>Feature sequence001 3352 2279 gene locus_tag LOCUS_00010 3352 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4392 3349 gene locus_tag LOCUS_00020 4392 3349 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_00020 6032 4497 gene locus_tag LOCUS_00030 6032 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6031 6198 gene locus_tag LOCUS_00040 6031 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6968 7393 gene locus_tag LOCUS_00050 6968 7393 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_00050 7628 8017 gene locus_tag LOCUS_00060 7628 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9234 8065 gene locus_tag LOCUS_00070 gene queG 9234 8065 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_00070 9384 10154 gene locus_tag LOCUS_00080 9384 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11154 10180 gene locus_tag LOCUS_00090 11154 10180 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257056.1 protein_id gnl|my_center|LOCUS_00090 11589 11371 gene locus_tag LOCUS_00100 11589 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11708 12034 gene locus_tag LOCUS_00110 11708 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12508 12059 gene locus_tag LOCUS_00120 12508 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12739 13596 gene locus_tag LOCUS_00130 12739 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15001 13625 gene locus_tag LOCUS_00140 15001 13625 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_00140 15267 16061 gene locus_tag LOCUS_00150 15267 16061 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_00150 17256 16111 gene locus_tag LOCUS_00160 17256 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17903 17253 gene locus_tag LOCUS_00170 17903 17253 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_00170 18145 19839 gene locus_tag LOCUS_00180 18145 19839 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_00180 20154 19876 gene locus_tag LOCUS_00190 20154 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20359 21120 gene locus_tag LOCUS_00200 gene aqpZ 20359 21120 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071520.1 protein_id gnl|my_center|LOCUS_00200 21979 21284 gene locus_tag LOCUS_00210 21979 21284 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018324898.1 protein_id gnl|my_center|LOCUS_00210 22754 22095 gene locus_tag LOCUS_00220 22754 22095 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_00220 24785 22797 gene locus_tag LOCUS_00230 24785 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25325 26122 gene locus_tag LOCUS_00240 25325 26122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26314 26203 gene locus_tag LOCUS_r00010 26314 26203 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 26890 26429 gene locus_tag LOCUS_00250 26890 26429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26968 28566 gene locus_tag LOCUS_00260 gene gpmI 26968 28566 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_00260 28631 29767 gene locus_tag LOCUS_00270 gene solA 28631 29767 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_00270 30688 29810 gene locus_tag LOCUS_00280 30688 29810 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_00280 31090 30836 gene locus_tag LOCUS_00290 31090 30836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31442 32725 gene locus_tag LOCUS_00300 31442 32725 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939886.1 protein_id gnl|my_center|LOCUS_00300 34271 33099 gene locus_tag LOCUS_00310 34271 33099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34688 35221 gene locus_tag LOCUS_00320 34688 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37421 35292 gene locus_tag LOCUS_00330 37421 35292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38382 37573 gene locus_tag LOCUS_00340 38382 37573 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_00340 40144 38483 gene locus_tag LOCUS_00350 40144 38483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42549 40141 gene locus_tag LOCUS_00360 42549 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42735 42974 gene locus_tag LOCUS_00370 42735 42974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43186 42971 gene locus_tag LOCUS_00380 43186 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43979 43743 gene locus_tag LOCUS_00390 43979 43743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44359 44712 gene locus_tag LOCUS_00400 44359 44712 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_00400 46027 44714 gene locus_tag LOCUS_00410 46027 44714 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_00410 46639 46235 gene locus_tag LOCUS_00420 46639 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47566 46814 gene locus_tag LOCUS_00430 47566 46814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48084 47566 gene locus_tag LOCUS_00440 48084 47566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49858 48314 gene locus_tag LOCUS_00450 49858 48314 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_00450 51425 50037 gene locus_tag LOCUS_00460 51425 50037 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_00460 51384 51614 gene locus_tag LOCUS_00470 51384 51614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51879 53636 gene locus_tag LOCUS_00480 51879 53636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53633 54343 gene locus_tag LOCUS_00490 53633 54343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54460 56019 gene locus_tag LOCUS_00500 54460 56019 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_00500 56405 56073 gene locus_tag LOCUS_00510 56405 56073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56506 57408 gene locus_tag LOCUS_00520 gene meaB 56506 57408 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888382.1 protein_id gnl|my_center|LOCUS_00520 57625 58665 gene locus_tag LOCUS_00530 57625 58665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60328 58925 gene locus_tag LOCUS_00540 60328 58925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60427 62451 gene locus_tag LOCUS_00550 60427 62451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62722 62414 gene locus_tag LOCUS_00560 62722 62414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62609 64342 gene locus_tag LOCUS_00570 62609 64342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64510 66993 gene locus_tag LOCUS_00580 64510 66993 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256179.1 protein_id gnl|my_center|LOCUS_00580 67995 67039 gene locus_tag LOCUS_00590 67995 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68162 69250 gene locus_tag LOCUS_00600 68162 69250 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_00600 69343 69930 gene locus_tag LOCUS_00610 69343 69930 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969495.1 protein_id gnl|my_center|LOCUS_00610 70352 71497 gene locus_tag LOCUS_00620 gene dgoD 70352 71497 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_00620 71543 72355 gene locus_tag LOCUS_00630 71543 72355 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240172.1 protein_id gnl|my_center|LOCUS_00630 72358 73209 gene locus_tag LOCUS_00640 72358 73209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73206 74195 gene locus_tag LOCUS_00650 73206 74195 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_00650 74325 75386 gene locus_tag LOCUS_00660 74325 75386 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_00660 75431 76489 gene locus_tag LOCUS_00670 75431 76489 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_00670 76653 78032 gene locus_tag LOCUS_00680 76653 78032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78339 80555 gene locus_tag LOCUS_00690 78339 80555 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_00690 80586 81908 gene locus_tag LOCUS_00700 80586 81908 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_00700 82884 81979 gene locus_tag LOCUS_00710 82884 81979 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280060.1 protein_id gnl|my_center|LOCUS_00710 83101 84273 gene locus_tag LOCUS_00720 gene gcvT 83101 84273 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_00720 84394 84780 gene locus_tag LOCUS_00730 gene gcvH 84394 84780 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_00730 84867 86219 gene locus_tag LOCUS_00740 gene gcvPA 84867 86219 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_00740 86247 86783 gene locus_tag LOCUS_00750 86247 86783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 86830 87657 gene locus_tag LOCUS_00760 86830 87657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88867 87737 gene locus_tag LOCUS_00770 gene rho 88867 87737 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227674.1 protein_id gnl|my_center|LOCUS_00770 89168 90154 gene locus_tag LOCUS_00780 89168 90154 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_00780 91310 90228 gene locus_tag LOCUS_00790 91310 90228 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_00790 91583 91496 gene locus_tag LOCUS_t00010 91583 91496 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 91750 92211 gene locus_tag LOCUS_00800 91750 92211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 92593 92312 gene locus_tag LOCUS_00810 92593 92312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 93061 92807 gene locus_tag LOCUS_00820 gene infA 93061 92807 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_00820 93298 93783 gene locus_tag LOCUS_00830 93298 93783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 93855 94454 gene locus_tag LOCUS_00840 93855 94454 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_00840 95199 94900 gene locus_tag LOCUS_00850 95199 94900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 95080 95544 gene locus_tag LOCUS_00860 95080 95544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 95700 96647 gene locus_tag LOCUS_00870 gene speB 95700 96647 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_00870 96948 96742 gene locus_tag LOCUS_00880 96948 96742 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357750.1 protein_id gnl|my_center|LOCUS_00880 97969 97163 gene locus_tag LOCUS_00890 97969 97163 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_00890 98075 99289 gene locus_tag LOCUS_00900 gene dprA 98075 99289 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_00900 99433 100821 gene locus_tag LOCUS_00910 gene secD 99433 100821 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_00910 100866 101810 gene locus_tag LOCUS_00920 gene secF 100866 101810 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_00920 101912 102694 gene locus_tag LOCUS_00930 101912 102694 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_00930 102795 103709 gene locus_tag LOCUS_00940 102795 103709 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_00940 104789 103755 gene locus_tag LOCUS_00950 104789 103755 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_00950 105283 104879 gene locus_tag LOCUS_00960 105283 104879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105594 107042 gene locus_tag LOCUS_00970 105594 107042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109094 107259 gene locus_tag LOCUS_00980 109094 107259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence002 1 909 gene locus_tag LOCUS_00990 1 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 1025 1687 gene locus_tag LOCUS_01000 gene eda 1025 1687 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_01000 2984 1815 gene locus_tag LOCUS_01010 2984 1815 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_01010 3193 3618 gene locus_tag LOCUS_01020 3193 3618 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_01020 3718 4665 gene locus_tag LOCUS_01030 3718 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 5488 4709 gene locus_tag LOCUS_01040 5488 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5700 6164 gene locus_tag LOCUS_01050 5700 6164 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_01050 7525 6227 gene locus_tag LOCUS_01060 7525 6227 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043553261.1 protein_id gnl|my_center|LOCUS_01060 8817 7522 gene locus_tag LOCUS_01070 8817 7522 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421521.1 protein_id gnl|my_center|LOCUS_01070 8997 9482 gene locus_tag LOCUS_01080 8997 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 9607 11271 gene locus_tag LOCUS_01090 9607 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 11325 13385 gene locus_tag LOCUS_01100 11325 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 13539 14027 gene locus_tag LOCUS_01110 13539 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14286 15599 gene locus_tag LOCUS_01120 gene eno 14286 15599 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_01120 15694 16065 gene locus_tag LOCUS_01130 15694 16065 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257928.1 protein_id gnl|my_center|LOCUS_01130 18153 16159 gene locus_tag LOCUS_01140 18153 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 18368 19336 gene locus_tag LOCUS_01150 18368 19336 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_01150 19925 19368 gene locus_tag LOCUS_01160 19925 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 19830 20525 gene locus_tag LOCUS_01170 19830 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 20546 21814 gene locus_tag LOCUS_01180 20546 21814 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_01180 21982 22057 gene locus_tag LOCUS_t00020 21982 22057 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22117 22260 gene locus_tag LOCUS_01190 22117 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 22931 22350 gene locus_tag LOCUS_01200 22931 22350 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_01200 24069 23068 gene locus_tag LOCUS_01210 24069 23068 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_01210 24192 25367 gene locus_tag LOCUS_01220 24192 25367 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_01220 25975 25499 gene locus_tag LOCUS_01230 25975 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 27478 26264 gene locus_tag LOCUS_01240 27478 26264 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_01240 27646 28500 gene locus_tag LOCUS_01250 27646 28500 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_01250 28558 28989 gene locus_tag LOCUS_01260 28558 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 29101 29027 gene locus_tag LOCUS_t00030 29101 29027 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29263 30213 gene locus_tag LOCUS_01270 29263 30213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 30210 30695 gene locus_tag LOCUS_01280 30210 30695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 30931 33039 gene locus_tag LOCUS_01290 30931 33039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_01290 33286 35331 gene locus_tag LOCUS_01300 33286 35331 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_01300 35491 36480 gene locus_tag LOCUS_01310 35491 36480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_01310 36480 37781 gene locus_tag LOCUS_01320 36480 37781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_01320 37787 38878 gene locus_tag LOCUS_01330 37787 38878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 protein_id gnl|my_center|LOCUS_01330 38875 39912 gene locus_tag LOCUS_01340 38875 39912 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082545.1 protein_id gnl|my_center|LOCUS_01340 40898 39951 gene locus_tag LOCUS_01350 40898 39951 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015276.1 protein_id gnl|my_center|LOCUS_01350 41221 42795 gene locus_tag LOCUS_01360 41221 42795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 42916 44070 gene locus_tag LOCUS_01370 42916 44070 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_01370 44408 45373 gene locus_tag LOCUS_01380 44408 45373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 45494 47293 gene locus_tag LOCUS_01390 45494 47293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 48386 47337 gene locus_tag LOCUS_01400 gene uxuA 48386 47337 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906067.1 protein_id gnl|my_center|LOCUS_01400 48795 49403 gene locus_tag LOCUS_01410 48795 49403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 49862 49407 gene locus_tag LOCUS_01420 49862 49407 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_01420 51061 49961 gene locus_tag LOCUS_01430 51061 49961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_01430 53245 51137 gene locus_tag LOCUS_01440 53245 51137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 53438 54535 gene locus_tag LOCUS_01450 53438 54535 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_01450 55129 57561 gene locus_tag LOCUS_01460 55129 57561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 57819 58859 gene locus_tag LOCUS_01470 gene pdhA 57819 58859 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_01470 58847 59821 gene locus_tag LOCUS_01480 58847 59821 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_01480 59879 61327 gene locus_tag LOCUS_01490 59879 61327 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_01490 61471 61869 gene locus_tag LOCUS_01500 61471 61869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 62071 64017 gene locus_tag LOCUS_01510 62071 64017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 64094 64420 gene locus_tag LOCUS_01520 64094 64420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 64521 64976 gene locus_tag LOCUS_01530 gene ndk 64521 64976 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01530 65419 65078 gene locus_tag LOCUS_01540 65419 65078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 65732 67123 gene locus_tag LOCUS_01550 65732 67123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 67156 67506 gene locus_tag LOCUS_01560 67156 67506 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_01560 67745 68485 gene locus_tag LOCUS_01570 67745 68485 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222414.1 protein_id gnl|my_center|LOCUS_01570 68567 69133 gene locus_tag LOCUS_01580 68567 69133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 71201 69141 gene locus_tag LOCUS_01590 71201 69141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 72037 71138 gene locus_tag LOCUS_01600 72037 71138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 72285 73463 gene locus_tag LOCUS_01610 72285 73463 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_01610 74096 73497 gene locus_tag LOCUS_01620 74096 73497 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_01620 75456 74203 gene locus_tag LOCUS_01630 75456 74203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 76289 75513 gene locus_tag LOCUS_01640 76289 75513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01640 76731 77492 gene locus_tag LOCUS_01650 76731 77492 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399178.1 protein_id gnl|my_center|LOCUS_01650 82812 77581 gene locus_tag LOCUS_01660 82812 77581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence003 425 1567 gene locus_tag LOCUS_01670 425 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1825 1586 gene locus_tag LOCUS_01680 gene clpS 1825 1586 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140748.1 protein_id gnl|my_center|LOCUS_01680 2045 3298 gene locus_tag LOCUS_01690 gene fabF 2045 3298 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_01690 3337 3825 gene locus_tag LOCUS_01700 gene accB 3337 3825 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946212.1 protein_id gnl|my_center|LOCUS_01700 5027 4119 gene locus_tag LOCUS_01710 5027 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 5199 5996 gene locus_tag LOCUS_01720 5199 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 6090 6371 gene locus_tag LOCUS_01730 6090 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6558 8126 gene locus_tag LOCUS_01740 6558 8126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_01740 8273 9277 gene locus_tag LOCUS_01750 8273 9277 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_01750 9355 10257 gene locus_tag LOCUS_01760 9355 10257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_01760 10867 11109 gene locus_tag LOCUS_01770 10867 11109 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01770 11248 11670 gene locus_tag LOCUS_01780 11248 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 11719 13251 gene locus_tag LOCUS_01790 11719 13251 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546302.1 protein_id gnl|my_center|LOCUS_01790 13520 13236 gene locus_tag LOCUS_01800 13520 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13789 13517 gene locus_tag LOCUS_01810 13789 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 14791 13805 gene locus_tag LOCUS_01820 14791 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 14945 16027 gene locus_tag LOCUS_01830 14945 16027 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_01830 16178 16080 gene locus_tag LOCUS_t00040 16178 16080 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 17357 16254 gene locus_tag LOCUS_01840 17357 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 18203 17376 gene locus_tag LOCUS_01850 18203 17376 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258338.1 protein_id gnl|my_center|LOCUS_01850 18344 19339 gene locus_tag LOCUS_01860 18344 19339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 19502 20041 gene locus_tag LOCUS_01870 19502 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 21025 20138 gene locus_tag LOCUS_01880 21025 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 21461 22342 gene locus_tag LOCUS_01890 21461 22342 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_01890 22379 22714 gene locus_tag LOCUS_01900 22379 22714 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_01900 22804 25005 gene locus_tag LOCUS_01910 22804 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 25878 25075 gene locus_tag LOCUS_01920 gene radC 25878 25075 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_01920 26075 27517 gene locus_tag LOCUS_01930 26075 27517 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_01930 27514 28341 gene locus_tag LOCUS_01940 27514 28341 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_01940 28338 30221 gene locus_tag LOCUS_01950 28338 30221 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584157.1 protein_id gnl|my_center|LOCUS_01950 31065 30250 gene locus_tag LOCUS_01960 31065 30250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143020.1 protein_id gnl|my_center|LOCUS_01960 31226 32581 gene locus_tag LOCUS_01970 31226 32581 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_01970 32789 34258 gene locus_tag LOCUS_01980 32789 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 34255 35109 gene locus_tag LOCUS_01990 34255 35109 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_01990 36489 35164 gene locus_tag LOCUS_02000 gene mqnC 36489 35164 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_02000 37640 36621 gene locus_tag LOCUS_02010 gene pdxA 37640 36621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_02010 37709 38671 gene locus_tag LOCUS_02020 gene pheA 37709 38671 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_02020 38675 39061 gene locus_tag LOCUS_02030 38675 39061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 39233 42364 gene locus_tag LOCUS_02040 39233 42364 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870423.1 protein_id gnl|my_center|LOCUS_02040 42475 43194 gene locus_tag LOCUS_02050 42475 43194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 43271 45454 gene locus_tag LOCUS_02060 43271 45454 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_02060 46366 45521 gene locus_tag LOCUS_02070 46366 45521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 46563 46488 gene locus_tag LOCUS_t00050 46563 46488 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48491 46629 gene locus_tag LOCUS_02080 48491 46629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530489.1 protein_id gnl|my_center|LOCUS_02080 50409 48514 gene locus_tag LOCUS_02090 50409 48514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 protein_id gnl|my_center|LOCUS_02090 51713 50553 gene locus_tag LOCUS_02100 51713 50553 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460323.1 protein_id gnl|my_center|LOCUS_02100 51598 51873 gene locus_tag LOCUS_02110 51598 51873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 51900 52115 gene locus_tag LOCUS_02120 51900 52115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 52169 52960 gene locus_tag LOCUS_02130 52169 52960 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869335.1 protein_id gnl|my_center|LOCUS_02130 53510 52989 gene locus_tag LOCUS_02140 53510 52989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 54385 53537 gene locus_tag LOCUS_02150 54385 53537 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_02150 56870 54501 gene locus_tag LOCUS_02160 56870 54501 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_02160 57488 56970 gene locus_tag LOCUS_02170 57488 56970 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_02170 57520 58680 gene locus_tag LOCUS_02180 57520 58680 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401873.1 protein_id gnl|my_center|LOCUS_02180 58953 60080 gene locus_tag LOCUS_02190 58953 60080 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_02190 60194 61072 gene locus_tag LOCUS_02200 60194 61072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 61275 61078 gene locus_tag LOCUS_02210 61275 61078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 61635 61303 gene locus_tag LOCUS_02220 61635 61303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 61588 61743 gene locus_tag LOCUS_02230 61588 61743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 62594 61815 gene locus_tag LOCUS_02240 62594 61815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02240 63091 62552 gene locus_tag LOCUS_02250 63091 62552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 63229 65559 gene locus_tag LOCUS_02260 gene topA 63229 65559 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259747.1 protein_id gnl|my_center|LOCUS_02260 65677 67596 gene locus_tag LOCUS_02270 gene selB 65677 67596 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_02270 68305 68120 gene locus_tag LOCUS_02280 68305 68120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 68280 68696 gene locus_tag LOCUS_02290 68280 68696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 68764 69552 gene locus_tag LOCUS_02300 68764 69552 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_02300 69688 70857 gene locus_tag LOCUS_02310 69688 70857 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_02310 72888 70867 gene locus_tag LOCUS_02320 gene glgB 72888 70867 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence004 416 1336 gene locus_tag LOCUS_02330 416 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1502 2266 gene locus_tag LOCUS_02340 1502 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4295 2379 gene locus_tag LOCUS_02350 4295 2379 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583972.1 protein_id gnl|my_center|LOCUS_02350 4518 5291 gene locus_tag LOCUS_02360 4518 5291 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_02360 6137 5259 gene locus_tag LOCUS_02370 6137 5259 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_02370 7060 6242 gene locus_tag LOCUS_02380 7060 6242 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257306.1 protein_id gnl|my_center|LOCUS_02380 7327 7959 gene locus_tag LOCUS_02390 7327 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8573 7968 gene locus_tag LOCUS_02400 8573 7968 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 protein_id gnl|my_center|LOCUS_02400 8700 10793 gene locus_tag LOCUS_02410 8700 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11398 10886 gene locus_tag LOCUS_02420 11398 10886 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_02420 11627 13879 gene locus_tag LOCUS_02430 11627 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 14474 15931 gene locus_tag LOCUS_02440 14474 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 16045 16974 gene locus_tag LOCUS_02450 16045 16974 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_02450 17134 17781 gene locus_tag LOCUS_02460 17134 17781 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259234.1 protein_id