tag LOCUS_26260 <3481 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948184.1:aconitate hydratase >Feature sequence0435 <1 1538 gene locus_tag LOCUS_26270 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173668762.1:ATP-dependent DNA helicase UvrD2 1535 2719 gene locus_tag LOCUS_26280 1535 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3126 2755 gene locus_tag LOCUS_26290 3126 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence0436 1830 370 gene locus_tag LOCUS_26300 1830 370 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_26300 3123 1846 gene locus_tag LOCUS_26310 gene serS 3123 1846 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence0437 1308 385 gene locus_tag LOCUS_26320 1308 385 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_26320 1398 2270 gene locus_tag LOCUS_26330 1398 2270 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_26330 3177 2284 gene locus_tag LOCUS_26340 gene murQ 3177 2284 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775346.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence0438 858 205 gene locus_tag LOCUS_26350 858 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2024 891 gene locus_tag LOCUS_26360 2024 891 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_26360 3443 2115 gene locus_tag LOCUS_26370 3443 2115 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence0439 184 1401 gene locus_tag LOCUS_26380 184 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1404 1874 gene locus_tag LOCUS_26390 gene rpiB 1404 1874 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_26390 1871 3052 gene locus_tag LOCUS_26400 1871 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence0440 2052 547 gene locus_tag LOCUS_26410 gene nusA 2052 547 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_26410 2605 2042 gene locus_tag LOCUS_26420 2605 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3197 2715 gene locus_tag LOCUS_26430 3197 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence0441 1707 982 gene locus_tag LOCUS_26440 1707 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_26440 2936 1704 gene locus_tag LOCUS_26450 2936 1704 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_26450 3366 2938 gene locus_tag LOCUS_26460 3366 2938 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392805.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence0442 960 832 gene locus_tag LOCUS_26470 960 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1507 1154 gene locus_tag LOCUS_26480 1507 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence0443 213 947 gene locus_tag LOCUS_26490 213 947 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_26490 1570 950 gene locus_tag LOCUS_26500 1570 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1624 2634 gene locus_tag LOCUS_26510 1624 2634 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039458.1 protein_id gnl|my_center|LOCUS_26510 2646 3077 gene locus_tag LOCUS_26520 2646 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3077 3238 gene locus_tag LOCUS_26530 3077 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence0444 314 33 gene locus_tag LOCUS_26540 314 33 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_26540 1987 311 gene locus_tag LOCUS_26550 gene recN 1987 311 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_26550 2843 1980 gene locus_tag LOCUS_26560 2843 1980 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence0445 <1 2182 gene locus_tag LOCUS_26570 <1 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679596.1:preprotein translocase subunit SecA 3345 2242 gene locus_tag LOCUS_26580 3345 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence0446 1260 673 gene locus_tag LOCUS_26590 1260 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1490 1269 gene locus_tag LOCUS_26600 1490 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2833 1586 gene locus_tag LOCUS_26610 2833 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence0447 2800 83 gene locus_tag LOCUS_26620 gene ppdK 2800 83 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence0448 222 1262 gene locus_tag LOCUS_26630 gene hemW 222 1262 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_26630 1347 2096 gene locus_tag LOCUS_26640 1347 2096 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_26640 2100 2594 gene locus_tag LOCUS_26650 gene ruvC 2100 2594 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_26650 2591 3223 gene locus_tag LOCUS_26660 gene ruvA 2591 3223 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence0449 1341 829 gene locus_tag LOCUS_26670 1341 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1516 2601 gene locus_tag LOCUS_26680 1516 2601 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_26680 3236 2598 gene locus_tag LOCUS_26690 3236 2598 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence0450 88 594 gene locus_tag LOCUS_26700 88 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 624 1259 gene locus_tag LOCUS_26710 624 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1271 1477 gene locus_tag LOCUS_26720 1271 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1494 2114 gene locus_tag LOCUS_26730 1494 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2111 2545 gene locus_tag LOCUS_26740 2111 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2542 2907 gene locus_tag LOCUS_26750 2542 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2897 3109 gene locus_tag LOCUS_26760 2897 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence0451 1825 758 gene locus_tag LOCUS_26770 1825 758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_26770 <3377 1822 gene locus_tag LOCUS_26780 <3377 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732280.1:ABC transporter ATP-binding protein >Feature sequence0452 <1 796 gene locus_tag LOCUS_26790 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706024.1:selenium-dependent molybdenum cofactor biosynthesis protein YqeB 861 1988 gene locus_tag LOCUS_26800 861 1988 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_26800 1999 2967 gene locus_tag LOCUS_26810 1999 2967 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence0453 287 985 gene locus_tag LOCUS_26820 gene ulaF 287 985 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170813.1 protein_id gnl|my_center|LOCUS_26820 1234 2196 gene locus_tag LOCUS_26830 1234 2196 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040322.1 protein_id gnl|my_center|LOCUS_26830 2266 2790 gene locus_tag LOCUS_26840 2266 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0454 1235 285 gene locus_tag LOCUS_26850 gene kdgK 1235 285 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 protein_id gnl|my_center|LOCUS_26850 2026 1232 gene locus_tag LOCUS_26860 2026 1232 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439844.1 protein_id gnl|my_center|LOCUS_26860 2608 2321 gene locus_tag LOCUS_26870 2608 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2894 2598 gene locus_tag LOCUS_26880 2894 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence0455 <1 1939 gene locus_tag LOCUS_26890 <1 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545329.1:vitamin B12-dependent ribonucleotide reductase 1920 3224 gene locus_tag LOCUS_26900 1920 3224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence0456 212 415 gene locus_tag LOCUS_26910 212 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 697 623 gene locus_tag LOCUS_t00340 697 623 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 754 1401 gene locus_tag LOCUS_26920 754 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1792 1346 gene locus_tag LOCUS_26930 1792 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2030 2260 gene locus_tag LOCUS_26940 gene rpmB 2030 2260 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence0457 <1 1093 gene locus_tag LOCUS_26950 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393219.1:NADH-dependent [FeFe] hydrogenase, group A6 1152 2378 gene locus_tag LOCUS_26960 1152 2378 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404741.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence0458 1617 130 gene locus_tag LOCUS_26970 1617 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1797 3005 gene locus_tag LOCUS_26980 1797 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence0459 148 558 gene locus_tag LOCUS_26990 gene ybgC 148 558 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 protein_id gnl|my_center|LOCUS_26990 1783 545 gene locus_tag LOCUS_27000 1783 545 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946662.1 protein_id gnl|my_center|LOCUS_27000 2175 1780 gene locus_tag LOCUS_27010 gene umuD 2175 1780 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705001.1 protein_id gnl|my_center|LOCUS_27010 3197 2217 gene locus_tag LOCUS_27020 3197 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence0460 35 1483 gene locus_tag LOCUS_27030 35 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2132 1467 gene locus_tag LOCUS_27040 2132 1467 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435225.1 protein_id gnl|my_center|LOCUS_27040 2403 2116 gene locus_tag LOCUS_27050 2403 2116 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889969.1 protein_id gnl|my_center|LOCUS_27050 <3348 2473 gene locus_tag LOCUS_27060 <3348 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001971889.1:helix-turn-helix domain-containing protein >Feature sequence0461 <1 946 gene locus_tag LOCUS_27070 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038038884.1:prephenate dehydratase 948 1493 gene locus_tag LOCUS_27080 948 1493 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_27080 1497 2225 gene locus_tag LOCUS_27090 1497 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence0462 <1 508 gene locus_tag LOCUS_27100 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357916.1:ABC transporter permease 511 1518 gene locus_tag LOCUS_27110 511 1518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_27110 1569 2618 gene locus_tag LOCUS_27120 1569 2618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence0463 2388 1276 gene locus_tag LOCUS_27130 2388 1276 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence0464 730 816 gene locus_tag LOCUS_t00350 730 816 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1098 1274 gene locus_tag LOCUS_27140 1098 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1896 1645 gene locus_tag LOCUS_27150 1896 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2849 2367 gene locus_tag LOCUS_27160 2849 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence0465 973 167 gene locus_tag LOCUS_27170 gene sgcQ 973 167 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_27170 1802 1023 gene locus_tag LOCUS_27180 1802 1023 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963554.1 protein_id gnl|my_center|LOCUS_27180 2631 1936 gene locus_tag LOCUS_27190 2631 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 <3325 2809 gene locus_tag LOCUS_27200 <3325 2809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001286139.1:L-fuculose-phosphate aldolase >Feature sequence0466 1386 532 gene locus_tag LOCUS_27210 1386 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2112 1471 gene locus_tag LOCUS_27220 2112 1471 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_27220 <3319 2123 gene locus_tag LOCUS_27230 <3319 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838309.1:PAS domain S-box protein >Feature sequence0467 202 435 gene locus_tag LOCUS_27240 202 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1226 1441 gene locus_tag LOCUS_27250 1226 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2502 2350 gene locus_tag LOCUS_27260 2502 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2862 2566 gene locus_tag LOCUS_27270 2862 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3105 3272 gene locus_tag LOCUS_27280 3105 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0468 <1 1614 gene locus_tag LOCUS_27290 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668994.1:transcription termination factor Rho 1690 1893 gene locus_tag LOCUS_27300 gene rpmE 1690 1893 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_27300 2094 3263 gene locus_tag LOCUS_27310 2094 3263 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence0469 <1 1162 gene locus_tag LOCUS_27320 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023692.1:acetolactate synthase large subunit 1356 1156 gene locus_tag LOCUS_27330 1356 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1622 2116 gene locus_tag LOCUS_27340 1622 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2116 2601 gene locus_tag LOCUS_27350 2116 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence0470 313 759 gene locus_tag LOCUS_27360 313 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 753 2483 gene locus_tag LOCUS_27370 753 2483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0471 <1 694 gene locus_tag LOCUS_27380 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545399.1:ABC transporter permease 737 2032 gene locus_tag LOCUS_27390 737 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence0472 3115 1022 gene locus_tag LOCUS_27400 3115 1022 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0473 1886 198 gene locus_tag LOCUS_27410 1886 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2677 2015 gene locus_tag LOCUS_27420 2677 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3011 2877 gene locus_tag LOCUS_27430 3011 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence0474 109 37 gene locus_tag LOCUS_t00360 109 37 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 192 809 gene locus_tag LOCUS_27440 192 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 941 1726 gene locus_tag LOCUS_27450 941 1726 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_27450 1736 2878 gene locus_tag LOCUS_27460 1736 2878 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence0475 <1 632 gene locus_tag LOCUS_27470 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120973.1:galactose mutarotase 632 1390 gene locus_tag LOCUS_27480 632 1390 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_27480 1387 1998 gene locus_tag LOCUS_27490 gene udk 1387 1998 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655979.1 protein_id gnl|my_center|LOCUS_27490 2309 2010 gene locus_tag LOCUS_27500 gene yidD 2309 2010 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262564.1 protein_id gnl|my_center|LOCUS_27500 2438 2608 gene locus_tag LOCUS_27510 2438 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657037.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence0476 118 543 gene locus_tag LOCUS_27520 118 543 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_27520 1395 508 gene locus_tag LOCUS_27530 gene speB 1395 508 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_27530 2517 1405 gene locus_tag LOCUS_27540 gene nspC 2517 1405 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_27540 <3271 2520 gene locus_tag LOCUS_27550 <3271 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764762.1:saccharopine dehydrogenase family protein >Feature sequence0477 930 1937 gene locus_tag LOCUS_27560 gene lepB 930 1937 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661914.1 protein_id gnl|my_center|LOCUS_27560 1937 3136 gene locus_tag LOCUS_27570 gene hemW 1937 3136 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence0478 2645 402 gene locus_tag LOCUS_27580 2645 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence0479 75 1349 gene locus_tag LOCUS_27590 75 1349 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_27590 1415 2368 gene locus_tag LOCUS_27600 1415 2368 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_27600 2365 3183 gene locus_tag LOCUS_27610 2365 3183 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582884.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence0480 181 828 gene locus_tag LOCUS_27620 181 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 833 1720 gene locus_tag LOCUS_27630 833 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1731 2573 gene locus_tag LOCUS_27640 1731 2573 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666565.1 protein_id gnl|my_center|LOCUS_27640 <3256 2570 gene locus_tag LOCUS_27650 <3256 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964974.1:HD domain-containing protein >Feature sequence0481 1003 71 gene locus_tag LOCUS_27660 1003 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1517 996 gene locus_tag LOCUS_27670 1517 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1777 2925 gene locus_tag LOCUS_27680 gene metK 1777 2925 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence0482 17 1702 gene locus_tag LOCUS_27690 gene asnB 17 1702 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_27690 2204 2929 gene locus_tag LOCUS_27700 2204 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence0483 561 1361 gene locus_tag LOCUS_27710 561 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3209 1362 gene locus_tag LOCUS_27720 3209 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence0484 1302 400 gene locus_tag LOCUS_27730 1302 400 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_27730 2572 1286 gene locus_tag LOCUS_27740 2572 1286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086911.1 protein_id gnl|my_center|LOCUS_27740 <3243 2633 gene locus_tag LOCUS_27750 <3243 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257156.1:carbohydrate ABC transporter permease >Feature sequence0485 1397 594 gene locus_tag LOCUS_27760 1397 594 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_27760 1533 2795 gene locus_tag LOCUS_27770 1533 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence0486 898 122 gene locus_tag LOCUS_27780 898 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1166 957 gene locus_tag LOCUS_27790 1166 957 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 protein_id gnl|my_center|LOCUS_27790 1261 1333 gene locus_tag LOCUS_t00370 1261 1333 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1410 1925 gene locus_tag LOCUS_27800 1410 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1981 2766 gene locus_tag LOCUS_27810 1981 2766 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence0487 1345 323 gene locus_tag LOCUS_27820 1345 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1966 1355 gene locus_tag LOCUS_27830 gene lpoB 1966 1355 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence0488 1420 380 gene locus_tag LOCUS_27840 gene argC 1420 380 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_27840 2201 1515 gene locus_tag LOCUS_27850 2201 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2604 2233 gene locus_tag LOCUS_27860 2604 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0489 <1 868 gene locus_tag LOCUS_27870 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957235.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 1469 858 gene locus_tag LOCUS_27880 gene tmk 1469 858 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence0490 2296 1067 gene locus_tag LOCUS_27890 2296 1067 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_27890 <3226 2299 gene locus_tag LOCUS_27900 <3226 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939154.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence0491 259 89 gene locus_tag LOCUS_27910 259 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 762 835 gene locus_tag LOCUS_t00380 762 835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1330 1211 gene locus_tag LOCUS_27920 1330 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence0492 460 675 gene locus_tag LOCUS_27930 460 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 903 1718 gene locus_tag LOCUS_27940 903 1718 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_27940 1851 2486 gene locus_tag LOCUS_27950 1851 2486 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence0493 2505 1339 gene locus_tag LOCUS_27960 2505 1339 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence0494 <1 579 gene locus_tag LOCUS_27970 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461647.1:Crp/Fnr family transcriptional regulator 1118 582 gene locus_tag LOCUS_27980 1118 582 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493254.1 protein_id gnl|my_center|LOCUS_27980 1600 1115 gene locus_tag LOCUS_27990 1600 1115 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_27990 1957 2400 gene locus_tag LOCUS_28000 1957 2400 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0495 1169 333 gene locus_tag LOCUS_28010 1169 333 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016859.1 protein_id gnl|my_center|LOCUS_28010 2038 1292 gene locus_tag LOCUS_28020 2038 1292 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0496 450 2228 gene locus_tag LOCUS_28030 gene mutL 450 2228 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656028.1 protein_id gnl|my_center|LOCUS_28030 2671 2225 gene locus_tag LOCUS_28040 2671 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence0497 1008 166 gene locus_tag LOCUS_28050 1008 166 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_28050 1912 1019 gene locus_tag LOCUS_28060 1912 1019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_28060 3197 1989 gene locus_tag LOCUS_28070 3197 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0498 1318 542 gene locus_tag LOCUS_28080 gene tauC 1318 542 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 protein_id gnl|my_center|LOCUS_28080 2462 1386 gene locus_tag LOCUS_28090 2462 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 <3204 2533 gene locus_tag LOCUS_28100 <3204 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703923.1:ribose operon transcriptional repressor RbsR >Feature sequence0499 316 1122 gene locus_tag LOCUS_28110 316 1122 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173484.1 protein_id gnl|my_center|LOCUS_28110 1132 2103 gene locus_tag LOCUS_28120 1132 2103 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence0500 898 185 gene locus_tag LOCUS_28130 898 185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067353.1 protein_id gnl|my_center|LOCUS_28130 1668 886 gene locus_tag LOCUS_28140 1668 886 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_28140 2652 1678 gene locus_tag LOCUS_28150 2652 1678 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence0501 <1 745 gene locus_tag LOCUS_28160 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000103654.1:glucose-6-phosphate isomerase 768 1808 gene locus_tag LOCUS_28170 768 1808 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 protein_id gnl|my_center|LOCUS_28170 1899 3071 gene locus_tag LOCUS_28180 gene manA 1899 3071 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705335.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence0502 1349 462 gene locus_tag LOCUS_28190 gene dapA 1349 462 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_28190 2722 1361 gene locus_tag LOCUS_28200 2722 1361 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185933582.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence0503 66 1130 gene locus_tag LOCUS_28210 66 1130 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_28210 1130 1726 gene locus_tag LOCUS_28220 1130 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2216 1671 gene locus_tag LOCUS_28230 2216 1671 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_28230 2767 2213 gene locus_tag LOCUS_28240 2767 2213 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence0504 1292 1068 gene locus_tag LOCUS_28250 1292 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1843 1394 gene locus_tag LOCUS_28260 1843 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 <3151 1837 gene locus_tag LOCUS_28270 <3151 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399999.1:phage terminase large subunit >Feature sequence0505 404 1501 gene locus_tag LOCUS_28280 gene chvE 404 1501 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533632.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence0506 369 569 gene locus_tag LOCUS_28290 369 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 987 2081 gene locus_tag LOCUS_28300 987 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2191 2319 gene locus_tag LOCUS_28310 2191 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0507 1394 39 gene locus_tag LOCUS_28320 1394 39 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_28320 2519 1407 gene locus_tag LOCUS_28330 2519 1407 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_28330 <3134 2541 gene locus_tag LOCUS_28340 <3134 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888715.1:glycerophosphodiester phosphodiesterase >Feature sequence0508 <1 802 gene locus_tag LOCUS_28350 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015864.1:glycerol kinase GlpK 883 1851 gene locus_tag LOCUS_28360 gene selD 883 1851 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence0509 847 5 gene locus_tag LOCUS_28370 847 5 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_28370 1686 844 gene locus_tag LOCUS_28380 1686 844 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_28380 3105 1762 gene locus_tag LOCUS_28390 3105 1762 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence0510 348 1373 gene locus_tag LOCUS_28400 348 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1387 1971 gene locus_tag LOCUS_28410 1387 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1975 2736 gene locus_tag LOCUS_28420 1975 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence0511 1211 354 gene locus_tag LOCUS_28430 1211 354 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_28430 2157 1213 gene locus_tag LOCUS_28440 2157 1213 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_28440 <3124 2162 gene locus_tag LOCUS_28450 <3124 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368708.1:putative carbohydrate ABC transporter permease >Feature sequence0512 1311 484 gene locus_tag LOCUS_28460 1311 484 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_28460 2251 1316 gene locus_tag LOCUS_28470 2251 1316 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103759610.1 protein_id gnl|my_center|LOCUS_28470 3081 2248 gene locus_tag LOCUS_28480 3081 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence0513 1106 330 gene locus_tag LOCUS_28490 gene istB 1106 330 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439062.1 protein_id gnl|my_center|LOCUS_28490 2604 1096 gene locus_tag LOCUS_28500 gene istA 2604 1096 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_28500 2762 >3106 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacccgtgatgggtgcgac >Feature sequence0514 1124 117 gene locus_tag LOCUS_28510 1124 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2255 1128 gene locus_tag LOCUS_28520 2255 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 <3096 2317 gene locus_tag LOCUS_28530 <3096 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136619324.1:sugar ABC transporter substrate-binding protein >Feature sequence0515 2105 123 gene locus_tag LOCUS_28540 2105 123 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949159.1 protein_id gnl|my_center|LOCUS_28540 2769 2095 gene locus_tag LOCUS_28550 gene deoC 2769 2095 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence0516 58 2211 gene locus_tag LOCUS_28560 58 2211 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0517 1072 698 gene locus_tag LOCUS_28570 1072 698 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_28570 1743 1069 gene locus_tag LOCUS_28580 1743 1069 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_28580 1838 2605 gene locus_tag LOCUS_28590 1838 2605 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_28590 2996 2805 gene locus_tag LOCUS_28600 2996 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence0518 921 469 gene locus_tag LOCUS_28610 921 469 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_28610 1414 932 gene locus_tag LOCUS_28620 1414 932 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_28620 2096 1398 gene locus_tag LOCUS_28630 2096 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 <3084 2105 gene locus_tag LOCUS_28640 <3084 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147353.1:ATP synthase subunit B >Feature sequence0519 1540 221 gene locus_tag LOCUS_28650 1540 221 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_28650 1656 2168 gene locus_tag LOCUS_28660 1656 2168 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_28660 2236 3081 gene locus_tag LOCUS_28670 2236 3081 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence0520 1931 657 gene locus_tag LOCUS_28680 1931 657 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337986.1 protein_id gnl|my_center|LOCUS_28680 2073 2915 gene locus_tag LOCUS_28690 2073 2915 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383224.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0521 1308 667 gene locus_tag LOCUS_28700 1308 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2745 1348 gene locus_tag LOCUS_28710 2745 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence0522 78 2339 gene locus_tag LOCUS_28720 78 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence0523 2428 170 gene locus_tag LOCUS_28730 2428 170 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0524 177 1436 gene locus_tag LOCUS_28740 177 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1759 2424 gene locus_tag LOCUS_28750 gene pspA 1759 2424 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_28750 2424 2627 gene locus_tag LOCUS_28760 2424 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3066 2806 gene locus_tag LOCUS_28770 3066 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0525 380 682 gene locus_tag LOCUS_28780 380 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 679 1515 gene locus_tag LOCUS_28790 679 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1527 2528 gene locus_tag LOCUS_28800 1527 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2539 2994 gene locus_tag LOCUS_28810 2539 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0526 2676 1192 gene locus_tag LOCUS_28820 2676 1192 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence0527 403 1809 gene locus_tag LOCUS_28830 403 1809 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363290.1 protein_id gnl|my_center|LOCUS_28830 2030 2959 gene locus_tag LOCUS_28840 gene draG 2030 2959 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence0528 1844 336 gene locus_tag LOCUS_28850 gene abfA 1844 336 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_28850 2685 1849 gene locus_tag LOCUS_28860 2685 1849 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031710.