gnl|my_center|LOCUS_02460 18010 19593 gene locus_tag LOCUS_02470 18010 19593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 20053 19634 gene locus_tag LOCUS_02480 20053 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 20924 20025 gene locus_tag LOCUS_02490 20924 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 22673 21066 gene locus_tag LOCUS_02500 22673 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23494 22871 gene locus_tag LOCUS_02510 23494 22871 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 protein_id gnl|my_center|LOCUS_02510 23602 24342 gene locus_tag LOCUS_02520 23602 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 24403 25710 gene locus_tag LOCUS_02530 24403 25710 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583973.1 protein_id gnl|my_center|LOCUS_02530 25707 29360 gene locus_tag LOCUS_02540 25707 29360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 29396 30379 gene locus_tag LOCUS_02550 29396 30379 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775777.1 protein_id gnl|my_center|LOCUS_02550 30376 31305 gene locus_tag LOCUS_02560 30376 31305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 31394 33982 gene locus_tag LOCUS_02570 31394 33982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 34014 34916 gene locus_tag LOCUS_02580 gene ubiA 34014 34916 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_02580 34941 35540 gene locus_tag LOCUS_02590 34941 35540 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405961.1 protein_id gnl|my_center|LOCUS_02590 37051 35603 gene locus_tag LOCUS_02600 37051 35603 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_02600 37172 38017 gene locus_tag LOCUS_02610 37172 38017 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_02610 38032 38823 gene locus_tag LOCUS_02620 38032 38823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 38870 39886 gene locus_tag LOCUS_02630 gene iolG 38870 39886 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_02630 40800 40009 gene locus_tag LOCUS_02640 40800 40009 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532943.1 protein_id gnl|my_center|LOCUS_02640 41232 41023 gene locus_tag LOCUS_02650 41232 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 41262 42224 gene locus_tag LOCUS_02660 41262 42224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 43526 42453 gene locus_tag LOCUS_02670 43526 42453 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_02670 44437 43604 gene locus_tag LOCUS_02680 44437 43604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 44718 46499 gene locus_tag LOCUS_02690 44718 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 46719 46561 gene locus_tag LOCUS_02700 46719 46561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 46718 47659 gene locus_tag LOCUS_02710 46718 47659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_02710 47699 48607 gene locus_tag LOCUS_02720 47699 48607 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_02720 48612 49835 gene locus_tag LOCUS_02730 48612 49835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_02730 49832 50887 gene locus_tag LOCUS_02740 49832 50887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_02740 50949 52805 gene locus_tag LOCUS_02750 50949 52805 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_02750 54072 52876 gene locus_tag LOCUS_02760 54072 52876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 54862 54428 gene locus_tag LOCUS_02770 54862 54428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 55500 54940 gene locus_tag LOCUS_02780 55500 54940 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_02780 55971 55675 gene locus_tag LOCUS_02790 gene rpsF 55971 55675 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_02790 57380 56202 gene locus_tag LOCUS_02800 gene glnA 57380 56202 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_02800 57343 57630 gene locus_tag LOCUS_02810 57343 57630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 59352 57511 gene locus_tag LOCUS_02820 59352 57511 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_02820 60610 59336 gene locus_tag LOCUS_02830 gene tgt 60610 59336 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_02830 60785 61942 gene locus_tag LOCUS_02840 60785 61942 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_02840 65278 62009 gene locus_tag LOCUS_02850 65278 62009 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_02850 67932 65449 gene locus_tag LOCUS_02860 67932 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 68098 70752 gene locus_tag LOCUS_02870 gene alr 68098 70752 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257666.1 protein_id gnl|my_center|LOCUS_02870 71526 70804 gene locus_tag LOCUS_02880 71526 70804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence005 <1 673 gene locus_tag LOCUS_02890 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968365.1:dihydrodipicolinate synthase family protein 950 696 gene locus_tag LOCUS_02900 950 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2220 1357 gene locus_tag LOCUS_02910 2220 1357 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_02910 2712 2278 gene locus_tag LOCUS_02920 2712 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4251 2860 gene locus_tag LOCUS_02930 gene glnA 4251 2860 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_02930 5030 4719 gene locus_tag LOCUS_02940 5030 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 5600 5524 gene locus_tag LOCUS_t00060 5600 5524 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5676 6899 gene locus_tag LOCUS_02950 5676 6899 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_02950 6992 7852 gene locus_tag LOCUS_02960 6992 7852 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_02960 7927 8727 gene locus_tag LOCUS_02970 7927 8727 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_02970 8887 9279 gene locus_tag LOCUS_02980 8887 9279 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_02980 9921 9289 gene locus_tag LOCUS_02990 9921 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11055 9928 gene locus_tag LOCUS_03000 11055 9928 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_03000 11369 12991 gene locus_tag LOCUS_03010 gene groL 11369 12991 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_03010 13373 13774 gene locus_tag LOCUS_03020 13373 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 13771 14046 gene locus_tag LOCUS_03030 13771 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 14910 14107 gene locus_tag LOCUS_03040 14910 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_03040 15099 15812 gene locus_tag LOCUS_03050 15099 15812 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03050 16921 15827 gene locus_tag LOCUS_03060 16921 15827 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_03060 17719 17036 gene locus_tag LOCUS_03070 17719 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 18161 17748 gene locus_tag LOCUS_03080 18161 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 19059 18286 gene locus_tag LOCUS_03090 19059 18286 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_03090 19950 19189 gene locus_tag LOCUS_03100 19950 19189 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_03100 20191 20967 gene locus_tag LOCUS_03110 20191 20967 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_03110 20977 22008 gene locus_tag LOCUS_03120 20977 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 22021 22716 gene locus_tag LOCUS_03130 22021 22716 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_03130 24447 22732 gene locus_tag LOCUS_03140 24447 22732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_03140 26320 24362 gene locus_tag LOCUS_03150 26320 24362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_03150 26549 27349 gene locus_tag LOCUS_03160 26549 27349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_03160 27593 29392 gene locus_tag LOCUS_03170 27593 29392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250711.1 protein_id gnl|my_center|LOCUS_03170 29879 29472 gene locus_tag LOCUS_03180 29879 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 31034 32872 gene locus_tag LOCUS_03190 31034 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 33731 32919 gene locus_tag LOCUS_03200 33731 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 34768 33890 gene locus_tag LOCUS_03210 34768 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 36930 34852 gene locus_tag LOCUS_03220 36930 34852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 37196 37618 gene locus_tag LOCUS_03230 37196 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 38459 37719 gene locus_tag LOCUS_03240 38459 37719 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197352.1 protein_id gnl|my_center|LOCUS_03240 40009 38591 gene locus_tag LOCUS_03250 40009 38591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_03250 40165 41586 gene locus_tag LOCUS_03260 40165 41586 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_03260 42093 41662 gene locus_tag LOCUS_03270 42093 41662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 42323 42781 gene locus_tag LOCUS_03280 42323 42781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 42838 43737 gene locus_tag LOCUS_03290 42838 43737 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_03290 44254 43697 gene locus_tag LOCUS_03300 44254 43697 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_03300 45621 44251 gene locus_tag LOCUS_03310 45621 44251 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_03310 46203 45754 gene locus_tag LOCUS_03320 46203 45754 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_03320 46506 47585 gene locus_tag LOCUS_03330 46506 47585 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_03330 48402 47635 gene locus_tag LOCUS_03340 48402 47635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 49301 48399 gene locus_tag LOCUS_03350 49301 48399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 49857 49288 gene locus_tag LOCUS_03360 49857 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 50119 51774 gene locus_tag LOCUS_03370 50119 51774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 51978 52400 gene locus_tag LOCUS_03380 51978 52400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 53447 52452 gene locus_tag LOCUS_03390 53447 52452 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_03390 53510 53746 gene locus_tag LOCUS_03400 53510 53746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 53930 54481 gene locus_tag LOCUS_03410 53930 54481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 54569 55177 gene locus_tag LOCUS_03420 54569 55177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 56392 55241 gene locus_tag LOCUS_03430 56392 55241 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_03430 57439 56414 gene locus_tag LOCUS_03440 57439 56414 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728384.1 protein_id gnl|my_center|LOCUS_03440 58626 57469 gene locus_tag LOCUS_03450 58626 57469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 59497 58733 gene locus_tag LOCUS_03460 59497 58733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 60461 59445 gene locus_tag LOCUS_03470 60461 59445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 60731 61726 gene locus_tag LOCUS_03480 60731 61726 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_03480 61925 62398 gene locus_tag LOCUS_03490 61925 62398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 63042 62722 gene locus_tag LOCUS_03500 63042 62722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 63099 64868 gene locus_tag LOCUS_03510 63099 64868 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_03510 64930 66774 gene locus_tag LOCUS_03520 64930 66774 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_03520 <67313 66807 gene locus_tag LOCUS_03530 <67313 66807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086666.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence006 17 1015 gene locus_tag LOCUS_03540 17 1015 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031473.1 protein_id gnl|my_center|LOCUS_03540 2160 1057 gene locus_tag LOCUS_03550 2160 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3608 2799 gene locus_tag LOCUS_03560 3608 2799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_03560 4447 3605 gene locus_tag LOCUS_03570 4447 3605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_03570 4962 4444 gene locus_tag LOCUS_03580 4962 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 5441 4959 gene locus_tag LOCUS_03590 5441 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 6197 5553 gene locus_tag LOCUS_03600 6197 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 6323 7369 gene locus_tag LOCUS_03610 6323 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7390 8556 gene locus_tag LOCUS_03620 7390 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8553 9758 gene locus_tag LOCUS_03630 8553 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10914 9784 gene locus_tag LOCUS_03640 10914 9784 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_03640 11365 10925 gene locus_tag LOCUS_03650 11365 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12348 13637 gene locus_tag LOCUS_03660 12348 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 13741 14895 gene locus_tag LOCUS_03670 gene dnaN 13741 14895 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_03670 15775 14969 gene locus_tag LOCUS_03680 15775 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 16722 15772 gene locus_tag LOCUS_03690 16722 15772 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_03690 17403 17143 gene locus_tag LOCUS_03700 17403 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 17497 18894 gene locus_tag LOCUS_03710 17497 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 19041 19481 gene locus_tag LOCUS_03720 19041 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 20448 19468 gene locus_tag LOCUS_03730 20448 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 21092 22066 gene locus_tag LOCUS_03740 21092 22066 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_03740 22804 22088 gene locus_tag LOCUS_03750 22804 22088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 24927 22849 gene locus_tag LOCUS_03760 24927 22849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 25486 25061 gene locus_tag LOCUS_03770 25486 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 25712 26077 gene locus_tag LOCUS_03780 25712 26077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 26210 26707 gene locus_tag LOCUS_03790 26210 26707 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_03790 26757 27635 gene locus_tag LOCUS_03800 26757 27635 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973109.1 protein_id gnl|my_center|LOCUS_03800 27706 28914 gene locus_tag LOCUS_03810 27706 28914 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_03810 30309 29560 gene locus_tag LOCUS_03820 30309 29560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_03820 31087 30227 gene locus_tag LOCUS_03830 31087 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 32119 31250 gene locus_tag LOCUS_03840 32119 31250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 32322 33368 gene locus_tag LOCUS_03850 32322 33368 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_03850 33453 34280 gene locus_tag LOCUS_03860 33453 34280 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929745.1 protein_id gnl|my_center|LOCUS_03860 35673 34414 gene locus_tag LOCUS_03870 35673 34414 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_03870 35755 36843 gene locus_tag LOCUS_03880 gene mgrA 35755 36843 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103110.1 protein_id gnl|my_center|LOCUS_03880 37924 36938 gene locus_tag LOCUS_03890 37924 36938 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533193.1 protein_id gnl|my_center|LOCUS_03890 38037 39587 gene locus_tag LOCUS_03900 38037 39587 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_03900 40620 39643 gene locus_tag LOCUS_03910 40620 39643 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_03910 41824 40748 gene locus_tag LOCUS_03920 41824 40748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 43154 41826 gene locus_tag LOCUS_03930 43154 41826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 44539 43151 gene locus_tag LOCUS_03940 44539 43151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 46001 44622 gene locus_tag LOCUS_03950 46001 44622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 47365 45998 gene locus_tag LOCUS_03960 47365 45998 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_03960 47520 48485 gene locus_tag LOCUS_03970 47520 48485 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_03970 50436 48568 gene locus_tag LOCUS_03980 50436 48568 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_03980 51653 50610 gene locus_tag LOCUS_03990 51653 50610 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_03990 52744 51770 gene locus_tag LOCUS_04000 52744 51770 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_04000 53094 53930 gene locus_tag LOCUS_04010 53094 53930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 55126 54392 gene locus_tag LOCUS_04020 55126 54392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 55986 55201 gene locus_tag LOCUS_04030 55986 55201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 56043 56564 gene locus_tag LOCUS_04040 56043 56564 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257723.1 protein_id gnl|my_center|LOCUS_04040 56604 56996 gene locus_tag LOCUS_04050 56604 56996 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_04050 57842 57054 gene locus_tag LOCUS_04060 57842 57054 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_04060 58650 57847 gene locus_tag LOCUS_04070 58650 57847 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_04070 59718 58717 gene locus_tag LOCUS_04080 59718 58717 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_04080 60755 59715 gene locus_tag LOCUS_04090 60755 59715 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_04090 60871 62007 gene locus_tag LOCUS_04100 60871 62007 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_04100 62037 62246 gene locus_tag LOCUS_04110 62037 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 63378 62269 gene locus_tag LOCUS_04120 63378 62269 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405064.1 protein_id gnl|my_center|LOCUS_04120 63707 63426 gene locus_tag LOCUS_04130 63707 63426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 64039 63965 gene locus_tag LOCUS_t00070 64039 63965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65043 64108 gene locus_tag LOCUS_04140 gene mdh 65043 64108 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_04140 65953 65150 gene locus_tag LOCUS_04150 65953 65150 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_04150 <67185 66055 gene locus_tag LOCUS_04160 <67185 66055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977936.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence007 296 697 gene locus_tag LOCUS_04170 296 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 764 988 gene locus_tag LOCUS_04180 764 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2498 1011 gene locus_tag LOCUS_04190 2498 1011 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_04190 2694 3470 gene locus_tag LOCUS_04200 2694 3470 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_04200 3583 4032 gene locus_tag LOCUS_04210 3583 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4069 4485 gene locus_tag LOCUS_04220 4069 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5263 4529 gene locus_tag LOCUS_04230 5263 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5486 5767 gene locus_tag LOCUS_04240 5486 5767 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_04240 6217 5873 gene locus_tag LOCUS_04250 6217 5873 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_04250 6582 6274 gene locus_tag LOCUS_04260 6582 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6756 7592 gene locus_tag LOCUS_04270 6756 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 7720 8346 gene locus_tag LOCUS_04280 7720 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 9332 8370 gene locus_tag LOCUS_04290 9332 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9802 9329 gene locus_tag LOCUS_04300 9802 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9979 10449 gene locus_tag LOCUS_04310 9979 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 10463 10954 gene locus_tag LOCUS_04320 10463 10954 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_04320 10987 12048 gene locus_tag LOCUS_04330 gene acoA 10987 12048 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921304.1 protein_id gnl|my_center|LOCUS_04330 12168 13139 gene locus_tag LOCUS_04340 12168 13139 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_04340 13142 14599 gene locus_tag LOCUS_04350 13142 14599 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257843.1 protein_id gnl|my_center|LOCUS_04350 14610 15362 gene locus_tag LOCUS_04360 14610 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 15359 16090 gene locus_tag LOCUS_04370 gene rsmG 15359 16090 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_04370 18619 16178 gene locus_tag LOCUS_04380 18619 16178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 19376 18801 gene locus_tag LOCUS_04390 19376 18801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20026 19373 gene locus_tag LOCUS_04400 20026 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 21386 20145 gene locus_tag LOCUS_04410 gene recF 21386 20145 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_04410 22407 21508 gene locus_tag LOCUS_04420 gene garR 22407 21508 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_04420 23143 22493 gene locus_tag LOCUS_04430 23143 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 23499 24830 gene locus_tag LOCUS_04440 gene murD 23499 24830 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_04440 25573 24845 gene locus_tag LOCUS_04450 gene rph 25573 24845 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_04450 27281 25638 gene locus_tag LOCUS_04460 27281 25638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_04460 28069 27368 gene locus_tag LOCUS_04470 gene dcd 28069 27368 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_04470 28274 31480 gene locus_tag LOCUS_04480 28274 31480 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_04480 31571 32524 gene locus_tag LOCUS_04490 31571 32524 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_04490 32596 33504 gene locus_tag LOCUS_04500 32596 33504 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_04500 33549 35003 gene locus_tag LOCUS_04510 33549 35003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 35000 35929 gene locus_tag LOCUS_04520 35000 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 36000 38315 gene locus_tag LOCUS_04530 36000 38315 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_04530 38319 39254 gene locus_tag LOCUS_04540 38319 39254 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_04540 39247 40197 gene locus_tag LOCUS_04550 39247 40197 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_04550 40893 40288 gene locus_tag LOCUS_04560 40893 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 41665 41057 gene locus_tag LOCUS_04570 41665 41057 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_04570 41782 41708 gene locus_tag LOCUS_t00080 41782 41708 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42345 41848 gene locus_tag LOCUS_04580 42345 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 44268 42394 gene locus_tag LOCUS_04590 44268 42394 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_04590 44567 44265 gene locus_tag LOCUS_04600 44567 44265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 44697 47921 gene locus_tag LOCUS_04610 gene ileS 44697 47921 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_04610 48709 47960 gene locus_tag LOCUS_04620 48709 47960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_04620 49536 48709 gene locus_tag LOCUS_04630 49536 48709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_04630 50774 49533 gene locus_tag LOCUS_04640 50774 49533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039587.1 protein_id gnl|my_center|LOCUS_04640 51792 50833 gene locus_tag LOCUS_04650 51792 50833 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_04650 53239 51983 gene locus_tag LOCUS_04660 53239 51983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 53468 54181 gene locus_tag LOCUS_04670 gene yycF 53468 54181 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 protein_id gnl|my_center|LOCUS_04670 54254 54327 gene locus_tag LOCUS_t00090 54254 54327 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54405 54479 gene locus_tag LOCUS_t00100 54405 54479 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 55293 54499 gene locus_tag LOCUS_04680 55293 54499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889428.1 protein_id gnl|my_center|LOCUS_04680 56071 55367 gene locus_tag LOCUS_04690 gene modA 56071 55367 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_04690 57329 56229 gene locus_tag LOCUS_04700 57329 56229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 57883 58980 gene locus_tag LOCUS_04710 57883 58980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 59074 59457 gene locus_tag LOCUS_04720 59074 59457 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_04720 59467 61002 gene locus_tag LOCUS_04730 59467 61002 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_04730 61197 62504 gene locus_tag LOCUS_04740 61197 62504 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_04740 62700 63704 gene locus_tag LOCUS_04750 gene ychF 62700 63704 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_04750 63708 64271 gene locus_tag LOCUS_04760 63708 64271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 65229 64942 gene locus_tag LOCUS_04770 65229 64942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence008 429 1031 gene locus_tag LOCUS_04780 gene coaD 429 1031 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_04780 1145 1630 gene locus_tag LOCUS_04790 1145 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1724 2287 gene locus_tag LOCUS_04800 1724 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2669 3670 gene locus_tag LOCUS_04810 gene fabD 2669 3670 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_04810 3760 4515 gene locus_tag LOCUS_04820 gene fabG 3760 4515 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_04820 4532 5884 gene locus_tag LOCUS_04830 gene accC 4532 5884 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583402.1 protein_id gnl|my_center|LOCUS_04830 5958 6569 gene locus_tag LOCUS_04840 5958 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 6627 7598 gene locus_tag LOCUS_04850 6627 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7598 8329 gene locus_tag LOCUS_04860 7598 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 9048 8449 gene locus_tag LOCUS_04870 9048 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10147 9206 gene locus_tag LOCUS_04880 10147 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 10997 10182 gene locus_tag LOCUS_04890 10997 10182 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331316.1 protein_id gnl|my_center|LOCUS_04890 12143 11136 gene locus_tag LOCUS_04900 12143 11136 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762883.1 protein_id gnl|my_center|LOCUS_04900 15725 12396 gene locus_tag LOCUS_04910 gene carB 15725 12396 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_04910 16983 15739 gene locus_tag LOCUS_04920 gene carA 16983 15739 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_04920 17164 16970 gene locus_tag LOCUS_04930 17164 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17693 17148 gene locus_tag LOCUS_04940 17693 17148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17602 18447 gene locus_tag LOCUS_04950 17602 18447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 19497 18526 gene locus_tag LOCUS_04960 19497 18526 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_04960 20143 19547 gene locus_tag LOCUS_04970 gene pyrR 20143 19547 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_04970 21117 20398 gene locus_tag LOCUS_04980 21117 20398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_04980 21865 21140 gene locus_tag LOCUS_04990 21865 21140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_04990 22895 21882 gene locus_tag LOCUS_05000 22895 21882 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807650.1 protein_id gnl|my_center|LOCUS_05000 23762 22902 gene locus_tag LOCUS_05010 23762 22902 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_05010 25078 23831 gene locus_tag LOCUS_05020 25078 23831 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_05020 25322 26308 gene locus_tag LOCUS_05030 25322 26308 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970281.1 protein_id gnl|my_center|LOCUS_05030 27007 26357 gene locus_tag LOCUS_05040 27007 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 29478 27058 gene locus_tag LOCUS_05050 29478 27058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 31632 29977 gene locus_tag LOCUS_05060 31632 29977 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_05060 31932 33074 gene locus_tag LOCUS_05070 31932 33074 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_05070 33052 34554 gene locus_tag LOCUS_05080 33052 34554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 34670 35221 gene locus_tag LOCUS_05090 34670 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 35401 35649 gene locus_tag LOCUS_05100 35401 35649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 36646 35765 gene locus_tag LOCUS_05110 36646 35765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680928.1 protein_id gnl|my_center|LOCUS_05110 37090 37554 gene locus_tag LOCUS_05120 37090 37554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05120 37551 38105 gene locus_tag LOCUS_05130 37551 38105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05130 39537 38194 gene locus_tag LOCUS_05140 39537 38194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 41446 39593 gene locus_tag LOCUS_05150 41446 39593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 41771 42493 gene locus_tag LOCUS_05160 41771 42493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258497.1 protein_id gnl|my_center|LOCUS_05160 42635 42787 gene locus_tag LOCUS_05170 42635 42787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 44640 42784 gene locus_tag LOCUS_05180 44640 42784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 45397 44690 gene locus_tag LOCUS_05190 45397 44690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_05190 45586 46107 gene locus_tag LOCUS_05200 45586 46107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 46252 46542 gene locus_tag LOCUS_05210 46252 46542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 46698 47942 gene locus_tag LOCUS_05220 46698 47942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 47974 48246 gene locus_tag LOCUS_05230 47974 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 48363 49136 gene locus_tag LOCUS_05240 48363 49136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_05240 49159 50421 gene locus_tag LOCUS_05250 49159 50421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_05250 51116 51466 gene locus_tag LOCUS_05260 51116 51466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 51494 52087 gene locus_tag LOCUS_05270 51494 52087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 53590 52121 gene locus_tag LOCUS_05280 gene galK 53590 52121 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053411.1 protein_id gnl|my_center|LOCUS_05280 54510 53587 gene locus_tag LOCUS_05290 gene prmC 54510 53587 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_05290 55593 54520 gene locus_tag LOCUS_05300 gene prfA 55593 54520 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_05300 55933 55721 gene locus_tag LOCUS_05310 55933 55721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 57094 56012 gene locus_tag LOCUS_05320 57094 56012 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089091.1 protein_id gnl|my_center|LOCUS_05320 57229 58551 gene locus_tag LOCUS_05330 gene moeA 57229 58551 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_05330 58679 58948 gene locus_tag LOCUS_05340 gene rpsO 58679 58948 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_05340 59102 61444 gene locus_tag LOCUS_05350 gene pnp 59102 61444 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_05350 61585 62433 gene locus_tag LOCUS_05360 gene dapB 61585 62433 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_05360 62452 63393 gene locus_tag LOCUS_05370 gene dapA 62452 63393 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_05370 63417 63956 gene locus_tag LOCUS_05380 63417 63956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 64249 64001 gene locus_tag LOCUS_05390 64249 64001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 64748 64305 gene locus_tag LOCUS_05400 64748 64305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 64901 65248 gene locus_tag LOCUS_05410 64901 65248 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence009 13 1302 gene locus_tag LOCUS_05420 13 1302 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_05420 2006 1473 gene locus_tag LOCUS_05430 2006 1473 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_05430 3604 2378 gene locus_tag LOCUS_05440 3604 2378 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583724.1 protein_id gnl|my_center|LOCUS_05440 3770 4525 gene locus_tag LOCUS_05450 3770 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4522 4998 gene locus_tag LOCUS_05460 4522 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5200 6057 gene locus_tag LOCUS_05470 5200 6057 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_05470 7111 6572 gene locus_tag LOCUS_05480 7111 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7058 7552 gene locus_tag LOCUS_05490 7058 7552 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_05490 7723 8856 gene locus_tag LOCUS_05500 7723 8856 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_05500 10029 8992 gene locus_tag LOCUS_05510 10029 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10078 11349 gene locus_tag LOCUS_05520 10078 11349 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_05520 12795 11338 gene locus_tag LOCUS_05530 12795 11338 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_05530 12975 13493 gene locus_tag LOCUS_05540 12975 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13402 14028 gene locus_tag LOCUS_05550 13402 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 15256 14081 gene locus_tag LOCUS_05560 gene dapD 15256 14081 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_05560 16535 15297 gene locus_tag LOCUS_05570 gene dapC 16535 15297 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_05570 17402 16566 gene locus_tag LOCUS_05580 gene recO 17402 16566 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_05580 17870 17439 gene locus_tag LOCUS_05590 17870 17439 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_05590 19316 17877 gene locus_tag LOCUS_05600 19316 17877 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_05600 20399 19374 gene locus_tag LOCUS_05610 20399 19374 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_05610 21615 20509 gene locus_tag LOCUS_05620 21615 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 21766 21693 gene locus_tag LOCUS_t00110 21766 21693 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22750 21833 gene locus_tag LOCUS_05630 gene ispE 22750 21833 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_05630 22858 23682 gene locus_tag LOCUS_05640 22858 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 24181 23690 gene locus_tag LOCUS_05650 24181 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 24713 24186 gene locus_tag LOCUS_05660 24713 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 26913 24715 gene locus_tag LOCUS_05670 26913 24715 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909087.1 protein_id gnl|my_center|LOCUS_05670 27422 27072 gene locus_tag LOCUS_05680 27422 27072 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_05680 28201 27467 gene locus_tag LOCUS_05690 28201 27467 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144364.1 protein_id gnl|my_center|LOCUS_05690 29224 28235 gene locus_tag LOCUS_05700 29224 28235 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_05700 30461 29229 gene locus_tag LOCUS_05710 gene dnaJ 30461 29229 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_05710 32346 30466 gene locus_tag LOCUS_05720 gene dnaK 32346 30466 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_05720 32970 32356 gene locus_tag LOCUS_05730 gene grpE 32970 32356 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_05730 34108 32960 gene locus_tag LOCUS_05740 gene hrcA 34108 32960 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_05740 35923 34253 gene locus_tag LOCUS_05750 35923 34253 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_05750 36966 35980 gene locus_tag LOCUS_05760 36966 35980 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_05760 39260 36966 gene locus_tag LOCUS_05770 39260 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 40423 39257 gene locus_tag LOCUS_05780 40423 39257 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_05780 41820 40420 gene locus_tag LOCUS_05790 41820 40420 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268349.1 protein_id gnl|my_center|LOCUS_05790 42391 42062 gene locus_tag LOCUS_05800 42391 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 43261 42446 gene locus_tag LOCUS_05810 gene proC 43261 42446 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_05810 43462 44595 gene locus_tag LOCUS_05820 gene dgoD 43462 44595 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_05820 44689 45897 gene locus_tag LOCUS_05830 44689 45897 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_05830 46378 45929 gene locus_tag LOCUS_05840 46378 45929 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_05840 46478 47092 gene locus_tag LOCUS_05850 46478 47092 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_05850 47092 47781 gene locus_tag LOCUS_05860 47092 47781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 47824 48750 gene locus_tag LOCUS_05870 47824 48750 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_05870 49692 48769 gene locus_tag LOCUS_05880 49692 48769 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_05880 50875 49730 gene locus_tag LOCUS_05890 50875 49730 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_05890 52014 51034 gene locus_tag LOCUS_05900 gene xerD 52014 51034 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_05900 53399 52143 gene locus_tag LOCUS_05910 53399 52143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_05910 54340 53420 gene locus_tag LOCUS_05920 54340 53420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 55287 54490 gene locus_tag LOCUS_05930 55287 54490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 55361 55945 gene locus_tag LOCUS_05940 55361 55945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 58786 55826 gene locus_tag LOCUS_05950 58786 55826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 58889 59707 gene locus_tag LOCUS_05960 58889 59707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 59715 62231 gene locus_tag LOCUS_05970 59715 62231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 62346 63152 gene locus_tag LOCUS_05980 62346 63152 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085046.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence010 1912 626 gene locus_tag LOCUS_05990 1912 626 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_05990 2591 2184 gene locus_tag LOCUS_06000 2591 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4021 2840 gene locus_tag LOCUS_06010 4021 2840 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391323.1 protein_id gnl|my_center|LOCUS_06010 4270 5700 gene locus_tag LOCUS_06020 4270 5700 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_06020 5706 6581 gene locus_tag LOCUS_06030 5706 6581 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 protein_id gnl|my_center|LOCUS_06030 7012 8025 gene locus_tag LOCUS_06040 gene gap 7012 8025 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_06040 8198 9406 gene locus_tag LOCUS_06050 8198 9406 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_06050 9459 10232 gene locus_tag LOCUS_06060 gene tpiA 9459 10232 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_06060 10292 10516 gene locus_tag LOCUS_06070 10292 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10573 12186 gene locus_tag LOCUS_06080 10573 12186 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_06080 12187 13098 gene locus_tag LOCUS_06090 12187 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 13987 13178 gene locus_tag LOCUS_06100 13987 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 14300 14524 gene locus_tag LOCUS_06110 14300 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 15414 14677 gene locus_tag LOCUS_06120 15414 14677 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_06120 16123 15407 gene locus_tag LOCUS_06130 gene cmk 16123 15407 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_06130 16935 16120 gene locus_tag LOCUS_06140 16935 16120 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_06140 17310 18428 gene locus_tag LOCUS_06150 gene mvk 17310 18428 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_06150 18611 19480 gene locus_tag LOCUS_06160 18611 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19534 20739 gene locus_tag LOCUS_06170 gene ugpC 19534 20739 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392455.1 protein_id gnl|my_center|LOCUS_06170 20886 21986 gene locus_tag LOCUS_06180 gene nusA 20886 21986 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_06180 22216 22608 gene locus_tag LOCUS_06190 22216 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 22709 24667 gene locus_tag LOCUS_06200 22709 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 24853 25365 gene locus_tag LOCUS_06210 24853 25365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 26572 25505 gene locus_tag LOCUS_06220 26572 25505 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_06220 27720 26725 gene locus_tag LOCUS_06230 gene truB 27720 26725 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_06230 29301 27997 gene locus_tag LOCUS_06240 gene tyrS 29301 27997 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_06240 29261 29434 gene locus_tag LOCUS_06250 29261 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 30014 32278 gene locus_tag LOCUS_06260 30014 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 32331 33506 gene locus_tag LOCUS_06270 gene proB 32331 33506 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_06270 33904 36138 gene locus_tag LOCUS_06280 33904 36138 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_06280 36614 36294 gene locus_tag LOCUS_06290 36614 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 37163 36795 gene locus_tag LOCUS_06300 37163 36795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 37859 37290 gene locus_tag LOCUS_06310 37859 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 39294 38116 gene locus_tag LOCUS_06320 gene nifS 39294 38116 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_06320 39576 40013 gene locus_tag LOCUS_06330 39576 40013 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_06330 40010 40597 gene locus_tag LOCUS_06340 40010 40597 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_06340 40724 41284 gene locus_tag LOCUS_06350 40724 41284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 41315 42523 gene locus_tag LOCUS_06360 gene nuoD 41315 42523 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_06360 42523 43119 gene locus_tag LOCUS_06370 42523 43119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 43241 44629 gene locus_tag LOCUS_06380 gene nuoF 43241 44629 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_06380 44748 47312 gene locus_tag LOCUS_06390 gene nuoG 44748 47312 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_06390 47312 47479 gene locus_tag LOCUS_06400 47312 47479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 47487 48572 gene locus_tag LOCUS_06410 gene nuoH 47487 48572 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_06410 48678 49196 gene locus_tag LOCUS_06420 gene nuoI 48678 49196 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_06420 49228 49788 gene locus_tag LOCUS_06430 49228 49788 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_06430 49865 50182 gene locus_tag LOCUS_06440 gene nuoK 49865 50182 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416452.1 protein_id gnl|my_center|LOCUS_06440 50203 52182 gene locus_tag LOCUS_06450 gene nuoL 50203 52182 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_06450 52289 53875 gene locus_tag LOCUS_06460 52289 53875 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06460 53910 55412 gene locus_tag LOCUS_06470 53910 55412 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_06470 55540 56526 gene locus_tag LOCUS_06480 gene argF 55540 56526 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_06480 56616 57524 gene locus_tag LOCUS_06490 gene cdaA 56616 57524 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_06490 57530 58756 gene locus_tag LOCUS_06500 57530 58756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 58868 60571 gene locus_tag LOCUS_06510 58868 60571 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_06510 60678 61511 gene locus_tag LOCUS_06520 60678 61511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097732.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence011 666 391 gene locus_tag LOCUS_06530 666 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 919 1116 gene locus_tag LOCUS_06540 919 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1950 1051 gene locus_tag LOCUS_06550 1950 1051 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_06550 2251 3750 gene locus_tag LOCUS_06560 2251 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3747 5291 gene locus_tag LOCUS_06570 3747 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5335 6210 gene locus_tag LOCUS_06580 gene rfbD 5335 6210 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_06580 7220 6177 gene locus_tag LOCUS_06590 7220 6177 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_06590 7550 8728 gene locus_tag LOCUS_06600 7550 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8893 9966 gene locus_tag LOCUS_06610 8893 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9971 10315 gene locus_tag LOCUS_06620 9971 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10760 11236 gene locus_tag LOCUS_06630 gene flgC 10760 11236 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_06630 11327 11695 gene locus_tag LOCUS_06640 11327 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 11864 13618 gene locus_tag LOCUS_06650 gene fliF 11864 13618 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392292.1 protein_id gnl|my_center|LOCUS_06650 13782 14855 gene locus_tag LOCUS_06660 gene fliG 13782 14855 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_06660 14859 15695 gene locus_tag LOCUS_06670 14859 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 15692 17074 gene locus_tag LOCUS_06680 gene fliI 15692 17074 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_06680 17101 17613 gene locus_tag LOCUS_06690 gene fliJ 17101 17613 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392296.1 protein_id gnl|my_center|LOCUS_06690 17613 18257 gene locus_tag LOCUS_06700 17613 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 18277 18708 gene locus_tag LOCUS_06710 gene flgB 18277 18708 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_06710 19642 21903 gene locus_tag LOCUS_06720 19642 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 21932 22516 gene locus_tag LOCUS_06730 21932 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 22575 23069 gene locus_tag LOCUS_06740 22575 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 23258 24967 gene locus_tag LOCUS_06750 23258 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 25165 25857 gene locus_tag LOCUS_06760 25165 25857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 25978 28170 gene locus_tag LOCUS_06770 25978 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 28267 28623 gene locus_tag LOCUS_06780 28267 28623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 28670 29947 gene locus_tag LOCUS_06790 28670 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 30079 30507 gene locus_tag LOCUS_06800 30079 30507 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721753.1 protein_id gnl|my_center|LOCUS_06800 30529 31473 gene locus_tag LOCUS_06810 30529 31473 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_06810 31672 31950 gene locus_tag LOCUS_06820 31672 31950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 31987 32517 gene locus_tag LOCUS_06830 31987 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 33416 32616 gene locus_tag LOCUS_06840 33416 32616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 34611 33526 gene locus_tag LOCUS_06850 34611 33526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 35330 34608 gene locus_tag LOCUS_06860 35330 34608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 35486 37528 gene locus_tag LOCUS_06870 35486 37528 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259298.1 protein_id gnl|my_center|LOCUS_06870 40390 37631 gene locus_tag LOCUS_06880 gene gyrA 40390 37631 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_06880 41225 40503 gene locus_tag LOCUS_06890 41225 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 41826 41182 gene locus_tag LOCUS_06900 gene moaC 41826 41182 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_06900 46028 41871 gene locus_tag LOCUS_06910 gene gltB 46028 41871 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_06910 45966 46454 gene locus_tag LOCUS_06920 45966 46454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 47469 46927 gene locus_tag LOCUS_06930 47469 46927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 47536 47871 gene locus_tag LOCUS_06940 47536 47871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 49941 47965 gene locus_tag LOCUS_06950 gene acs 49941 47965 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_06950 50193 51323 gene locus_tag LOCUS_06960 50193 51323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 51406 52929 gene locus_tag LOCUS_06970 51406 52929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 52884 53378 gene locus_tag LOCUS_06980 52884 53378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 53468 54160 gene locus_tag LOCUS_06990 gene tmk 53468 54160 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_06990 54601 54173 gene locus_tag LOCUS_07000 54601 54173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 54996 54598 gene locus_tag LOCUS_07010 54996 54598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 56148 55027 gene locus_tag LOCUS_07020 gene dgoD 56148 55027 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_07020 56409 57281 gene locus_tag LOCUS_07030 56409 57281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 57313 58026 gene locus_tag LOCUS_07040 57313 58026 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_07040 58089 59540 gene locus_tag LOCUS_07050 58089 59540 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_07050 59678 59436 gene locus_tag LOCUS_07060 59678 59436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence012 2310 1414 gene locus_tag LOCUS_07070 2310 1414 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259313.1 protein_id gnl|my_center|LOCUS_07070 3395 2376 gene locus_tag LOCUS_07080 3395 2376 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_07080 5148 3484 gene locus_tag LOCUS_07090 5148 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6354 6124 gene locus_tag LOCUS_07100 6354 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6322 6747 gene locus_tag LOCUS_07110 6322 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7442 6744 gene locus_tag LOCUS_07120 7442 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7646 10765 gene locus_tag LOCUS_07130 7646 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10762 13977 gene locus_tag LOCUS_07140 10762 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 14310 16046 gene locus_tag LOCUS_07150 14310 16046 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_07150 16089 16616 gene locus_tag LOCUS_07160 gene ilvN 16089 16616 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_07160 16712 17707 gene locus_tag LOCUS_07170 gene ilvC 16712 17707 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_07170 17812 19410 gene locus_tag LOCUS_07180 17812 19410 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142287.1 protein_id gnl|my_center|LOCUS_07180 19449 20864 gene locus_tag LOCUS_07190 gene leuC 19449 20864 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_07190 20901 21518 gene locus_tag LOCUS_07200 gene leuD 20901 21518 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_07200 21560 22738 gene locus_tag LOCUS_07210 gene leuB 21560 22738 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_07210 22920 24503 gene locus_tag LOCUS_07220 gene cimA 22920 24503 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_07220 24802 24593 gene locus_tag LOCUS_07230 24802 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 25330 24839 gene locus_tag LOCUS_07240 25330 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07240 25532 26926 gene locus_tag LOCUS_07250 gene tig 25532 26926 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_07250 27014 27655 gene locus_tag LOCUS_07260 gene clpP 27014 27655 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_07260 27833 29113 gene locus_tag LOCUS_07270 gene clpX 27833 29113 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_07270 30454 29192 gene locus_tag LOCUS_07280 gene nadA 30454 29192 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858544.1 protein_id gnl|my_center|LOCUS_07280 30652 31155 gene locus_tag LOCUS_07290 30652 31155 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_07290 32083 31178 gene locus_tag LOCUS_07300 32083 31178 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938520.1 protein_id gnl|my_center|LOCUS_07300 32157 32492 gene locus_tag LOCUS_07310 32157 32492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 32660 33466 gene locus_tag LOCUS_07320 32660 33466 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_07320 33912 34394 gene locus_tag LOCUS_07330 33912 34394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 34860 36686 gene locus_tag LOCUS_07340 gene thrS 34860 36686 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_07340 36951 39494 gene locus_tag LOCUS_07350 36951 39494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 40505 39579 gene locus_tag LOCUS_07360 gene rbsK 40505 39579 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_07360 40536 40889 gene locus_tag LOCUS_07370 40536 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 40968 41321 gene locus_tag LOCUS_07380 gene rplT 40968 41321 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_07380 41428 42318 gene locus_tag LOCUS_07390 41428 42318 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_07390 42315 43364 gene locus_tag LOCUS_07400 gene pheS 42315 43364 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_07400 43483 46011 gene locus_tag LOCUS_07410 gene pheT 43483 46011 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_07410 47007 46075 gene locus_tag LOCUS_07420 47007 46075 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_07420 47819 47004 gene locus_tag LOCUS_07430 47819 47004 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380364.1 protein_id gnl|my_center|LOCUS_07430 49510 48089 gene locus_tag LOCUS_07440 49510 48089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 49706 51085 gene locus_tag LOCUS_07450 49706 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 51862 51206 gene locus_tag LOCUS_07460 51862 51206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 52965 51955 gene locus_tag LOCUS_07470 gene galE 52965 51955 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_07470 53156 53231 gene locus_tag LOCUS_t00120 53156 53231 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 54390 53392 gene locus_tag LOCUS_07480 54390 53392 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_07480 54808 55032 gene locus_tag LOCUS_07490 54808 55032 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583957.