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence0529 <1 819 gene locus_tag LOCUS_28870 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861545.1:efflux RND transporter permease subunit 816 2192 gene locus_tag LOCUS_28880 816 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2252 3037 gene locus_tag LOCUS_28890 2252 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28890 >Feature sequence0530 394 762 gene locus_tag LOCUS_28900 394 762 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_28900 793 1095 gene locus_tag LOCUS_28910 793 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1112 1591 gene locus_tag LOCUS_28920 1112 1591 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_28920 1588 2172 gene locus_tag LOCUS_28930 1588 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2177 2827 gene locus_tag LOCUS_28940 2177 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0531 1538 93 gene locus_tag LOCUS_28950 gene glgA 1538 93 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_28950 2558 1623 gene locus_tag LOCUS_28960 gene trxB 2558 1623 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence0532 101 1444 gene locus_tag LOCUS_28970 101 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1491 2627 gene locus_tag LOCUS_28980 1491 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence0533 1259 312 gene locus_tag LOCUS_28990 1259 312 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_28990 2233 1247 gene locus_tag LOCUS_29000 2233 1247 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_29000 <3016 2239 gene locus_tag LOCUS_29010 <3016 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479718.1:KamA family radical SAM protein >Feature sequence0534 780 2759 gene locus_tag LOCUS_29020 780 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence0535 780 187 gene locus_tag LOCUS_29030 780 187 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_29030 1417 845 gene locus_tag LOCUS_29040 1417 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2397 1561 gene locus_tag LOCUS_29050 2397 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 <3005 2390 gene locus_tag LOCUS_29060 <3005 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023873.1:lysine 2,3-aminomutase >Feature sequence0536 921 67 gene locus_tag LOCUS_29070 921 67 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_29070 1832 918 gene locus_tag LOCUS_29080 1832 918 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_29080 2536 1913 gene locus_tag LOCUS_29090 2536 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence0537 1793 285 gene locus_tag LOCUS_29100 1793 285 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_29100 <3001 1903 gene locus_tag LOCUS_29110 <3001 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257409.1:maltodextrin glucosidase >Feature sequence0538 1163 144 gene locus_tag LOCUS_29120 gene asd 1163 144 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_29120 1970 1371 gene locus_tag LOCUS_29130 1970 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 <2999 1967 gene locus_tag LOCUS_29140 <2999 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461230.1:DUF1538 domain-containing protein >Feature sequence0539 1035 217 gene locus_tag LOCUS_29150 gene iolO 1035 217 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_29150 2433 1039 gene locus_tag LOCUS_29160 gene larA 2433 1039 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964087.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence0540 15 1172 gene locus_tag LOCUS_29170 15 1172 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_29170 1217 1963 gene locus_tag LOCUS_29180 1217 1963 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence0541 1642 695 gene locus_tag LOCUS_29190 1642 695 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_29190 2817 1645 gene locus_tag LOCUS_29200 2817 1645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence0542 1212 427 gene locus_tag LOCUS_29210 1212 427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_29210 1547 1209 gene locus_tag LOCUS_29220 1547 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2281 1646 gene locus_tag LOCUS_29230 2281 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2957 2340 gene locus_tag LOCUS_29240 2957 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence0543 1 1359 gene locus_tag LOCUS_29250 gene gnd 1 1359 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_29250 1369 2469 gene locus_tag LOCUS_29260 1369 2469 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0544 1033 116 gene locus_tag LOCUS_29270 gene pstC 1033 116 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_29270 2112 1108 gene locus_tag LOCUS_29280 2112 1108 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence0545 168 647 gene locus_tag LOCUS_29290 168 647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_29290 686 1636 gene locus_tag LOCUS_29300 686 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1581 1943 gene locus_tag LOCUS_29310 1581 1943 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence0546 2676 2038 gene locus_tag LOCUS_29320 2676 2038 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0547 152 1624 gene locus_tag LOCUS_29330 152 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence0548 <1 747 gene locus_tag LOCUS_29340 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083268.1:5-keto-L-gluconate epimerase 1243 2667 gene locus_tag LOCUS_29350 gene ltrA 1243 2667 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_29350 >Feature sequence0549 1450 1755 gene locus_tag LOCUS_29360 1450 1755 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_29360 2219 1749 gene locus_tag LOCUS_29370 2219 1749 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_29370 <2961 2302 gene locus_tag LOCUS_29380 <2961 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082326.1:argininosuccinate synthase >Feature sequence0550 352 107 gene locus_tag LOCUS_29390 352 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1077 358 gene locus_tag LOCUS_29400 1077 358 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_29400 1513 2361 gene locus_tag LOCUS_29410 1513 2361 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_29410 2742 2605 gene locus_tag LOCUS_29420 2742 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence0551 1688 384 gene locus_tag LOCUS_29430 1688 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2452 1688 gene locus_tag LOCUS_29440 2452 1688 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0552 <2953 763 gene locus_tag LOCUS_29450 <2953 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194931144.1:methionine synthase >Feature sequence0553 2918 2223 gene locus_tag LOCUS_29460 2918 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence0554 1359 637 gene locus_tag LOCUS_29470 1359 637 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_29470 1400 2368 gene locus_tag LOCUS_29480 1400 2368 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706765.1 protein_id gnl|my_center|LOCUS_29480 <2953 2365 gene locus_tag LOCUS_29490 <2953 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase >Feature sequence0555 <1 1119 gene locus_tag LOCUS_29500 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898268.1:TRAP transporter large permease 1983 1348 gene locus_tag LOCUS_29510 1983 1348 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence0556 2810 1002 gene locus_tag LOCUS_29520 2810 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence0557 245 862 gene locus_tag LOCUS_29530 245 862 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_29530 866 1246 gene locus_tag LOCUS_29540 866 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1276 1536 gene locus_tag LOCUS_29550 1276 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1599 2156 gene locus_tag LOCUS_29560 1599 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2210 2647 gene locus_tag LOCUS_29570 2210 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence0558 218 1414 gene locus_tag LOCUS_29580 218 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence0559 2122 1094 gene locus_tag LOCUS_29590 2122 1094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence0560 1306 2745 gene locus_tag LOCUS_29600 1306 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2742 2927 gene locus_tag LOCUS_29610 2742 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence0561 1625 186 gene locus_tag LOCUS_29620 1625 186 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_29620 1724 2329 gene locus_tag LOCUS_29630 1724 2329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865247.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence0562 >Feature sequence0563 1547 174 gene locus_tag LOCUS_29640 gene argH 1547 174 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_29640 1970 2584 gene locus_tag LOCUS_29650 1970 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0564 1403 315 gene locus_tag LOCUS_29660 1403 315 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 protein_id gnl|my_center|LOCUS_29660 2851 1394 gene locus_tag LOCUS_29670 2851 1394 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657618.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence0565 <2905 258 gene locus_tag LOCUS_29680 <2905 258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase >Feature sequence0566 1265 231 gene locus_tag LOCUS_29690 1265 231 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657937.1 protein_id gnl|my_center|LOCUS_29690 1882 1262 gene locus_tag LOCUS_29700 gene lexA 1882 1262 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_29700 2149 1886 gene locus_tag LOCUS_29710 2149 1886 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_29710 <2904 2149 gene locus_tag LOCUS_29720 <2904 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000062490.1:HPr(Ser) kinase/phosphatase >Feature sequence0567 134 877 gene locus_tag LOCUS_29730 134 877 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence0568 493 1050 gene locus_tag LOCUS_29740 493 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1052 1630 gene locus_tag LOCUS_29750 1052 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 <2899 1627 gene locus_tag LOCUS_29760 <2899 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288195.1:sugar phosphate nucleotidyltransferase >Feature sequence0569 854 78 gene locus_tag LOCUS_29770 854 78 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656367.1 protein_id gnl|my_center|LOCUS_29770 1654 854 gene locus_tag LOCUS_29780 1654 854 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_29780 <2898 1662 gene locus_tag LOCUS_29790 <2898 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681149.1:ribonuclease Y >Feature sequence0570 19 468 gene locus_tag LOCUS_29800 19 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 491 1093 gene locus_tag LOCUS_29810 gene rdgB 491 1093 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_29810 1093 2775 gene locus_tag LOCUS_29820 gene pepF 1093 2775 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence0571 2227 368 gene locus_tag LOCUS_29830 2227 368 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence0572 <1 972 gene locus_tag LOCUS_29840 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667239.1:outer membrane protein assembly factor BamA >Feature sequence0573 342 1667 gene locus_tag LOCUS_29850 342 1667 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_29850 1733 1933 gene locus_tag LOCUS_29860 1733 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence0574 93 347 gene locus_tag LOCUS_29870 93 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 344 595 gene locus_tag LOCUS_29880 344 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 598 1581 gene locus_tag LOCUS_29890 598 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 1574 2572 gene locus_tag LOCUS_29900 1574 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence0575 500 1117 gene locus_tag LOCUS_29910 500 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1856 1122 gene locus_tag LOCUS_29920 1856 1122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049879.1 protein_id gnl|my_center|LOCUS_29920 <2876 1928 gene locus_tag LOCUS_29930 <2876 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943345.1:acetate kinase >Feature sequence0576 395 2419 gene locus_tag LOCUS_29940 395 2419 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence0577 <1 734 gene locus_tag LOCUS_29950 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000301647.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 1619 918 gene locus_tag LOCUS_29960 1619 918 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 protein_id gnl|my_center|LOCUS_29960 1815 2171 gene locus_tag LOCUS_29970 1815 2171 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence0578 197 1489 gene locus_tag LOCUS_29980 197 1489 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972873.1 protein_id gnl|my_center|LOCUS_29980 1565 2464 gene locus_tag LOCUS_29990 1565 2464 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence0579 2199 742 gene locus_tag LOCUS_30000 2199 742 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_30000 2863 2207 gene locus_tag LOCUS_30010 2863 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence0580 >Feature sequence0581 1685 372 gene locus_tag LOCUS_30020 1685 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1764 2549 gene locus_tag LOCUS_30030 1764 2549 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence0582 1418 576 gene locus_tag LOCUS_30040 gene kduI 1418 576 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 protein_id gnl|my_center|LOCUS_30040 2234 1443 gene locus_tag LOCUS_30050 2234 1443 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339509.1 protein_id gnl|my_center|LOCUS_30050 <2847 2249 gene locus_tag LOCUS_30060 <2847 2249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049769589.1:TRAP transporter large permease subunit >Feature sequence0583 1741 239 gene locus_tag LOCUS_30070 gene gguA 1741 239 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_30070 2845 1838 gene locus_tag LOCUS_30080 2845 1838 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0584 2403 1105 gene locus_tag LOCUS_30090 gene aepX 2403 1105 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679012.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence0585 173 1531 gene locus_tag LOCUS_30100 173 1531 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114397.1 protein_id gnl|my_center|LOCUS_30100 <2841 1710 gene locus_tag LOCUS_30110 <2841 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263007.1:glycoside hydrolase family 2 protein >Feature sequence0586 645 166 gene locus_tag LOCUS_30120 645 166 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_30120 2123 651 gene locus_tag LOCUS_30130 2123 651 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_30130 2382 2116 gene locus_tag LOCUS_30140 2382 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2688 2398 gene locus_tag LOCUS_30150 2688 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence0587 1 2043 gene locus_tag LOCUS_30160 1 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0588 <1 630 gene locus_tag LOCUS_30170 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016563.1:MetQ/NlpA family ABC transporter substrate-binding protein 785 1795 gene locus_tag LOCUS_30180 gene argF 785 1795 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_30180 1844 2311 gene locus_tag LOCUS_30190 1844 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence0589 2035 902 gene locus_tag LOCUS_30200 2035 902 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793088.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence0590 45 1097 gene locus_tag LOCUS_30210 45 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0591 2299 1271 gene locus_tag LOCUS_30220 gene pdxA 2299 1271 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_30220 2431 2658 gene locus_tag LOCUS_30230 2431 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence0592 1855 386 gene locus_tag LOCUS_30240 1855 386 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_30240 2114 1848 gene locus_tag LOCUS_30250 2114 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 <2803 2131 gene locus_tag LOCUS_30260 <2803 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986397.1:SpoIIE family protein phosphatase >Feature sequence0593 <1 612 gene locus_tag LOCUS_30270 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667239.1:outer membrane protein assembly factor BamA >Feature sequence0594 27 1295 gene locus_tag LOCUS_30280 27 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence0595 407 1078 gene locus_tag LOCUS_30290 407 1078 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_30290 1596 1075 gene locus_tag LOCUS_30300 1596 1075 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948274.1 protein_id gnl|my_center|LOCUS_30300 1708 2625 gene locus_tag LOCUS_30310 1708 2625 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence0596 <1 966 gene locus_tag LOCUS_30320 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065524.1:DUF2341 domain-containing protein 1037 2572 gene locus_tag LOCUS_30330 1037 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence0597 >Feature sequence0598 1213 2724 gene locus_tag LOCUS_30340 1213 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0599 47 319 gene locus_tag LOCUS_30350 47 319 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_30350 2746 365 gene locus_tag LOCUS_30360 2746 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence0600 135 1835 gene locus_tag LOCUS_30370 135 1835 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_30370 >Feature sequence0601 1787 852 gene locus_tag LOCUS_30380 gene mraY 1787 852 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925371.1 protein_id gnl|my_center|LOCUS_30380 <2748 1780 gene locus_tag LOCUS_30390 <2748 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678687.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence0602 581 420 gene locus_tag LOCUS_30400 581 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 799 653 gene locus_tag LOCUS_30410 799 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1428 1658 gene locus_tag LOCUS_30420 1428 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence0603 1 816 gene locus_tag LOCUS_30430 gene mnmA 1 816 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047964.1 protein_id gnl|my_center|LOCUS_30430 877 1689 gene locus_tag LOCUS_30440 gene nagB 877 1689 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_30440 2108 2686 gene locus_tag LOCUS_30450 2108 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence0604 1203 457 gene locus_tag LOCUS_30460 1203 457 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_30460 1388 2296 gene locus_tag LOCUS_30470 1388 2296 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence0605 >Feature sequence0606 <1 706 gene locus_tag LOCUS_30480 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173998.1:carbohydrate ABC transporter permease 712 1851 gene locus_tag LOCUS_30490 712 1851 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0607 844 458 gene locus_tag LOCUS_30500 844 458 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_30500 971 1792 gene locus_tag LOCUS_30510 gene mazG 971 1792 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 protein_id gnl|my_center|LOCUS_30510 1829 2473 gene locus_tag LOCUS_30520 1829 2473 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966135.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence0608 2542 1196 gene locus_tag LOCUS_30530 2542 1196 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence0609 154 1098 gene locus_tag LOCUS_30540 154 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence0610 441 1202 gene locus_tag LOCUS_30550 441 1202 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_30550 2422 1199 gene locus_tag LOCUS_30560 2422 1199 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656022.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence0611 <2722 1102 gene locus_tag LOCUS_30570 <2722 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548569.1:glycosyltransferase family 8 protein >Feature sequence0612 718 2610 gene locus_tag LOCUS_30580 718 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence0613 134 1381 gene locus_tag LOCUS_30590 134 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1391 2194 gene locus_tag LOCUS_30600 1391 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence0614 1050 2204 gene locus_tag LOCUS_30610 1050 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence0615 <1 562 gene locus_tag LOCUS_30620 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001289363.1:ABC transporter ATP-binding protein 1976 615 gene locus_tag LOCUS_30630 1976 615 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107578.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence0616 286 816 gene locus_tag LOCUS_30640 286 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1645 878 gene locus_tag LOCUS_30650 gene pflA 1645 878 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_30650 2704 1655 gene locus_tag LOCUS_30660 2704 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence0617 >Feature sequence0618 1371 106 gene locus_tag LOCUS_30670 1371 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 <2704 1450 gene locus_tag LOCUS_30680 <2704 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459729.1:L-fucose/L-arabinose isomerase family protein >Feature sequence0619 <2704 680 gene locus_tag LOCUS_30690 <2704 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869170.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence0620 506 183 gene locus_tag LOCUS_30700 506 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 <2703 669 gene locus_tag LOCUS_30710 <2703 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681223.1:elongation factor G >Feature sequence0621 93 752 gene locus_tag LOCUS_30720 93 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 721 1221 gene locus_tag LOCUS_30730 721 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 1243 1938 gene locus_tag LOCUS_30740 1243 1938 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_30740 <2700 1939 gene locus_tag LOCUS_30750 <2700 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057953.1:inositol monophosphatase family protein >Feature sequence0622 603 7 gene locus_tag LOCUS_30760 603 7 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900899.1 protein_id gnl|my_center|LOCUS_30760 1365 613 gene locus_tag LOCUS_30770 1365 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2252 1362 gene locus_tag LOCUS_30780 2252 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence0623 >Feature sequence0624 2004 772 gene locus_tag LOCUS_30790 2004 772 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_30790 <2696 2012 gene locus_tag LOCUS_30800 <2696 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081168.1:sugar transferase >Feature sequence0625 600 271 gene locus_tag LOCUS_30810 600 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1041 607 gene locus_tag LOCUS_30820 1041 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1669 1049 gene locus_tag LOCUS_30830 1669 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2226 1666 gene locus_tag LOCUS_30840 2226 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0626 28 1911 gene locus_tag LOCUS_30850 28 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2270 2611 gene locus_tag LOCUS_30860 2270 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence0627 37 285 gene locus_tag LOCUS_30870 37 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 301 1494 gene locus_tag LOCUS_30880 301 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1481 2107 gene locus_tag LOCUS_30890 1481 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 <2693 2100 gene locus_tag LOCUS_30900 <2693 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438353.1:adenylosuccinate lyase >Feature sequence0628 834 94 gene locus_tag LOCUS_30910 834 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2446 827 gene locus_tag LOCUS_30920 gene istA 2446 827 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0629 1596 892 gene locus_tag LOCUS_30930 1596 892 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_30930 <2684 1598 gene locus_tag LOCUS_30940 <2684 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680939.1:ribosome biogenesis GTPase Der >Feature sequence0630 1488 502 gene locus_tag LOCUS_30950 1488 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0631 1380 739 gene locus_tag LOCUS_30960 1380 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2153 1662 gene locus_tag LOCUS_30970 2153 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2452 2213 gene locus_tag LOCUS_30980 2452 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence0632 <1 517 gene locus_tag LOCUS_30990 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869698.1:ribosome biogenesis GTP-binding protein YihA/YsxC >Feature sequence0633 >Feature sequence0634 55 753 gene locus_tag LOCUS_31000 55 753 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 protein_id gnl|my_center|LOCUS_31000 1651 728 gene locus_tag LOCUS_31010 1651 728 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_31010 1757 2071 gene locus_tag LOCUS_31020 gene trxA 1757 2071 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263363.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0635 >Feature sequence0636 2640 1306 gene locus_tag LOCUS_31030 2640 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0637 <1 1599 gene locus_tag LOCUS_31040 <1 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393611.1:DUF1116 domain-containing protein 1624 2496 gene locus_tag LOCUS_31050 1624 2496 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence0638 26 1030 gene locus_tag LOCUS_31060 gene rsgA 26 1030 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence0639 1018 491 gene locus_tag LOCUS_31070 1018 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2184 1030 gene locus_tag LOCUS_31080 gene murG 2184 1030 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence0640 59 2353 gene locus_tag LOCUS_31090 59 2353 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence0641 1136 2041 gene locus_tag LOCUS_31100 gene rsmA 1136 2041 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_31100 <2654 1980 gene locus_tag LOCUS_31110 <2654 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966714.1:MATE family efflux transporter >Feature sequence0642 1778 417 gene locus_tag LOCUS_31120 1778 417 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_31120 2631 1840 gene locus_tag LOCUS_31130 2631 1840 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence0643 <1 702 gene locus_tag LOCUS_31140 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387108.1:voltage-gated chloride channel family protein >Feature sequence0644 1578 457 gene locus_tag LOCUS_31150 gene gcvT 1578 457 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_31150 1986 1591 gene locus_tag LOCUS_31160 1986 1591 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_31160 2257 2598 gene locus_tag LOCUS_31170 2257 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence0645 2097 850 gene locus_tag LOCUS_31180 2097 850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321046.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence0646 1457 2380 gene locus_tag LOCUS_31190 1457 2380 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence0647 1536 2210 gene locus_tag LOCUS_31200 1536 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence0648 1532 708 gene locus_tag LOCUS_31210 1532 708 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_31210 1686 2195 gene locus_tag LOCUS_31220 gene trmL 1686 2195 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence0649 612 469 gene locus_tag LOCUS_31230 612 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1166 2458 gene locus_tag LOCUS_31240 1166 2458 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence0650 768 1103 gene locus_tag LOCUS_31250 768 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1100 1375 gene locus_tag LOCUS_31260 1100 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 1434 1793 gene locus_tag LOCUS_31270 1434 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1991 2146 gene locus_tag LOCUS_31280 1991 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 <2619 2113 gene locus_tag LOCUS_31290 <2619 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001970104.1:extracellular solute-binding protein >Feature sequence0651 26 886 gene locus_tag LOCUS_31300 gene rfbB 26 886 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_31300 903 1454 gene locus_tag LOCUS_31310 gene rfbC 903 1454 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_31310 1451 2548 gene locus_tag LOCUS_31320 1451 2548 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101281.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence0652 2505 1255 gene locus_tag LOCUS_31330 2505 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0653 1192 101 gene locus_tag LOCUS_31340 1192 101 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_31340 1349 2326 gene locus_tag LOCUS_31350 1349 2326 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence0654 >Feature sequence0655 3 1436 gene locus_tag LOCUS_31360 3 1436 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_31360 1429 2286 gene locus_tag LOCUS_31370 1429 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence0656 980 207 gene locus_tag LOCUS_31380 980 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 <2599 977 gene locus_tag LOCUS_31390 <2599 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679748.1:phospho-sugar mutase >Feature sequence0657 859 47 gene locus_tag LOCUS_31400 859 47 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_31400 1883 852 gene locus_tag LOCUS_31410 1883 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2450 2013 gene locus_tag LOCUS_31420 2450 2013 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence0658 <1 636 gene locus_tag LOCUS_31430 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061331.1:glycosyl hydrolase 646 1614 gene locus_tag LOCUS_31440 646 1614 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence0659 60 1244 gene locus_tag LOCUS_31450 60 1244 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_31450 <2584 1241 gene locus_tag LOCUS_31460 <2584 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072723.1:exodeoxyribonuclease I >Feature sequence0660 <2583 861 gene locus_tag LOCUS_31470 <2583 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957290.1:alpha-amylase family glycosyl hydrolase >Feature sequence0661 117 548 gene locus_tag LOCUS_31480 117 548 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_31480 553 1584 gene locus_tag LOCUS_31490 553 1584 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_31490 <2580 1693 gene locus_tag LOCUS_31500 <2580 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035844551.1:CehA/McbA family metallohydrolase >Feature sequence0662 1648 98 gene locus_tag LOCUS_31510 1648 98 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_31510 1816 1989 gene locus_tag LOCUS_31520 1816 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0663 225 2441 gene locus_tag LOCUS_31530 225 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence0664 50 895 gene locus_tag LOCUS_31540 50 895 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence0665 2387 1662 gene locus_tag LOCUS_31550 2387 1662 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355958.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence0666 2061 832 gene locus_tag LOCUS_31560 2061 832 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence0667 1993 1622 gene locus_tag LOCUS_31570 1993 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 2393 1980 gene locus_tag LOCUS_31580 2393 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence0668 142 1128 gene locus_tag LOCUS_31590 142 1128 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_31590 1195 2262 gene locus_tag LOCUS_31600 1195 2262 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence0669 <1 832 gene locus_tag LOCUS_31610 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001298012.1:L-ascorbate 6-phosphate lactonase 871 1908 gene locus_tag LOCUS_31620 871 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837545.