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence013 276 1904 gene locus_tag LOCUS_07500 276 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5268 1849 gene locus_tag LOCUS_07510 5268 1849 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_07510 8876 5277 gene locus_tag LOCUS_07520 8876 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9571 9086 gene locus_tag LOCUS_07530 9571 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 12573 9868 gene locus_tag LOCUS_07540 12573 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 16252 12674 gene locus_tag LOCUS_07550 16252 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16852 18195 gene locus_tag LOCUS_07560 16852 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 18361 19209 gene locus_tag LOCUS_07570 18361 19209 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_07570 19517 19227 gene locus_tag LOCUS_07580 19517 19227 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_07580 19722 20027 gene locus_tag LOCUS_07590 19722 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 20024 20755 gene locus_tag LOCUS_07600 gene rnc 20024 20755 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_07600 21100 23406 gene locus_tag LOCUS_07610 21100 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 23721 24947 gene locus_tag LOCUS_07620 23721 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 26600 24993 gene locus_tag LOCUS_07630 26600 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 27451 26678 gene locus_tag LOCUS_07640 27451 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 28363 27464 gene locus_tag LOCUS_07650 gene ftsX 28363 27464 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_07650 29615 28539 gene locus_tag LOCUS_07660 gene prfB 29615 28539 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_07660 29907 31847 gene locus_tag LOCUS_07670 29907 31847 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_07670 31966 32457 gene locus_tag LOCUS_07680 31966 32457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884048.1 protein_id gnl|my_center|LOCUS_07680 32486 33589 gene locus_tag LOCUS_07690 32486 33589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884049.1 protein_id gnl|my_center|LOCUS_07690 33766 34866 gene locus_tag LOCUS_07700 33766 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_07700 35020 35997 gene locus_tag LOCUS_07710 35020 35997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 36023 37315 gene locus_tag LOCUS_07720 36023 37315 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_07720 37750 37424 gene locus_tag LOCUS_07730 37750 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 39561 37966 gene locus_tag LOCUS_07740 39561 37966 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_07740 40866 39799 gene locus_tag LOCUS_07750 40866 39799 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_07750 40996 42006 gene locus_tag LOCUS_07760 40996 42006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 42032 42349 gene locus_tag LOCUS_07770 42032 42349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42346 43851 gene locus_tag LOCUS_07780 42346 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 43945 45213 gene locus_tag LOCUS_07790 43945 45213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 45968 45147 gene locus_tag LOCUS_07800 45968 45147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 46142 47356 gene locus_tag LOCUS_07810 46142 47356 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_07810 47523 48317 gene locus_tag LOCUS_07820 47523 48317 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_07820 48439 49209 gene locus_tag LOCUS_07830 48439 49209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 49434 49655 gene locus_tag LOCUS_07840 49434 49655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 50103 49897 gene locus_tag LOCUS_07850 50103 49897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 50042 51490 gene locus_tag LOCUS_07860 50042 51490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 51862 51545 gene locus_tag LOCUS_07870 51862 51545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 52300 54087 gene locus_tag LOCUS_07880 52300 54087 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258639.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence014 1633 284 gene locus_tag LOCUS_07890 1633 284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929215.1 protein_id gnl|my_center|LOCUS_07890 1563 1916 gene locus_tag LOCUS_07900 1563 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3131 1812 gene locus_tag LOCUS_07910 3131 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3684 3433 gene locus_tag LOCUS_07920 3684 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07920 4000 3581 gene locus_tag LOCUS_07930 4000 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07930 5196 4024 gene locus_tag LOCUS_07940 5196 4024 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_07940 5650 5970 gene locus_tag LOCUS_07950 5650 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6456 6187 gene locus_tag LOCUS_07960 6456 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8109 6523 gene locus_tag LOCUS_07970 8109 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9227 8106 gene locus_tag LOCUS_07980 gene urtC 9227 8106 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_07980 10124 9228 gene locus_tag LOCUS_07990 gene urtB 10124 9228 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_07990 11794 10337 gene locus_tag LOCUS_08000 11794 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 12152 12454 gene locus_tag LOCUS_08010 12152 12454 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729214.1 protein_id gnl|my_center|LOCUS_08010 12773 13108 gene locus_tag LOCUS_08020 12773 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 13135 14853 gene locus_tag LOCUS_08030 gene ureC 13135 14853 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969961.1 protein_id gnl|my_center|LOCUS_08030 15363 14929 gene locus_tag LOCUS_08040 15363 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15408 16097 gene locus_tag LOCUS_08050 gene ureE 15408 16097 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172973.1 protein_id gnl|my_center|LOCUS_08050 16137 16871 gene locus_tag LOCUS_08060 16137 16871 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 protein_id gnl|my_center|LOCUS_08060 16911 17597 gene locus_tag LOCUS_08070 gene ureG 16911 17597 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212232.1 protein_id gnl|my_center|LOCUS_08070 17881 18726 gene locus_tag LOCUS_08080 17881 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 19424 18807 gene locus_tag LOCUS_08090 19424 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 20623 19490 gene locus_tag LOCUS_08100 20623 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 21192 22040 gene locus_tag LOCUS_08110 gene hag 21192 22040 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_08110 22217 23284 gene locus_tag LOCUS_08120 22217 23284 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_08120 23338 24849 gene locus_tag LOCUS_08130 23338 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 24912 25934 gene locus_tag LOCUS_08140 24912 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 25938 27392 gene locus_tag LOCUS_08150 25938 27392 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_08150 27678 27469 gene locus_tag LOCUS_08160 27678 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 28129 27731 gene locus_tag LOCUS_08170 28129 27731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 28549 28202 gene locus_tag LOCUS_08180 28549 28202 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_08180 28913 28608 gene locus_tag LOCUS_08190 28913 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 29345 29752 gene locus_tag LOCUS_08200 29345 29752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 31121 29919 gene locus_tag LOCUS_08210 31121 29919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 31926 32390 gene locus_tag LOCUS_08220 31926 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 32560 33021 gene locus_tag LOCUS_08230 32560 33021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 33921 33718 gene locus_tag LOCUS_08240 33921 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 35041 34097 gene locus_tag LOCUS_08250 35041 34097 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_08250 36310 35144 gene locus_tag LOCUS_08260 36310 35144 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_08260 36766 36488 gene locus_tag LOCUS_08270 36766 36488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37638 37462 gene locus_tag LOCUS_08280 37638 37462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 38575 37811 gene locus_tag LOCUS_08290 38575 37811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_08290 39374 38667 gene locus_tag LOCUS_08300 39374 38667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 40814 39822 gene locus_tag LOCUS_08310 40814 39822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 41771 41025 gene locus_tag LOCUS_08320 41771 41025 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_08320 42594 41833 gene locus_tag LOCUS_08330 42594 41833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 43552 42662 gene locus_tag LOCUS_08340 43552 42662 CDS product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966325.1 protein_id gnl|my_center|LOCUS_08340 44711 43539 gene locus_tag LOCUS_08350 44711 43539 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_08350 46300 44792 gene locus_tag LOCUS_08360 46300 44792 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_08360 47631 46384 gene locus_tag LOCUS_08370 47631 46384 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_08370 47762 48889 gene locus_tag LOCUS_08380 47762 48889 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_08380 49375 49127 gene locus_tag LOCUS_08390 49375 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 49654 50712 gene locus_tag LOCUS_08400 49654 50712 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_08400 50832 51698 gene locus_tag LOCUS_08410 50832 51698 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258778.1 protein_id gnl|my_center|LOCUS_08410 51829 54171 gene locus_tag LOCUS_08420 51829 54171 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence015 2296 1448 gene locus_tag LOCUS_08430 gene lgt 2296 1448 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_08430 2427 3185 gene locus_tag LOCUS_08440 2427 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3247 4224 gene locus_tag LOCUS_08450 3247 4224 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_08450 4512 4267 gene locus_tag LOCUS_08460 4512 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 5566 4610 gene locus_tag LOCUS_08470 5566 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 6623 5643 gene locus_tag LOCUS_08480 gene ftsY 6623 5643 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_08480 7450 6716 gene locus_tag LOCUS_08490 7450 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7945 8634 gene locus_tag LOCUS_08500 7945 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 9688 8756 gene locus_tag LOCUS_08510 9688 8756 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_08510 9880 11028 gene locus_tag LOCUS_08520 gene mnmA 9880 11028 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_08520 11025 11510 gene locus_tag LOCUS_08530 11025 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11602 12351 gene locus_tag LOCUS_08540 11602 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 13103 12348 gene locus_tag LOCUS_08550 13103 12348 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_08550 13321 14190 gene locus_tag LOCUS_08560 13321 14190 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_08560 14239 14733 gene locus_tag LOCUS_08570 14239 14733 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_08570 14767 17244 gene locus_tag LOCUS_08580 14767 17244 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_08580 17469 18182 gene locus_tag LOCUS_08590 17469 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 20940 18289 gene locus_tag LOCUS_08600 20940 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 21439 21128 gene locus_tag LOCUS_08610 21439 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 21979 23370 gene locus_tag LOCUS_08620 21979 23370 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_08620 23373 24176 gene locus_tag LOCUS_08630 23373 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257264.1 protein_id gnl|my_center|LOCUS_08630 24939 24184 gene locus_tag LOCUS_08640 24939 24184 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909121.1 protein_id gnl|my_center|LOCUS_08640 25683 25078 gene locus_tag LOCUS_08650 gene hisB 25683 25078 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_08650 26315 25680 gene locus_tag LOCUS_08660 26315 25680 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_08660 27643 26390 gene locus_tag LOCUS_08670 27643 26390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 29214 28006 gene locus_tag LOCUS_08680 29214 28006 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 protein_id gnl|my_center|LOCUS_08680 31322 29376 gene locus_tag LOCUS_08690 31322 29376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 31622 32827 gene locus_tag LOCUS_08700 31622 32827 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_08700 33854 32838 gene locus_tag LOCUS_08710 gene fmt 33854 32838 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_08710 34427 33855 gene locus_tag LOCUS_08720 gene def 34427 33855 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_08720 34947 34489 gene locus_tag LOCUS_08730 34947 34489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 34861 35139 gene locus_tag LOCUS_08740 34861 35139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 36853 35330 gene locus_tag LOCUS_08750 gene gltX 36853 35330 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_08750 37155 38372 gene locus_tag LOCUS_08760 37155 38372 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062719.1 protein_id gnl|my_center|LOCUS_08760 38431 39573 gene locus_tag LOCUS_08770 gene sucC 38431 39573 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_08770 39621 40505 gene locus_tag LOCUS_08780 gene sucD 39621 40505 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_08780 40983 40591 gene locus_tag LOCUS_08790 40983 40591 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808431.1 protein_id gnl|my_center|LOCUS_08790 42515 40980 gene locus_tag LOCUS_08800 gene argH 42515 40980 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_08800 43772 42558 gene locus_tag LOCUS_08810 43772 42558 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_08810 44750 43971 gene locus_tag LOCUS_08820 gene argB 44750 43971 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706663.1 protein_id gnl|my_center|LOCUS_08820 46001 44778 gene locus_tag LOCUS_08830 gene argJ 46001 44778 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_08830 48336 46123 gene locus_tag LOCUS_08840 48336 46123 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_08840 49630 48566 gene locus_tag LOCUS_08850 gene hisC 49630 48566 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530940.1 protein_id gnl|my_center|LOCUS_08850 50633 49713 gene locus_tag LOCUS_08860 50633 49713 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 protein_id gnl|my_center|LOCUS_08860 50924 51679 gene locus_tag LOCUS_08870 50924 51679 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_08870 51811 52803 gene locus_tag LOCUS_08880 51811 52803 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence016 1608 736 gene locus_tag LOCUS_08890 1608 736 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_08890 2026 1664 gene locus_tag LOCUS_08900 2026 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1928 2188 gene locus_tag LOCUS_08910 1928 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2337 3689 gene locus_tag LOCUS_08920 2337 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3794 5089 gene locus_tag LOCUS_08930 3794 5089 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_08930 5089 6330 gene locus_tag LOCUS_08940 5089 6330 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_08940 6618 7316 gene locus_tag LOCUS_08950 6618 7316 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546179.1 protein_id gnl|my_center|LOCUS_08950 7372 8484 gene locus_tag LOCUS_08960 7372 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8594 9109 gene locus_tag LOCUS_08970 8594 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9146 10051 gene locus_tag LOCUS_08980 9146 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10929 10222 gene locus_tag LOCUS_08990 10929 10222 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258171.1 protein_id gnl|my_center|LOCUS_08990 12408 11074 gene locus_tag LOCUS_09000 12408 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257592.1 protein_id gnl|my_center|LOCUS_09000 13024 12491 gene locus_tag LOCUS_09010 13024 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13816 13034 gene locus_tag LOCUS_09020 13816 13034 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_09020 14034 14717 gene locus_tag LOCUS_09030 14034 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14761 16032 gene locus_tag LOCUS_09040 gene serS 14761 16032 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_09040 16482 16096 gene locus_tag LOCUS_09050 16482 16096 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_09050 17156 16509 gene locus_tag LOCUS_09060 17156 16509 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_09060 17597 17884 gene locus_tag LOCUS_09070 17597 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 18013 18585 gene locus_tag LOCUS_09080 18013 18585 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_09080 18623 19120 gene locus_tag LOCUS_09090 gene smpB 18623 19120 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_09090 19691 20605 gene locus_tag LOCUS_09100 19691 20605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 protein_id gnl|my_center|LOCUS_09100 20654 21115 gene locus_tag LOCUS_09110 20654 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 21097 21285 gene locus_tag LOCUS_09120 21097 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 22886 21888 gene locus_tag LOCUS_09130 22886 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 23089 24435 gene locus_tag LOCUS_09140 23089 24435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_09140 24523 25212 gene locus_tag LOCUS_09150 24523 25212 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 protein_id gnl|my_center|LOCUS_09150 25275 26324 gene locus_tag LOCUS_09160 25275 26324 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_09160 28378 26450 gene locus_tag LOCUS_09170 gene recN 28378 26450 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_09170 32820 28576 gene locus_tag LOCUS_09180 32820 28576 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_09180 33079 33297 gene locus_tag LOCUS_09190 33079 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 33415 34326 gene locus_tag LOCUS_09200 33415 34326 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_09200 34360 36438 gene locus_tag LOCUS_09210 34360 36438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 37621 36455 gene locus_tag LOCUS_09220 37621 36455 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_09220 38502 37618 gene locus_tag LOCUS_09230 38502 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 39601 38612 gene locus_tag LOCUS_09240 39601 38612 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 protein_id gnl|my_center|LOCUS_09240 40530 39598 gene locus_tag LOCUS_09250 gene accD 40530 39598 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_09250 40687 42462 gene locus_tag LOCUS_09260 40687 42462 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_09260 42618 44051 gene locus_tag LOCUS_09270 gene glpK 42618 44051 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_09270 44167 44874 gene locus_tag LOCUS_09280 44167 44874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09280 46428 44926 gene locus_tag LOCUS_09290 gene rimO 46428 44926 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_09290 47504 46545 gene locus_tag LOCUS_09300 47504 46545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 49481 47931 gene locus_tag LOCUS_09310 49481 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 50906 49581 gene locus_tag LOCUS_09320 50906 49581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 50983 51378 gene locus_tag LOCUS_09330 50983 51378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence017 261 860 gene locus_tag LOCUS_09340 261 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 3881 942 gene locus_tag LOCUS_09350 gene mutS 3881 942 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_09350 4933 3884 gene locus_tag LOCUS_09360 gene rseP 4933 3884 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_09360 6376 5084 gene locus_tag LOCUS_09370 gene dxr 6376 5084 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_09370 7475 6414 gene locus_tag LOCUS_09380 7475 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8072 7482 gene locus_tag LOCUS_09390 gene frr 8072 7482 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_09390 8932 8135 gene locus_tag LOCUS_09400 gene pyrH 8932 8135 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_09400 9610 9086 gene locus_tag LOCUS_09410 gene tsf 9610 9086 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_09410 10621 9755 gene locus_tag LOCUS_09420 gene rpsB 10621 9755 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_09420 10813 11316 gene locus_tag LOCUS_09430 10813 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 11760 11356 gene locus_tag LOCUS_09440 11760 11356 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_09440 11828 12682 gene locus_tag LOCUS_09450 gene thyX 11828 12682 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081517.1 protein_id gnl|my_center|LOCUS_09450 14037 12679 gene locus_tag LOCUS_09460 14037 12679 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_09460 15011 14034 gene locus_tag LOCUS_09470 15011 14034 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_09470 15229 15924 gene locus_tag LOCUS_09480 15229 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 16125 17324 gene locus_tag LOCUS_09490 16125 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 17544 17846 gene locus_tag LOCUS_09500 17544 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17905 18429 gene locus_tag LOCUS_09510 17905 18429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180591.1 protein_id gnl|my_center|LOCUS_09510 18664 19863 gene locus_tag LOCUS_09520 18664 19863 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_09520 19895 20950 gene locus_tag LOCUS_09530 19895 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 21917 21726 gene locus_tag LOCUS_09540 21917 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 21966 22430 gene locus_tag LOCUS_09550 21966 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 22486 23916 gene locus_tag LOCUS_09560 22486 23916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 24523 23930 gene locus_tag LOCUS_09570 24523 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 25649 24642 gene locus_tag LOCUS_09580 25649 24642 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876861.1 protein_id gnl|my_center|LOCUS_09580 28210 25832 gene locus_tag LOCUS_09590 28210 25832 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_09590 28721 28212 gene locus_tag LOCUS_09600 28721 28212 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_09600 29599 28721 gene locus_tag LOCUS_09610 29599 28721 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_09610 30120 30794 gene locus_tag LOCUS_09620 30120 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 31869 30865 gene locus_tag LOCUS_09630 31869 30865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_09630 33134 31920 gene locus_tag LOCUS_09640 33134 31920 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_09640 33240 34820 gene locus_tag LOCUS_09650 gene dop 33240 34820 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_09650 34810 35010 gene locus_tag LOCUS_09660 34810 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 35084 36637 gene locus_tag LOCUS_09670 gene pafA 35084 36637 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729397.1 protein_id gnl|my_center|LOCUS_09670 37795 36638 gene locus_tag LOCUS_09680 37795 36638 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_09680 38106 39155 gene locus_tag LOCUS_09690 38106 39155 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645608.1 protein_id gnl|my_center|LOCUS_09690 39282 39767 gene locus_tag LOCUS_09700 39282 39767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 41697 39838 gene locus_tag LOCUS_09710 41697 39838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_09710 43652 41694 gene locus_tag LOCUS_09720 43652 41694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_09720 43969 44385 gene locus_tag LOCUS_09730 43969 44385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 44540 45643 gene locus_tag LOCUS_09740 gene asd 44540 45643 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_09740 46432 46232 gene locus_tag LOCUS_09750 46432 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 46322 46687 gene locus_tag LOCUS_09760 46322 46687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 46764 47474 gene locus_tag LOCUS_09770 46764 47474 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200431.1 protein_id gnl|my_center|LOCUS_09770 47625 50342 gene locus_tag LOCUS_09780 47625 50342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence018 1477 929 gene locus_tag LOCUS_09790 1477 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1361 4753 gene locus_tag LOCUS_09800 gene cydD 1361 4753 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_09800 5196 4918 gene locus_tag LOCUS_09810 5196 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 6655 5528 gene locus_tag LOCUS_09820 6655 5528 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_09820 6763 6957 gene locus_tag LOCUS_09830 6763 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 7669 6950 gene locus_tag LOCUS_09840 7669 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8544 7639 gene locus_tag LOCUS_09850 8544 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 8911 9843 gene locus_tag LOCUS_09860 8911 9843 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_09860 10086 11513 gene locus_tag LOCUS_09870 10086 11513 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258475.1 protein_id gnl|my_center|LOCUS_09870 12776 11631 gene locus_tag LOCUS_09880 12776 11631 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_09880 14385 13291 gene locus_tag LOCUS_09890 14385 13291 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_09890 15814 14372 gene locus_tag LOCUS_09900 15814 14372 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_09900 15732 15965 gene locus_tag LOCUS_09910 15732 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 16089 17453 gene locus_tag LOCUS_09920 16089 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 17666 17902 gene locus_tag LOCUS_09930 17666 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 19648 17918 gene locus_tag LOCUS_09940 19648 17918 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383260.1 protein_id gnl|my_center|LOCUS_09940 23134 19766 gene locus_tag LOCUS_09950 23134 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 23375 24388 gene locus_tag LOCUS_09960 23375 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 24435 25232 gene locus_tag LOCUS_09970 24435 25232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_09970 26909 25470 gene locus_tag LOCUS_09980 26909 25470 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257390.1 protein_id gnl|my_center|LOCUS_09980 27806 27048 gene locus_tag LOCUS_09990 27806 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 29873 27903 gene locus_tag LOCUS_10000 29873 27903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 31344 31003 gene locus_tag LOCUS_10010 31344 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 