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence0670 128 763 gene locus_tag LOCUS_31630 128 763 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_31630 773 1537 gene locus_tag LOCUS_31640 773 1537 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_31640 <2562 1534 gene locus_tag LOCUS_31650 <2562 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893877.1:D-aminoacylase >Feature sequence0671 2493 1585 gene locus_tag LOCUS_31660 2493 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence0672 >Feature sequence0673 >Feature sequence0674 1406 414 gene locus_tag LOCUS_31670 1406 414 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_31670 2018 1563 gene locus_tag LOCUS_31680 2018 1563 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530560.1 protein_id gnl|my_center|LOCUS_31680 2543 2025 gene locus_tag LOCUS_31690 2543 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence0675 2269 1637 gene locus_tag LOCUS_31700 2269 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence0676 144 617 gene locus_tag LOCUS_31710 144 617 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113347.1 protein_id gnl|my_center|LOCUS_31710 644 1123 gene locus_tag LOCUS_31720 644 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2225 1209 gene locus_tag LOCUS_31730 2225 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence0677 >Feature sequence0678 783 274 gene locus_tag LOCUS_31740 783 274 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_31740 882 1673 gene locus_tag LOCUS_31750 882 1673 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_31750 2352 1639 gene locus_tag LOCUS_31760 2352 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence0679 1060 476 gene locus_tag LOCUS_31770 1060 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1667 1029 gene locus_tag LOCUS_31780 1667 1029 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 protein_id gnl|my_center|LOCUS_31780 <2532 1678 gene locus_tag LOCUS_31790 <2532 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679468.1:GTPase ObgE >Feature sequence0680 226 1140 gene locus_tag LOCUS_31800 226 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1143 2318 gene locus_tag LOCUS_31810 gene dinB 1143 2318 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence0681 696 7 gene locus_tag LOCUS_31820 696 7 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_31820 2530 755 gene locus_tag LOCUS_31830 gene yidC 2530 755 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence0682 532 1395 gene locus_tag LOCUS_31840 532 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2389 1367 gene locus_tag LOCUS_31850 2389 1367 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987066.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence0683 1264 515 gene locus_tag LOCUS_31860 gene cobS 1264 515 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926961.1 protein_id gnl|my_center|LOCUS_31860 1899 1261 gene locus_tag LOCUS_31870 gene cobU 1899 1261 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence0684 1971 352 gene locus_tag LOCUS_31880 1971 352 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence0685 <1 1079 gene locus_tag LOCUS_31890 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920600.1:Gx transporter family protein >Feature sequence0686 1186 2229 gene locus_tag LOCUS_31900 1186 2229 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence0687 643 92 gene locus_tag LOCUS_31910 643 92 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815839.1 protein_id gnl|my_center|LOCUS_31910 937 1962 gene locus_tag LOCUS_31920 937 1962 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence0688 943 449 gene locus_tag LOCUS_31930 943 449 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815953.1 protein_id gnl|my_center|LOCUS_31930 1915 947 gene locus_tag LOCUS_31940 1915 947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence0689 472 1050 gene locus_tag LOCUS_31950 472 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1164 1583 gene locus_tag LOCUS_31960 1164 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1594 2226 gene locus_tag LOCUS_31970 1594 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460670.1 protein_id gnl|my_center|LOCUS_31970 >Feature sequence0690 2175 262 gene locus_tag LOCUS_31980 2175 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0691 1807 2226 gene locus_tag LOCUS_31990 1807 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2351 2482 gene locus_tag LOCUS_32000 2351 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0692 501 145 gene locus_tag LOCUS_32010 501 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 899 540 gene locus_tag LOCUS_32020 gene rplT 899 540 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_32020 1109 912 gene locus_tag LOCUS_32030 gene rpmI 1109 912 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556787.1 protein_id gnl|my_center|LOCUS_32030 1746 1192 gene locus_tag LOCUS_32040 gene infC 1746 1192 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556788.1 protein_id gnl|my_center|LOCUS_32040 <2499 1918 gene locus_tag LOCUS_32050 <2499 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798895.1:class II fructose-1,6-bisphosphate aldolase >Feature sequence0693 >Feature sequence0694 1508 192 gene locus_tag LOCUS_32060 1508 192 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_32060 2047 1508 gene locus_tag LOCUS_32070 2047 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 2497 2117 gene locus_tag LOCUS_32080 2497 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence0695 >Feature sequence0696 851 1000 gene locus_tag LOCUS_32090 851 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0697 621 154 gene locus_tag LOCUS_32100 gene ispF 621 154 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_32100 1430 618 gene locus_tag LOCUS_32110 1430 618 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680203.1 protein_id gnl|my_center|LOCUS_32110 1980 1432 gene locus_tag LOCUS_32120 1980 1432 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence0698 2289 1738 gene locus_tag LOCUS_32130 2289 1738 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence0699 >Feature sequence0700 >Feature sequence0701 <1 1683 gene locus_tag LOCUS_32140 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000502395.1:putative selenate reductase subunit YgfK >Feature sequence0702 255 1289 gene locus_tag LOCUS_32150 gene lgoD 255 1289 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 protein_id gnl|my_center|LOCUS_32150 2329 1439 gene locus_tag LOCUS_32160 2329 1439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0703 245 430 gene locus_tag LOCUS_32170 245 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 778 2091 gene locus_tag LOCUS_32180 778 2091 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence0704 >Feature sequence0705 134 2452 gene locus_tag LOCUS_32190 134 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0706 1993 1622 gene locus_tag LOCUS_32200 1993 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 2393 1980 gene locus_tag LOCUS_32210 2393 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0707 2306 1770 gene locus_tag LOCUS_32220 2306 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence0708 1667 210 gene locus_tag LOCUS_32230 1667 210 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_32230 <2466 1674 gene locus_tag LOCUS_32240 <2466 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545959.1:Trk system potassium transporter TrkA >Feature sequence0709 1099 8 gene locus_tag LOCUS_32250 1099 8 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_32250 <2465 1201 gene locus_tag LOCUS_32260 <2465 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667047.1:ribose-phosphate pyrophosphokinase >Feature sequence0710 <1 654 gene locus_tag LOCUS_32270 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942928.1:3-deoxy-7-phosphoheptulonate synthase 670 1215 gene locus_tag LOCUS_32280 670 1215 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence0711 311 33 gene locus_tag LOCUS_32290 311 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 732 1613 gene locus_tag LOCUS_32300 732 1613 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_32300 1619 2239 gene locus_tag LOCUS_32310 1619 2239 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence0712 2326 1595 gene locus_tag LOCUS_32320 2326 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence0713 1372 1142 gene locus_tag LOCUS_32330 1372 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1325 1630 gene locus_tag LOCUS_32340 1325 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1665 2411 gene locus_tag LOCUS_32350 1665 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence0714 245 772 gene locus_tag LOCUS_32360 245 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 769 1254 gene locus_tag LOCUS_32370 769 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1258 1947 gene locus_tag LOCUS_32380 1258 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 1931 2263 gene locus_tag LOCUS_32390 1931 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence0715 183 40 gene locus_tag LOCUS_32400 183 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 1269 265 gene locus_tag LOCUS_32410 1269 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence0716 170 769 gene locus_tag LOCUS_32420 170 769 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_32420 2217 766 gene locus_tag LOCUS_32430 2217 766 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence0717 83 292 gene locus_tag LOCUS_32440 83 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 304 1176 gene locus_tag LOCUS_32450 gene purU 304 1176 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_32450 <2446 1282 gene locus_tag LOCUS_32460 <2446 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083240.1:ammonium transporter >Feature sequence0718 169 1236 gene locus_tag LOCUS_32470 gene ablA 169 1236 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_32470 2381 1233 gene locus_tag LOCUS_32480 2381 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0719 1342 326 gene locus_tag LOCUS_32490 1342 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2028 1288 gene locus_tag LOCUS_32500 2028 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0720 536 1540 gene locus_tag LOCUS_32510 536 1540 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_32510 2145 1543 gene locus_tag LOCUS_32520 2145 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence0721 804 196 gene locus_tag LOCUS_32530 804 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1216 2139 gene locus_tag LOCUS_32540 1216 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0722 549 289 gene locus_tag LOCUS_32550 549 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 490 717 gene locus_tag LOCUS_32560 490 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence0723 1003 23 gene locus_tag LOCUS_32570 1003 23 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_32570 1245 1006 gene locus_tag LOCUS_32580 1245 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 1436 1511 gene locus_tag LOCUS_t00390 1436 1511 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2427 1540 gene locus_tag LOCUS_32590 2427 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0724 896 498 gene locus_tag LOCUS_32600 gene mutT 896 498 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_32600 1332 910 gene locus_tag LOCUS_32610 1332 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 <2427 1329 gene locus_tag LOCUS_32620 <2427 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817435.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase >Feature sequence0725 59 634 gene locus_tag LOCUS_32630 59 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1207 956 gene locus_tag LOCUS_32640 1207 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1202 1867 gene locus_tag LOCUS_32650 1202 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence0726 37 1323 gene locus_tag LOCUS_32660 37 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence0727 >Feature sequence0728 533 6 gene locus_tag LOCUS_32670 533 6 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962957.1 protein_id gnl|my_center|LOCUS_32670 1614 514 gene locus_tag LOCUS_32680 1614 514 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367751.1 protein_id gnl|my_center|LOCUS_32680 2162 1578 gene locus_tag LOCUS_32690 2162 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence0729 104 475 gene locus_tag LOCUS_32700 104 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 771 478 gene locus_tag LOCUS_32710 771 478 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462153.1 protein_id gnl|my_center|LOCUS_32710 902 1966 gene locus_tag LOCUS_32720 902 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence0730 1964 858 gene locus_tag LOCUS_32730 gene dxr 1964 858 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence0731 1141 173 gene locus_tag LOCUS_32740 1141 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1309 1512 gene locus_tag LOCUS_32750 1309 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 <2413 1521 gene locus_tag LOCUS_32760 <2413 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784478.1:FAD-dependent oxidoreductase >Feature sequence0732 955 809 gene locus_tag LOCUS_32770 955 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1117 2040 gene locus_tag LOCUS_32780 1117 2040 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence0733 >Feature sequence0734 377 1360 gene locus_tag LOCUS_32790 gene ccpA 377 1360 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0735 1632 625 gene locus_tag LOCUS_32800 1632 625 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286006.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence0736 257 1237 gene locus_tag LOCUS_32810 257 1237 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_32810 1805 1197 gene locus_tag LOCUS_32820 1805 1197 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846708.1 protein_id gnl|my_center|LOCUS_32820 2263 1802 gene locus_tag LOCUS_32830 2263 1802 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678721.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence0737 276 1250 gene locus_tag LOCUS_32840 276 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1533 1315 gene locus_tag LOCUS_32850 gene infA 1533 1315 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_32850 <2401 1603 gene locus_tag LOCUS_32860 <2401 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020940.1:sodium-dependent transporter >Feature sequence0738 1493 618 gene locus_tag LOCUS_32870 1493 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2303 1494 gene locus_tag LOCUS_32880 2303 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0739 730 2127 gene locus_tag LOCUS_32890 730 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence0740 32 1066 gene locus_tag LOCUS_32900 gene purM 32 1066 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_32900 1063 2343 gene locus_tag LOCUS_32910 1063 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence0741 2301 1498 gene locus_tag LOCUS_32920 2301 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence0742 1669 1046 gene locus_tag LOCUS_32930 1669 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 1889 1641 gene locus_tag LOCUS_32940 1889 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence0743 97 378 gene locus_tag LOCUS_32950 97 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1182 469 gene locus_tag LOCUS_32960 1182 469 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989760.1 protein_id gnl|my_center|LOCUS_32960 <2390 1329 gene locus_tag LOCUS_32970 <2390 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667011.1:GTPase HflX >Feature sequence0744 39 1160 gene locus_tag LOCUS_32980 gene tgt 39 1160 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_32980 1138 2127 gene locus_tag LOCUS_32990 1138 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence0745 1317 1141 gene locus_tag LOCUS_33000 1317 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence0746 1749 43 gene locus_tag LOCUS_33010 1749 43 CDS product IS1634-like element ISMac5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021089.1 protein_id gnl|my_center|LOCUS_33010 1839 2228 gene locus_tag LOCUS_33020 1839 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence0747 734 285 gene locus_tag LOCUS_33030 734 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 868 1839 gene locus_tag LOCUS_33040 868 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence0748 401 904 gene locus_tag LOCUS_33050 gene ybeY 401 904 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_33050 901 1668 gene locus_tag LOCUS_33060 901 1668 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence0749 <1 1344 gene locus_tag LOCUS_33070 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198892.1:acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta >Feature sequence0750 2377 689 gene locus_tag LOCUS_33080 2377 689 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence0751 533 1093 gene locus_tag LOCUS_33090 533 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1164 1442 gene locus_tag LOCUS_33100 1164 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 1652 1936 gene locus_tag LOCUS_33110 1652 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1984 2313 gene locus_tag LOCUS_33120 1984 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence0752 1463 714 gene locus_tag LOCUS_33130 1463 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 <2372 1468 gene locus_tag LOCUS_33140 <2372 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002677985.1:HD domain-containing protein >Feature sequence0753 <1 816 gene locus_tag LOCUS_33150 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706729.1:patatin-like phospholipase family protein 813 1223 gene locus_tag LOCUS_33160 813 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556699.1 protein_id gnl|my_center|LOCUS_33160 1843 1175 gene locus_tag LOCUS_33170 gene mtnN 1843 1175 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228756.1 protein_id gnl|my_center|LOCUS_33170 <2368 1833 gene locus_tag LOCUS_33180 <2368 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792714.1:pyridoxamine kinase >Feature sequence0754 1612 14 gene locus_tag LOCUS_33190 1612 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2304 1597 gene locus_tag LOCUS_33200 2304 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence0755 <2361 1715 gene locus_tag LOCUS_33210 <2361 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870248.1:CoB--CoM heterodisulfide reductase subunit B >Feature sequence0756 66 722 gene locus_tag LOCUS_33220 66 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 792 2015 gene locus_tag LOCUS_33230 792 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence0757 301 666 gene locus_tag LOCUS_33240 301 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence0758 <2354 679 gene locus_tag LOCUS_33250 <2354 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459675.1:ABC transporter ATP-binding protein >Feature sequence0759 >Feature sequence0760 2343 1486 gene locus_tag LOCUS_33260 2343 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence0761 386 1117 gene locus_tag LOCUS_33270 386 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1682 1098 gene locus_tag LOCUS_33280 1682 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 2074 1688 gene locus_tag LOCUS_33290 2074 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence0762 2252 426 gene locus_tag LOCUS_33300 2252 426 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence0763 254 2059 gene locus_tag LOCUS_33310 254 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 2047 2259 gene locus_tag LOCUS_33320 2047 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence0764 625 1197 gene locus_tag LOCUS_33330 625 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 1182 2231 gene locus_tag LOCUS_33340 1182 2231 CDS product ISAs1-like element ISBthe4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108038.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence0765 <2336 431 gene locus_tag LOCUS_33350 <2336 431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:efflux RND transporter permease subunit >Feature sequence0766 211 1131 gene locus_tag LOCUS_33360 211 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence0767 <1 1437 gene locus_tag LOCUS_33370 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393628.1:FAD-dependent oxidoreductase >Feature sequence0768 489 325 gene locus_tag LOCUS_33380 489 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 1574 588 gene locus_tag LOCUS_33390 1574 588 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_33390 2319 1561 gene locus_tag LOCUS_33400 2319 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence0769 1091 114 gene locus_tag LOCUS_33410 1091 114 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_33410 1959 1171 gene locus_tag LOCUS_33420 gene kdgR 1959 1171 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence0770 146 1165 gene locus_tag LOCUS_33430 gene pdxA 146 1165 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence0771 485 1060 gene locus_tag LOCUS_33440 485 1060 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_33440 <2319 1057 gene locus_tag LOCUS_33450 <2319 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682053.1:MFS transporter >Feature sequence0772 <2316 873 gene locus_tag LOCUS_33460 <2316 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966451.1:citramalate synthase >Feature sequence0773 <2311 423 gene locus_tag LOCUS_33470 <2311 423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015951.1:DEAD/DEAH box helicase >Feature sequence0774 1565 261 gene locus_tag LOCUS_33480 1565 261 CDS product ISAs1-like element IS1548 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564846.1 protein_id gnl|my_center|LOCUS_33480 2128 1577 gene locus_tag LOCUS_33490 2128 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence0775 1364 174 gene locus_tag LOCUS_33500 gene ygeW 1364 174 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_33500 <2304 1405 gene locus_tag LOCUS_33510 <2304 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362247.1:YgeY family selenium metabolism-linked hydrolase >Feature sequence0776 751 503 gene locus_tag LOCUS_33520 751 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 810 932 gene locus_tag LOCUS_33530 810 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 <2301 1285 gene locus_tag LOCUS_33540 <2301 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457560.1:His-Xaa-Ser system radical SAM maturase HxsC >Feature sequence0777 324 1196 gene locus_tag LOCUS_33550 324 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_33550 <2298 1193 gene locus_tag LOCUS_33560 <2298 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669419.1:polynucleotide adenylyltransferase PcnB >Feature sequence0778 241 95 gene locus_tag LOCUS_33570 241 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 1017 1598 gene locus_tag LOCUS_33580 1017 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence0779 <1 613 gene locus_tag LOCUS_33590 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727561.1:DUF4194 domain-containing protein >Feature sequence0780 <2287 1382 gene locus_tag LOCUS_33600 <2287 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682194.1:UvrD-helicase domain-containing protein >Feature sequence0781 146 316 gene locus_tag LOCUS_33610 146 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 313 834 gene locus_tag LOCUS_33620 313 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 827 2026 gene locus_tag LOCUS_33630 827 2026 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244232.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence0782 <1 674 gene locus_tag LOCUS_33640 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088799.1:TRAP transporter substrate-binding protein 752 1231 gene locus_tag LOCUS_33650 752 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence0783 163 88 gene locus_tag LOCUS_t00400 163 88 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 352 921 gene locus_tag LOCUS_33660 352 921 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_33660 1045 1776 gene locus_tag LOCUS_33670 1045 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence0784 1450 512 gene locus_tag LOCUS_33680 1450 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2228 1407 gene locus_tag LOCUS_33690 2228 1407 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence0785 <1 1055 gene locus_tag LOCUS_33700 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681438.1:NADPH-dependent glutamate synthase 1160 1624 gene locus_tag LOCUS_33710 1160 1624 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_33710 2154 1618 gene locus_tag LOCUS_33720 2154 1618 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence0786 1705 1007 gene locus_tag LOCUS_33730 1705 1007 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023421.1 protein_id gnl|my_center|LOCUS_33730 1724 2152 gene locus_tag LOCUS_33740 1724 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2268 2149 gene locus_tag LOCUS_33750 2268 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence0787 >Feature sequence0788 597 382 gene locus_tag LOCUS_33760 597 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 907 539 gene locus_tag LOCUS_33770 907 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1731 904 gene locus_tag LOCUS_33780 1731 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 <2267 1734 gene locus_tag LOCUS_33790 <2267 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144956692.1:DDE-type integrase/transposase/recombinase >Feature sequence0789 1920 121 gene locus_tag LOCUS_33800 1920 121 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence0790 >Feature sequence0791 <1 737 gene locus_tag LOCUS_33810 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023462.1:ABC transporter substrate-binding protein 805 1716 gene locus_tag LOCUS_33820 805 1716 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence0792 572 222 gene locus_tag LOCUS_33830 572 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 1500 574 gene locus_tag LOCUS_33840 1500 574 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence0793 1744 431 gene locus_tag LOCUS_33850 gene mtaB 1744 431 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_33850 <2261 1741 gene locus_tag LOCUS_33860 <2261 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957934.1:prephenate dehydrogenase/arogenate dehydrogenase family protein >Feature sequence0794 89 940 gene locus_tag LOCUS_33870 gene tsf 89 940 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_33870 1001 1555 gene locus_tag LOCUS_33880 gene frr 1001 1555 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_33880 1556 2158 gene locus_tag LOCUS_33890 1556 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence0795 1421 465 gene locus_tag LOCUS_33900 1421 465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_33900 <2257 1418 gene locus_tag LOCUS_33910 <2257 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014233.1:sugar ABC transporter ATP-binding protein >Feature sequence0796 2 289 gene locus_tag LOCUS_33920 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence0797 >Feature sequence0798 1683 778 gene locus_tag LOCUS_33930 1683 778 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_33930 1761 2180 gene locus_tag LOCUS_33940 1761 2180 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence0799 460 909 gene locus_tag LOCUS_33950 gene dut 460 909 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_33950 966 2174 gene locus_tag LOCUS_33960 966 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence0800 461 583 gene locus_tag LOCUS_33970 461 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence0801 1217 75 gene locus_tag LOCUS_33980 1217 75 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657215.1 protein_id gnl|my_center|LOCUS_33980 1869 1204 gene locus_tag LOCUS_33990 gene deoC 1869 1204 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence0802 >Feature sequence0803 106 966 gene locus_tag LOCUS_34000 106 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence0804 >Feature sequence0805 104 1243 gene locus_tag LOCUS_34010 104 1243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence0806 1390 263 gene locus_tag LOCUS_34020 gene opuCA 1390 263 CDS product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 protein_id gnl|my_center|LOCUS_34020 1997 1638 gene locus_tag LOCUS_34030 1997 1638 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence0807 <2237 1621 gene locus_tag LOCUS_34040 <2237 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869350.1:lactate utilization protein >Feature sequence0808 1452 31 gene locus_tag LOCUS_34050 1452 31 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_34050 <2237 1439 gene locus_tag LOCUS_34060 <2237 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925146.1:V-type ATP synthase subunit A >Feature sequence0809 112 1224 gene locus_tag LOCUS_34070 112 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence0810 >Feature sequence0811 1481 2173 gene locus_tag LOCUS_34080 1481 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence0812 <1 945 gene locus_tag LOCUS_34090 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669886.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0813 410 754 gene locus_tag LOCUS_34100 410 754 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 protein_id gnl|my_center|LOCUS_34100 747 1727 gene locus_tag LOCUS_34110 747 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 <2204 1681 gene locus_tag LOCUS_34120 <2204 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682106.1:DUF4954 family protein >Feature sequence0814 223 810 gene locus_tag LOCUS_34130 223 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence0815 161 1900 gene locus_tag LOCUS_34140 161 1900 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence0816 <1 2165 gene locus_tag LOCUS_34150 <1 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956889.1:phage minor structural protein >Feature sequence0817 38 1219 gene locus_tag LOCUS_34160 gene gguB 38 1219 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence0818 1174 1746 gene locus_tag LOCUS_34170 1174 1746 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence0819 878 648 gene locus_tag LOCUS_34180 878 648 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence0820 1711 362 gene locus_tag LOCUS_34190 gene tig 1711 362 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_34190 2086 2014 gene locus_tag LOCUS_t00410 2086 2014 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0821 1807 1124 gene locus_tag LOCUS_34200 1807 1124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence0822 198 1994 gene locus_tag LOCUS_34210 198 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence0823 <2183 1183 gene locus_tag LOCUS_34220 <2183 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000659298.1:anion transporter >Feature sequence0824 >Feature sequence0825 1383 649 gene locus_tag LOCUS_34230 1383 649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence0826 <1 658 gene locus_tag LOCUS_34240 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986756.1:MBL fold metallo-hydrolase 655 1371 gene locus_tag LOCUS_34250 655 1371 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34250 1444 1806 gene locus_tag LOCUS_34260 1444 1806 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_34260 2022 1858 gene locus_tag LOCUS_34270 2022 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence0827 433 1038 gene locus_tag LOCUS_34280 433 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence0828 408 46 gene locus_tag LOCUS_34290 408 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 <2176 527 gene locus_tag LOCUS_34300 <2176 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462918.1:energy-coupling factor transporter transmembrane component T >Feature sequence0829 1395 598 gene locus_tag LOCUS_34310 gene suhB 1395 598 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 protein_id gnl|my_center|LOCUS_34310 1979 1392 gene locus_tag LOCUS_34320 1979 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence0830 <2171 1051 gene locus_tag LOCUS_34330 <2171 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387108.1:voltage-gated chloride channel family protein >Feature sequence0831 1450 335 gene locus_tag LOCUS_34340 1450 335 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920600.1 protein_id gnl|my_center|LOCUS_34340 1814 1437 gene locus_tag LOCUS_34350 1814 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence0832 198 2096 gene locus_tag LOCUS_34360 198 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence0833 1765 539 gene locus_tag LOCUS_34370 1765 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence0834 1222 509 gene locus_tag LOCUS_34380 1222 509 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence0835 <1 780 gene locus_tag LOCUS_34390 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870186.1:transketolase 794 1732 gene locus_tag LOCUS_34400 794 1732 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence0836 22 888 gene locus_tag LOCUS_34410 22 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 1481 2029 gene locus_tag LOCUS_34420 1481 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence0837 <2150 1174 gene locus_tag LOCUS_34430 <2150 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156276126.1:BMP family ABC transporter substrate-binding protein >Feature sequence0838 1787 1155 gene locus_tag LOCUS_34440 1787 1155 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence0839 1990 671 gene locus_tag LOCUS_34450 1990 671 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence0840 1410 631 gene locus_tag LOCUS_34460 1410 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence0841 >Feature sequence0842 <1 525 gene locus_tag LOCUS_34470 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705335.1:mannose-6-phosphate isomerase, class I 568 1857 gene locus_tag LOCUS_34480 568 1857 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927762.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence0843 1356 196 gene locus_tag LOCUS_34490 gene anmK 1356 196 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_34490 1832 1353 gene locus_tag LOCUS_34500 1832 1353 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527000.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence0844 >Feature sequence0845 29 1177 gene locus_tag LOCUS_34510 29 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 1351 2124 gene locus_tag LOCUS_34520 1351 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence0846 >Feature sequence0847 1499 225 gene locus_tag LOCUS_34530 gene galK 1499 225 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence0848 1420 422 gene locus_tag LOCUS_34540 1420 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 <2122 1429 gene locus_tag LOCUS_34550 <2122 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002677705.1:ATP-dependent protease ATPase subunit HslU >Feature sequence0849 <1 649 gene locus_tag LOCUS_34560 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005174778.1:sensor histidine kinase 646 2121 gene locus_tag LOCUS_34570 646 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence0850 <2119 1293 gene locus_tag LOCUS_34580 <2119 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775817.1:carbohydrate ABC transporter permease >Feature sequence0851 327 1202 gene locus_tag LOCUS_34590 327 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence0852 62 868 gene locus_tag LOCUS_34600 62 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence0853 >Feature sequence0854 370 161 gene locus_tag LOCUS_34610 370 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 587 339 gene locus_tag LOCUS_34620 587 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 679 2013 gene locus_tag LOCUS_34630 679 2013 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence0855 1650 286 gene locus_tag LOCUS_34640 1650 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence0856 1721 258 gene locus_tag LOCUS_34650 1721 258 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_34650 1834 2034 gene locus_tag LOCUS_34660 1834 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence0857 267 1295 gene locus_tag LOCUS_34670 267 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1606 1265 gene locus_tag LOCUS_34680 1606 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0858 1213 1013 gene locus_tag LOCUS_34690 1213 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1497 1775 gene locus_tag LOCUS_34700 1497 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence0859 <1 611 gene locus_tag LOCUS_34710 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808433.1:DUF362 domain-containing protein 621 1103 gene locus_tag LOCUS_34720 621 1103 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_34720 >Feature sequence0860 1625 1476 gene locus_tag LOCUS_34730 1625 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence0861 1608 1159 gene locus_tag LOCUS_34740 gene dut 1608 1159 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence0862 1460 732 gene locus_tag LOCUS_34750 1460 732 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_34750 <2091 1470 gene locus_tag LOCUS_34760 <2091 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918873.1:glycoside hydrolase family 43 protein >Feature sequence0863 >Feature sequence0864 1007 174 gene locus_tag LOCUS_34770 1007 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1493 1059 gene locus_tag LOCUS_34780 1493 1059 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence0865 >Feature sequence0866 418 167 gene locus_tag LOCUS_34790 418 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 692 492 gene locus_tag LOCUS_34800 692 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 1722 865 gene locus_tag LOCUS_34810 1722 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence0867 <1 832 gene locus_tag LOCUS_34820 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941760.1:PstS family phosphate ABC transporter substrate-binding protein 905 1819 gene locus_tag LOCUS_34830 gene pstC 905 1819 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence0868 274 1542 gene locus_tag LOCUS_34840 274 1542 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_34840 >Feature sequence0869 1577 522 gene locus_tag LOCUS_34850 1577 522 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence0870 >Feature sequence0871 <1 1457 gene locus_tag LOCUS_34860 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein >Feature sequence0872 <2078 857 gene locus_tag LOCUS_34870 <2078 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393722.1:BREX-1 system phosphatase PglZ type B >Feature sequence0873 1 222 gene locus_tag LOCUS_34880 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 231 1274 gene locus_tag LOCUS_34890 231 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 1271 2035 gene locus_tag LOCUS_34900 1271 2035 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence0874 1199 351 gene locus_tag LOCUS_34910 1199 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1780 1196 gene locus_tag LOCUS_34920 1780 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence0875 726 1193 gene locus_tag LOCUS_34930 726 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence0876 449 1435 gene locus_tag LOCUS_34940 449 1435 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence0877 <1 564 gene locus_tag LOCUS_34950 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920611.1:type II toxin-antitoxin system HipA family toxin 737 1549 gene locus_tag LOCUS_34960 gene sppA 737 1549 CDS product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_34960 >Feature sequence0878 524 171 gene locus_tag LOCUS_34970 524 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 998 528 gene locus_tag LOCUS_34980 998 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2052 1012 gene locus_tag LOCUS_34990 gene nqrF 2052 1012 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence0879 1886 765 gene locus_tag LOCUS_35000 1886 765 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_35000 >Feature sequence0880 >Feature sequence0881 494 1558 gene locus_tag LOCUS_35010 494 1558 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence0882 1021 401 gene locus_tag LOCUS_35020 1021 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35020 <2049 1160 gene locus_tag LOCUS_35030 <2049 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003321939.1:tyrosine-type recombinase/integrase >Feature sequence0883 1305 448 gene locus_tag LOCUS_35040 1305 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1390 1839 gene locus_tag LOCUS_35050 1390 1839 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948369.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence0884 1221 406 gene locus_tag LOCUS_35060 1221 406 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792714.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence0885 1793 222 gene locus_tag LOCUS_35070 1793 222 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166970.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence0886 80 931 gene locus_tag LOCUS_35080 80 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0887 1467 475 gene locus_tag LOCUS_35090 1467 475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972979.1 protein_id gnl|my_center|LOCUS_35090 1952 1494 gene locus_tag LOCUS_35100 1952 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence0888 <1 1767 gene locus_tag LOCUS_35110 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263007.1:glycoside hydrolase family 2 protein >Feature sequence0889 160 924 gene locus_tag LOCUS_35120 160 924 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 protein_id gnl|my_center|LOCUS_35120 924 1562 gene locus_tag LOCUS_35130 gene plsY 924 1562 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_35130 1559 1972 gene locus_tag LOCUS_35140 1559 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence0890 949 362 gene locus_tag LOCUS_35150 949 362 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970963.1 protein_id gnl|my_center|LOCUS_35150 <2032 942 gene locus_tag LOCUS_35160 <2032 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678989.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence0891 1007 516 gene locus_tag LOCUS_35170 1007 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 <2029 1061 gene locus_tag LOCUS_35180 <2029 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395802.1:TRAP transporter substrate-binding protein >Feature sequence0892 >Feature sequence0893 1879 404 gene locus_tag LOCUS_35190 1879 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence0894 284 637 gene locus_tag LOCUS_35200 284 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 645 1112 gene locus_tag LOCUS_35210 645 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence0895 502 1137 gene locus_tag LOCUS_35220 502 1137 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101300.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence0896 974 1717 gene locus_tag LOCUS_35230 974 1717 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_35230 >Feature sequence0897 861 1 gene locus_tag LOCUS_35240 861 1 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156746.1 protein_id gnl|my_center|LOCUS_35240 968 1837 gene locus_tag LOCUS_35250 968 1837 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence0898 >Feature sequence0899 859 1635 gene locus_tag LOCUS_35260 859 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence0900 1148 1942 gene locus_tag LOCUS_35270 1148 1942 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence0901 267 1451 gene locus_tag LOCUS_35280 267 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence0902 1387 1169 gene locus_tag LOCUS_35290 1387 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1386 1802 gene locus_tag LOCUS_35300 1386 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence0903 446 1603 gene locus_tag LOCUS_35310 446 1603 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence0904 1589 306 gene locus_tag LOCUS_35320 1589 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence0905 3 1265 gene locus_tag LOCUS_35330 3 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 1262 1999 gene locus_tag LOCUS_35340 1262 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence0906 >Feature sequence0907 1658 627 gene locus_tag LOCUS_35350 gene rtcA 1658 627 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_35350 1795 1723 gene locus_tag LOCUS_t00420 1795 1723 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2004 1864 gene locus_tag LOCUS_35360 2004 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence0908 1370 336 gene locus_tag LOCUS_35370 gene queA 1370 336 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_35370 <2002 1345 gene locus_tag LOCUS_35380 <2002 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679608.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence0909 <1999 1132 gene locus_tag LOCUS_35390 <1999 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966448.1:3-isopropylmalate dehydrogenase >Feature sequence0910 29 925 gene locus_tag LOCUS_35400 29 925 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_35400 1921 1139 gene locus_tag LOCUS_35410 1921 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence0911 <1 1105 gene locus_tag LOCUS_35420 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680885.1:TraB/GumN family protein <1997 1244 gene locus_tag LOCUS_35430 <1997 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680482.1:DNA repair protein RadA >Feature sequence0912 2 568 gene locus_tag LOCUS_35440 2 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 577 1605 gene locus_tag LOCUS_35450 577 1605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157734.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence0913 1947 811 gene locus_tag LOCUS_35460 gene dnaJ 1947 811 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence0914 1 732 gene locus_tag LOCUS_35470 1 732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_35470 722 1438 gene locus_tag LOCUS_35480 722 1438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence0915 1265 30 gene locus_tag LOCUS_35490 1265 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 1939 1268 gene locus_tag LOCUS_35500 1939 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence0916 <1 636 gene locus_tag LOCUS_35510 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000974881.1:F0F1 ATP synthase subunit alpha 1279 1148 gene locus_tag LOCUS_35520 1279 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence0917 928 1863 gene locus_tag LOCUS_35530 928 1863 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence0918 1329 982 gene locus_tag LOCUS_35540 1329 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence0919 460 1518 gene locus_tag LOCUS_35550 460 1518 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence0920 469 83 gene locus_tag LOCUS_35560 469 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 798 466 gene locus_tag LOCUS_35570 798 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 1136 795 gene locus_tag LOCUS_35580 1136 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 <1983 1151 gene locus_tag LOCUS_35590 <1983 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337511.1:phage major capsid protein >Feature sequence0921 1089 298 gene locus_tag LOCUS_35600 1089 298 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_35600 1697 1101 gene locus_tag LOCUS_35610 1697 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence0922 <1 510 gene locus_tag LOCUS_35620 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669259.1:peptide deformylase 507 1451 gene locus_tag LOCUS_35630 gene fmt 507 1451 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence0923 1090 413 gene locus_tag LOCUS_35640 1090 413 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018377503.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence0924 4 951 gene locus_tag LOCUS_35650 4 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 >Feature sequence0925 <1 627 gene locus_tag LOCUS_35660 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023462.1:ABC transporter substrate-binding protein 681 1610 gene locus_tag LOCUS_35670 681 1610 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence0926 140 733 gene locus_tag LOCUS_35680 140 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence0927 <1973 381 gene locus_tag LOCUS_35690 <1973 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021089.1:IS1634-like element ISMac5 family transposase >Feature sequence0928 <1 1504 gene locus_tag LOCUS_35700 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064252985.1:sugar ABC transporter ATP-binding protein >Feature sequence0929 954 1133 gene locus_tag LOCUS_35710 954 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1824 1897 gene locus_tag LOCUS_t00430 1824 1897 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0930 423 268 gene locus_tag LOCUS_35720 423 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1385 420 gene locus_tag LOCUS_35730 1385 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0931 3 467 gene locus_tag LOCUS_35740 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence0932 470 1648 gene locus_tag LOCUS_35750 470 1648 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080490.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence0933 <1 531 gene locus_tag LOCUS_35760 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272027.1:transketolase 531 1454 gene locus_tag LOCUS_35770 531 1454 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence0934 379 1242 gene locus_tag LOCUS_35780 379 1242 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_35780 <1966 1235 gene locus_tag LOCUS_35790 <1966 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905066.1:SulP family inorganic anion transporter >Feature sequence0935 <1 628 gene locus_tag LOCUS_35800 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393607.1:carbamate kinase 618 1178 gene locus_tag LOCUS_35810 618 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 <1961 1134 gene locus_tag LOCUS_35820 <1961 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764530.1:DUF4105 domain-containing protein >Feature sequence0936 <1 734 gene locus_tag LOCUS_35830 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 817 1359 gene locus_tag LOCUS_35840 817 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence0937 132 524 gene locus_tag LOCUS_35850 132 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 604 996 gene locus_tag LOCUS_35860 604 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1006 1299 gene locus_tag LOCUS_35870 1006 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 383 967 gene locus_tag LOCUS_35880 383 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1864 992 gene locus_tag LOCUS_35890 1864 992 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence0941 38 532 gene locus_tag LOCUS_35900 38 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 541 1584 gene locus_tag LOCUS_35910 gene corA 541 1584 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence0942 <1949 415 gene locus_tag LOCUS_35920 <1949 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948757.1:MBL fold metallo-hydrolase >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 176 1213 gene locus_tag LOCUS_35930 176 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence0946 74 1051 gene locus_tag LOCUS_35940 74 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 1048 1293 gene locus_tag LOCUS_35950 1048 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 1265 1894 gene locus_tag LOCUS_35960 1265 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence0947 346 933 gene locus_tag LOCUS_35970 346 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 930 1445 gene locus_tag LOCUS_35980 930 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1485 1703 gene locus_tag LOCUS_35990 1485 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence0948 716 180 gene locus_tag LOCUS_36000 716 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence0949 >Feature sequence0950 1083 547 gene locus_tag LOCUS_36010 1083 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 1713 1168 gene locus_tag LOCUS_36020 1713 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence0951 229 897 gene locus_tag LOCUS_36030 229 897 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258526.1 protein_id gnl|my_center|LOCUS_36030 894 1772 gene locus_tag LOCUS_36040 894 1772 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence0952 105 416 gene locus_tag LOCUS_36050 105 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 455 1672 gene locus_tag LOCUS_36060 455 1672 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence0953 809 1912 gene locus_tag LOCUS_36070 809 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence0954 236 973 gene locus_tag LOCUS_36080 236 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence0955 780 109 gene locus_tag LOCUS_36090 780 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 1798 800 gene locus_tag LOCUS_36100 1798 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence0956 284 1894 gene locus_tag LOCUS_36110 284 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence0957 1317 148 gene locus_tag LOCUS_36120 1317 148 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence0958 47 766 gene locus_tag LOCUS_36130 47 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 <1912 899 gene locus_tag LOCUS_36140 <1912 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079960.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 1 1284 gene locus_tag LOCUS_36150 1 1284 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383327.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence0962 235 1020 gene locus_tag LOCUS_36160 gene udp 235 1020 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_36160 1770 1108 gene locus_tag LOCUS_36170 1770 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence0963 >Feature sequence0964 1038 112 gene locus_tag LOCUS_36180 1038 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 1833 1084 gene locus_tag LOCUS_36190 1833 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence0965 >Feature sequence0966 1208 360 gene locus_tag LOCUS_36200 1208 360 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_36200 <1898 1218 gene locus_tag LOCUS_36210 <1898 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994448.1:sugar ABC transporter permease >Feature sequence0967 112 1476 gene locus_tag LOCUS_36220 112 1476 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence0968 1127 1654 gene locus_tag LOCUS_36230 1127 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence0969 >Feature sequence0970 1026 52 gene locus_tag LOCUS_36240 1026 52 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_36240 1109 1651 gene locus_tag LOCUS_36250 1109 1651 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence0971 <1895 281 gene locus_tag LOCUS_36260 <1895 281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021089.1:IS1634-like element ISMac5 family transposase >Feature sequence0972 >Feature sequence0973 40 378 gene locus_tag LOCUS_36270 40 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963386.1 protein_id gnl|my_center|LOCUS_36270 447 656 gene locus_tag LOCUS_36280 447 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence0974 554 315 gene locus_tag LOCUS_36290 554 315 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567888.1 protein_id gnl|my_center|LOCUS_36290 1263 769 gene locus_tag LOCUS_36300 1263 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36300 <1895 1335 gene locus_tag LOCUS_36310 <1895 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000413171.1:type 8 capsular polysaccharide synthesis protein Cap8G note possible pseudo, frameshifted >Feature sequence0975 >Feature sequence0976 1542 46 gene locus_tag LOCUS_36320 1542 46 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence0977 >Feature sequence0978 1521 85 gene locus_tag LOCUS_36330 1521 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1817 1518 gene locus_tag LOCUS_36340 1817 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence0979 483 1250 gene locus_tag LOCUS_36350 483 1250 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 <1 667 gene locus_tag LOCUS_36360 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase >Feature sequence0983 693 454 gene locus_tag LOCUS_36370 gene purS 693 454 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_36370 1510 749 gene locus_tag LOCUS_36380 1510 749 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080122.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence0984 1364 429 gene locus_tag LOCUS_36390 1364 429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_36390 <1888 1361 gene locus_tag LOCUS_36400 <1888 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015834.1:ABC transporter ATP-binding protein >Feature sequence0985 517 227 gene locus_tag LOCUS_36410 517 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 1404 529 gene locus_tag LOCUS_36420 1404 529 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence0986 304 1665 gene locus_tag LOCUS_36430 304 1665 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389902.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence0987 >Feature sequence0988 86 1051 gene locus_tag LOCUS_36440 86 1051 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence0989 1486 725 gene locus_tag LOCUS_36450 1486 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_36450 >Feature sequence0990 <1 585 gene locus_tag LOCUS_36460 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109439.1:NAD+--arginine ADP-ribosyltransferase EFV 612 1241 gene locus_tag LOCUS_36470 612 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence0991 >Feature sequence0992 729 94 gene locus_tag LOCUS_36480 729 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1476 859 gene locus_tag LOCUS_36490 1476 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence0993 >Feature sequence0994 <1868 586 gene locus_tag LOCUS_36500 <1868 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459464.1:tripartite tricarboxylate transporter permease >Feature sequence0995 1345 8 gene locus_tag LOCUS_36510 1345 8 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657618.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence0996 141 872 gene locus_tag LOCUS_36520 141 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence0997 >Feature sequence0998 1823 381 gene locus_tag LOCUS_36530 1823 381 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_36530 >Feature sequence0999 840 82 gene locus_tag LOCUS_36540 gene livF 840 82 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176347.1 protein_id gnl|my_center|LOCUS_36540 1616 837 gene locus_tag LOCUS_36550 1616 837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence1000 164 685 gene locus_tag LOCUS_36560 164 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 699 1232 gene locus_tag LOCUS_36570 699 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1208 1837 gene locus_tag LOCUS_36580 1208 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence1001 141 572 gene locus_tag LOCUS_36590 141 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 620 844 gene locus_tag LOCUS_36600 620 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence1002 2 640 gene locus_tag LOCUS_36610 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 750 1781 gene locus_tag LOCUS_36620 750 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence1003 1611 166 gene locus_tag LOCUS_36630 1611 166 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence1004 >Feature sequence1005 340 197 gene locus_tag LOCUS_36640 340 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 1723 635 gene locus_tag LOCUS_36650 1723 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence1006 1332 484 gene locus_tag LOCUS_36660 1332 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence1007 1027 548 gene locus_tag LOCUS_36670 1027 548 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693871.1 protein_id gnl|my_center|LOCUS_36670 <1847 1105 gene locus_tag LOCUS_36680 <1847 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529042.1:TRAP transporter substrate-binding protein >Feature sequence1008 671 246 gene locus_tag LOCUS_36690 671 246 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence1009 265 510 gene locus_tag LOCUS_36700 265 510 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence1010 126 725 gene locus_tag LOCUS_36710 126 725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393188.1 protein_id gnl|my_center|LOCUS_36710 740 1633 gene locus_tag LOCUS_36720 740 1633 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence1011 52 750 gene locus_tag LOCUS_36730 52 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 1247 702 gene locus_tag LOCUS_36740 gene yfcE 1247 702 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence1012 550 17 gene locus_tag LOCUS_36750 550 17 CDS product DUF2764 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678963.1 protein_id gnl|my_center|LOCUS_36750 1162 560 gene locus_tag LOCUS_36760 1162 560 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_36760 1347 1655 gene locus_tag LOCUS_36770 1347 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1013 >Feature sequence1014 576 749 gene locus_tag LOCUS_36780 576 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 995 1759 gene locus_tag LOCUS_36790 995 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence1015 506 87 gene locus_tag LOCUS_36800 506 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence1016 >Feature sequence1017 8 1000 gene locus_tag LOCUS_36810 8 1000 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence1018 >Feature sequence1019 <1829 741 gene locus_tag LOCUS_36820 <1829 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860970.1:phosphoribosylaminoimidazolecarboxamide formyltransferase >Feature sequence1020 732 854 gene locus_tag LOCUS_36830 732 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 <1828 959 gene locus_tag LOCUS_36840 <1828 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099839674.1:cation-translocating P-type ATPase >Feature sequence1021 600 1010 gene locus_tag LOCUS_36850 600 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence1022 754 152 gene locus_tag LOCUS_36860 754 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 <1827 781 gene locus_tag LOCUS_36870 <1827 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494943.1:MATE family efflux transporter >Feature sequence1023 1540 869 gene locus_tag LOCUS_36880 1540 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence1024 >Feature sequence1025 1 459 gene locus_tag LOCUS_36890 1 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 603 1337 gene locus_tag LOCUS_36900 603 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence1026 1018 314 gene locus_tag LOCUS_36910 1018 314 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_36910 1081 1548 gene locus_tag LOCUS_36920 1081 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence1027 <1 557 gene locus_tag LOCUS_36930 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667601.1:50S ribosomal protein L1 570 1109 gene locus_tag LOCUS_36940 gene rplJ 570 1109 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936486.1 protein_id gnl|my_center|LOCUS_36940 1180 1560 gene locus_tag LOCUS_36950 gene rplL 1180 1560 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707702.