32959 31577 gene locus_tag LOCUS_10020 32959 31577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 32855 33205 gene locus_tag LOCUS_10030 32855 33205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 34281 33277 gene locus_tag LOCUS_10040 34281 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 34424 35068 gene locus_tag LOCUS_10050 34424 35068 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258950.1 protein_id gnl|my_center|LOCUS_10050 35722 35069 gene locus_tag LOCUS_10060 35722 35069 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_10060 36612 35803 gene locus_tag LOCUS_10070 36612 35803 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_10070 36867 37079 gene locus_tag LOCUS_10080 36867 37079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 37313 38365 gene locus_tag LOCUS_10090 37313 38365 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_10090 38604 40085 gene locus_tag LOCUS_10100 38604 40085 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_10100 40544 42121 gene locus_tag LOCUS_10110 40544 42121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence019 1623 460 gene locus_tag LOCUS_10120 1623 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1937 1689 gene locus_tag LOCUS_10130 1937 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2854 2261 gene locus_tag LOCUS_10140 2854 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3458 2904 gene locus_tag LOCUS_10150 3458 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4570 3695 gene locus_tag LOCUS_10160 4570 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5954 4659 gene locus_tag LOCUS_10170 5954 4659 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_10170 7401 6097 gene locus_tag LOCUS_10180 7401 6097 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084763.1 protein_id gnl|my_center|LOCUS_10180 8681 7575 gene locus_tag LOCUS_10190 gene cax 8681 7575 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_10190 10418 8793 gene locus_tag LOCUS_10200 10418 8793 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_10200 11253 10513 gene locus_tag LOCUS_10210 11253 10513 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_10210 11402 11743 gene locus_tag LOCUS_10220 11402 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12844 11762 gene locus_tag LOCUS_10230 gene ddcP 12844 11762 CDS product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 protein_id gnl|my_center|LOCUS_10230 13188 12973 gene locus_tag LOCUS_10240 13188 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 13126 13851 gene locus_tag LOCUS_10250 13126 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 15017 13965 gene locus_tag LOCUS_10260 15017 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 15319 16086 gene locus_tag LOCUS_10270 15319 16086 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_10270 17034 16192 gene locus_tag LOCUS_10280 17034 16192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_10280 18371 17031 gene locus_tag LOCUS_10290 18371 17031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18501 19511 gene locus_tag LOCUS_10300 18501 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19694 20839 gene locus_tag LOCUS_10310 19694 20839 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_10310 21574 20891 gene locus_tag LOCUS_10320 21574 20891 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_10320 21687 22673 gene locus_tag LOCUS_10330 21687 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 22739 23917 gene locus_tag LOCUS_10340 gene dusB 22739 23917 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_10340 24036 24740 gene locus_tag LOCUS_10350 24036 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_10350 25134 24817 gene locus_tag LOCUS_10360 25134 24817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 25022 26422 gene locus_tag LOCUS_10370 25022 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26531 26770 gene locus_tag LOCUS_10380 26531 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26777 27034 gene locus_tag LOCUS_10390 26777 27034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 27560 27874 gene locus_tag LOCUS_10400 27560 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 28349 29344 gene locus_tag LOCUS_10410 28349 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 30031 29753 gene locus_tag LOCUS_10420 30031 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 30444 36563 gene locus_tag LOCUS_10430 30444 36563 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_10430 36560 39622 gene locus_tag LOCUS_10440 36560 39622 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence020 944 21 gene locus_tag LOCUS_10450 944 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10450 1575 1003 gene locus_tag LOCUS_10460 gene uraD 1575 1003 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_10460 1785 3077 gene locus_tag LOCUS_10470 1785 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3689 3165 gene locus_tag LOCUS_10480 3689 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4244 3738 gene locus_tag LOCUS_10490 gene fliW 4244 3738 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_10490 5532 4348 gene locus_tag LOCUS_10500 5532 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7642 5852 gene locus_tag LOCUS_10510 7642 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 8264 7713 gene locus_tag LOCUS_10520 8264 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8704 8411 gene locus_tag LOCUS_10530 8704 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9710 8895 gene locus_tag LOCUS_10540 gene flgG 9710 8895 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657111.1 protein_id gnl|my_center|LOCUS_10540 10545 9793 gene locus_tag LOCUS_10550 gene flgF 10545 9793 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_10550 11339 10614 gene locus_tag LOCUS_10560 11339 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11701 11336 gene locus_tag LOCUS_10570 11701 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12489 11701 gene locus_tag LOCUS_10580 12489 11701 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_10580 13033 12539 gene locus_tag LOCUS_10590 13033 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 13989 13030 gene locus_tag LOCUS_10600 13989 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 15189 13993 gene locus_tag LOCUS_10610 15189 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 17054 15186 gene locus_tag LOCUS_10620 17054 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 19253 17127 gene locus_tag LOCUS_10630 gene flhA 19253 17127 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_10630 20451 19288 gene locus_tag LOCUS_10640 gene flhB 20451 19288 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_10640 21312 20527 gene locus_tag LOCUS_10650 gene fliR 21312 20527 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_10650 21603 21334 gene locus_tag LOCUS_10660 gene fliQ 21603 21334 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_10660 22524 21775 gene locus_tag LOCUS_10670 gene fliP 22524 21775 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_10670 23401 22643 gene locus_tag LOCUS_10680 23401 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 23883 23467 gene locus_tag LOCUS_10690 23883 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 24943 23897 gene locus_tag LOCUS_10700 gene fliM 24943 23897 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392325.1 protein_id gnl|my_center|LOCUS_10700 25827 25072 gene locus_tag LOCUS_10710 25827 25072 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_10710 26815 25973 gene locus_tag LOCUS_10720 26815 25973 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_10720 27211 27017 gene locus_tag LOCUS_10730 27211 27017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 27996 27256 gene locus_tag LOCUS_10740 27996 27256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_10740 28619 27993 gene locus_tag LOCUS_10750 28619 27993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 29610 28867 gene locus_tag LOCUS_10760 29610 28867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_10760 31553 29613 gene locus_tag LOCUS_10770 31553 29613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 31993 31550 gene locus_tag LOCUS_10780 31993 31550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 31992 32504 gene locus_tag LOCUS_10790 31992 32504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 33103 32561 gene locus_tag LOCUS_10800 33103 32561 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_10800 33478 34503 gene locus_tag LOCUS_10810 gene pdhA 33478 34503 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_10810 34640 35656 gene locus_tag LOCUS_10820 34640 35656 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_10820 35803 37071 gene locus_tag LOCUS_10830 35803 37071 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_10830 37113 38531 gene locus_tag LOCUS_10840 gene lpdA 37113 38531 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_10840 38646 39302 gene locus_tag LOCUS_10850 38646 39302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 39714 40070 gene locus_tag LOCUS_10860 39714 40070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence021 563 1684 gene locus_tag LOCUS_10870 563 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1672 2298 gene locus_tag LOCUS_10880 1672 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2332 3333 gene locus_tag LOCUS_10890 2332 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3324 3728 gene locus_tag LOCUS_10900 3324 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3856 5646 gene locus_tag LOCUS_10910 gene ftsH 3856 5646 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_10910 6130 5711 gene locus_tag LOCUS_10920 6130 5711 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817449.1 protein_id gnl|my_center|LOCUS_10920 6553 6230 gene locus_tag LOCUS_10930 6553 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6838 7377 gene locus_tag LOCUS_10940 6838 7377 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_10940 8152 7481 gene locus_tag LOCUS_10950 8152 7481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_10950 8335 8829 gene locus_tag LOCUS_10960 8335 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 9262 9516 gene locus_tag LOCUS_10970 9262 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 10810 9446 gene locus_tag LOCUS_10980 10810 9446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_10980 11036 12493 gene locus_tag LOCUS_10990 11036 12493 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_10990 12521 13921 gene locus_tag LOCUS_11000 12521 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 14659 13937 gene locus_tag LOCUS_11010 gene yfbR 14659 13937 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_11010 15662 14607 gene locus_tag LOCUS_11020 15662 14607 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_11020 16738 15659 gene locus_tag LOCUS_11030 gene rfbB 16738 15659 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_11030 17377 18609 gene locus_tag LOCUS_11040 17377 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 18778 20061 gene locus_tag LOCUS_11050 18778 20061 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706694.1 protein_id gnl|my_center|LOCUS_11050 20352 21545 gene locus_tag LOCUS_11060 20352 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 21538 22254 gene locus_tag LOCUS_11070 gene udk 21538 22254 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172663.1 protein_id gnl|my_center|LOCUS_11070 23740 22376 gene locus_tag LOCUS_11080 gene purB 23740 22376 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423756.1 protein_id gnl|my_center|LOCUS_11080 24167 23820 gene locus_tag LOCUS_11090 24167 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 protein_id gnl|my_center|LOCUS_11090 25476 24484 gene locus_tag LOCUS_11100 gene gyaR 25476 24484 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_11100 25573 26388 gene locus_tag LOCUS_11110 25573 26388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_11110 26509 27576 gene locus_tag LOCUS_11120 26509 27576 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_11120 29733 27619 gene locus_tag LOCUS_11130 29733 27619 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_11130 30450 29899 gene locus_tag LOCUS_11140 30450 29899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 31053 30697 gene locus_tag LOCUS_11150 31053 30697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 31532 31978 gene locus_tag LOCUS_11160 31532 31978 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_11160 33582 31975 gene locus_tag LOCUS_11170 33582 31975 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_11170 34521 33673 gene locus_tag LOCUS_11180 gene cpdA 34521 33673 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_11180 35504 36709 gene locus_tag LOCUS_11190 35504 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 36883 38235 gene locus_tag LOCUS_11200 36883 38235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence022 788 309 gene locus_tag LOCUS_11210 788 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2659 785 gene locus_tag LOCUS_11220 gene asnB 2659 785 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772517.1 protein_id gnl|my_center|LOCUS_11220 2832 3764 gene locus_tag LOCUS_11230 2832 3764 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807052.1 protein_id gnl|my_center|LOCUS_11230 3808 4686 gene locus_tag LOCUS_11240 3808 4686 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975595.1 protein_id gnl|my_center|LOCUS_11240 4693 5931 gene locus_tag LOCUS_11250 4693 5931 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 protein_id gnl|my_center|LOCUS_11250 6091 7521 gene locus_tag LOCUS_11260 6091 7521 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_11260 7518 9053 gene locus_tag LOCUS_11270 7518 9053 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_11270 9432 10187 gene locus_tag LOCUS_11280 9432 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10339 11697 gene locus_tag LOCUS_11290 10339 11697 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_11290 13163 11799 gene locus_tag LOCUS_11300 gene obgE 13163 11799 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_11300 13377 15641 gene locus_tag LOCUS_11310 13377 15641 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_11310 17506 15773 gene locus_tag LOCUS_11320 gene ilvD 17506 15773 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_11320 18573 17842 gene locus_tag LOCUS_11330 18573 17842 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_11330 18762 19436 gene locus_tag LOCUS_11340 gene phoU 18762 19436 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_11340 19490 21166 gene locus_tag LOCUS_11350 19490 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 21390 21073 gene locus_tag LOCUS_11360 21390 21073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 21935 21477 gene locus_tag LOCUS_11370 gene bcp 21935 21477 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_11370 22412 22026 gene locus_tag LOCUS_11380 22412 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 23423 22548 gene locus_tag LOCUS_11390 23423 22548 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_11390 24179 23436 gene locus_tag LOCUS_11400 24179 23436 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_11400 25068 24169 gene locus_tag LOCUS_11410 25068 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 25502 25699 gene locus_tag LOCUS_11420 25502 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 27361 26099 gene locus_tag LOCUS_11430 27361 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 27469 28431 gene locus_tag LOCUS_11440 27469 28431 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_11440 29092 28451 gene locus_tag LOCUS_11450 29092 28451 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_11450 29154 31220 gene locus_tag LOCUS_11460 gene gyrB 29154 31220 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_11460 31492 32403 gene locus_tag LOCUS_11470 gene plsX 31492 32403 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_11470 33729 32428 gene locus_tag LOCUS_11480 33729 32428 CDS product 2-phospho-L-lactate transferase CofD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257392.1 protein_id gnl|my_center|LOCUS_11480 34924 33836 gene locus_tag LOCUS_11490 34924 33836 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257657.1 protein_id gnl|my_center|LOCUS_11490 35122 35547 gene locus_tag LOCUS_11500 35122 35547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 35566 35889 gene locus_tag LOCUS_11510 35566 35889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 37074 35899 gene locus_tag LOCUS_11520 37074 35899 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_11520 37646 37233 gene locus_tag LOCUS_11530 37646 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence023 277 1008 gene locus_tag LOCUS_11540 277 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1235 1585 gene locus_tag LOCUS_11550 1235 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2518 1670 gene locus_tag LOCUS_11560 2518 1670 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_11560 2638 4497 gene locus_tag LOCUS_11570 2638 4497 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871433.1 protein_id gnl|my_center|LOCUS_11570 5204 4500 gene locus_tag LOCUS_11580 5204 4500 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_11580 6121 5201 gene locus_tag LOCUS_11590 6121 5201 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_11590 7036 6272 gene locus_tag LOCUS_11600 7036 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9590 7140 gene locus_tag LOCUS_11610 gene gyrA 9590 7140 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_11610 11888 9696 gene locus_tag LOCUS_11620 gene gyrB 11888 9696 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_11620 13107 12091 gene locus_tag LOCUS_11630 13107 12091 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_11630 14448 13129 gene locus_tag LOCUS_11640 gene nagA 14448 13129 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_11640 14892 14686 gene locus_tag LOCUS_11650 14892 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14782 15942 gene locus_tag LOCUS_11660 14782 15942 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_11660 16133 15939 gene locus_tag LOCUS_11670 16133 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 16038 17420 gene locus_tag LOCUS_11680 16038 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 17431 17781 gene locus_tag LOCUS_11690 17431 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 18920 17793 gene locus_tag LOCUS_11700 18920 17793 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_11700 19916 18942 gene locus_tag LOCUS_11710 19916 18942 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_11710 21615 20326 gene locus_tag LOCUS_11720 21615 20326 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259097.1 protein_id gnl|my_center|LOCUS_11720 21614 21844 gene locus_tag LOCUS_11730 21614 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 25130 21927 gene locus_tag LOCUS_11740 25130 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 26279 25182 gene locus_tag LOCUS_11750 26279 25182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 29028 26413 gene locus_tag LOCUS_11760 gene lon 29028 26413 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_11760 29846 29160 gene locus_tag LOCUS_11770 29846 29160 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_11770 29971 31554 gene locus_tag LOCUS_11780 gene rny 29971 31554 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_11780 31551 32447 gene locus_tag LOCUS_11790 31551 32447 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_11790 33085 32477 gene locus_tag LOCUS_11800 gene coaE 33085 32477 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_11800 33199 34449 gene locus_tag LOCUS_11810 33199 34449 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_11810 34446 35666 gene locus_tag LOCUS_11820 gene ribD 34446 35666 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_11820 35690 36307 gene locus_tag LOCUS_11830 35690 36307 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_11830 36460 37689 gene locus_tag LOCUS_11840 36460 37689 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_11840 37822 38307 gene locus_tag LOCUS_11850 gene ribE 37822 38307 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence024 1129 1494 gene locus_tag LOCUS_11860 1129 1494 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_11860 1485 2126 gene locus_tag LOCUS_11870 gene nuoB 1485 2126 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 protein_id gnl|my_center|LOCUS_11870 2212 3123 gene locus_tag LOCUS_11880 2212 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3133 4305 gene locus_tag LOCUS_11890 3133 4305 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_11890 4365 5603 gene locus_tag LOCUS_11900 gene nuoH 4365 5603 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813219.1 protein_id gnl|my_center|LOCUS_11900 5637 6128 gene locus_tag LOCUS_11910 5637 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6233 6751 gene locus_tag LOCUS_11920 6233 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6773 7081 gene locus_tag LOCUS_11930 gene nuoK 6773 7081 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_11930 7085 9094 gene locus_tag LOCUS_11940 gene nuoL 7085 9094 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_11940 9166 10638 gene locus_tag LOCUS_11950 9166 10638 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_11950 10672 12375 gene locus_tag LOCUS_11960 10672 12375 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_11960 12482 12676 gene locus_tag LOCUS_11970 12482 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 13916 12699 gene locus_tag LOCUS_11980 13916 12699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_11980 15373 13964 gene locus_tag LOCUS_11990 15373 13964 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731631.1 protein_id gnl|my_center|LOCUS_11990 16079 15456 gene locus_tag LOCUS_12000 16079 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16567 17523 gene locus_tag LOCUS_12010 gene mutM 16567 17523 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_12010 17567 19615 gene locus_tag LOCUS_12020 17567 19615 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_12020 19645 19971 gene locus_tag LOCUS_12030 19645 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 20125 21042 gene locus_tag LOCUS_12040 gene kdgD 20125 21042 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088612.1 protein_id gnl|my_center|LOCUS_12040 21127 22764 gene locus_tag LOCUS_12050 21127 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22742 22939 gene locus_tag LOCUS_12060 22742 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 23463 22867 gene locus_tag LOCUS_12070 23463 22867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 23700 25337 gene locus_tag LOCUS_12080 gene groL 23700 25337 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583321.1 protein_id gnl|my_center|LOCUS_12080 25473 27584 gene locus_tag LOCUS_12090 25473 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 27615 28958 gene locus_tag LOCUS_12100 27615 28958 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_12100 29092 30147 gene locus_tag LOCUS_12110 29092 30147 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965522.1 protein_id gnl|my_center|LOCUS_12110 30219 30734 gene locus_tag LOCUS_12120 30219 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 31932 30757 gene locus_tag LOCUS_12130 31932 30757 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_12130 32062 33165 gene locus_tag LOCUS_12140 32062 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 33519 33244 gene locus_tag LOCUS_12150 gene rpsT 33519 33244 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_12150 34200 33559 gene locus_tag LOCUS_12160 34200 33559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 37009 34346 gene locus_tag LOCUS_12170 gene clpB 37009 34346 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_12170 37614 37249 gene locus_tag LOCUS_12180 37614 37249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <38177 37629 gene locus_tag LOCUS_12190 <38177 37629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036661.1:molecular chaperone DnaJ >Feature sequence025 <1 937 gene locus_tag LOCUS_12200 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068009.1:aldose 1-epimerase family protein 3338 2157 gene locus_tag LOCUS_12210 3338 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3451 3807 gene locus_tag LOCUS_12220 3451 3807 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_12220 4919 3855 gene locus_tag LOCUS_12230 4919 3855 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_12230 5157 6503 gene locus_tag LOCUS_12240 5157 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6688 8259 gene locus_tag LOCUS_12250 gene metG 6688 8259 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_12250 9277 8297 gene locus_tag LOCUS_12260 9277 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10387 9281 gene locus_tag LOCUS_12270 10387 9281 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_12270 10776 10387 gene locus_tag LOCUS_12280 10776 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11341 12741 gene locus_tag LOCUS_12290 11341 12741 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_12290 13291 12776 gene locus_tag LOCUS_12300 13291 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 13677 13291 gene locus_tag LOCUS_12310 13677 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 15231 13903 gene locus_tag LOCUS_12320 15231 13903 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250942.1 protein_id gnl|my_center|LOCUS_12320 16757 15270 gene locus_tag LOCUS_12330 16757 15270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531249.1 protein_id gnl|my_center|LOCUS_12330 16832 18169 gene locus_tag LOCUS_12340 16832 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 19883 18573 gene locus_tag LOCUS_12350 19883 18573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391264.1 protein_id gnl|my_center|LOCUS_12350 22994 20190 gene locus_tag LOCUS_12360 gene leuS 22994 20190 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_12360 23544 23122 gene locus_tag LOCUS_12370 23544 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 23727 25208 gene locus_tag LOCUS_12380 gene mnmE 23727 25208 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_12380 25678 25950 gene locus_tag LOCUS_12390 25678 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 26079 27278 gene locus_tag LOCUS_12400 26079 27278 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_12400 27389 28273 gene locus_tag LOCUS_12410 27389 28273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 28266 29114 gene locus_tag LOCUS_12420 28266 29114 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256343.1 protein_id gnl|my_center|LOCUS_12420 29190 29684 gene locus_tag LOCUS_12430 29190 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 31016 29697 gene locus_tag LOCUS_12440 31016 29697 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_12440 31163 32752 gene locus_tag LOCUS_12450 gene pruA 31163 32752 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_12450 34475 32853 gene locus_tag LOCUS_12460 gene groL 34475 32853 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_12460 36253 34760 gene locus_tag LOCUS_12470 36253 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 37961 36315 gene locus_tag LOCUS_12480 37961 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence026 1651 356 gene locus_tag LOCUS_12490 1651 356 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_12490 1874 2863 gene locus_tag LOCUS_12500 1874 2863 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_12500 2942 4141 gene locus_tag LOCUS_12510 2942 4141 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_12510 4316 4125 gene locus_tag LOCUS_12520 4316 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4512 4252 gene locus_tag LOCUS_12530 4512 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4462 4644 gene locus_tag LOCUS_12540 4462 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5705 4791 gene locus_tag LOCUS_12550 5705 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5832 6635 gene locus_tag LOCUS_12560 5832 