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence1028 <1 999 gene locus_tag LOCUS_36960 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061143.1:phytoene desaturase family protein >Feature sequence1029 >Feature sequence1030 1454 486 gene locus_tag LOCUS_36970 1454 486 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence1031 1608 19 gene locus_tag LOCUS_36980 1608 19 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence1032 1196 1618 gene locus_tag LOCUS_36990 1196 1618 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence1033 103 186 gene locus_tag LOCUS_t00440 103 186 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1200 250 gene locus_tag LOCUS_37000 1200 250 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208385.1 protein_id gnl|my_center|LOCUS_37000 1653 1213 gene locus_tag LOCUS_37010 1653 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 >Feature sequence1034 >Feature sequence1035 132 605 gene locus_tag LOCUS_37020 132 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence1036 1100 27 gene locus_tag LOCUS_37030 1100 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 1277 1711 gene locus_tag LOCUS_37040 1277 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence1037 >Feature sequence1038 980 126 gene locus_tag LOCUS_37050 980 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence1039 <1 654 gene locus_tag LOCUS_37060 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681107.1:GntP family permease >Feature sequence1040 2 1417 gene locus_tag LOCUS_37070 2 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence1041 <1 546 gene locus_tag LOCUS_37080 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092770593.1:carbohydrate ABC transporter permease 590 1372 gene locus_tag LOCUS_37090 590 1372 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 <1 813 gene locus_tag LOCUS_37100 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009566022.1:TRAP transporter substrate-binding protein 867 1358 gene locus_tag LOCUS_37110 867 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence1045 1631 945 gene locus_tag LOCUS_37120 1631 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 >Feature sequence1046 89 424 gene locus_tag LOCUS_37130 89 424 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_37130 1366 431 gene locus_tag LOCUS_37140 1366 431 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_37140 1786 1376 gene locus_tag LOCUS_37150 1786 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence1047 1495 389 gene locus_tag LOCUS_37160 1495 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence1048 >Feature sequence1049 1180 647 gene locus_tag LOCUS_37170 1180 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence1050 1787 759 gene locus_tag LOCUS_37180 1787 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence1051 >Feature sequence1052 45 593 gene locus_tag LOCUS_37190 gene cobO 45 593 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_37190 675 1307 gene locus_tag LOCUS_37200 gene cps4B 675 1307 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence1053 >Feature sequence1054 525 1598 gene locus_tag LOCUS_37210 525 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 >Feature sequence1055 154 312 gene locus_tag LOCUS_37220 154 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 1564 332 gene locus_tag LOCUS_37230 1564 332 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence1056 649 1089 gene locus_tag LOCUS_37240 649 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1104 1562 gene locus_tag LOCUS_37250 1104 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence1057 729 172 gene locus_tag LOCUS_37260 729 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 >Feature sequence1058 >Feature sequence1059 561 391 gene locus_tag LOCUS_37270 561 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence1060 331 1611 gene locus_tag LOCUS_37280 331 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence1061 606 25 gene locus_tag LOCUS_37290 606 25 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_37290 <1769 761 gene locus_tag LOCUS_37300 <1769 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023422.1:IS1634-like element ISMac12 family transposase >Feature sequence1062 478 1458 gene locus_tag LOCUS_37310 478 1458 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815698.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence1063 >Feature sequence1064 1602 22 gene locus_tag LOCUS_37320 1602 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence1065 1713 535 gene locus_tag LOCUS_37330 1713 535 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255334.1 protein_id gnl|my_center|LOCUS_37330 >Feature sequence1066 104 1456 gene locus_tag LOCUS_37340 104 1456 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681233.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence1067 804 295 gene locus_tag LOCUS_37350 804 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 1754 807 gene locus_tag LOCUS_37360 1754 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence1068 >Feature sequence1069 332 553 gene locus_tag LOCUS_37370 332 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 554 793 gene locus_tag LOCUS_37380 554 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 866 1177 gene locus_tag LOCUS_37390 866 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1412 1639 gene locus_tag LOCUS_37400 1412 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence1070 142 1371 gene locus_tag LOCUS_37410 142 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence1071 <1 853 gene locus_tag LOCUS_37420 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973962.1:glycoside hydrolase family 105 protein 1698 850 gene locus_tag LOCUS_37430 1698 850 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_37430 >Feature sequence1072 113 1126 gene locus_tag LOCUS_37440 113 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 1385 1732 gene locus_tag LOCUS_37450 1385 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence1073 1615 452 gene locus_tag LOCUS_37460 1615 452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence1074 1487 1726 gene locus_tag LOCUS_37470 1487 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence1075 1675 377 gene locus_tag LOCUS_37480 1675 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence1076 380 544 gene locus_tag LOCUS_37490 380 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 613 1560 gene locus_tag LOCUS_37500 613 1560 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065612111.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence1077 140 18 gene locus_tag LOCUS_37510 140 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 1243 1055 gene locus_tag LOCUS_37520 1243 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence1078 1347 736 gene locus_tag LOCUS_37530 1347 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence1079 22 849 gene locus_tag LOCUS_37540 22 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 >Feature sequence1080 <1 1703 gene locus_tag LOCUS_37550 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761136.1:PEP/pyruvate-binding domain-containing protein >Feature sequence1081 35 418 gene locus_tag LOCUS_37560 35 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence1082 1589 108 gene locus_tag LOCUS_37570 1589 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence1083 3 158 gene locus_tag LOCUS_37580 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 139 1512 gene locus_tag LOCUS_37590 139 1512 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_37590 1509 1730 gene locus_tag LOCUS_37600 1509 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence1084 927 142 gene locus_tag LOCUS_37610 927 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence1085 >Feature sequence1086 >Feature sequence1087 454 1047 gene locus_tag LOCUS_37620 454 1047 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_37620 1053 1613 gene locus_tag LOCUS_37630 1053 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence1088 >Feature sequence1089 1600 761 gene locus_tag LOCUS_37640 1600 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence1090 <1728 816 gene locus_tag LOCUS_37650 <1728 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990068.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence1091 168 536 gene locus_tag LOCUS_37660 168 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 533 751 gene locus_tag LOCUS_37670 533 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence1092 251 1330 gene locus_tag LOCUS_37680 251 1330 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence1093 927 256 gene locus_tag LOCUS_37690 927 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 <1724 920 gene locus_tag LOCUS_37700 <1724 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948297.1:polyamine ABC transporter ATP-binding protein >Feature sequence1094 >Feature sequence1095 1311 1535 gene locus_tag LOCUS_37710 1311 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 >Feature sequence1096 498 710 gene locus_tag LOCUS_37720 498 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 821 1243 gene locus_tag LOCUS_37730 821 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 1233 1457 gene locus_tag LOCUS_37740 1233 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence1097 233 1450 gene locus_tag LOCUS_37750 233 1450 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056650.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence1098 56 1507 gene locus_tag LOCUS_37760 gene mobV 56 1507 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323434.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence1099 203 901 gene locus_tag LOCUS_37770 203 901 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082090.1 protein_id gnl|my_center|LOCUS_37770 >Feature sequence1100 1675 734 gene locus_tag LOCUS_37780 1675 734 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_37780 >Feature sequence1101 1581 664 gene locus_tag LOCUS_37790 1581 664 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence1102 364 1458 gene locus_tag LOCUS_37800 364 1458 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence1103 139 1257 gene locus_tag LOCUS_37810 139 1257 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582516.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence1104 164 1582 gene locus_tag LOCUS_37820 gene ltrA 164 1582 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence1105 736 820 gene locus_tag LOCUS_t00450 736 820 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 936 1229 gene locus_tag LOCUS_37830 936 1229 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889969.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence1106 256 1416 gene locus_tag LOCUS_37840 256 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence1107 356 580 gene locus_tag LOCUS_37850 356 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 577 981 gene locus_tag LOCUS_37860 577 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 1367 1582 gene locus_tag LOCUS_37870 1367 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence1108 565 1317 gene locus_tag LOCUS_37880 565 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence1109 360 815 gene locus_tag LOCUS_37890 360 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence1110 <1 1074 gene locus_tag LOCUS_37900 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680429.1:methionine adenosyltransferase <1706 1058 gene locus_tag LOCUS_37910 <1706 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869386.1:anaerobic ribonucleoside-triphosphate reductase activating protein >Feature sequence1111 133 699 gene locus_tag LOCUS_37920 133 699 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 protein_id gnl|my_center|LOCUS_37920 1616 696 gene locus_tag LOCUS_37930 1616 696 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528649.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence1112 >Feature sequence1113 173 706 gene locus_tag LOCUS_37940 173 706 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_37940 1422 703 gene locus_tag LOCUS_37950 1422 703 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461647.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence1114 1497 1273 gene locus_tag LOCUS_37960 1497 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 1639 1475 gene locus_tag LOCUS_37970 1639 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 >Feature sequence1115 1023 1532 gene locus_tag LOCUS_37980 1023 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence1116 <1701 955 gene locus_tag LOCUS_37990 <1701 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766232.1:histidinol dehydrogenase >Feature sequence1117 2 505 gene locus_tag LOCUS_38000 2 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 498 1454 gene locus_tag LOCUS_38010 498 1454 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence1118 1674 4 gene locus_tag LOCUS_38020 1674 4 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence1119 >Feature sequence1120 170 505 gene locus_tag LOCUS_38030 170 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 519 1001 gene locus_tag LOCUS_38040 519 1001 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_38040 998 1564 gene locus_tag LOCUS_38050 998 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence1121 <1 1502 gene locus_tag LOCUS_38060 <1 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667902.1:DNA topoisomerase IV subunit B >Feature sequence1122 159 1670 gene locus_tag LOCUS_38070 159 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence1123 284 1174 gene locus_tag LOCUS_38080 284 1174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_38080 1269 1436 gene locus_tag LOCUS_38090 1269 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1124 <1 1456 gene locus_tag LOCUS_38100 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971451.1:DNA-directed RNA polymerase >Feature sequence1125 3 1010 gene locus_tag LOCUS_38110 3 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 1216 941 gene locus_tag LOCUS_38120 1216 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 >Feature sequence1126 220 852 gene locus_tag LOCUS_38130 gene ruvA 220 852 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence1127 1408 1007 gene locus_tag LOCUS_38140 1408 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1442 1597 gene locus_tag LOCUS_38150 1442 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 >Feature sequence1128 44 883 gene locus_tag LOCUS_38160 44 883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_38160 880 1593 gene locus_tag LOCUS_38170 880 1593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence1129 812 219 gene locus_tag LOCUS_38180 gene hisH 812 219 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_38180 <1687 809 gene locus_tag LOCUS_38190 <1687 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766230.1:bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB >Feature sequence1130 46 822 gene locus_tag LOCUS_38200 46 822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948655.1 protein_id gnl|my_center|LOCUS_38200 809 1480 gene locus_tag LOCUS_38210 809 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence1131 279 1574 gene locus_tag LOCUS_38220 279 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence1132 >Feature sequence1133 1290 109 gene locus_tag LOCUS_38230 1290 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 >Feature sequence1134 <1678 915 gene locus_tag LOCUS_38240 <1678 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921512.1:LacI family DNA-binding transcriptional regulator >Feature sequence1135 1167 1658 gene locus_tag LOCUS_38250 1167 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence1136 <1678 4 gene locus_tag LOCUS_38260 <1678 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393722.1:BREX-1 system phosphatase PglZ type B >Feature sequence1137 <1677 493 gene locus_tag LOCUS_38270 <1677 493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966040.1:MFS transporter >Feature sequence1138 >Feature sequence1139 <1674 118 gene locus_tag LOCUS_38280 <1674 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250356.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence1140 <1673 1019 gene locus_tag LOCUS_38290 <1673 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964255.1:histidinol dehydrogenase >Feature sequence1141 792 175 gene locus_tag LOCUS_38300 792 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 945 1145 gene locus_tag LOCUS_38310 945 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 1165 1374 gene locus_tag LOCUS_38320 1165 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence1142 >Feature sequence1143 26 781 gene locus_tag LOCUS_38330 26 781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066010.1 protein_id gnl|my_center|LOCUS_38330 <1671 771 gene locus_tag LOCUS_38340 <1671 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937748.1:adenine deaminase >Feature sequence1144 <1 638 gene locus_tag LOCUS_38350 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385183.1:DNA polymerase III subunit delta' >Feature sequence1145 <1 776 gene locus_tag LOCUS_38360 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943766.1:sigma 54-interacting transcriptional regulator 967 833 gene locus_tag LOCUS_38370 967 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence1146 517 1542 gene locus_tag LOCUS_38380 517 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 208 1260 gene locus_tag LOCUS_38390 208 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence1150 162 1280 gene locus_tag LOCUS_38400 gene ugpC 162 1280 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_38400 >Feature sequence1151 <1 786 gene locus_tag LOCUS_38410 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530686.1:ROK family transcriptional regulator 1533 1009 gene locus_tag LOCUS_38420 1533 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence1152 <1 915 gene locus_tag LOCUS_38430 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584090.1:sugar ABC transporter substrate-binding protein >Feature sequence1153 502 1194 gene locus_tag LOCUS_38440 gene rsmI 502 1194 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_38440 >Feature sequence1154 1383 382 gene locus_tag LOCUS_38450 1383 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 >Feature sequence1155 >Feature sequence1156 <1 583 gene locus_tag LOCUS_38460 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533602.1:ABC transporter permease 585 902 gene locus_tag LOCUS_38470 gene rhaM 585 902 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence1157 >Feature sequence1158 >Feature sequence1159 1540 179 gene locus_tag LOCUS_38480 1540 179 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence1160 >Feature sequence1161 >Feature sequence1162 1353 784 gene locus_tag LOCUS_38490 1353 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1359 1478 gene locus_tag LOCUS_38500 1359 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence1163 >Feature sequence1164 >Feature sequence1165 <1645 111 gene locus_tag LOCUS_38510 <1645 111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797468.1:pyruvate formate lyase family protein >Feature sequence1166 >Feature sequence1167 1626 1117 gene locus_tag LOCUS_38520 1626 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence1168 >Feature sequence1169 59 1165 gene locus_tag LOCUS_38530 gene ychF 59 1165 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence1170 1084 83 gene locus_tag LOCUS_38540 gene yiaK 1084 83 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094954.1 protein_id gnl|my_center|LOCUS_38540 <1642 1081 gene locus_tag LOCUS_38550 <1642 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680941.1:UvrD-helicase domain-containing protein >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 575 1516 gene locus_tag LOCUS_38560 575 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence1174 1114 254 gene locus_tag LOCUS_38570 1114 254 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_38570 1362 1180 gene locus_tag LOCUS_38580 1362 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence1175 1197 451 gene locus_tag LOCUS_38590 1197 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence1176 52 1227 gene locus_tag LOCUS_38600 52 1227 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 protein_id gnl|my_center|LOCUS_38600 >Feature sequence1177 1584 457 gene locus_tag LOCUS_38610 1584 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence1178 3 1406 gene locus_tag LOCUS_38620 3 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence1179 1567 890 gene locus_tag LOCUS_38630 1567 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence1180 1541 321 gene locus_tag LOCUS_38640 1541 321 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence1181 <1 635 gene locus_tag LOCUS_38650 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061266.1:phosphoglycerate dehydrogenase 650 772 gene locus_tag LOCUS_38660 650 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 790 1446 gene locus_tag LOCUS_38670 790 1446 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence1182 331 1266 gene locus_tag LOCUS_38680 gene xerC 331 1266 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence1183 172 1047 gene locus_tag LOCUS_38690 gene ftsY 172 1047 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_38690 1181 1603 gene locus_tag LOCUS_38700 1181 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence1184 1570 1280 gene locus_tag LOCUS_38710 1570 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence1185 1547 123 gene locus_tag LOCUS_38720 1547 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence1186 <1 815 gene locus_tag LOCUS_38730 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012602296.1:sugar kinase >Feature sequence1187 87 299 gene locus_tag LOCUS_38740 87 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 337 819 gene locus_tag LOCUS_38750 337 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 830 1348 gene locus_tag LOCUS_38760 830 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence1188 >Feature sequence1189 <1 953 gene locus_tag LOCUS_38770 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000633861.1:ATP-binding cassette domain-containing protein >Feature sequence1190 >Feature sequence1191 >Feature sequence1192 1498 239 gene locus_tag LOCUS_38780 1498 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence1193 <1608 337 gene locus_tag LOCUS_38790 <1608 337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785885.1:catalase >Feature sequence1194 >Feature sequence1195 456 274 gene locus_tag LOCUS_38800 456 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence1196 21 1175 gene locus_tag LOCUS_38810 21 1175 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_38810 1605 1375 gene locus_tag LOCUS_38820 1605 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38820 >Feature sequence1197 >Feature sequence1198 537 7 gene locus_tag LOCUS_38830 537 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence1199 <1 647 gene locus_tag LOCUS_38840 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975043.1:NAD(P)-dependent alcohol dehydrogenase 1391 729 gene locus_tag LOCUS_38850 1391 729 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence1200 251 370 gene locus_tag LOCUS_38860 251 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 569 733 gene locus_tag LOCUS_38870 569 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 1202 1411 gene locus_tag LOCUS_38880 1202 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence1201 337 558 gene locus_tag LOCUS_38890 337 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 638 904 gene locus_tag LOCUS_38900 638 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 1575 967 gene locus_tag LOCUS_38910 1575 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942932.1 protein_id gnl|my_center|LOCUS_38910 >Feature sequence1202 948 367 gene locus_tag LOCUS_38920 948 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 1093 932 gene locus_tag LOCUS_38930 1093 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 1585 1211 gene locus_tag LOCUS_38940 1585 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence1203 >Feature sequence1204 1515 40 gene locus_tag LOCUS_38950 gene xylB 1515 40 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_38950 >Feature sequence1205 155 586 gene locus_tag LOCUS_38960 155 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 579 920 gene locus_tag LOCUS_38970 579 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 979 1395 gene locus_tag LOCUS_38980 979 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence1206 810 121 gene locus_tag LOCUS_38990 810 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 <1596 882 gene locus_tag LOCUS_39000 <1596 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679883.1:30S ribosomal protein S1 >Feature sequence1207 1219 989 gene locus_tag LOCUS_39010 1219 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence1208 1 642 gene locus_tag LOCUS_39020 1 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 624 923 gene locus_tag LOCUS_39030 624 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 925 1272 gene locus_tag LOCUS_39040 925 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence1209 >Feature sequence1210 216 896 gene locus_tag LOCUS_39050 216 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 443 1279 gene locus_tag LOCUS_39060 443 1279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence1214 <1592 533 gene locus_tag LOCUS_39070 <1592 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000463030.1:tripartite tricarboxylate transporter permease >Feature sequence1215 <1 797 gene locus_tag LOCUS_39080 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812070.1:5'/3'-nucleotidase SurE 790 1143 gene locus_tag LOCUS_39090 790 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence1216 1032 103 gene locus_tag LOCUS_39100 1032 103 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence1217 1546 29 gene locus_tag LOCUS_39110 1546 29 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence1218 222 1373 gene locus_tag LOCUS_39120 222 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence1219 1242 1015 gene locus_tag LOCUS_39130 1242 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence1220 >Feature sequence1221 1123 698 gene locus_tag LOCUS_39140 1123 698 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence1222 158 586 gene locus_tag LOCUS_39150 158 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence1223 199 41 gene locus_tag LOCUS_39160 199 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 822 1094 gene locus_tag LOCUS_39170 822 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 1028 1273 gene locus_tag LOCUS_39180 1028 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence1224 775 155 gene locus_tag LOCUS_39190 775 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 1105 776 gene locus_tag LOCUS_39200 1105 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 1505 1098 gene locus_tag LOCUS_39210 1505 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence1225 >Feature sequence1226 <1581 958 gene locus_tag LOCUS_39220 <1581 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938534.1:basic amino acid ABC transporter substrate-binding protein >Feature sequence1227 124 408 gene locus_tag LOCUS_39230 124 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 560 847 gene locus_tag LOCUS_39240 560 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 840 1070 gene locus_tag LOCUS_39250 840 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1070 1531 gene locus_tag LOCUS_39260 1070 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence1228 1325 837 gene locus_tag LOCUS_39270 1325 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence1229 1042 383 gene locus_tag LOCUS_39280 1042 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39280 1423 1058 gene locus_tag LOCUS_39290 1423 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39290 >Feature sequence1230 8 490 gene locus_tag LOCUS_39300 8 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 <1578 487 gene locus_tag LOCUS_39310 <1578 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139375234.1:S41 family peptidase >Feature sequence1231 >Feature sequence1232 773 1498 gene locus_tag LOCUS_39320 773 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence1233 1012 440 gene locus_tag LOCUS_39330 gene mocA 1012 440 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence1234 <1576 707 gene locus_tag LOCUS_39340 <1576 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989339.1:2-hydroxyacid dehydrogenase family protein >Feature sequence1235 >Feature sequence1236 <1575 558 gene locus_tag LOCUS_39350 <1575 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070958.1:TonB-dependent copper receptor >Feature sequence1237 >Feature sequence1238 3 368 gene locus_tag LOCUS_39360 3 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence1239 1036 326 gene locus_tag LOCUS_39370 1036 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence1240 196 477 gene locus_tag LOCUS_39380 196 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence1241 240 1022 gene locus_tag LOCUS_39390 240 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39390 1015 1425 gene locus_tag LOCUS_39400 1015 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence1242 1504 689 gene locus_tag LOCUS_39410 1504 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence1243 1502 1023 gene locus_tag LOCUS_39420 1502 1023 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520538.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence1244 787 161 gene locus_tag LOCUS_39430 787 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 1299 784 gene locus_tag LOCUS_39440 1299 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence1245 <1 773 gene locus_tag LOCUS_39450 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679012.1:phosphoenolpyruvate mutase >Feature sequence1246 412 293 gene locus_tag LOCUS_39460 412 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 <1567 437 gene locus_tag LOCUS_39470 <1567 437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760641.1:FGGY-family carbohydrate kinase >Feature sequence1247 569 1033 gene locus_tag LOCUS_39480 gene nrdR 569 1033 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence1248 473 1435 gene locus_tag LOCUS_39490 gene amrS 473 1435 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence1249 >Feature sequence1250 619 131 gene locus_tag LOCUS_39500 619 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence1251 >Feature sequence1252 561 319 gene locus_tag LOCUS_39510 561 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 713 561 gene locus_tag LOCUS_39520 713 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 958 713 gene locus_tag LOCUS_39530 958 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 1133 969 gene locus_tag LOCUS_39540 1133 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 1397 1251 gene locus_tag LOCUS_39550 1397 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 >Feature sequence1253 <1 1091 gene locus_tag LOCUS_39560 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941205.1:EAL domain-containing protein >Feature sequence1254 <1559 374 gene locus_tag LOCUS_39570 <1559 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675346.1:sigma-54 dependent transcriptional regulator >Feature sequence1255 >Feature sequence1256 >Feature sequence1257 >Feature sequence1258 >Feature sequence1259 <1 531 gene locus_tag LOCUS_39580 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919363.1:LacI family DNA-binding transcriptional regulator 518 1438 gene locus_tag LOCUS_39590 518 1438 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_39590 >Feature sequence1260 1552 149 gene locus_tag LOCUS_39600 gene purB 1552 149 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence1261 >Feature sequence1262 <1 637 gene locus_tag LOCUS_39610 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263332.1:decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase >Feature sequence1263 904 1368 gene locus_tag LOCUS_39620 904 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 1365 1505 gene locus_tag LOCUS_39630 1365 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence1264 346 1548 gene locus_tag LOCUS_39640 346 1548 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_39640 >Feature sequence1265 396 1382 gene locus_tag LOCUS_39650 gene pspF 396 1382 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence1266 3 410 gene locus_tag LOCUS_39660 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 423 1211 gene locus_tag LOCUS_39670 423 1211 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039072.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence1267 340 1086 gene locus_tag LOCUS_39680 340 1086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_39680 >Feature sequence1268 >Feature sequence1269 <1545 603 gene locus_tag LOCUS_39690 <1545 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962445.1:NADP-specific glutamate dehydrogenase >Feature sequence1270 <1 1146 gene locus_tag LOCUS_39700 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582923.1:ABC transporter substrate-binding protein >Feature sequence1271 <1544 515 gene locus_tag LOCUS_39710 <1544 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972785.1:TRAP transporter large permease >Feature sequence1272 355 1521 gene locus_tag LOCUS_39720 gene chrA 355 1521 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_39720 >Feature sequence1273 <1 1158 gene locus_tag LOCUS_39730 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071804.1:DEAD/DEAH box helicase 1155 1457 gene locus_tag LOCUS_39740 1155 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence1274 1030 197 gene locus_tag LOCUS_39750 1030 197 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_39750 >Feature sequence1275 >Feature sequence1276 >Feature sequence1277 <1 775 gene locus_tag LOCUS_39760 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009931701.1:trehalose operon repressor >Feature sequence1278 >Feature sequence1279 41 1405 gene locus_tag LOCUS_39770 41 1405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257949.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence1280 >Feature sequence1281 <1 586 gene locus_tag LOCUS_39780 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133957058.1:TRAP transporter permease >Feature sequence1282 <1535 923 gene locus_tag LOCUS_39790 <1535 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089638.1:aspartate aminotransferase family protein >Feature sequence1283 >Feature sequence1284 >Feature sequence1285 779 348 gene locus_tag LOCUS_39800 779 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence1286 1360 821 gene locus_tag LOCUS_39810 1360 821 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075566313.1 protein_id gnl|my_center|LOCUS_39810 >Feature sequence1287 604 413 gene locus_tag LOCUS_39820 604 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 1182 697 gene locus_tag LOCUS_39830 1182 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence1288 302 577 gene locus_tag LOCUS_39840 302 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 620 808 gene locus_tag LOCUS_39850 620 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 929 1159 gene locus_tag LOCUS_39860 929 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 1179 1400 gene locus_tag LOCUS_39870 1179 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence1289 >Feature sequence1290 893 84 gene locus_tag LOCUS_39880 893 84 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence1291 1250 1041 gene locus_tag LOCUS_39890 1250 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 >Feature sequence1292 847 482 gene locus_tag LOCUS_39900 847 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 1208 807 gene locus_tag LOCUS_39910 1208 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence1293 <1523 747 gene locus_tag LOCUS_39920 <1523 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965612.1:dTDP-4-dehydrorhamnose reductase >Feature sequence1294 <1523 815 gene locus_tag LOCUS_39930 <1523 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814295.1:aldehyde dehydrogenase >Feature sequence1295 178 594 gene locus_tag LOCUS_39940 178 594 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815877.1 protein_id gnl|my_center|LOCUS_39940 887 747 gene locus_tag LOCUS_39950 887 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 1005 862 gene locus_tag LOCUS_39960 1005 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 1431 1015 gene locus_tag LOCUS_39970 1431 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 >Feature sequence1296 1307 117 gene locus_tag LOCUS_39980 1307 117 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_39980 >Feature sequence1297 1461 94 gene locus_tag LOCUS_39990 1461 94 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence1298 >Feature sequence1299 312 1481 gene locus_tag LOCUS_40000 312 1481 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence1300 <1 545 gene locus_tag LOCUS_40010 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001279286.1:UDP-4-amino-4-deoxy-L-arabinose aminotransferase >Feature sequence1301 612 376 gene locus_tag LOCUS_40020 612 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence1302 1412 219 gene locus_tag LOCUS_40030 1412 219 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence1303 37 1395 gene locus_tag LOCUS_40040 37 1395 CDS product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187628.1 protein_id gnl|my_center|LOCUS_40040 >Feature sequence1304 321 1358 gene locus_tag LOCUS_40050 321 1358 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence1305 <1512 697 gene locus_tag LOCUS_40060 <1512 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303104.1:TonB-dependent receptor >Feature sequence1306 204 581 gene locus_tag LOCUS_40070 204 581 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021349.1 protein_id gnl|my_center|LOCUS_40070 583 1434 gene locus_tag LOCUS_40080 583 1434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_40080 >Feature sequence1307 75 3 gene locus_tag LOCUS_t00460 75 3 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 310 1095 gene locus_tag LOCUS_40090 310 1095 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_40090 >Feature sequence1308 >Feature sequence1309 1379 408 gene locus_tag LOCUS_40100 1379 408 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938271.1 protein_id gnl|my_center|LOCUS_40100 >Feature sequence1310 774 1196 gene locus_tag LOCUS_40110 774 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 1186 1356 gene locus_tag LOCUS_40120 1186 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 >Feature sequence1311 947 531 gene locus_tag LOCUS_40130 947 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1348 944 gene locus_tag LOCUS_40140 1348 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence1312 <1 769 gene locus_tag LOCUS_40150 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249303.1:slipin family protein 766 1446 gene locus_tag LOCUS_40160 766 1446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 30 1088 gene locus_tag LOCUS_40170 gene leuB 30 1088 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence1316 27 773 gene locus_tag LOCUS_40180 27 773 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020379.1 protein_id gnl|my_center|LOCUS_40180 991 1365 gene locus_tag LOCUS_40190 991 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence1317 >Feature sequence1318 <1497 758 gene locus_tag LOCUS_40200 <1497 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202261.1:capsular polysaccharide biosynthesis protein CapF >Feature sequence1319 <1497 414 gene locus_tag LOCUS_40210 <1497 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202933.1:phosphoenolpyruvate mutase >Feature sequence1320 1471 518 gene locus_tag LOCUS_40220 1471 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 1 192 gene locus_tag LOCUS_40230 1 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 953 189 gene locus_tag LOCUS_40240 953 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence1325 383 1126 gene locus_tag LOCUS_40250 383 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence1326 217 1401 gene locus_tag LOCUS_40260 217 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence1327 121 897 gene locus_tag LOCUS_40270 121 897 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_40270 <1486 932 gene locus_tag LOCUS_40280 <1486 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_160069703.1:carbohydrate-binding family 9-like protein >Feature sequence1328 307 1221 gene locus_tag LOCUS_40290 307 1221 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_40290 >Feature sequence1329 >Feature sequence1330 <1 1340 gene locus_tag LOCUS_40300 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393496.1:pyridoxal-phosphate dependent enzyme >Feature sequence1331 <1 883 gene locus_tag LOCUS_40310 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287995.1:sugar ABC transporter ATP-binding protein >Feature sequence1332 >Feature sequence1333 <1477 448 gene locus_tag LOCUS_40320 <1477 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760603.1:diphosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence1334 <1 949 gene locus_tag LOCUS_40330 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681761.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence1335 54 416 gene locus_tag LOCUS_40340 54 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 418 1293 gene locus_tag LOCUS_40350 418 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 >Feature sequence1336 <1 1336 gene locus_tag LOCUS_40360 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080610.1:glycerol kinase GlpK >Feature sequence1337 1468 737 gene locus_tag LOCUS_40370 1468 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 >Feature sequence1338 >Feature sequence1339 1445 24 gene locus_tag LOCUS_40380 gene xdhA 1445 24 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242244.1 protein_id gnl|my_center|LOCUS_40380 >Feature sequence1340 <1 1153 gene locus_tag LOCUS_40390 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379712.1:knotted carbamoyltransferase YgeW >Feature sequence1341 >Feature sequence1342 175 459 gene locus_tag LOCUS_40400 175 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 522 1406 gene locus_tag LOCUS_40410 gene rfbA 522 1406 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 protein_id gnl|my_center|LOCUS_40410 >Feature sequence1343 704 54 gene locus_tag LOCUS_40420 704 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence1344 961 770 gene locus_tag LOCUS_40430 961 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence1345 1377 142 gene locus_tag LOCUS_40440 1377 142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095708.1 protein_id gnl|my_center|LOCUS_40440 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 <1 993 gene locus_tag LOCUS_40450 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393734.1:citramalate synthase >Feature sequence1349 >Feature sequence1350 156 1142 gene locus_tag LOCUS_40460 156 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence1351 1311 619 gene locus_tag LOCUS_40470 gene rsmI 1311 619 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_40470 >Feature sequence1352 265 774 gene locus_tag LOCUS_40480 265 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40480 808 1104 gene locus_tag LOCUS_40490 808 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence1353 >Feature sequence1354 <1455 762 gene locus_tag LOCUS_40500 <1455 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948895.1:cation diffusion facilitator family transporter >Feature sequence1355 >Feature sequence1356 <1452 79 gene locus_tag LOCUS_40510 <1452 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005805141.1:IS66-like element ISBthe6 family transposase >Feature sequence1357 <1452 356 gene locus_tag LOCUS_40520 <1452 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102276.1:helix-turn-helix domain-containing protein >Feature sequence1358 606 1025 gene locus_tag LOCUS_40530 606 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 >Feature sequence1359 >Feature sequence1360 466 1401 gene locus_tag LOCUS_40540 466 1401 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658190.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence1361 <1447 690 gene locus_tag LOCUS_40550 <1447 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083268.1:5-keto-L-gluconate epimerase >Feature sequence1362 736 2 gene locus_tag LOCUS_40560 736 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 1170 733 gene locus_tag LOCUS_40570 1170 733 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_40570 >Feature sequence1363 1 942 gene locus_tag LOCUS_40580 1 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 >Feature sequence1364 84 218 gene locus_tag LOCUS_40590 84 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence1365 72 1328 gene locus_tag LOCUS_40600 gene larA 72 1328 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence1366 >Feature sequence1367 995 57 gene locus_tag LOCUS_40610 995 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 >Feature sequence1368 <1 504 gene locus_tag LOCUS_40620 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091117.1:TatD family hydrolase 1273 470 gene locus_tag LOCUS_40630 1273 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence1369 <1441 884 gene locus_tag LOCUS_40640 <1441 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877021.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence1370 682 524 gene locus_tag LOCUS_40650 682 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 816 1040 gene locus_tag LOCUS_40660 816 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence1371 1358 462 gene locus_tag LOCUS_40670 1358 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence1372 <1 681 gene locus_tag LOCUS_40680 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948435.1:AraC family transcriptional regulator >Feature sequence1373 620 904 gene locus_tag LOCUS_40690 620 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 987 1226 gene locus_tag LOCUS_40700 987 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence1374 592 227 gene locus_tag LOCUS_40710 592 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 506 727 gene locus_tag LOCUS_40720 506 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence1375 1254 127 gene locus_tag LOCUS_40730 1254 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence1376 <1435 358 gene locus_tag LOCUS_40740 <1435 358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022377.1:ISL3-like element ISMac21 family transposase >Feature sequence1377 1315 26 gene locus_tag LOCUS_40750 1315 26 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598615.1 protein_id gnl|my_center|LOCUS_40750 >Feature sequence1378 >Feature sequence1379 >Feature sequence1380 409 245 gene locus_tag LOCUS_40760 409 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 1430 1080 gene locus_tag LOCUS_40770 1430 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence1381 585 1352 gene locus_tag LOCUS_40780 585 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence1382 1427 750 gene locus_tag LOCUS_40790 1427 750 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence1383 1050 181 gene locus_tag LOCUS_40800 1050 181 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_40800 >Feature sequence1384 >Feature sequence1385 566 811 gene locus_tag LOCUS_40810 566 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence1386 435 641 gene locus_tag LOCUS_40820 435 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence1387 1346 342 gene locus_tag LOCUS_40830 gene mglC 1346 342 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 protein_id gnl|my_center|LOCUS_40830 >Feature sequence1388 191 622 gene locus_tag LOCUS_40840 191 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence1389 <1 867 gene locus_tag LOCUS_40850 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948454.1:DnaD domain protein >Feature sequence1390 >Feature sequence1391 978 838 gene locus_tag LOCUS_40860 978 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 >Feature sequence1392 <1 1353 gene locus_tag LOCUS_40870 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288004.1:response regulator >Feature sequence1393 86 1084 gene locus_tag LOCUS_40880 86 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence1394 669 1415 gene locus_tag LOCUS_40890 669 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence1395 <1 1355 gene locus_tag LOCUS_40900 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002657592.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence1396 >Feature sequence1397 72 377 gene locus_tag LOCUS_40910 72 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40910 608 1201 gene locus_tag LOCUS_40920 608 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 >Feature sequence1398 589 38 gene locus_tag LOCUS_40930 589 38 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_40930 1371 586 gene locus_tag LOCUS_40940 1371 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence1399 275 1399 gene locus_tag LOCUS_40950 275 1399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_40950 >Feature sequence1400 <1 1077 gene locus_tag LOCUS_40960 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810397.1:serpin family protein >Feature sequence1401 379 1401 gene locus_tag LOCUS_40970 379 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 >Feature sequence1402 87 692 gene locus_tag LOCUS_40980 87 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 <1413 741 gene locus_tag LOCUS_40990 <1413 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074276.1:NAD-dependent epimerase >Feature sequence1403 >Feature sequence1404 >Feature sequence1405 <1 892 gene locus_tag LOCUS_41000 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010829.1:M42 family metallopeptidase >Feature sequence1406 1041 289 gene locus_tag LOCUS_41010 1041 289 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence1407 3 629 gene locus_tag LOCUS_41020 3 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 679 1002 gene locus_tag LOCUS_41030 679 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence1408 18 89 gene locus_tag LOCUS_t00470 18 89 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1409 >Feature sequence1410 3 902 gene locus_tag LOCUS_41040 3 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 <1411 883 gene locus_tag LOCUS_41050 <1411 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680912.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence1411 <1410 861 gene locus_tag LOCUS_41060 <1410 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202261.1:capsular polysaccharide biosynthesis protein CapF >Feature sequence1412 >Feature sequence1413 1204 668 gene locus_tag LOCUS_41070 1204 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence1414 <1405 255 gene locus_tag LOCUS_41080 <1405 255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986887.1:cysteine desulfurase NifS >Feature sequence1415 <1 928 gene locus_tag LOCUS_41090 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948145.1:electron transport complex subunit RsxC >Feature sequence1416 532 5 gene locus_tag LOCUS_41100 532 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 >Feature sequence1417 >Feature sequence1418 550 753 gene locus_tag LOCUS_41110 550 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 1061 693 gene locus_tag LOCUS_41120 1061 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 1290 1171 gene locus_tag LOCUS_41130 1290 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence1419 174 52 gene locus_tag LOCUS_41140 174 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 410 177 gene locus_tag LOCUS_41150 410 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1081 467 gene locus_tag LOCUS_41160 gene rpsD 1081 467 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence1420 >Feature sequence1421 613 1236 gene locus_tag LOCUS_41170 613 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 >Feature sequence1422 <1400 144 gene locus_tag LOCUS_41180 <1400 144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804244.1:arylsulfatase >Feature sequence1423 >Feature sequence1424 >Feature sequence1425 <1 1206 gene locus_tag LOCUS_41190 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964011.1:glucuronate isomerase >Feature sequence1426 1107 556 gene locus_tag LOCUS_41200 1107 556 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099218.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence1427 >Feature sequence1428 655 873 gene locus_tag LOCUS_41210 655 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 <1395 861 gene locus_tag LOCUS_41220 <1395 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454913.1:sodium/glutamate symporter >Feature sequence1429 187 387 gene locus_tag LOCUS_41230 187 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 384 1253 gene locus_tag LOCUS_41240 384 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 >Feature sequence1430 169 1089 gene locus_tag LOCUS_41250 169 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence1431 1287 529 gene locus_tag LOCUS_41260 1287 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 >Feature sequence1432 <1 765 gene locus_tag LOCUS_41270 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681056.1:DNA translocase FtsK >Feature sequence1433 >Feature sequence1434 >Feature sequence1435 1385 471 gene locus_tag LOCUS_41280 1385 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 >Feature sequence1436 >Feature sequence1437 >Feature sequence1438 <1 1230 gene locus_tag LOCUS_41290 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000455419.1:extracellular solute-binding protein >Feature sequence1439 1102 662 gene locus_tag LOCUS_41300 1102 662 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_41300 >Feature sequence1440 1020 142 gene locus_tag LOCUS_41310 1020 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence1441 370 1131 gene locus_tag LOCUS_41320 370 1131 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780022.1 protein_id gnl|my_center|LOCUS_41320 >Feature sequence1442 >Feature sequence1443 344 1144 gene locus_tag LOCUS_41330 344 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence1444 >Feature sequence1445 <1 506 gene locus_tag LOCUS_41340 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249269.1:MBL fold metallo-hydrolase >Feature sequence1446 449 225 gene locus_tag LOCUS_41350 449 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 954 439 gene locus_tag LOCUS_41360 954 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 1364 951 gene locus_tag LOCUS_41370 1364 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 >Feature sequence1447 1105 902 gene locus_tag LOCUS_41380 1105 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 1227 1298 gene locus_tag LOCUS_t00480 1227 1298 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1448 817 242 gene locus_tag LOCUS_41390 817 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 <1381 814 gene locus_tag LOCUS_41400 <1381 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965550.1:glycoside hydrolase family 31 protein >Feature sequence1449 888 46 gene locus_tag LOCUS_41410 888 46 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_41410 1256 1050 gene locus_tag LOCUS_41420 1256 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 <1 598 gene locus_tag LOCUS_41430 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868849.1:phosphate ABC transporter permease PstA 600 1370 gene locus_tag LOCUS_41440 gene pstB 600 1370 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_41440 >Feature sequence1453 <1 1212 gene locus_tag LOCUS_41450 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880448.1:phosphoribosylamine--glycine ligase >Feature sequence1454 321 965 gene locus_tag LOCUS_41460 321 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence1455 >Feature sequence1456 228 833 gene locus_tag LOCUS_41470 228 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 830 1012 gene locus_tag LOCUS_41480 830 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence1457 61 1350 gene locus_tag LOCUS_41490 gene rlmI 61 1350 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence1458 >Feature sequence1459 >Feature sequence1460 <1374 737 gene locus_tag LOCUS_41500 <1374 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023683.1:arsenite methyltransferase >Feature sequence1461 894 1100 gene locus_tag LOCUS_41510 894 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence1462 241 1293 gene locus_tag LOCUS_41520 241 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence1463 <1 1269 gene locus_tag LOCUS_41530 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator >Feature sequence1464 <1373 871 gene locus_tag LOCUS_41540 <1373 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000211475.1:L-rhamnose isomerase >Feature sequence1465 <1 1103 gene locus_tag LOCUS_41550 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482837.1:pseudouridine synthase >Feature sequence1466 >Feature sequence1467 40 816 gene locus_tag LOCUS_41560 40 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence1468 <1 510 gene locus_tag LOCUS_41570 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860950.1:pyruvate formate-lyase-activating protein >Feature sequence1469 85 1101 gene locus_tag LOCUS_41580 85 1101 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969638.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence1470 1150 158 gene locus_tag LOCUS_41590 1150 158 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814089.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence1471 >Feature sequence1472 <1366 79 gene locus_tag LOCUS_41600 <1366 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963506.1:beta-N-acetylhexosaminidase >Feature sequence1473 222 341 gene locus_tag LOCUS_41610 222 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 555 932 gene locus_tag LOCUS_41620 555 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence1474 611 162 gene locus_tag LOCUS_41630 611 162 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence1475 735 76 gene locus_tag LOCUS_41640 735 76 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_41640 784 1029 gene locus_tag LOCUS_41650 784 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 >Feature sequence1476 >Feature sequence1477 1361 1230 gene locus_tag LOCUS_41660 1361 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 >Feature sequence1478 >Feature sequence1479 1023 130 gene locus_tag LOCUS_41670 1023 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 1261 1064 gene locus_tag LOCUS_41680 1261 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 >Feature sequence1480 <1361 690 gene locus_tag LOCUS_41690 <1361 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391833.1:IS21 family transposase >Feature sequence1481 >Feature sequence1482 516 139 gene locus_tag LOCUS_41700 516 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence1483 634 2 gene locus_tag LOCUS_41710 634 2 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529167.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence1484 656 69 gene locus_tag LOCUS_41720 656 69 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887849.1 protein_id gnl|my_center|LOCUS_41720 <1359 649 gene locus_tag LOCUS_41730 <1359 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678989.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence1485 >Feature sequence1486 >Feature sequence1487 303 731 gene locus_tag LOCUS_41740 303 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence1488 <1 759 gene locus_tag LOCUS_41750 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202924.1:SDR family oxidoreductase >Feature sequence1489 >Feature sequence1490 <1 1327 gene locus_tag LOCUS_41760 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860962.1:EAL domain-containing protein >Feature sequence1491 20 1003 gene locus_tag LOCUS_41770 20 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 >Feature sequence1492 >Feature sequence1493 >Feature sequence1494 928 344 gene locus_tag LOCUS_41780 928 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence1495 634 404 gene locus_tag LOCUS_41790 634 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 >Feature sequence1496 >Feature sequence1497 >Feature sequence1498 24 806 gene locus_tag LOCUS_41800 24 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence1499 >Feature sequence1500 161 24 gene locus_tag LOCUS_41810 161 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 890 261 gene locus_tag LOCUS_41820 890 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 1344 943 gene locus_tag LOCUS_41830 1344 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence1501 339 851 gene locus_tag LOCUS_41840 339 851 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_41840 >Feature sequence1502 203 1324 gene locus_tag LOCUS_41850 gene cobD 203 1324 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_41850 >Feature sequence1503 <1 832 gene locus_tag LOCUS_41860 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391061.1:phage capsid protein >Feature sequence1504 <1 1092 gene locus_tag LOCUS_41870 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861347.1:prephenate dehydratase >Feature sequence1505 762 100 gene locus_tag LOCUS_41880 762 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence1506 >Feature sequence1507 >Feature sequence1508 35 235 gene locus_tag LOCUS_41890 35 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence1509 >Feature sequence1510 828 4 gene locus_tag LOCUS_41900 828 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 1305 844 gene locus_tag LOCUS_41910 1305 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 >Feature sequence1511 >Feature sequence1512 >Feature sequence1513 1130 663 gene locus_tag LOCUS_41920 gene ybaK 1130 663 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723804.1 protein_id gnl|my_center|LOCUS_41920 >Feature sequence1514 1249 56 gene locus_tag LOCUS_41930 gene nagA 1249 56 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_41930 >Feature sequence1515 >Feature sequence1516 1140 730 gene locus_tag LOCUS_41940 1140 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 >Feature sequence1517 >Feature sequence1518 164 1237 gene locus_tag LOCUS_41950 164 1237 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 protein_id gnl|my_center|LOCUS_41950 >Feature sequence1519 <1 828 gene locus_tag LOCUS_41960 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229507.1:sugar ABC transporter permease >Feature sequence1520 >Feature sequence1521 65 886 gene locus_tag LOCUS_41970 65 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 895 1311 gene locus_tag LOCUS_41980 895 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence1522 >Feature sequence1523 >Feature sequence1524 643 1152 gene locus_tag LOCUS_41990 643 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 1171 1314 gene locus_tag LOCUS_42000 1171 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence1525 >Feature sequence1526 576 307 gene locus_tag LOCUS_42010 576 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence1527 >Feature sequence1528 <1 761 gene locus_tag LOCUS_42020 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682350.1:polyribonucleotide nucleotidyltransferase 764 1201 gene locus_tag LOCUS_42030 gene dut 764 1201 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence1529 264 1322 gene locus_tag LOCUS_42040 264 1322 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_42040 >Feature sequence1530 <1327 436 gene locus_tag LOCUS_42050 <1327 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940946.1:B12-binding domain-containing radical SAM protein >Feature sequence1531 1025 192 gene locus_tag LOCUS_42060 1025 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence1532 >Feature sequence1533 >Feature sequence1534 >Feature sequence1535 >Feature sequence1536 907 743 gene locus_tag LOCUS_42070 907 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence1537 106 900 gene locus_tag LOCUS_42080 106 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42080 >Feature sequence1538 >Feature sequence1539 152 1039 gene locus_tag LOCUS_42090 152 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence1540 1313 201 gene locus_tag LOCUS_42100 1313 201 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence1541 878 225 gene locus_tag LOCUS_42110 878 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 >Feature sequence1542 310 1125 gene locus_tag LOCUS_42120 310 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence1543 285 551 gene locus_tag LOCUS_42130 285 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence1544 >Feature sequence1545 <1317 273 gene locus_tag LOCUS_42140 <1317 273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048109.