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8467 6749 gene locus_tag LOCUS_12570 8467 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9136 8945 gene locus_tag LOCUS_12580 9136 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9333 9046 gene locus_tag LOCUS_12590 9333 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9600 9343 gene locus_tag LOCUS_12600 9600 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9541 9909 gene locus_tag LOCUS_12610 9541 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10125 11171 gene locus_tag LOCUS_12620 10125 11171 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_12620 11235 13145 gene locus_tag LOCUS_12630 11235 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13198 14757 gene locus_tag LOCUS_12640 13198 14757 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_12640 14935 15585 gene locus_tag LOCUS_12650 14935 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 15734 17413 gene locus_tag LOCUS_12660 15734 17413 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_12660 19068 20186 gene locus_tag LOCUS_12670 gene rho 19068 20186 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_12670 20222 20308 gene locus_tag LOCUS_t00130 20222 20308 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20423 20668 gene locus_tag LOCUS_12680 20423 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 20772 21650 gene locus_tag LOCUS_12690 gene atpB 20772 21650 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_12690 21856 22107 gene locus_tag LOCUS_12700 21856 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 22265 22777 gene locus_tag LOCUS_12710 22265 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 22777 23079 gene locus_tag LOCUS_12720 22777 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 23013 23288 gene locus_tag LOCUS_12730 23013 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 23331 24875 gene locus_tag LOCUS_12740 gene atpA 23331 24875 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_12740 25015 25887 gene locus_tag LOCUS_12750 25015 25887 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_12750 25928 27406 gene locus_tag LOCUS_12760 gene atpD 25928 27406 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_12760 27500 27925 gene locus_tag LOCUS_12770 27500 27925 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_12770 28000 29373 gene locus_tag LOCUS_12780 gene murA 28000 29373 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_12780 29530 30531 gene locus_tag LOCUS_12790 29530 30531 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_12790 31157 30552 gene locus_tag LOCUS_12800 31157 30552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 31743 31195 gene locus_tag LOCUS_12810 31743 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 31851 32426 gene locus_tag LOCUS_12820 31851 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 34584 32989 gene locus_tag LOCUS_12830 34584 32989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 35416 34655 gene locus_tag LOCUS_12840 gene larB 35416 34655 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_12840 35874 36947 gene locus_tag LOCUS_12850 35874 36947 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence027 4584 2713 gene locus_tag LOCUS_12860 4584 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5707 4466 gene locus_tag LOCUS_12870 5707 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8784 5752 gene locus_tag LOCUS_12880 8784 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10550 8925 gene locus_tag LOCUS_12890 10550 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10868 11692 gene locus_tag LOCUS_12900 10868 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12096 13004 gene locus_tag LOCUS_12910 12096 13004 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 13474 14706 gene locus_tag LOCUS_12920 13474 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 14918 16108 gene locus_tag LOCUS_12930 14918 16108 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_12930 16310 17398 gene locus_tag LOCUS_12940 16310 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 17403 18626 gene locus_tag LOCUS_12950 17403 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 18623 21208 gene locus_tag LOCUS_12960 18623 21208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 21291 21890 gene locus_tag LOCUS_12970 21291 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 22206 23693 gene locus_tag LOCUS_12980 22206 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 23817 25439 gene locus_tag LOCUS_12990 23817 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 25339 25671 gene locus_tag LOCUS_13000 25339 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 25813 28704 gene locus_tag LOCUS_13010 25813 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 28930 30099 gene locus_tag LOCUS_13020 28930 30099 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_13020 30219 31664 gene locus_tag LOCUS_13030 30219 31664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 31661 32821 gene locus_tag LOCUS_13040 31661 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 33266 32961 gene locus_tag LOCUS_13050 33266 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 33186 34250 gene locus_tag LOCUS_13060 33186 34250 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_13060 34247 35578 gene locus_tag LOCUS_13070 34247 35578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 35684 37153 gene locus_tag LOCUS_13080 35684 37153 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence028 568 653 gene locus_tag LOCUS_t00140 568 653 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1401 679 gene locus_tag LOCUS_13090 1401 679 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125812.1 protein_id gnl|my_center|LOCUS_13090 1513 1944 gene locus_tag LOCUS_13100 1513 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2069 2947 gene locus_tag LOCUS_13110 2069 2947 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_13110 2934 4343 gene locus_tag LOCUS_13120 2934 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4344 5837 gene locus_tag LOCUS_13130 4344 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6981 5869 gene locus_tag LOCUS_13140 6981 5869 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_13140 7576 7046 gene locus_tag LOCUS_13150 7576 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 8214 7591 gene locus_tag LOCUS_13160 8214 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 8658 8413 gene locus_tag LOCUS_13170 8658 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 11362 8885 gene locus_tag LOCUS_13180 11362 8885 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_13180 11489 14224 gene locus_tag LOCUS_13190 gene alaS 11489 14224 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081612.1 protein_id gnl|my_center|LOCUS_13190 14497 15870 gene locus_tag LOCUS_13200 14497 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 16025 18529 gene locus_tag LOCUS_13210 16025 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18590 19135 gene locus_tag LOCUS_13220 gene ruvX 18590 19135 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141132.1 protein_id gnl|my_center|LOCUS_13220 19190 20437 gene locus_tag LOCUS_13230 gene mltG 19190 20437 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_13230 20457 21611 gene locus_tag LOCUS_13240 20457 21611 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_13240 21704 22333 gene locus_tag LOCUS_13250 gene efp 21704 22333 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_13250 22345 22839 gene locus_tag LOCUS_13260 22345 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 23032 22847 gene locus_tag LOCUS_13270 23032 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 23528 24043 gene locus_tag LOCUS_13280 23528 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 26087 24063 gene locus_tag LOCUS_13290 26087 24063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 27078 26077 gene locus_tag LOCUS_13300 27078 26077 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_13300 27172 27864 gene locus_tag LOCUS_13310 27172 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 28251 29312 gene locus_tag LOCUS_13320 28251 29312 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_13320 29600 30424 gene locus_tag LOCUS_13330 gene mreC 29600 30424 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_13330 30439 30960 gene locus_tag LOCUS_13340 30439 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 30963 32867 gene locus_tag LOCUS_13350 gene mrdA 30963 32867 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_13350 33019 34425 gene locus_tag LOCUS_13360 gene rodA 33019 34425 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_13360 34633 35559 gene locus_tag LOCUS_13370 gene thrB 34633 35559 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence029 1913 219 gene locus_tag LOCUS_13380 1913 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3604 2219 gene locus_tag LOCUS_13390 3604 2219 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_13390 4936 3641 gene locus_tag LOCUS_13400 4936 3641 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257030.1 protein_id gnl|my_center|LOCUS_13400 6415 4994 gene locus_tag LOCUS_13410 6415 4994 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_13410 7114 6557 gene locus_tag LOCUS_13420 7114 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 8376 7129 gene locus_tag LOCUS_13430 8376 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 10022 8478 gene locus_tag LOCUS_13440 10022 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10767 10967 gene locus_tag LOCUS_13450 10767 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11341 12900 gene locus_tag LOCUS_13460 11341 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12920 13999 gene locus_tag LOCUS_13470 12920 13999 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_13470 15304 14084 gene locus_tag LOCUS_13480 15304 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 16997 15735 gene locus_tag LOCUS_13490 16997 15735 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_13490 18434 17160 gene locus_tag LOCUS_13500 18434 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 19191 19667 gene locus_tag LOCUS_13510 19191 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 20679 19741 gene locus_tag LOCUS_13520 gene gnd 20679 19741 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_13520 22201 20801 gene locus_tag LOCUS_13530 22201 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22558 23280 gene locus_tag LOCUS_13540 22558 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 23342 24598 gene locus_tag LOCUS_13550 23342 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 24746 25711 gene locus_tag LOCUS_13560 24746 25711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_13560 25708 26583 gene locus_tag LOCUS_13570 25708 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 27679 26642 gene locus_tag LOCUS_13580 gene argC 27679 26642 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082328.1 protein_id gnl|my_center|LOCUS_13580 27737 28045 gene locus_tag LOCUS_13590 27737 28045 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_13590 28229 28594 gene locus_tag LOCUS_13600 28229 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28669 29715 gene locus_tag LOCUS_13610 28669 29715 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 protein_id gnl|my_center|LOCUS_13610 31060 29738 gene locus_tag LOCUS_13620 31060 29738 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_13620 31699 31469 gene locus_tag LOCUS_13630 31699 31469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 31661 32182 gene locus_tag LOCUS_13640 31661 32182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 32264 33265 gene locus_tag LOCUS_13650 32264 33265 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869118.1 protein_id gnl|my_center|LOCUS_13650 33993 33328 gene locus_tag LOCUS_13660 33993 33328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence030 395 1933 gene locus_tag LOCUS_13670 gene gntK 395 1933 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_13670 2882 1974 gene locus_tag LOCUS_13680 gene metF 2882 1974 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_13680 4436 3033 gene locus_tag LOCUS_13690 4436 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4682 6217 gene locus_tag LOCUS_13700 4682 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6373 6699 gene locus_tag LOCUS_13710 6373 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7235 6831 gene locus_tag LOCUS_13720 7235 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7338 8630 gene locus_tag LOCUS_13730 7338 8630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_13730 8938 8657 gene locus_tag LOCUS_13740 8938 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10224 9148 gene locus_tag LOCUS_13750 10224 9148 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_13750 11191 10241 gene locus_tag LOCUS_13760 11191 10241 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257056.1 protein_id gnl|my_center|LOCUS_13760 11577 11239 gene locus_tag LOCUS_13770 11577 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 11737 12987 gene locus_tag LOCUS_13780 11737 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14517 13060 gene locus_tag LOCUS_13790 14517 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15346 14675 gene locus_tag LOCUS_13800 15346 14675 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_13800 15511 16560 gene locus_tag LOCUS_13810 15511 16560 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_13810 17238 16684 gene locus_tag LOCUS_13820 17238 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 17458 17718 gene locus_tag LOCUS_13830 17458 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 18237 18779 gene locus_tag LOCUS_13840 18237 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 21510 18934 gene locus_tag LOCUS_13850 21510 18934 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_13850 21910 22746 gene locus_tag LOCUS_13860 21910 22746 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_13860 23875 22874 gene locus_tag LOCUS_13870 gene fba 23875 22874 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_13870 25405 24050 gene locus_tag LOCUS_13880 25405 24050 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_13880 25563 27035 gene locus_tag LOCUS_13890 25563 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 27039 27719 gene locus_tag LOCUS_13900 27039 27719 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530164.1 protein_id gnl|my_center|LOCUS_13900 28213 27758 gene locus_tag LOCUS_13910 28213 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 29129 28299 gene locus_tag LOCUS_13920 29129 28299 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_13920 30080 29265 gene locus_tag LOCUS_13930 30080 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 30372 31406 gene locus_tag LOCUS_13940 30372 31406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_13940 31567 32556 gene locus_tag LOCUS_13950 31567 32556 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence031 3 236 gene locus_tag LOCUS_13960 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 841 638 gene locus_tag LOCUS_13970 841 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1328 2008 gene locus_tag LOCUS_13980 1328 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2302 3504 gene locus_tag LOCUS_13990 2302 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3673 4383 gene locus_tag LOCUS_14000 3673 4383 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_14000 4444 5427 gene locus_tag LOCUS_14010 gene rsmH 4444 5427 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_14010 5533 6141 gene locus_tag LOCUS_14020 5533 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6488 8455 gene locus_tag LOCUS_14030 6488 8455 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_14030 8542 10203 gene locus_tag LOCUS_14040 8542 10203 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_14040 10405 11211 gene locus_tag LOCUS_14050 gene mraY 10405 11211 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_14050 11661 12698 gene locus_tag LOCUS_14060 gene ftsW 11661 12698 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_14060 12790 14007 gene locus_tag LOCUS_14070 12790 14007 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_14070 14036 15598 gene locus_tag LOCUS_14080 gene murC 14036 15598 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 protein_id gnl|my_center|LOCUS_14080 15639 16769 gene locus_tag LOCUS_14090 gene murB 15639 16769 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_14090 16762 17652 gene locus_tag LOCUS_14100 16762 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 17881 19128 gene locus_tag LOCUS_14110 gene ftsA 17881 19128 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_14110 19282 20538 gene locus_tag LOCUS_14120 gene ftsZ 19282 20538 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256642.1 protein_id gnl|my_center|LOCUS_14120 21868 20672 gene locus_tag LOCUS_14130 gene thrC 21868 20672 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_14130 22696 22977 gene locus_tag LOCUS_14140 22696 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 23205 22924 gene locus_tag LOCUS_14150 23205 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 23617 23255 gene locus_tag LOCUS_14160 23617 23255 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258098.1 protein_id gnl|my_center|LOCUS_14160 23708 24286 gene locus_tag LOCUS_14170 23708 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 25212 24343 gene locus_tag LOCUS_14180 25212 24343 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_14180 25583 25209 gene locus_tag LOCUS_14190 25583 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 25891 28473 gene locus_tag LOCUS_14200 25891 28473 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_14200 28580 30394 gene locus_tag LOCUS_14210 28580 30394 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_14210 30507 30953 gene locus_tag LOCUS_14220 30507 30953 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700135.1 protein_id gnl|my_center|LOCUS_14220 31046 31915 gene locus_tag LOCUS_14230 31046 31915 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence032 889 1518 gene locus_tag LOCUS_14240 889 1518 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_14240 1562 1488 gene locus_tag LOCUS_t00150 1562 1488 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1581 2945 gene locus_tag LOCUS_14250 1581 2945 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_14250 3078 5543 gene locus_tag LOCUS_14260 3078 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5974 6918 gene locus_tag LOCUS_14270 gene oppB 5974 6918 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_14270 6915 7868 gene locus_tag LOCUS_14280 6915 7868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_14280 8026 9753 gene locus_tag LOCUS_14290 8026 9753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_14290 9838 10965 gene locus_tag LOCUS_14300 9838 10965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_14300 11050 12093 gene locus_tag LOCUS_14310 11050 12093 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_14310 12601 12350 gene locus_tag LOCUS_14320 12601 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 12651 12947 gene locus_tag LOCUS_14330 12651 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 13032 13703 gene locus_tag LOCUS_14340 gene hisH 13032 13703 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_14340 13700 14230 gene locus_tag LOCUS_14350 13700 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 14245 15036 gene locus_tag LOCUS_14360 gene hisF 14245 15036 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_14360 15079 15741 gene locus_tag LOCUS_14370 gene hisIE 15079 15741 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_14370 16418 15780 gene locus_tag LOCUS_14380 16418 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18212 16491 gene locus_tag LOCUS_14390 18212 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 18874 18308 gene locus_tag LOCUS_14400 18874 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 19987 18995 gene locus_tag LOCUS_14410 19987 18995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_14410 21944 20145 gene locus_tag LOCUS_14420 gene lepA 21944 20145 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_14420 23591 22026 gene locus_tag LOCUS_14430 gene murJ 23591 22026 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258283.1 protein_id gnl|my_center|LOCUS_14430 24182 23937 gene locus_tag LOCUS_14440 24182 23937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 24535 25785 gene locus_tag LOCUS_14450 24535 25785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 25893 27128 gene locus_tag LOCUS_14460 25893 27128 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_14460 29512 27212 gene locus_tag LOCUS_14470 29512 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 30257 30937 gene locus_tag LOCUS_14480 30257 30937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence033 321 1487 gene locus_tag LOCUS_14490 321 1487 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920457.1 protein_id gnl|my_center|LOCUS_14490 1487 2842 gene locus_tag LOCUS_14500 1487 2842 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_14500 2900 3670 gene locus_tag LOCUS_14510 gene allE 2900 3670 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_14510 3757 5004 gene locus_tag LOCUS_14520 3757 5004 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_14520 5122 6261 gene locus_tag LOCUS_14530 5122 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6408 7520 gene locus_tag LOCUS_14540 6408 7520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_14540 7517 8518 gene locus_tag LOCUS_14550 7517 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8522 10135 gene locus_tag LOCUS_14560 8522 10135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_14560 10283 11305 gene locus_tag LOCUS_14570 10283 11305 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_14570 11391 12938 gene locus_tag LOCUS_14580 11391 12938 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030610791.1 protein_id gnl|my_center|LOCUS_14580 12940 14580 gene locus_tag LOCUS_14590 12940 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 14531 15241 gene locus_tag LOCUS_14600 14531 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 16749 15424 gene locus_tag LOCUS_14610 16749 15424 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_14610 20369 16746 gene locus_tag LOCUS_14620 20369 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21141 20566 gene locus_tag LOCUS_14630 21141 20566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_14630 21278 21634 gene locus_tag LOCUS_14640 21278 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 22048 21972 gene locus_tag LOCUS_t00160 22048 21972 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22122 23222 gene locus_tag LOCUS_14650 22122 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 23557 24651 gene locus_tag LOCUS_14660 23557 24651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 24825 25718 gene locus_tag LOCUS_14670 24825 25718 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_14670 25803 27239 gene locus_tag LOCUS_14680 25803 27239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_14680 28074 27328 gene locus_tag LOCUS_14690 28074 27328 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153442595.1 protein_id gnl|my_center|LOCUS_14690 29018 28161 gene locus_tag LOCUS_14700 29018 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 29142 29894 gene locus_tag LOCUS_14710 29142 29894 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_14710 30668 29910 gene locus_tag LOCUS_14720 30668 29910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence034 174 1100 gene locus_tag LOCUS_14730 174 1100 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_14730 3387 1204 gene locus_tag LOCUS_14740 gene katG 3387 1204 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_14740 3664 4446 gene locus_tag LOCUS_14750 3664 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4517 5305 gene locus_tag LOCUS_14760 4517 5305 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_14760 6326 5409 gene locus_tag LOCUS_14770 6326 5409 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_14770 6769 6476 gene locus_tag LOCUS_14780 6769 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6997 6779 gene locus_tag LOCUS_14790 6997 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8591 6948 gene locus_tag LOCUS_14800 8591 6948 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257911.1 protein_id gnl|my_center|LOCUS_14800 8648 9544 gene locus_tag LOCUS_14810 8648 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 10804 9749 gene locus_tag LOCUS_14820 gene cah 10804 9749 CDS product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 protein_id gnl|my_center|LOCUS_14820 11458 10835 gene locus_tag LOCUS_14830 11458 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 13990 11711 gene locus_tag LOCUS_14840 13990 11711 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968714.1 protein_id gnl|my_center|LOCUS_14840 15202 14108 gene locus_tag LOCUS_14850 gene thiO 15202 14108 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_14850 15476 17758 gene locus_tag LOCUS_14860 15476 17758 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_14860 17954 18919 gene locus_tag LOCUS_14870 17954 18919 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380364.1 protein_id gnl|my_center|LOCUS_14870 18956 19885 gene locus_tag LOCUS_14880 18956 19885 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_14880 20079 21491 gene locus_tag LOCUS_14890 20079 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 21588 21860 gene locus_tag LOCUS_14900 21588 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 21998 23317 gene locus_tag LOCUS_14910 21998 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 23386 23838 gene locus_tag LOCUS_14920 gene rplI 23386 23838 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_14920 23944 25281 gene locus_tag LOCUS_14930 gene dnaB 23944 25281 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_14930 25361 26521 gene locus_tag LOCUS_14940 25361 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 26743 29598 gene locus_tag LOCUS_14950 gene secA 26743 29598 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256432.