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence1546 >Feature sequence1547 >Feature sequence1548 2 778 gene locus_tag LOCUS_42150 2 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 1121 801 gene locus_tag LOCUS_42160 1121 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 >Feature sequence1549 <1316 257 gene locus_tag LOCUS_42170 <1316 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105368.1:mannitol dehydrogenase family protein >Feature sequence1550 <1 703 gene locus_tag LOCUS_42180 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861989.1:putative 2-aminoethylphosphonate ABC transporter substrate-binding protein >Feature sequence1551 407 901 gene locus_tag LOCUS_42190 407 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 >Feature sequence1552 >Feature sequence1553 391 1224 gene locus_tag LOCUS_42200 391 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 1295 1224 gene locus_tag LOCUS_t00490 1295 1224 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1554 >Feature sequence1555 <1313 404 gene locus_tag LOCUS_42210 <1313 404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399577.1:DNA modification methylase >Feature sequence1556 >Feature sequence1557 1265 642 gene locus_tag LOCUS_42220 1265 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence1558 1010 168 gene locus_tag LOCUS_42230 1010 168 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence1559 <1 714 gene locus_tag LOCUS_42240 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763481.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F >Feature sequence1560 1134 268 gene locus_tag LOCUS_42250 1134 268 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_42250 >Feature sequence1561 654 40 gene locus_tag LOCUS_42260 654 40 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_42260 <1308 658 gene locus_tag LOCUS_42270 <1308 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942056.1:Mrp/NBP35 family ATP-binding protein >Feature sequence1562 41 940 gene locus_tag LOCUS_42280 gene rfbD 41 940 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_42280 >Feature sequence1563 >Feature sequence1564 755 555 gene locus_tag LOCUS_42290 755 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 >Feature sequence1565 >Feature sequence1566 358 230 gene locus_tag LOCUS_42300 358 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 948 826 gene locus_tag LOCUS_42310 948 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 1124 1279 gene locus_tag LOCUS_42320 1124 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 >Feature sequence1567 <1 1224 gene locus_tag LOCUS_42330 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002294025.1:SulP family inorganic anion transporter >Feature sequence1568 289 1179 gene locus_tag LOCUS_42340 289 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 >Feature sequence1569 >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 279 449 gene locus_tag LOCUS_42350 279 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 <1297 509 gene locus_tag LOCUS_42360 <1297 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000782251.1:lactonase family protein >Feature sequence1573 <1 707 gene locus_tag LOCUS_42370 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459567.1:cytochrome c biogenesis protein CcdA >Feature sequence1574 1274 666 gene locus_tag LOCUS_42380 1274 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 >Feature sequence1575 <1296 508 gene locus_tag LOCUS_42390 <1296 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898649.1:ABC transporter substrate-binding protein >Feature sequence1576 212 847 gene locus_tag LOCUS_42400 212 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence1577 20 634 gene locus_tag LOCUS_42410 20 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence1578 <1 597 gene locus_tag LOCUS_42420 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048116.1:Gfo/Idh/MocA family oxidoreductase 597 1199 gene locus_tag LOCUS_42430 597 1199 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_42430 >Feature sequence1579 41 409 gene locus_tag LOCUS_42440 41 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 492 1103 gene locus_tag LOCUS_42450 492 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 >Feature sequence1580 374 63 gene locus_tag LOCUS_42460 374 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1026 511 gene locus_tag LOCUS_42470 1026 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence1581 41 940 gene locus_tag LOCUS_42480 gene rfbD 41 940 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_42480 >Feature sequence1582 <1 944 gene locus_tag LOCUS_42490 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000869006.1:3-dehydro-L-gulonate 2-dehydrogenase >Feature sequence1583 >Feature sequence1584 >Feature sequence1585 <1 1180 gene locus_tag LOCUS_42500 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680710.1:isoleucine--tRNA ligase >Feature sequence1586 3 653 gene locus_tag LOCUS_42510 3 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 707 922 gene locus_tag LOCUS_42520 707 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 949 1209 gene locus_tag LOCUS_42530 949 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 >Feature sequence1587 1241 336 gene locus_tag LOCUS_42540 1241 336 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_42540 >Feature sequence1588 264 851 gene locus_tag LOCUS_42550 264 851 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence1589 25 441 gene locus_tag LOCUS_42560 25 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 >Feature sequence1590 44 1159 gene locus_tag LOCUS_42570 44 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence1591 257 1039 gene locus_tag LOCUS_42580 gene cobJ 257 1039 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence1592 >Feature sequence1593 26 1222 gene locus_tag LOCUS_42590 26 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 >Feature sequence1594 <1284 305 gene locus_tag LOCUS_42600 <1284 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461512.1:ATP-binding protein >Feature sequence1595 <1284 402 gene locus_tag LOCUS_42610 <1284 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897930.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence1596 >Feature sequence1597 615 445 gene locus_tag LOCUS_42620 615 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 1281 652 gene locus_tag LOCUS_42630 1281 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 >Feature sequence1598 >Feature sequence1599 >Feature sequence1600 >Feature sequence1601 1 630 gene locus_tag LOCUS_42640 1 630 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_42640 <1282 635 gene locus_tag LOCUS_42650 <1282 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994395.1:LacI family DNA-binding transcriptional regulator >Feature sequence1602 761 204 gene locus_tag LOCUS_42660 761 204 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_42660 <1282 758 gene locus_tag LOCUS_42670 <1282 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869096.1:RnfABCDGE type electron transport complex subunit D >Feature sequence1603 >Feature sequence1604 555 695 gene locus_tag LOCUS_42680 555 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 >Feature sequence1605 >Feature sequence1606 >Feature sequence1607 <1 531 gene locus_tag LOCUS_42690 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001231960.1:ERF family protein 531 899 gene locus_tag LOCUS_42700 531 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence1608 <1276 762 gene locus_tag LOCUS_42710 <1276 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000725771.1:BMP family ABC transporter substrate-binding protein >Feature sequence1609 233 60 gene locus_tag LOCUS_42720 233 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 1087 230 gene locus_tag LOCUS_42730 1087 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence1610 >Feature sequence1611 227 1207 gene locus_tag LOCUS_42740 227 1207 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence1612 1160 567 gene locus_tag LOCUS_42750 gene hisH 1160 567 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_42750 >Feature sequence1613 <1270 143 gene locus_tag LOCUS_42760 <1270 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence1614 <1270 697 gene locus_tag LOCUS_42770 <1270 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022619212.1:Crp/Fnr family transcriptional regulator >Feature sequence1615 >Feature sequence1616 >Feature sequence1617 132 470 gene locus_tag LOCUS_42780 132 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42780 431 847 gene locus_tag LOCUS_42790 431 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42790 >Feature sequence1618 >Feature sequence1619 <1267 32 gene locus_tag LOCUS_42800 <1267 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902115.1:phage/plasmid primase, P4 family >Feature sequence1620 688 900 gene locus_tag LOCUS_42810 688 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 911 1180 gene locus_tag LOCUS_42820 911 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 1264 1189 gene locus_tag LOCUS_t00500 1264 1189 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1621 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 <1261 183 gene locus_tag LOCUS_42830 <1261 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775660.1:extracellular solute-binding protein >Feature sequence1625 >Feature sequence1626 >Feature sequence1627 <1 1143 gene locus_tag LOCUS_42840 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399687.1:DNA polymerase >Feature sequence1628 171 959 gene locus_tag LOCUS_42850 171 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence1629 <1 522 gene locus_tag LOCUS_42860 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064940.1:RnfABCDGE type electron transport complex subunit E 524 1117 gene locus_tag LOCUS_42870 gene rsxA 524 1117 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_42870 >Feature sequence1630 >Feature sequence1631 174 1052 gene locus_tag LOCUS_42880 174 1052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_42880 >Feature sequence1632 >Feature sequence1633 462 67 gene locus_tag LOCUS_42890 462 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 868 452 gene locus_tag LOCUS_42900 868 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 >Feature sequence1634 >Feature sequence1635 3 458 gene locus_tag LOCUS_42910 gene mraZ 3 458 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence1636 36 398 gene locus_tag LOCUS_42920 36 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 395 748 gene locus_tag LOCUS_42930 395 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence1637 190 35 gene locus_tag LOCUS_42940 190 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 488 892 gene locus_tag LOCUS_42950 488 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 >Feature sequence1638 987 1208 gene locus_tag LOCUS_42960 987 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence1639 >Feature sequence1640 >Feature sequence1641 370 1251 gene locus_tag LOCUS_42970 370 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence1642 <1252 61 gene locus_tag LOCUS_42980 <1252 61 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461629.1:anaerobic nitric oxide reductase flavorubredoxin >Feature sequence1643 <1 1008 gene locus_tag LOCUS_42990 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023993.1:glutamate 5-kinase >Feature sequence1644 >Feature sequence1645 1252 125 gene locus_tag LOCUS_43000 1252 125 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence1646 1226 30 gene locus_tag LOCUS_43010 1226 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 >Feature sequence1647 >Feature sequence1648 264 860 gene locus_tag LOCUS_43020 264 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 >Feature sequence1649 >Feature sequence1650 905 714 gene locus_tag LOCUS_43030 905 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 >Feature sequence1651 2 463 gene locus_tag LOCUS_43040 gene hslV 2 463 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence1652 <1 823 gene locus_tag LOCUS_43050 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393604.1:cobalamin-dependent protein >Feature sequence1653 >Feature sequence1654 839 96 gene locus_tag LOCUS_43060 839 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 >Feature sequence1655 <1 1066 gene locus_tag LOCUS_43070 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079973.1:bifunctional L-alanine/L-glutamate racemase >Feature sequence1656 43 1032 gene locus_tag LOCUS_43080 43 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 >Feature sequence1657 >Feature sequence1658 689 144 gene locus_tag LOCUS_43090 689 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1051 743 gene locus_tag LOCUS_43100 1051 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence1659 >Feature sequence1660 91 519 gene locus_tag LOCUS_43110 91 519 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_43110 534 863 gene locus_tag LOCUS_43120 534 863 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_43120 866 1021 gene locus_tag LOCUS_43130 866 1021 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_43130 >Feature sequence1661 >Feature sequence1662 >Feature sequence1663 >Feature sequence1664 425 694 gene locus_tag LOCUS_43140 425 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence1665 889 134 gene locus_tag LOCUS_43150 889 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 1226 882 gene locus_tag LOCUS_43160 1226 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 >Feature sequence1666 1115 543 gene locus_tag LOCUS_43170 1115 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 1236 1108 gene locus_tag LOCUS_43180 1236 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 >Feature sequence1667 >Feature sequence1668 >Feature sequence1669 326 787 gene locus_tag LOCUS_43190 326 787 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 protein_id gnl|my_center|LOCUS_43190 927 1094 gene locus_tag LOCUS_43200 927 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence1670 13 798 gene locus_tag LOCUS_43210 13 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 >Feature sequence1671 50 286 gene locus_tag LOCUS_43220 50 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 283 516 gene locus_tag LOCUS_43230 283 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 513 662 gene locus_tag LOCUS_43240 513 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 662 811 gene locus_tag LOCUS_43250 662 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 789 1082 gene locus_tag LOCUS_43260 789 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence1672 >Feature sequence1673 306 695 gene locus_tag LOCUS_43270 306 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 692 1126 gene locus_tag LOCUS_43280 692 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 >Feature sequence1674 1229 291 gene locus_tag LOCUS_43290 1229 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 >Feature sequence1675 348 229 gene locus_tag LOCUS_43300 348 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 982 692 gene locus_tag LOCUS_43310 982 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence1676 1207 164 gene locus_tag LOCUS_43320 1207 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence1677 <1 808 gene locus_tag LOCUS_43330 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393226.1:IS1634 family transposase 991 830 gene locus_tag LOCUS_43340 991 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence1678 >Feature sequence1679 <1 1066 gene locus_tag LOCUS_43350 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532883.1:ABC transporter ATP-binding protein >Feature sequence1680 >Feature sequence1681 >Feature sequence1682 >Feature sequence1683 <1 1152 gene locus_tag LOCUS_43360 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813871.1:tripartite tricarboxylate transporter permease >Feature sequence1684 <1228 472 gene locus_tag LOCUS_43370 <1228 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957104.1:phenylalanine--tRNA ligase subunit beta note possible pseudo, internal stop codon >Feature sequence1685 950 375 gene locus_tag LOCUS_43380 950 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence1686 1132 179 gene locus_tag LOCUS_43390 1132 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43390 >Feature sequence1687 >Feature sequence1688 618 238 gene locus_tag LOCUS_43400 618 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 >Feature sequence1689 >Feature sequence1690 1192 302 gene locus_tag LOCUS_43410 1192 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence1691 245 733 gene locus_tag LOCUS_43420 245 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 730 867 gene locus_tag LOCUS_43430 730 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence1692 343 176 gene locus_tag LOCUS_43440 343 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 >Feature sequence1693 <1222 208 gene locus_tag LOCUS_43450 <1222 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876398.1:sodium:proton antiporter >Feature sequence1694 <1222 529 gene locus_tag LOCUS_43460 <1222 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938382.1:response regulator transcription factor >Feature sequence1695 <1222 647 gene locus_tag LOCUS_43470 <1222 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940628.1:dihydroxy-acid dehydratase >Feature sequence1696 793 395 gene locus_tag LOCUS_43480 gene aroH 793 395 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679161.1 protein_id gnl|my_center|LOCUS_43480 >Feature sequence1697 >Feature sequence1698 412 1023 gene locus_tag LOCUS_43490 412 1023 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485245.1 protein_id gnl|my_center|LOCUS_43490 >Feature sequence1699 <1219 436 gene locus_tag LOCUS_43500 <1219 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107231.1:polysaccharide biosynthesis protein >Feature sequence1700 >Feature sequence1701 279 449 gene locus_tag LOCUS_43510 279 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 1071 610 gene locus_tag LOCUS_43520 1071 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence1702 32 631 gene locus_tag LOCUS_43530 32 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence1703 290 436 gene locus_tag LOCUS_43540 290 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence1704 905 18 gene locus_tag LOCUS_43550 905 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 805 1086 gene locus_tag LOCUS_43560 805 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence1705 1031 909 gene locus_tag LOCUS_43570 1031 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence1706 1186 236 gene locus_tag LOCUS_43580 1186 236 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_43580 >Feature sequence1707 797 273 gene locus_tag LOCUS_43590 797 273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_43590 >Feature sequence1708 >Feature sequence1709 >Feature sequence1710 44 967 gene locus_tag LOCUS_43600 44 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence1711 251 1114 gene locus_tag LOCUS_43610 251 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 >Feature sequence1712 >Feature sequence1713 >Feature sequence1714 >Feature sequence1715 581 1147 gene locus_tag LOCUS_43620 581 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence1716 227 571 gene locus_tag LOCUS_43630 gene tnpB 227 571 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921815.1 protein_id gnl|my_center|LOCUS_43630 >Feature sequence1717 <1 771 gene locus_tag LOCUS_43640 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000682329.1:arginine deiminase >Feature sequence1718 >Feature sequence1719 <1211 253 gene locus_tag LOCUS_43650 <1211 253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627591.1:DUF3798 domain-containing protein >Feature sequence1720 >Feature sequence1721 141 494 gene locus_tag LOCUS_43660 141 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence1722 >Feature sequence1723 739 617 gene locus_tag LOCUS_43670 739 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 1077 784 gene locus_tag LOCUS_43680 1077 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence1724 258 82 gene locus_tag LOCUS_43690 258 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 741 1082 gene locus_tag LOCUS_43700 741 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence1725 271 86 gene locus_tag LOCUS_43710 271 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 1022 264 gene locus_tag LOCUS_43720 1022 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272402.1 protein_id gnl|my_center|LOCUS_43720 >Feature sequence1726 183 731 gene locus_tag LOCUS_43730 183 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 >Feature sequence1727 <1206 494 gene locus_tag LOCUS_43740 <1206 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405018.1:phosphate ABC transporter permease subunit PstC >Feature sequence1728 >Feature sequence1729 >Feature sequence1730 96 1046 gene locus_tag LOCUS_43750 96 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 >Feature sequence1731 >Feature sequence1732 >Feature sequence1733 <1 1160 gene locus_tag LOCUS_43760 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679249.1:NFACT family protein >Feature sequence1734 818 312 gene locus_tag LOCUS_43770 818 312 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461262.1 protein_id gnl|my_center|LOCUS_43770 1047 886 gene locus_tag LOCUS_43780 1047 886 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence1735 <1199 128 gene locus_tag LOCUS_43790 <1199 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225009.1:extracellular solute-binding protein >Feature sequence1736 >Feature sequence1737 >Feature sequence1738 >Feature sequence1739 <1197 482 gene locus_tag LOCUS_43800 <1197 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000831067.1:sensor histidine kinase >Feature sequence1740 503 628 gene locus_tag LOCUS_43810 503 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence1741 540 953 gene locus_tag LOCUS_43820 540 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 >Feature sequence1742 1030 383 gene locus_tag LOCUS_43830 gene cobU 1030 383 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_43830 >Feature sequence1743 >Feature sequence1744 >Feature sequence1745 >Feature sequence1746 >Feature sequence1747 >Feature sequence1748 <1193 468 gene locus_tag LOCUS_43840 <1193 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366535.1:aspartate aminotransferase family protein >Feature sequence1749 >Feature sequence1750 <1 1036 gene locus_tag LOCUS_43850 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858465.1:RND family transporter >Feature sequence1751 >Feature sequence1752 >Feature sequence1753 496 275 gene locus_tag LOCUS_43860 496 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 1185 493 gene locus_tag LOCUS_43870 1185 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence1754 37 1026 gene locus_tag LOCUS_43880 gene galE 37 1026 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_43880 >Feature sequence1755 626 117 gene locus_tag LOCUS_43890 626 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 <1188 665 gene locus_tag LOCUS_43900 <1188 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882963.1:30S ribosomal protein S1 >Feature sequence1756 152 1060 gene locus_tag LOCUS_43910 152 1060 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_43910 >Feature sequence1757 512 1174 gene locus_tag LOCUS_43920 512 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 >Feature sequence1758 405 941 gene locus_tag LOCUS_43930 405 941 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_43930 >Feature sequence1759 <1 599 gene locus_tag LOCUS_43940 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133415011.1:sugar ABC transporter substrate-binding protein >Feature sequence1760 >Feature sequence1761 <1186 152 gene locus_tag LOCUS_43950 <1186 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938013.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence1762 >Feature sequence1763 <1185 578 gene locus_tag LOCUS_43960 <1185 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969467.1:N-acetylneuraminate lyase >Feature sequence1764 >Feature sequence1765 240 52 gene locus_tag LOCUS_43970 240 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 836 237 gene locus_tag LOCUS_43980 836 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence1766 >Feature sequence1767 1 414 gene locus_tag LOCUS_43990 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence1768 914 675 gene locus_tag LOCUS_44000 914 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence1769 257 613 gene locus_tag LOCUS_44010 257 613 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence1770 1046 165 gene locus_tag LOCUS_44020 1046 165 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_44020 >Feature sequence1771 1063 536 gene locus_tag LOCUS_44030 1063 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence1772 612 202 gene locus_tag LOCUS_44040 612 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 830 609 gene locus_tag LOCUS_44050 830 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 >Feature sequence1773 381 64 gene locus_tag LOCUS_44060 381 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 767 378 gene locus_tag LOCUS_44070 767 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence1774 >Feature sequence1775 >Feature sequence1776 >Feature sequence1777 >Feature sequence1778 300 812 gene locus_tag LOCUS_44080 300 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 >Feature sequence1779 77 292 gene locus_tag LOCUS_44090 77 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 276 1160 gene locus_tag LOCUS_44100 276 1160 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_44100 >Feature sequence1780 >Feature sequence1781 15 989 gene locus_tag LOCUS_44110 15 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence1782 >Feature sequence1783 868 188 gene locus_tag LOCUS_44120 868 188 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence1784 <1175 589 gene locus_tag LOCUS_44130 <1175 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975242.1:iron ABC transporter permease >Feature sequence1785 <1174 560 gene locus_tag LOCUS_44140 <1174 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080841.1:solute carrier family 23 protein >Feature sequence1786 <1 897 gene locus_tag LOCUS_44150 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228527.1:secretion stress-responsive two-component system sensor histidine kinase CssS >Feature sequence1787 >Feature sequence1788 199 1023 gene locus_tag LOCUS_44160 199 1023 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_44160 >Feature sequence1789 >Feature sequence1790 >Feature sequence1791 722 225 gene locus_tag LOCUS_44170 gene leuD 722 225 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_44170 >Feature sequence1792 <1169 18 gene locus_tag LOCUS_44180 <1169 18 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775606.1:IS1595-like element ISSsu9 family transposase >Feature sequence1793 >Feature sequence1794 >Feature sequence1795 >Feature sequence1796 336 578 gene locus_tag LOCUS_44190 336 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 575 1141 gene locus_tag LOCUS_44200 575 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 >Feature sequence1797 216 37 gene locus_tag LOCUS_44210 216 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence1798 >Feature sequence1799 >Feature sequence1800 59 1096 gene locus_tag LOCUS_44220 59 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 >Feature sequence1801 148 1089 gene locus_tag LOCUS_44230 148 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 >Feature sequence1802 >Feature sequence1803 241 645 gene locus_tag LOCUS_44240 241 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 >Feature sequence1804 909 94 gene locus_tag LOCUS_44250 909 94 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence1805 535 365 gene locus_tag LOCUS_44260 535 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 947 525 gene locus_tag LOCUS_44270 947 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence1806 <1 782 gene locus_tag LOCUS_44280 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107264.1:EFR1 family ferrodoxin >Feature sequence1807 >Feature sequence1808 696 502 gene locus_tag LOCUS_44290 696 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 >Feature sequence1809 >Feature sequence1810 <1 654 gene locus_tag LOCUS_44300 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392701.1:MBL fold metallo-hydrolase <1160 651 gene locus_tag LOCUS_44310 <1160 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971767.1:N-acetyltransferase >Feature sequence1811 >Feature sequence1812 >Feature sequence1813 >Feature sequence1814 259 591 gene locus_tag LOCUS_44320 259 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 606 779 gene locus_tag LOCUS_44330 606 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 >Feature sequence1815 194 403 gene locus_tag LOCUS_44340 194 403 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_44340 400 642 gene locus_tag LOCUS_44350 400 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 >Feature sequence1816 343 993 gene locus_tag LOCUS_44360 343 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 >Feature sequence1817 >Feature sequence1818 531 196 gene locus_tag LOCUS_44370 531 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 >Feature sequence1819 24 99 gene locus_tag LOCUS_t00510 24 99 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 405 530 gene locus_tag LOCUS_44380 405 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence1820 940 620 gene locus_tag LOCUS_44390 940 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 >Feature sequence1821 <1 1154 gene locus_tag LOCUS_44400 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246965.1:sugar ABC transporter substrate-binding protein >Feature sequence1822 >Feature sequence1823 146 658 gene locus_tag LOCUS_44410 146 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 <1156 655 gene locus_tag LOCUS_44420 <1156 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333876.1:sugar phosphate isomerase/epimerase >Feature sequence1824 1154 168 gene locus_tag LOCUS_44430 1154 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence1825 427 257 gene locus_tag LOCUS_44440 427 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 616 440 gene locus_tag LOCUS_44450 616 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 >Feature sequence1826 >Feature sequence1827 >Feature sequence1828 >Feature sequence1829 >Feature sequence1830 263 1147 gene locus_tag LOCUS_44460 263 1147 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_44460 >Feature sequence1831 >Feature sequence1832 60 293 gene locus_tag LOCUS_44470 60 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 293 616 gene locus_tag LOCUS_44480 293 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 613 978 gene locus_tag LOCUS_44490 613 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 >Feature sequence1833 789 43 gene locus_tag LOCUS_44500 789 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 >Feature sequence1834 168 323 gene locus_tag LOCUS_44510 168 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 324 476 gene locus_tag LOCUS_44520 324 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 553 846 gene locus_tag LOCUS_44530 553 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 843 1061 gene locus_tag LOCUS_44540 843 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 >Feature sequence1835 <1151 380 gene locus_tag LOCUS_44550 <1151 380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379352.1:ABC transporter substrate-binding protein >Feature sequence1836 1148 186 gene locus_tag LOCUS_44560 1148 186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053222.1 protein_id gnl|my_center|LOCUS_44560 >Feature sequence1837 >Feature sequence1838 373 449 gene locus_tag LOCUS_t00520 373 449 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 512 587 gene locus_tag LOCUS_t00530 512 587 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1839 361 924 gene locus_tag LOCUS_44570 361 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 >Feature sequence1840 >Feature sequence1841 <1147 319 gene locus_tag LOCUS_44580 <1147 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869847.1:ketoacyl-ACP synthase III >Feature sequence1842 >Feature sequence1843 <1 765 gene locus_tag LOCUS_44590 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022404.1:F0F1 ATP synthase subunit gamma >Feature sequence1844 >Feature sequence1845 46 118 gene locus_tag LOCUS_t00540 46 118 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1023 154 gene locus_tag LOCUS_44600 1023 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 >Feature sequence1846 501 1139 gene locus_tag LOCUS_44610 gene thyX 501 1139 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890400.1 protein_id gnl|my_center|LOCUS_44610 >Feature sequence1847 >Feature sequence1848 >Feature sequence1849 >Feature sequence1850 <1144 24 gene locus_tag LOCUS_44620 <1144 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165442178.