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence035 2 907 gene locus_tag LOCUS_14960 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 880 1131 gene locus_tag LOCUS_14970 880 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1874 1278 gene locus_tag LOCUS_14980 1874 1278 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839715.1 protein_id gnl|my_center|LOCUS_14980 2210 1914 gene locus_tag LOCUS_14990 2210 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2367 2293 gene locus_tag LOCUS_t00170 2367 2293 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2553 3305 gene locus_tag LOCUS_15000 2553 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3326 3763 gene locus_tag LOCUS_15010 3326 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3867 4367 gene locus_tag LOCUS_15020 3867 4367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_15020 5569 4604 gene locus_tag LOCUS_15030 5569 4604 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_15030 5671 6249 gene locus_tag LOCUS_15040 5671 6249 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_15040 6322 7437 gene locus_tag LOCUS_15050 gene mtnA 6322 7437 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_15050 7593 8501 gene locus_tag LOCUS_15060 gene mtnP 7593 8501 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_15060 8760 9734 gene locus_tag LOCUS_15070 8760 9734 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_15070 9826 11097 gene locus_tag LOCUS_15080 gene ahcY 9826 11097 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_15080 11228 12463 gene locus_tag LOCUS_15090 gene metK 11228 12463 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_15090 12615 13682 gene locus_tag LOCUS_15100 12615 13682 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_15100 14206 13790 gene locus_tag LOCUS_15110 14206 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 14455 15663 gene locus_tag LOCUS_15120 14455 15663 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257903.1 protein_id gnl|my_center|LOCUS_15120 15753 17171 gene locus_tag LOCUS_15130 15753 17171 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_15130 17398 19107 gene locus_tag LOCUS_15140 17398 19107 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_15140 20054 19203 gene locus_tag LOCUS_15150 20054 19203 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_15150 20311 21390 gene locus_tag LOCUS_15160 20311 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 21455 22465 gene locus_tag LOCUS_15170 21455 22465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660593.1 protein_id gnl|my_center|LOCUS_15170 22542 23501 gene locus_tag LOCUS_15180 22542 23501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256917.1 protein_id gnl|my_center|LOCUS_15180 23526 24575 gene locus_tag LOCUS_15190 23526 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 24595 25380 gene locus_tag LOCUS_15200 24595 25380 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_15200 25971 25438 gene locus_tag LOCUS_15210 25971 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 26055 26807 gene locus_tag LOCUS_15220 26055 26807 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_15220 26829 27494 gene locus_tag LOCUS_15230 26829 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 27518 28093 gene locus_tag LOCUS_15240 gene ruvA 27518 28093 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence036 2313 1516 gene locus_tag LOCUS_15250 2313 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4682 2337 gene locus_tag LOCUS_15260 gene topA 4682 2337 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259747.1 protein_id gnl|my_center|LOCUS_15260 8755 4937 gene locus_tag LOCUS_15270 8755 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9733 8825 gene locus_tag LOCUS_15280 9733 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 10790 9882 gene locus_tag LOCUS_15290 gene rsmA 10790 9882 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814989.1 protein_id gnl|my_center|LOCUS_15290 13110 11206 gene locus_tag LOCUS_15300 13110 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 15029 13641 gene locus_tag LOCUS_15310 15029 13641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 protein_id gnl|my_center|LOCUS_15310 16031 15144 gene locus_tag LOCUS_15320 16031 15144 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_15320 17180 16170 gene locus_tag LOCUS_15330 17180 16170 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_15330 17297 18916 gene locus_tag LOCUS_15340 gene guaA 17297 18916 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256861.1 protein_id gnl|my_center|LOCUS_15340 19397 18975 gene locus_tag LOCUS_15350 19397 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 21104 19413 gene locus_tag LOCUS_15360 21104 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 21253 21423 gene locus_tag LOCUS_15370 21253 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 22581 21508 gene locus_tag LOCUS_15380 22581 21508 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965522.1 protein_id gnl|my_center|LOCUS_15380 22666 23988 gene locus_tag LOCUS_15390 22666 23988 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_15390 24084 24734 gene locus_tag LOCUS_15400 24084 24734 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_15400 25859 24750 gene locus_tag LOCUS_15410 25859 24750 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_15410 25952 27247 gene locus_tag LOCUS_15420 25952 27247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_15420 27859 27248 gene locus_tag LOCUS_15430 27859 27248 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence037 1045 218 gene locus_tag LOCUS_15440 1045 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2462 1152 gene locus_tag LOCUS_15450 2462 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3717 2599 gene locus_tag LOCUS_15460 gene citA 3717 2599 CDS product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 protein_id gnl|my_center|LOCUS_15460 4297 3929 gene locus_tag LOCUS_15470 4297 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5364 4324 gene locus_tag LOCUS_15480 5364 4324 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_15480 6701 5361 gene locus_tag LOCUS_15490 6701 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7618 6812 gene locus_tag LOCUS_15500 7618 6812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974854.1 protein_id gnl|my_center|LOCUS_15500 8741 7686 gene locus_tag LOCUS_15510 8741 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9637 8747 gene locus_tag LOCUS_15520 9637 8747 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089803.1 protein_id gnl|my_center|LOCUS_15520 10599 9637 gene locus_tag LOCUS_15530 10599 9637 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061268.1 protein_id gnl|my_center|LOCUS_15530 12170 10782 gene locus_tag LOCUS_15540 12170 10782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086695.1 protein_id gnl|my_center|LOCUS_15540 12846 12373 gene locus_tag LOCUS_15550 12846 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 12748 12984 gene locus_tag LOCUS_15560 12748 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 12991 13167 gene locus_tag LOCUS_15570 12991 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 14274 13240 gene locus_tag LOCUS_15580 14274 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 14629 15384 gene locus_tag LOCUS_15590 14629 15384 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_15590 17372 15456 gene locus_tag LOCUS_15600 17372 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 18696 17656 gene locus_tag LOCUS_15610 gene iolG 18696 17656 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_15610 18920 20443 gene locus_tag LOCUS_15620 18920 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 20550 20945 gene locus_tag LOCUS_15630 20550 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 20842 21465 gene locus_tag LOCUS_15640 20842 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 22057 23055 gene locus_tag LOCUS_15650 22057 23055 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_15650 23115 23474 gene locus_tag LOCUS_15660 23115 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 23471 23992 gene locus_tag LOCUS_15670 23471 23992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 24078 25124 gene locus_tag LOCUS_15680 24078 25124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_15680 25121 25849 gene locus_tag LOCUS_15690 25121 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 25899 27020 gene locus_tag LOCUS_15700 25899 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 <28728 27023 gene locus_tag LOCUS_15710 <28728 27023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence038 1435 506 gene locus_tag LOCUS_15720 1435 506 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_15720 1791 1528 gene locus_tag LOCUS_15730 1791 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1961 2037 gene locus_tag LOCUS_t00180 1961 2037 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2199 2792 gene locus_tag LOCUS_15740 2199 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5694 2854 gene locus_tag LOCUS_15750 5694 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6325 5708 gene locus_tag LOCUS_15760 6325 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 9297 6322 gene locus_tag LOCUS_15770 9297 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9518 11776 gene locus_tag LOCUS_15780 gene ligA 9518 11776 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040247.1 protein_id gnl|my_center|LOCUS_15780 12143 12616 gene locus_tag LOCUS_15790 12143 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12669 14504 gene locus_tag LOCUS_15800 12669 14504 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_15800 14598 15773 gene locus_tag LOCUS_15810 14598 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 16125 15886 gene locus_tag LOCUS_15820 16125 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 16613 17821 gene locus_tag LOCUS_15830 16613 17821 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 protein_id gnl|my_center|LOCUS_15830 17892 18953 gene locus_tag LOCUS_15840 17892 18953 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_15840 18950 19891 gene locus_tag LOCUS_15850 gene murQ 18950 19891 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726731.1 protein_id gnl|my_center|LOCUS_15850 20051 20908 gene locus_tag LOCUS_15860 gene nagB 20051 20908 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_15860 22674 20968 gene locus_tag LOCUS_15870 gene argS 22674 20968 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_15870 22809 23834 gene locus_tag LOCUS_15880 22809 23834 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804598.1 protein_id gnl|my_center|LOCUS_15880 23831 24676 gene locus_tag LOCUS_15890 23831 24676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 24685 25467 gene locus_tag LOCUS_15900 24685 25467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170564.1 protein_id gnl|my_center|LOCUS_15900 26812 25574 gene locus_tag LOCUS_15910 26812 25574 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_15910 26991 27374 gene locus_tag LOCUS_15920 26991 27374 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888860.1 protein_id gnl|my_center|LOCUS_15920 27843 27409 gene locus_tag LOCUS_15930 gene aroQ 27843 27409 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_15930 27923 28300 gene locus_tag LOCUS_15940 27923 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence039 285 1049 gene locus_tag LOCUS_15950 285 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2063 1041 gene locus_tag LOCUS_15960 2063 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2206 2997 gene locus_tag LOCUS_15970 2206 2997 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_15970 3204 4607 gene locus_tag LOCUS_15980 3204 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5775 5302 gene locus_tag LOCUS_15990 5775 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5678 6541 gene locus_tag LOCUS_16000 5678 6541 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976274.1 protein_id gnl|my_center|LOCUS_16000 6612 7733 gene locus_tag LOCUS_16010 6612 7733 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726983.1 protein_id gnl|my_center|LOCUS_16010 7890 9032 gene locus_tag LOCUS_16020 7890 9032 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_16020 9748 9137 gene locus_tag LOCUS_16030 9748 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 10167 9955 gene locus_tag LOCUS_16040 10167 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 10048 10878 gene locus_tag LOCUS_16050 10048 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 10946 11713 gene locus_tag LOCUS_16060 10946 11713 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889086.1 protein_id gnl|my_center|LOCUS_16060 11691 12392 gene locus_tag LOCUS_16070 11691 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 12274 13086 gene locus_tag LOCUS_16080 12274 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 13358 13855 gene locus_tag LOCUS_16090 13358 13855 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_16090 13951 14922 gene locus_tag LOCUS_16100 13951 14922 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_16100 15121 16302 gene locus_tag LOCUS_16110 15121 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 16357 17502 gene locus_tag LOCUS_16120 16357 17502 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_16120 18191 17871 gene locus_tag LOCUS_16130 18191 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 18166 19101 gene locus_tag LOCUS_16140 18166 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 19098 20285 gene locus_tag LOCUS_16150 19098 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 20369 21439 gene locus_tag LOCUS_16160 20369 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 21604 22569 gene locus_tag LOCUS_16170 21604 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 22984 24261 gene locus_tag LOCUS_16180 22984 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 25410 24319 gene locus_tag LOCUS_16190 gene moaA 25410 24319 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_16190 26214 25540 gene locus_tag LOCUS_16200 26214 25540 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence040 216 1241 gene locus_tag LOCUS_16210 gene glpX 216 1241 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_16210 1402 2415 gene locus_tag LOCUS_16220 1402 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3226 2504 gene locus_tag LOCUS_16230 3226 2504 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_16230 3357 4226 gene locus_tag LOCUS_16240 3357 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6776 4854 gene locus_tag LOCUS_16250 6776 4854 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225010.1 protein_id gnl|my_center|LOCUS_16250 8366 6993 gene locus_tag LOCUS_16260 8366 6993 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089801.1 protein_id gnl|my_center|LOCUS_16260 8645 11251 gene locus_tag LOCUS_16270 8645 11251 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_16270 12346 11477 gene locus_tag LOCUS_16280 12346 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 12513 13070 gene locus_tag LOCUS_16290 gene pyrE 12513 13070 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_16290 13218 14171 gene locus_tag LOCUS_16300 13218 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 14493 15449 gene locus_tag LOCUS_16310 14493 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 15500 16567 gene locus_tag LOCUS_16320 15500 16567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 16613 16999 gene locus_tag LOCUS_16330 16613 16999 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529258.1 protein_id gnl|my_center|LOCUS_16330 18371 17139 gene locus_tag LOCUS_16340 18371 17139 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_16340 19618 18422 gene locus_tag LOCUS_16350 19618 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 19836 20513 gene locus_tag LOCUS_16360 19836 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 20919 22775 gene locus_tag LOCUS_16370 20919 22775 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_16370 22823 23428 gene locus_tag LOCUS_16380 22823 23428 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_16380 23475 24170 gene locus_tag LOCUS_16390 23475 24170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 25420 24290 gene locus_tag LOCUS_16400 25420 24290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 26255 25518 gene locus_tag LOCUS_16410 26255 25518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 <26971 26326 gene locus_tag LOCUS_16420 <26971 26326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525160.1:SDR family oxidoreductase >Feature sequence041 2902 533 gene locus_tag LOCUS_16430 2902 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3136 4029 gene locus_tag LOCUS_16440 3136 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4412 5260 gene locus_tag LOCUS_16450 gene hag 4412 5260 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_16450 5902 6768 gene locus_tag LOCUS_16460 5902 6768 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_16460 7115 6891 gene locus_tag LOCUS_16470 7115 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 7331 8254 gene locus_tag LOCUS_16480 7331 8254 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066688.1 protein_id gnl|my_center|LOCUS_16480 9667 8276 gene locus_tag LOCUS_16490 9667 8276 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628869.1 protein_id gnl|my_center|LOCUS_16490 9967 11850 gene locus_tag LOCUS_16500 9967 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 13159 11954 gene locus_tag LOCUS_16510 13159 11954 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_16510 13131 13295 gene locus_tag LOCUS_16520 13131 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 13301 13624 gene locus_tag LOCUS_16530 13301 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14904 13708 gene locus_tag LOCUS_16540 14904 13708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_16540 15834 14947 gene locus_tag LOCUS_16550 15834 14947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_16550 17114 15831 gene locus_tag LOCUS_16560 gene kynU 17114 15831 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_16560 17279 18394 gene locus_tag LOCUS_16570 17279 18394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_16570 18452 19888 gene locus_tag LOCUS_16580 18452 19888 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_16580 20928 19951 gene locus_tag LOCUS_16590 20928 19951 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_16590 21149 21223 gene locus_tag LOCUS_t00190 21149 21223 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22354 21362 gene locus_tag LOCUS_16600 22354 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 23521 23883 gene locus_tag LOCUS_16610 23521 23883 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625774.1 protein_id gnl|my_center|LOCUS_16610 23927 24283 gene locus_tag LOCUS_16620 23927 24283 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 protein_id gnl|my_center|LOCUS_16620 24446 24805 gene locus_tag LOCUS_16630 24446 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 26238 24985 gene locus_tag LOCUS_16640 26238 24985 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence042 4633 5001 gene locus_tag LOCUS_16650 4633 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5629 6087 gene locus_tag LOCUS_16660 5629 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8683 9078 gene locus_tag LOCUS_16670 8683 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10069 10581 gene locus_tag LOCUS_16680 10069 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 10962 11579 gene locus_tag LOCUS_16690 10962 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 11899 12690 gene locus_tag LOCUS_16700 11899 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 14201 12780 gene locus_tag LOCUS_16710 14201 12780 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_16710 14301 15083 gene locus_tag LOCUS_16720 14301 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 15059 15832 gene locus_tag LOCUS_16730 15059 15832 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972793.1 protein_id gnl|my_center|LOCUS_16730 17180 15903 gene locus_tag LOCUS_16740 17180 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 17500 20253 gene locus_tag LOCUS_16750 17500 20253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 20592 20383 gene locus_tag LOCUS_16760 20592 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 20553 21212 gene locus_tag LOCUS_16770 20553 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16770 21461 22225 gene locus_tag LOCUS_16780 21461 22225 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16780 22600 22286 gene locus_tag LOCUS_16790 22600 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 23023 23583 gene locus_tag LOCUS_16800 23023 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 23727 23996 gene locus_tag LOCUS_16810 23727 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 24050 25057 gene locus_tag LOCUS_16820 24050 25057 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046800989.1 protein_id gnl|my_center|LOCUS_16820 25817 25062 gene locus_tag LOCUS_16830 25817 25062 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence043 800 207 gene locus_tag LOCUS_16840 800 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 1046 1276 gene locus_tag LOCUS_16850 1046 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2685 1351 gene locus_tag LOCUS_16860 2685 1351 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_16860 3103 3834 gene locus_tag LOCUS_16870 3103 3834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_16870 3831 5372 gene locus_tag LOCUS_16880 3831 5372 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_16880 6333 5392 gene locus_tag LOCUS_16890 6333 5392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_16890 7555 6341 gene locus_tag LOCUS_16900 7555 6341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339412.1 protein_id gnl|my_center|LOCUS_16900 9201 7552 gene locus_tag LOCUS_16910 9201 7552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905892.1 protein_id gnl|my_center|LOCUS_16910 10605 9439 gene locus_tag LOCUS_16920 10605 9439 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_16920 10975 11676 gene locus_tag LOCUS_16930 10975 11676 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_16930 11797 12996 gene locus_tag LOCUS_16940 11797 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 14684 13824 gene locus_tag LOCUS_16950 14684 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 14940 15422 gene locus_tag LOCUS_16960 14940 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 15555 16163 gene locus_tag LOCUS_16970 15555 16163 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_16970 17217 16309 gene locus_tag LOCUS_16980 17217 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 17954 17328 gene locus_tag LOCUS_16990 17954 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 18308 19066 gene locus_tag LOCUS_17000 18308 19066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_17000 19054 22458 gene locus_tag LOCUS_17010 19054 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 21292 21207 gene locus_tag LOCUS_t00200 21292 21207 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22636 23682 gene locus_tag LOCUS_17020 22636 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 24998 23790 gene locus_tag LOCUS_17030 24998 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 25580 25035 gene locus_tag LOCUS_17040 25580 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence044 497 1537 gene locus_tag LOCUS_17050 497 1537 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_17050 1801 3246 gene locus_tag LOCUS_17060 1801 3246 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_17060 3356 4384 gene locus_tag LOCUS_17070 3356 4384 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_17070 5807 5133 gene locus_tag LOCUS_17080 gene purN 5807 5133 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 protein_id gnl|my_center|LOCUS_17080 7080 5839 gene locus_tag LOCUS_17090 gene purM 7080 5839 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678769.1 protein_id gnl|my_center|LOCUS_17090 8092 7073 gene locus_tag LOCUS_17100 8092 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 9543 8089 gene locus_tag LOCUS_17110 gene purF 9543 8089 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_17110 10010 9540 gene locus_tag LOCUS_17120 10010 9540 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681904.1 protein_id gnl|my_center|LOCUS_17120 10942 10007 gene locus_tag LOCUS_17130 10942 10007 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_17130 11663 10929 gene locus_tag LOCUS_17140 gene purQ 11663 10929 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_17140 14620 11660 gene locus_tag LOCUS_17150 gene purL 14620 11660 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_17150 14831 16429 gene locus_tag LOCUS_17160 14831 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 19184 16485 gene locus_tag LOCUS_17170 19184 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 19301 19798 gene locus_tag LOCUS_17180 19301 19798 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361213.1 protein_id gnl|my_center|LOCUS_17180 19805 20488 gene locus_tag LOCUS_17190 gene upp 19805 20488 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_17190 20795 21787 gene locus_tag LOCUS_17200 20795 21787 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_17200 21874 22245 gene locus_tag LOCUS_17210 21874 22245 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_17210 22344 23399 gene locus_tag LOCUS_17220 22344 23399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_17220 23721 23455 gene locus_tag LOCUS_17230 23721 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24014 24187 gene locus_tag LOCUS_17240 24014 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 24776 24174 gene locus_tag LOCUS_17250 24776 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 24858 25043 gene locus_tag LOCUS_17260 24858 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence045 1293 2240 gene locus_tag LOCUS_17270 1293 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2461 3150 gene locus_tag LOCUS_17280 2461 3150 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_17280 3209 5797 gene locus_tag LOCUS_17290 3209 5797 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_17290 6185 7258 gene locus_tag LOCUS_17300 gene aroF 6185 7258 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_17300 7255 8748 gene locus_tag LOCUS_17310 gene aroA 7255 8748 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_17310 8745 9644 gene locus_tag LOCUS_17320 8745 9644 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_17320 9761 10924 gene locus_tag LOCUS_17330 gene aroC 9761 10924 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_17330 10921 11574 gene locus_tag LOCUS_17340 10921 11574 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_17340 11571 12680 gene locus_tag LOCUS_17350 gene aroB 11571 12680 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257969.1 protein_id gnl|my_center|LOCUS_17350 12750 13511 gene locus_tag LOCUS_17360 12750 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 13574 13798 gene locus_tag LOCUS_17370 13574 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 13944 13744 gene locus_tag LOCUS_17380 13944 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 13943 14818 gene locus_tag LOCUS_17390 13943 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 14916 15476 gene locus_tag LOCUS_17400 14916 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 15576 16214 gene locus_tag LOCUS_17410 15576 16214 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_17410 17147 16320 gene locus_tag LOCUS_17420 gene trpA 17147 16320 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_17420 18370 17144 gene locus_tag LOCUS_17430 gene trpB 18370 17144 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_17430 19477 18470 gene locus_tag LOCUS_17440 gene trpS 19477 18470 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_17440 20298 19543 gene locus_tag LOCUS_17450 20298 19543 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_17450 21236 20295 gene locus_tag LOCUS_17460 gene trpC 21236 20295 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660663.1 protein_id gnl|my_center|LOCUS_17460 22341 21307 gene locus_tag LOCUS_17470 gene trpD 22341 21307 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_17470 23407 22796 gene locus_tag LOCUS_17480 23407 22796 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_17480 25035 23404 gene locus_tag LOCUS_17490 gene trpE 25035 23404 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence046 2240 1626 gene locus_tag LOCUS_17500 2240 1626 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_17500 2511 4235 gene locus_tag LOCUS_17510 2511 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4296 5798 gene locus_tag LOCUS_17520 4296 5798 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_17520 5878 6846 gene locus_tag LOCUS_17530 5878 6846 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_17530 6906 7250 gene locus_tag LOCUS_17540 6906 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9086 7302 gene locus_tag LOCUS_17550 9086 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 10636 9188 gene locus_tag LOCUS_17560 10636 9188 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_17560 10636 11499 gene locus_tag LOCUS_17570 10636 11499 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_17570 12568 11501 gene locus_tag LOCUS_17580 12568 11501 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_17580 13654 12578 gene locus_tag LOCUS_17590 13654 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14692 13706 gene locus_tag LOCUS_17600 14692 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 15755 14733 gene locus_tag LOCUS_17610 15755 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 16523 15768 gene locus_tag LOCUS_17620 16523 15768 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 17630 16689 gene locus_tag LOCUS_17630 17630 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 19117 17672 gene locus_tag LOCUS_17640 19117 