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence1851 <1143 534 gene locus_tag LOCUS_44630 <1143 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256547.1:glycosyltransferase >Feature sequence1852 760 62 gene locus_tag LOCUS_44640 760 62 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256823.1 protein_id gnl|my_center|LOCUS_44640 >Feature sequence1853 >Feature sequence1854 >Feature sequence1855 938 171 gene locus_tag LOCUS_44650 938 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence1856 990 304 gene locus_tag LOCUS_44660 990 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 >Feature sequence1857 >Feature sequence1858 <1142 136 gene locus_tag LOCUS_44670 <1142 136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627060.1:ISL3 family transposase >Feature sequence1859 <1 738 gene locus_tag LOCUS_44680 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437556.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence1860 <1 788 gene locus_tag LOCUS_44690 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583016.1:5-deoxy-glucuronate isomerase >Feature sequence1861 990 439 gene locus_tag LOCUS_44700 990 439 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_44700 >Feature sequence1862 >Feature sequence1863 24 1097 gene locus_tag LOCUS_44710 24 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence1864 99 422 gene locus_tag LOCUS_44720 99 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence1865 >Feature sequence1866 869 87 gene locus_tag LOCUS_44730 869 87 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_44730 >Feature sequence1867 874 299 gene locus_tag LOCUS_44740 874 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 >Feature sequence1868 709 110 gene locus_tag LOCUS_44750 709 110 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121273.1 protein_id gnl|my_center|LOCUS_44750 >Feature sequence1869 <1137 89 gene locus_tag LOCUS_44760 <1137 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087861794.1:DNA polymerase IV >Feature sequence1870 >Feature sequence1871 1137 691 gene locus_tag LOCUS_44770 1137 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 >Feature sequence1872 866 123 gene locus_tag LOCUS_44780 866 123 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence1873 1069 68 gene locus_tag LOCUS_44790 gene yiaK 1069 68 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869020.1 protein_id gnl|my_center|LOCUS_44790 >Feature sequence1874 >Feature sequence1875 >Feature sequence1876 >Feature sequence1877 365 910 gene locus_tag LOCUS_44800 365 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 >Feature sequence1878 >Feature sequence1879 924 172 gene locus_tag LOCUS_44810 924 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 >Feature sequence1880 >Feature sequence1881 <1130 539 gene locus_tag LOCUS_44820 <1130 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358553.1:FadR/GntR family transcriptional regulator >Feature sequence1882 156 968 gene locus_tag LOCUS_44830 156 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 >Feature sequence1883 79 609 gene locus_tag LOCUS_44840 gene loaP 79 609 CDS product antiterminator LoaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681936.1 protein_id gnl|my_center|LOCUS_44840 >Feature sequence1884 >Feature sequence1885 >Feature sequence1886 <1 518 gene locus_tag LOCUS_44850 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399690.1:DUF2815 family protein >Feature sequence1887 1074 91 gene locus_tag LOCUS_44860 gene araH 1074 91 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705780.1 protein_id gnl|my_center|LOCUS_44860 >Feature sequence1888 674 24 gene locus_tag LOCUS_44870 674 24 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_44870 1002 685 gene locus_tag LOCUS_44880 1002 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 >Feature sequence1889 >Feature sequence1890 <1 670 gene locus_tag LOCUS_44890 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104542.1:VapE family protein 836 1117 gene locus_tag LOCUS_44900 836 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 >Feature sequence1891 492 923 gene locus_tag LOCUS_44910 492 923 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_44910 >Feature sequence1892 1042 317 gene locus_tag LOCUS_44920 1042 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence1893 236 1084 gene locus_tag LOCUS_44930 236 1084 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence1894 419 138 gene locus_tag LOCUS_44940 419 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 >Feature sequence1895 1082 129 gene locus_tag LOCUS_44950 1082 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence1896 654 1043 gene locus_tag LOCUS_44960 654 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 >Feature sequence1897 249 884 gene locus_tag LOCUS_44970 249 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence1898 932 291 gene locus_tag LOCUS_44980 932 291 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870241.1 protein_id gnl|my_center|LOCUS_44980 >Feature sequence1899 >Feature sequence1900 >Feature sequence1901 962 381 gene locus_tag LOCUS_44990 962 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 >Feature sequence1902 871 1011 gene locus_tag LOCUS_45000 871 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence1903 363 1055 gene locus_tag LOCUS_45010 363 1055 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_45010 >Feature sequence1904 >Feature sequence1905 >Feature sequence1906 >Feature sequence1907 >Feature sequence1908 >Feature sequence1909 >Feature sequence1910 >Feature sequence1911 <1 695 gene locus_tag LOCUS_45020 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124047.1:metallophosphoesterase >Feature sequence1912 <1118 410 gene locus_tag LOCUS_45030 <1118 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000794551.1:chromate transporter >Feature sequence1913 >Feature sequence1914 >Feature sequence1915 >Feature sequence1916 >Feature sequence1917 <1 868 gene locus_tag LOCUS_45040 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679730.1:ATP-dependent DNA helicase >Feature sequence1918 269 796 gene locus_tag LOCUS_45050 269 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence1919 >Feature sequence1920 >Feature sequence1921 645 7 gene locus_tag LOCUS_45060 645 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence1922 41 832 gene locus_tag LOCUS_45070 41 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence1923 >Feature sequence1924 >Feature sequence1925 >Feature sequence1926 <1 991 gene locus_tag LOCUS_45080 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948977.1:sensor histidine kinase >Feature sequence1927 <1111 442 gene locus_tag LOCUS_45090 <1111 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870600.1:ATP-binding cassette domain-containing protein >Feature sequence1928 1055 210 gene locus_tag LOCUS_45100 1055 210 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_45100 >Feature sequence1929 <1110 128 gene locus_tag LOCUS_45110 <1110 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225009.1:extracellular solute-binding protein >Feature sequence1930 466 278 gene locus_tag LOCUS_45120 466 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 714 463 gene locus_tag LOCUS_45130 714 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence1931 152 406 gene locus_tag LOCUS_45140 152 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 403 744 gene locus_tag LOCUS_45150 403 744 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence1932 >Feature sequence1933 >Feature sequence1934 <1 556 gene locus_tag LOCUS_45160 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940378.1:long-chain fatty acid--CoA ligase >Feature sequence1935 329 997 gene locus_tag LOCUS_45170 329 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence1936 >Feature sequence1937 >Feature sequence1938 >Feature sequence1939 <1104 35 gene locus_tag LOCUS_45180 <1104 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949077.1:diguanylate cyclase >Feature sequence1940 >Feature sequence1941 >Feature sequence1942 >Feature sequence1943 <1103 547 gene locus_tag LOCUS_45190 <1103 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669362.1:V-type ATP synthase subunit A >Feature sequence1944 >Feature sequence1945 >Feature sequence1946 >Feature sequence1947 >Feature sequence1948 <1 1062 gene locus_tag LOCUS_45200 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113850176.1:DEAD/DEAH box helicase >Feature sequence1949 <1099 323 gene locus_tag LOCUS_45210 <1099 323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949077.1:diguanylate cyclase >Feature sequence1950 705 436 gene locus_tag LOCUS_45220 705 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 >Feature sequence1951 >Feature sequence1952 >Feature sequence1953 >Feature sequence1954 >Feature sequence1955 >Feature sequence1956 23 334 gene locus_tag LOCUS_45230 23 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 327 617 gene locus_tag LOCUS_45240 327 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 643 840 gene locus_tag LOCUS_45250 643 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 >Feature sequence1957 342 124 gene locus_tag LOCUS_45260 342 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 1095 355 gene locus_tag LOCUS_45270 1095 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence1958 >Feature sequence1959 <1096 43 gene locus_tag LOCUS_45280 <1096 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243735.1:guanosine ABC transporter permease NupP >Feature sequence1960 >Feature sequence1961 >Feature sequence1962 946 59 gene locus_tag LOCUS_45290 946 59 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence1963 >Feature sequence1964 142 828 gene locus_tag LOCUS_45300 gene ric 142 828 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 protein_id gnl|my_center|LOCUS_45300 >Feature sequence1965 390 881 gene locus_tag LOCUS_45310 390 881 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_45310 >Feature sequence1966 198 503 gene locus_tag LOCUS_45320 198 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 505 1029 gene locus_tag LOCUS_45330 505 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence1967 >Feature sequence1968 >Feature sequence1969 815 315 gene locus_tag LOCUS_45340 815 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 >Feature sequence1970 238 780 gene locus_tag LOCUS_45350 238 780 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence1971 369 1016 gene locus_tag LOCUS_45360 369 1016 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence1972 655 32 gene locus_tag LOCUS_45370 655 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 >Feature sequence1973 >Feature sequence1974 984 529 gene locus_tag LOCUS_45380 984 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence1975 >Feature sequence1976 >Feature sequence1977 <1 709 gene locus_tag LOCUS_45390 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010255334.1:phosphoglycerate kinase >Feature sequence1978 >Feature sequence1979 362 862 gene locus_tag LOCUS_45400 362 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence1980 948 406 gene locus_tag LOCUS_45410 948 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45410 >Feature sequence1981 404 246 gene locus_tag LOCUS_45420 404 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 >Feature sequence1982 346 1005 gene locus_tag LOCUS_45430 346 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 >Feature sequence1983 19 261 gene locus_tag LOCUS_45440 19 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 <1087 262 gene locus_tag LOCUS_45450 <1087 262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545411.1:B12-binding domain-containing radical SAM protein >Feature sequence1984 >Feature sequence1985 <1 720 gene locus_tag LOCUS_45460 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393457.1:xanthine dehydrogenase FAD-binding subunit XdhB >Feature sequence1986 772 332 gene locus_tag LOCUS_45470 772 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 >Feature sequence1987 574 1008 gene locus_tag LOCUS_45480 574 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 >Feature sequence1988 <1 1023 gene locus_tag LOCUS_45490 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459365.1:IS256-like element ISDha1 family transposase >Feature sequence1989 >Feature sequence1990 4 381 gene locus_tag LOCUS_45500 4 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 >Feature sequence1991 >Feature sequence1992 405 40 gene locus_tag LOCUS_45510 405 40 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145905.1 protein_id gnl|my_center|LOCUS_45510 634 458 gene locus_tag LOCUS_45520 634 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 >Feature sequence1993 <1083 210 gene locus_tag LOCUS_45530 <1083 210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048163.1:2-hydroxyacyl-CoA dehydratase >Feature sequence1994 <1 936 gene locus_tag LOCUS_45540 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000257523.1:phage major capsid protein >Feature sequence1995 <1 649 gene locus_tag LOCUS_45550 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803743.1:sugar ABC transporter permease >Feature sequence1996 <1082 348 gene locus_tag LOCUS_45560 <1082 348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681112.1:tetratricopeptide repeat protein >Feature sequence1997 91 213 gene locus_tag LOCUS_45570 91 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 259 546 gene locus_tag LOCUS_45580 259 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 547 672 gene locus_tag LOCUS_45590 547 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 674 886 gene locus_tag LOCUS_45600 674 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 >Feature sequence1998 >Feature sequence1999 >Feature sequence2000 23 475 gene locus_tag LOCUS_45610 23 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 465 968 gene locus_tag LOCUS_45620 465 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 >Feature sequence2001 20 334 gene locus_tag LOCUS_45630 20 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 321 1067 gene locus_tag LOCUS_45640 321 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 >Feature sequence2002 >Feature sequence2003 975 376 gene locus_tag LOCUS_45650 975 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 >Feature sequence2004 >Feature sequence2005 >Feature sequence2006 51 239 gene locus_tag LOCUS_45660 51 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 380 979 gene locus_tag LOCUS_45670 380 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 >Feature sequence2007 <1077 544 gene locus_tag LOCUS_45680 <1077 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048114.1:polysaccharide biosynthesis C-terminal domain-containing protein >Feature sequence2008 >Feature sequence2009 <1077 403 gene locus_tag LOCUS_45690 <1077 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089802.1:sugar ABC transporter permease >Feature sequence2010 >Feature sequence2011 510 13 gene locus_tag LOCUS_45700 510 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 >Feature sequence2012 >Feature sequence2013 >Feature sequence2014 1023 70 gene locus_tag LOCUS_45710 1023 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 >Feature sequence2015 311 1051 gene locus_tag LOCUS_45720 311 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence2016 <1073 336 gene locus_tag LOCUS_45730 <1073 336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080425.1:glycoside hydrolase family 2 protein >Feature sequence2017 491 177 gene locus_tag LOCUS_45740 491 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 <1073 488 gene locus_tag LOCUS_45750 <1073 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986862.1:sulfite exporter TauE/SafE family protein >Feature sequence2018 >Feature sequence2019 >Feature sequence2020 <1072 335 gene locus_tag LOCUS_45760 <1072 335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584082.1:alpha-N-arabinofuranosidase >Feature sequence2021 >Feature sequence2022 >Feature sequence2023 >Feature sequence2024 >Feature sequence2025 387 109 gene locus_tag LOCUS_45770 387 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 1024 479 gene locus_tag LOCUS_45780 1024 479 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence2026 2 121 gene locus_tag LOCUS_45790 2 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 118 507 gene locus_tag LOCUS_45800 118 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 >Feature sequence2027 162 524 gene locus_tag LOCUS_45810 162 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 524 826 gene locus_tag LOCUS_45820 524 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence2028 >Feature sequence2029 >Feature sequence2030 458 1018 gene locus_tag LOCUS_45830 458 1018 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951420.1 protein_id gnl|my_center|LOCUS_45830 >Feature sequence2031 >Feature sequence2032 <1067 324 gene locus_tag LOCUS_45840 <1067 324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679310.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence2033 >Feature sequence2034 798 304 gene locus_tag LOCUS_45850 798 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence2035 <1066 160 gene locus_tag LOCUS_45860 <1066 160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956682.1:IS30-like element ISTde2 family transposase >Feature sequence2036 257 556 gene locus_tag LOCUS_45870 257 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 >Feature sequence2037 >Feature sequence2038 >Feature sequence2039 306 175 gene locus_tag LOCUS_45880 306 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 946 533 gene locus_tag LOCUS_45890 946 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 >Feature sequence2040 >Feature sequence2041 >Feature sequence2042 >Feature sequence2043 >Feature sequence2044 <1 905 gene locus_tag LOCUS_45900 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809362.1:HAMP domain-containing sensor histidine kinase >Feature sequence2045 >Feature sequence2046 26 919 gene locus_tag LOCUS_45910 gene nupQ 26 919 CDS product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 protein_id gnl|my_center|LOCUS_45910 >Feature sequence2047 418 119 gene locus_tag LOCUS_45920 418 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 1034 663 gene locus_tag LOCUS_45930 1034 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence2048 >Feature sequence2049 >Feature sequence2050 84 923 gene locus_tag LOCUS_45940 84 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 >Feature sequence2051 <1 943 gene locus_tag LOCUS_45950 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152948297.1:protease Lon-related BREX system protein BrxL >Feature sequence2052 >Feature sequence2053 >Feature sequence2054 476 958 gene locus_tag LOCUS_45960 476 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence2055 189 752 gene locus_tag LOCUS_45970 189 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence2056 >Feature sequence2057 >Feature sequence2058 >Feature sequence2059 206 406 gene locus_tag LOCUS_45980 206 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 869 699 gene locus_tag LOCUS_45990 869 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 1015 866 gene locus_tag LOCUS_46000 1015 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence2060 >Feature sequence2061 >Feature sequence2062 656 48 gene locus_tag LOCUS_46010 656 48 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence2063 >Feature sequence2064 >Feature sequence2065 >Feature sequence2066 >Feature sequence2067 >Feature sequence2068 >Feature sequence2069 >Feature sequence2070 >Feature sequence2071 >Feature sequence2072 <1050 244 gene locus_tag LOCUS_46020 <1050 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210432.1:D-alanine--D-alanine ligase >Feature sequence2073 <1 590 gene locus_tag LOCUS_46030 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430702.1:transketolase family protein >Feature sequence2074 >Feature sequence2075 <1 771 gene locus_tag LOCUS_46040 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208631126.1:zinc-binding dehydrogenase >Feature sequence2076 >Feature sequence2077 26 877 gene locus_tag LOCUS_46050 26 877 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722560.1 protein_id gnl|my_center|LOCUS_46050 >Feature sequence2078 <1048 233 gene locus_tag LOCUS_46060 <1048 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163580248.1:bifunctional ornithine acetyltransferase/N-acetylglutamate synthase >Feature sequence2079 >Feature sequence2080 39 689 gene locus_tag LOCUS_46070 39 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 >Feature sequence2081 512 438 gene locus_tag LOCUS_t00550 512 438 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2082 >Feature sequence2083 741 4 gene locus_tag LOCUS_46080 gene mtrA 741 4 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_46080 1035 748 gene locus_tag LOCUS_46090 1035 748 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_46090 >Feature sequence2084 >Feature sequence2085 514 672 gene locus_tag LOCUS_46100 514 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 719 985 gene locus_tag LOCUS_46110 719 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence2086 509 177 gene locus_tag LOCUS_46120 509 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 775 506 gene locus_tag LOCUS_46130 775 506 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771169.1 protein_id gnl|my_center|LOCUS_46130 >Feature sequence2087 <1 767 gene locus_tag LOCUS_46140 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068619.1:MFS transporter 1040 831 gene locus_tag LOCUS_46150 1040 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 >Feature sequence2088 2 1030 gene locus_tag LOCUS_46160 2 1030 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_46160 >Feature sequence2089 >Feature sequence2090 >Feature sequence2091 >Feature sequence2092 >Feature sequence2093 288 1025 gene locus_tag LOCUS_46170 288 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence2094 >Feature sequence2095 <1041 13 gene locus_tag LOCUS_46180 <1041 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943127.1:OFA family MFS transporter >Feature sequence2096 >Feature sequence2097 <1040 520 gene locus_tag LOCUS_46190 <1040 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682373.1:methionine--tRNA ligase >Feature sequence2098 1023 184 gene locus_tag LOCUS_46200 1023 184 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_46200 >Feature sequence2099 >Feature sequence2100 475 269 gene locus_tag LOCUS_46210 475 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 >Feature sequence2101 >Feature sequence2102 854 33 gene locus_tag LOCUS_46220 854 33 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_46220 >Feature sequence2103 >Feature sequence2104 116 361 gene locus_tag LOCUS_46230 116 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 358 798 gene locus_tag LOCUS_46240 358 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 >Feature sequence2105 <1 784 gene locus_tag LOCUS_46250 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089115.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence2106 >Feature sequence2107 >Feature sequence2108 <1036 203 gene locus_tag LOCUS_46260 <1036 203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015262274.1:IS21 family transposase >Feature sequence2109 >Feature sequence2110 >Feature sequence2111 >Feature sequence2112 >Feature sequence2113 >Feature sequence2114 242 922 gene locus_tag LOCUS_46270 242 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 >Feature sequence2115 >Feature sequence2116 <1034 80 gene locus_tag LOCUS_46280 <1034 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228830.1:guanosine ABC transporter ATP-binding protein NupO >Feature sequence2117 >Feature sequence2118 <1 852 gene locus_tag LOCUS_46290 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence2119 1033 362 gene locus_tag LOCUS_46300 1033 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 >Feature sequence2120 <1 846 gene locus_tag LOCUS_46310 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681876.1:endopeptidase La >Feature sequence2121 >Feature sequence2122 >Feature sequence2123 217 80 gene locus_tag LOCUS_46320 217 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 998 285 gene locus_tag LOCUS_46330 998 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 >Feature sequence2124 >Feature sequence2125 619 158 gene locus_tag LOCUS_46340 619 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 >Feature sequence2126 <1028 450 gene locus_tag LOCUS_46350 <1028 450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229499.1:L-arabinose isomerase >Feature sequence2127 <1 1000 gene locus_tag LOCUS_46360 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020155.1:DEAD/DEAH box helicase >Feature sequence2128 >Feature sequence2129 >Feature sequence2130 <1 841 gene locus_tag LOCUS_46370 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038511.1:sugar MFS transporter >Feature sequence2131 >Feature sequence2132 178 327 gene locus_tag LOCUS_46380 178 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 650 1021 gene locus_tag LOCUS_46390 650 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 >Feature sequence2133 192 431 gene locus_tag LOCUS_46400 192 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence2134 >Feature sequence2135 <1 894 gene locus_tag LOCUS_46410 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680971.1:regulatory iron-sulfur-containing complex subunit RicT >Feature sequence2136 >Feature sequence2137 >Feature sequence2138 201 491 gene locus_tag LOCUS_46420 201 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 >Feature sequence2139 980 645 gene locus_tag LOCUS_46430 980 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 >Feature sequence2140 214 657 gene locus_tag LOCUS_46440 214 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 >Feature sequence2141 139 786 gene locus_tag LOCUS_46450 139 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence2142 >Feature sequence2143 81 536 gene locus_tag LOCUS_46460 81 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 582 1016 gene locus_tag LOCUS_46470 582 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence2144 >Feature sequence2145 <1020 394 gene locus_tag LOCUS_46480 <1020 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001179093.1:iron-containing alcohol dehydrogenase >Feature sequence2146 >Feature sequence2147 >Feature sequence2148 >Feature sequence2149 >Feature sequence2150 >Feature sequence2151 >Feature sequence2152 >Feature sequence2153 >Feature sequence2154 <1018 85 gene locus_tag LOCUS_46490 <1018 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798895.1:class II fructose-1,6-bisphosphate aldolase >Feature sequence2155 <1 756 gene locus_tag LOCUS_46500 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence2156 >Feature sequence2157 396 190 gene locus_tag LOCUS_46510 396 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence2158 <1017 486 gene locus_tag LOCUS_46520 <1017 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582463.1:phosphoglycerate dehydrogenase >Feature sequence2159 1015 776 gene locus_tag LOCUS_46530 1015 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence2160 <1016 92 gene locus_tag LOCUS_46540 <1016 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876537.1:deoxyribodipyrimidine photo-lyase >Feature sequence2161 937 527 gene locus_tag LOCUS_46550 937 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 >Feature sequence2162 >Feature sequence2163 >Feature sequence2164 433 987 gene locus_tag LOCUS_46560 gene rfbC 433 987 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_46560 >Feature sequence2165 <1014 346 gene locus_tag LOCUS_46570 <1014 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815913.1:ketopantoate reductase family protein >Feature sequence2166 >Feature sequence2167 129 875 gene locus_tag LOCUS_46580 129 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 >Feature sequence2168 >Feature sequence2169 >Feature sequence2170 564 770 gene locus_tag LOCUS_46590 564 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 >Feature sequence2171 <1 920 gene locus_tag LOCUS_46600 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679154.1:AAA family ATPase >Feature sequence2172 >Feature sequence2173 978 778 gene locus_tag LOCUS_46610 978 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence2174 >Feature sequence2175 >Feature sequence2176 >Feature sequence2177 >Feature sequence2178 <1 621 gene locus_tag LOCUS_46620 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272230.1:Fic family protein >Feature sequence2179 922 680 gene locus_tag LOCUS_46630 922 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence2180 47 544 gene locus_tag LOCUS_46640 47 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence2181 <1 562 gene locus_tag LOCUS_46650 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814089.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence2182 >Feature sequence2183 >Feature sequence2184 >Feature sequence2185 >Feature sequence2186 >Feature sequence2187 4 492 gene locus_tag LOCUS_46660 4 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence2188 >Feature sequence2189 501 145 gene locus_tag LOCUS_46670 501 145 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938797.1 protein_id gnl|my_center|LOCUS_46670 >Feature sequence2190 578 375 gene locus_tag LOCUS_46680 578 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence2191 <1 865 gene locus_tag LOCUS_46690 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000211475.1:L-rhamnose isomerase >Feature sequence2192 >Feature sequence2193 114 404 gene locus_tag LOCUS_46700 114 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 382 627 gene locus_tag LOCUS_46710 382 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 691 930 gene locus_tag LOCUS_46720 691 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 >Feature sequence2194 107 880 gene locus_tag LOCUS_46730 gene mtnP 107 880 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_46730 >Feature sequence2195 828 115 gene locus_tag LOCUS_46740 gene tsaB 828 115 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_46740 >Feature sequence2196 >Feature sequence2197 1001 267 gene locus_tag LOCUS_46750 1001 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 >Feature sequence2198 <1 929 gene locus_tag LOCUS_46760 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047942.1:amidophosphoribosyltransferase >Feature sequence2199 <1000 361 gene locus_tag LOCUS_46770 <1000 361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035887216.1:DUF1566 domain-containing protein >Feature sequence2200 >Feature sequence2201 >Feature sequence2202