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 20277 19117 gene locus_tag LOCUS_17650 20277 19117 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141444.1 protein_id gnl|my_center|LOCUS_17650 20194 20574 gene locus_tag LOCUS_17660 20194 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 20667 21629 gene locus_tag LOCUS_17670 20667 21629 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 protein_id gnl|my_center|LOCUS_17670 22916 21651 gene locus_tag LOCUS_17680 22916 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 25106 23136 gene locus_tag LOCUS_17690 25106 23136 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_17690 25453 25220 gene locus_tag LOCUS_17700 25453 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence047 876 13 gene locus_tag LOCUS_17710 876 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 995 1990 gene locus_tag LOCUS_17720 995 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1993 2718 gene locus_tag LOCUS_17730 1993 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2795 3649 gene locus_tag LOCUS_17740 2795 3649 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229012.1 protein_id gnl|my_center|LOCUS_17740 3789 5072 gene locus_tag LOCUS_17750 3789 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6298 5120 gene locus_tag LOCUS_17760 gene dgoD 6298 5120 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_17760 7326 6355 gene locus_tag LOCUS_17770 7326 6355 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_17770 7538 8395 gene locus_tag LOCUS_17780 7538 8395 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_17780 8415 9515 gene locus_tag LOCUS_17790 8415 9515 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_17790 10714 9563 gene locus_tag LOCUS_17800 10714 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 11772 10906 gene locus_tag LOCUS_17810 11772 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 12719 11886 gene locus_tag LOCUS_17820 12719 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 12944 13186 gene locus_tag LOCUS_17830 12944 13186 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_17830 14422 13202 gene locus_tag LOCUS_17840 14422 13202 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_17840 15612 14566 gene locus_tag LOCUS_17850 15612 14566 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_17850 17140 15707 gene locus_tag LOCUS_17860 17140 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 17478 18638 gene locus_tag LOCUS_17870 17478 18638 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_17870 18773 19024 gene locus_tag LOCUS_17880 18773 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 20060 19047 gene locus_tag LOCUS_17890 20060 19047 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_17890 20902 20057 gene locus_tag LOCUS_17900 20902 20057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_17900 22086 20902 gene locus_tag LOCUS_17910 22086 20902 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789856.1 protein_id gnl|my_center|LOCUS_17910 22387 23397 gene locus_tag LOCUS_17920 22387 23397 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_17920 24819 23482 gene locus_tag LOCUS_17930 24819 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence048 627 893 gene locus_tag LOCUS_17940 627 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 959 1780 gene locus_tag LOCUS_17950 959 1780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407292.1 protein_id gnl|my_center|LOCUS_17950 2951 1824 gene locus_tag LOCUS_17960 2951 1824 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435455.1 protein_id gnl|my_center|LOCUS_17960 3500 3111 gene locus_tag LOCUS_17970 3500 3111 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 protein_id gnl|my_center|LOCUS_17970 3642 4661 gene locus_tag LOCUS_17980 3642 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4717 5799 gene locus_tag LOCUS_17990 4717 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5868 7166 gene locus_tag LOCUS_18000 5868 7166 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727005.1 protein_id gnl|my_center|LOCUS_18000 7196 7633 gene locus_tag LOCUS_18010 7196 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18010 8553 8173 gene locus_tag LOCUS_18020 8553 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8750 9838 gene locus_tag LOCUS_18030 8750 9838 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_18030 10703 9963 gene locus_tag LOCUS_18040 10703 9963 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_18040 11003 12232 gene locus_tag LOCUS_18050 11003 12232 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 protein_id gnl|my_center|LOCUS_18050 12984 12304 gene locus_tag LOCUS_18060 12984 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 14076 13396 gene locus_tag LOCUS_18070 14076 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 14386 16386 gene locus_tag LOCUS_18080 14386 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 16516 17112 gene locus_tag LOCUS_18090 16516 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 17253 21521 gene locus_tag LOCUS_18100 17253 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 22087 23115 gene locus_tag LOCUS_18110 22087 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 23115 24140 gene locus_tag LOCUS_18120 23115 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence049 1726 1223 gene locus_tag LOCUS_18130 1726 1223 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_18130 2732 1806 gene locus_tag LOCUS_18140 2732 1806 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_18140 2907 3881 gene locus_tag LOCUS_18150 2907 3881 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_18150 4571 3933 gene locus_tag LOCUS_18160 4571 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4710 4784 gene locus_tag LOCUS_t00210 4710 4784 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5755 4799 gene locus_tag LOCUS_18170 5755 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 7881 5878 gene locus_tag LOCUS_18180 7881 5878 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_18180 7927 8097 gene locus_tag LOCUS_18190 7927 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9694 8849 gene locus_tag LOCUS_18200 9694 8849 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_18200 10466 11416 gene locus_tag LOCUS_18210 10466 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 11560 12366 gene locus_tag LOCUS_18220 gene azf 11560 12366 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_18220 12444 13691 gene locus_tag LOCUS_18230 12444 13691 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728677.1 protein_id gnl|my_center|LOCUS_18230 14933 14031 gene locus_tag LOCUS_18240 14933 14031 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_18240 15172 16722 gene locus_tag LOCUS_18250 gene selA 15172 16722 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_18250 16831 17295 gene locus_tag LOCUS_18260 gene greA 16831 17295 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_18260 17497 18945 gene locus_tag LOCUS_18270 gene lysS 17497 18945 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_18270 19044 19130 gene locus_tag LOCUS_t00220 19044 19130 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19582 19193 gene locus_tag LOCUS_18280 19582 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 20082 19579 gene locus_tag LOCUS_18290 20082 19579 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257468.1 protein_id gnl|my_center|LOCUS_18290 20611 20210 gene locus_tag LOCUS_18300 20611 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21152 20616 gene locus_tag LOCUS_18310 21152 20616 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257468.1 protein_id gnl|my_center|LOCUS_18310 21363 21803 gene locus_tag LOCUS_18320 21363 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 22294 22070 gene locus_tag LOCUS_18330 22294 22070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 22268 23818 gene locus_tag LOCUS_18340 22268 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence050 1413 2756 gene locus_tag LOCUS_18350 1413 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3151 5583 gene locus_tag LOCUS_18360 3151 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5683 6147 gene locus_tag LOCUS_18370 5683 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6324 7250 gene locus_tag LOCUS_18380 6324 7250 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_18380 7345 7614 gene locus_tag LOCUS_18390 7345 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 8715 8320 gene locus_tag LOCUS_18400 8715 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 8761 9123 gene locus_tag LOCUS_18410 8761 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 9829 9395 gene locus_tag LOCUS_18420 9829 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 11205 9862 gene locus_tag LOCUS_18430 gene melA 11205 9862 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_18430 11337 11561 gene locus_tag LOCUS_18440 11337 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 12191 11529 gene locus_tag LOCUS_18450 12191 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 12413 13777 gene locus_tag LOCUS_18460 12413 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 13963 14841 gene locus_tag LOCUS_18470 13963 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 15289 16479 gene locus_tag LOCUS_18480 15289 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 16609 17166 gene locus_tag LOCUS_18490 16609 17166 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 protein_id gnl|my_center|LOCUS_18490 19079 17781 gene locus_tag LOCUS_18500 19079 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 21025 19358 gene locus_tag LOCUS_18510 21025 19358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 22849 21029 gene locus_tag LOCUS_18520 22849 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <23704 22846 gene locus_tag LOCUS_18530 <23704 22846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618925.1:PHP domain-containing protein >Feature sequence051 1210 392 gene locus_tag LOCUS_18540 1210 392 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987022.1 protein_id gnl|my_center|LOCUS_18540 2348 1515 gene locus_tag LOCUS_18550 2348 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2925 2479 gene locus_tag LOCUS_18560 2925 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4395 3184 gene locus_tag LOCUS_18570 4395 3184 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973047.1 protein_id gnl|my_center|LOCUS_18570 4514 5419 gene locus_tag LOCUS_18580 4514 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 7202 5715 gene locus_tag LOCUS_18590 7202 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_18590 8463 7285 gene locus_tag LOCUS_18600 8463 7285 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226619.1 protein_id gnl|my_center|LOCUS_18600 8706 9470 gene locus_tag LOCUS_18610 8706 9470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_18610 9599 10063 gene locus_tag LOCUS_18620 9599 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 10180 11088 gene locus_tag LOCUS_18630 10180 11088 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 protein_id gnl|my_center|LOCUS_18630 11195 12022 gene locus_tag LOCUS_18640 11195 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12019 12816 gene locus_tag LOCUS_18650 12019 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12941 14554 gene locus_tag LOCUS_18660 12941 14554 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_18660 15517 16188 gene locus_tag LOCUS_18670 15517 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 16282 18075 gene locus_tag LOCUS_18680 16282 18075 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_18680 18138 18854 gene locus_tag LOCUS_18690 18138 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 18984 20183 gene locus_tag LOCUS_18700 18984 20183 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255920.1 protein_id gnl|my_center|LOCUS_18700 21438 22076 gene locus_tag LOCUS_18710 21438 22076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence052 2813 354 gene locus_tag LOCUS_18720 gene recG 2813 354 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_18720 4590 2815 gene locus_tag LOCUS_18730 4590 2815 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_18730 4842 5051 gene locus_tag LOCUS_18740 gene rpmB 4842 5051 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_18740 5851 5171 gene locus_tag LOCUS_18750 gene rpe 5851 5171 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_18750 6994 5858 gene locus_tag LOCUS_18760 gene rlmN 6994 5858 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_18760 7691 6999 gene locus_tag LOCUS_18770 7691 6999 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_18770 8859 7777 gene locus_tag LOCUS_18780 8859 7777 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_18780 9233 8850 gene locus_tag LOCUS_18790 9233 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 9361 9903 gene locus_tag LOCUS_18800 9361 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10482 9952 gene locus_tag LOCUS_18810 10482 9952 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_18810 10666 11571 gene locus_tag LOCUS_18820 10666 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 11835 11572 gene locus_tag LOCUS_18830 11835 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 12692 11847 gene locus_tag LOCUS_18840 gene pyrF 12692 11847 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_18840 13399 12689 gene locus_tag LOCUS_18850 13399 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 13650 13426 gene locus_tag LOCUS_18860 13650 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 13957 15156 gene locus_tag LOCUS_18870 13957 15156 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_18870 15317 16834 gene locus_tag LOCUS_18880 gene xylB 15317 16834 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_18880 20216 16896 gene locus_tag LOCUS_18890 20216 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 20344 21657 gene locus_tag LOCUS_18900 20344 21657 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence053 1204 110 gene locus_tag LOCUS_18910 1204 110 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705236.1 protein_id gnl|my_center|LOCUS_18910 1762 1433 gene locus_tag LOCUS_18920 1762 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2149 1940 gene locus_tag LOCUS_18930 2149 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2850 2218 gene locus_tag LOCUS_18940 2850 2218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_18940 3160 2843 gene locus_tag LOCUS_18950 3160 2843 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_18950 3372 3971 gene locus_tag LOCUS_18960 3372 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4048 8472 gene locus_tag LOCUS_18970 4048 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8618 9388 gene locus_tag LOCUS_18980 8618 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 9702 9448 gene locus_tag LOCUS_18990 9702 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10313 9699 gene locus_tag LOCUS_19000 10313 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11926 10820 gene locus_tag LOCUS_19010 11926 10820 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_19010 12943 11969 gene locus_tag LOCUS_19020 12943 11969 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_19020 13072 13368 gene locus_tag LOCUS_19030 13072 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 13459 14616 gene locus_tag LOCUS_19040 13459 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 15873 14638 gene locus_tag LOCUS_19050 15873 14638 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873235.1 protein_id gnl|my_center|LOCUS_19050 17481 16012 gene locus_tag LOCUS_19060 17481 16012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 18520 17600 gene locus_tag LOCUS_19070 18520 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 19090 18632 gene locus_tag LOCUS_19080 gene bcp 19090 18632 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_19080 19429 19701 gene locus_tag LOCUS_19090 19429 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 19958 20950 gene locus_tag LOCUS_19100 19958 20950 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence054 117 1187 gene locus_tag LOCUS_19110 117 1187 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_19110 1184 1621 gene locus_tag LOCUS_19120 1184 1621 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_19120 1642 4287 gene locus_tag LOCUS_19130 1642 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5271 4306 gene locus_tag LOCUS_19140 gene uxuA 5271 4306 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_19140 6161 5304 gene locus_tag LOCUS_19150 6161 5304 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_19150 7466 6384 gene locus_tag LOCUS_19160 7466 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 7527 8729 gene locus_tag LOCUS_19170 7527 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 9954 8734 gene locus_tag LOCUS_19180 gene serC 9954 8734 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_19180 10240 11649 gene locus_tag LOCUS_19190 10240 11649 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_19190 11914 12846 gene locus_tag LOCUS_19200 11914 12846 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_19200 12875 13705 gene locus_tag LOCUS_19210 12875 13705 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_19210 15191 13773 gene locus_tag LOCUS_19220 15191 13773 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_19220 17103 15667 gene locus_tag LOCUS_19230 17103 15667 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_19230 17383 18078 gene locus_tag LOCUS_19240 17383 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 18651 18235 gene locus_tag LOCUS_19250 18651 18235 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_19250 18902 18648 gene locus_tag LOCUS_19260 18902 18648 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_19260 19674 19198 gene locus_tag LOCUS_19270 19674 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 21233 19806 gene locus_tag LOCUS_19280 21233 19806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence055 40 1401 gene locus_tag LOCUS_19290 40 1401 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_19290 1512 1952 gene locus_tag LOCUS_19300 1512 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3042 1975 gene locus_tag LOCUS_19310 3042 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3115 4710 gene locus_tag LOCUS_19320 3115 4710 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_19320 5509 4883 gene locus_tag LOCUS_19330 gene rpiA 5509 4883 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_19330 5606 6430 gene locus_tag LOCUS_19340 5606 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6489 7106 gene locus_tag LOCUS_19350 6489 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 7240 7165 gene locus_tag LOCUS_t00230 7240 7165 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7543 7289 gene locus_tag LOCUS_19360 gene rpmA 7543 7289 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_19360 7884 7570 gene locus_tag LOCUS_19370 gene rplU 7884 7570 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258181.1 protein_id gnl|my_center|LOCUS_19370 9704 8022 gene locus_tag LOCUS_19380 9704 8022 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_19380 9835 10047 gene locus_tag LOCUS_19390 9835 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 10040 11074 gene locus_tag LOCUS_19400 gene galT 10040 11074 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583557.1 protein_id gnl|my_center|LOCUS_19400 11154 12320 gene locus_tag LOCUS_19410 gene galK 11154 12320 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292299.1 protein_id gnl|my_center|LOCUS_19410 13088 12390 gene locus_tag LOCUS_19420 gene lexA 13088 12390 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_19420 13573 15762 gene locus_tag LOCUS_19430 13573 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 15989 16777 gene locus_tag LOCUS_19440 15989 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 18660 17314 gene locus_tag LOCUS_19450 18660 17314 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_19450 19081 20517 gene locus_tag LOCUS_19460 19081 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence056 779 483 gene locus_tag LOCUS_19470 779 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1424 1098 gene locus_tag LOCUS_19480 1424 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1879 1421 gene locus_tag LOCUS_19490 1879 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2015 3232 gene locus_tag LOCUS_19500 2015 3232 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 protein_id gnl|my_center|LOCUS_19500 4066 3266 gene locus_tag LOCUS_19510 4066 3266 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_19510 4432 4208 gene locus_tag LOCUS_19520 4432 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4610 5098 gene locus_tag LOCUS_19530 4610 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5861 4995 gene locus_tag LOCUS_19540 5861 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 6787 5993 gene locus_tag LOCUS_19550 6787 5993 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_19550 7239 8078 gene locus_tag LOCUS_19560 7239 8078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_19560 8130 9998 gene locus_tag LOCUS_19570 8130 9998 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318618.1 protein_id gnl|my_center|LOCUS_19570 10711 10076 gene locus_tag LOCUS_19580 10711 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 12169 10793 gene locus_tag LOCUS_19590 12169 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 12364 13269 gene locus_tag LOCUS_19600 12364 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 13742 14839 gene locus_tag LOCUS_19610 13742 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 14917 16017 gene locus_tag LOCUS_19620 14917 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 17375 16032 gene locus_tag LOCUS_19630 17375 16032 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728677.1 protein_id gnl|my_center|LOCUS_19630 17718 17488 gene locus_tag LOCUS_19640 17718 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18247 17795 gene locus_tag LOCUS_19650 18247 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <20939 18327 gene locus_tag LOCUS_19660 <20939 18327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144035.1:heavy metal translocating P-type ATPase >Feature sequence057 <1 520 gene locus_tag LOCUS_19670 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928648.1:cyclin-dependent kinase inhibitor 3 family protein 1338 3731 gene locus_tag LOCUS_19680 1338 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3760 4599 gene locus_tag LOCUS_19690 3760 4599 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393805.1 protein_id gnl|my_center|LOCUS_19690 4731 6404 gene locus_tag LOCUS_19700 4731 6404 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_19700 6651 7556 gene locus_tag LOCUS_19710 6651 7556 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887479.1 protein_id gnl|my_center|LOCUS_19710 10608 7489 gene locus_tag LOCUS_19720 10608 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 11354 10674 gene locus_tag LOCUS_19730 11354 10674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803750.1 protein_id gnl|my_center|LOCUS_19730 11586 12215 gene locus_tag LOCUS_19740 11586 12215 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_19740 12325 13371 gene locus_tag LOCUS_19750 12325 13371 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_19750 13712 13407 gene locus_tag LOCUS_19760 13712 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 13988 14287 gene locus_tag LOCUS_19770 13988 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 15049 14309 gene locus_tag LOCUS_19780 15049 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 15147 15407 gene locus_tag LOCUS_19790 15147 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 15662 15330 gene locus_tag LOCUS_19800 15662 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16819 15833 gene locus_tag LOCUS_19810 16819 15833 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_19810 17023 17376 gene locus_tag LOCUS_19820 17023 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 17434 18243 gene locus_tag LOCUS_19830 17434 18243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 18594 18298 gene locus_tag LOCUS_19840 18594 18298 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_19840 18929 19822 gene locus_tag LOCUS_19850 18929 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence058 894 2165 gene locus_tag LOCUS_19860 894 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2156 2740 gene locus_tag LOCUS_19870 2156 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2700 3221 gene locus_tag LOCUS_19880 2700 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3294 3677 gene locus_tag LOCUS_19890 3294 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4444 3701 gene locus_tag LOCUS_19900 4444 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4876 4520 gene locus_tag LOCUS_19910 4876 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6537 5038 gene locus_tag LOCUS_19920 gene glnA 6537 5038 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_19920 6690 7553 gene locus_tag LOCUS_19930 6690 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 8007 7582 gene locus_tag LOCUS_19940 8007 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7907 8284 gene locus_tag LOCUS_19950 7907 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 11126 8325 gene locus_tag LOCUS_19960 11126 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12344 11478 gene locus_tag LOCUS_19970 12344 11478 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_19970 14284 12371 gene locus_tag LOCUS_19980 14284 12371 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_19980 15249 14278 gene locus_tag LOCUS_19990 15249 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 15178 15384 gene locus_tag LOCUS_20000 15178 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15912 15565 gene locus_tag LOCUS_20010 15912 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 16690 15977 gene locus_tag LOCUS_20020 gene map 16690 15977 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727693.1 protein_id gnl|my_center|LOCUS_20020 18122 16992 gene locus_tag LOCUS_20030 gene larA 18122 16992 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 18517 18134 gene locus_tag LOCUS_20040 gene nifU 18517 18134 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868961.1 protein_id gnl|my_center|LOCUS_20040 19000 18635 gene locus_tag LOCUS_20050 19000 18635 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_20050 19498 19031 gene locus_tag LOCUS_20060 19498 19031 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192846.1 protein_id gnl|my_center|LOCUS_20060 <20144 19521 gene locus_tag LOCUS_20070 <20144 19521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259320.1:cysteine desulfurase >Feature sequence059 782 1417 gene locus_tag LOCUS_20080 782 1417 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_20080 1911 1501 gene locus_tag LOCUS_20090 gene rpsI 1911 1501 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_20090 2366 1908 gene locus_tag LOCUS_20100 gene rplM 2366 1908 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418312.1 protein_id gnl|my_center|LOCUS_20100 3700 3419 gene locus_tag LOCUS_20110 3700 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 4850 3831 gene locus_tag LOCUS_20120 4850 3831 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_20120 5622 4996 gene locus_tag LOCUS_20130 gene rpsD 5622 4996 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_20130 6316 5918 gene locus_tag LOCUS_20140 gene rpsK 6316 5918 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_20140 6848 6465 gene locus_tag LOCUS_20150 gene rpsM 6848 6465 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_20150 7912 7238 gene locus_tag LOCUS_20160 7912 7238 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20160 9198 7909 gene locus_tag LOCUS_20170 gene secY 9198 7909 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_20170 9873 9349 gene locus_tag LOCUS_20180 gene rplO 9873 9349 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_20180 10146 9925 gene locus_tag LOCUS_20190 gene rpmD 10146 9925 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_20190 10683 10153 gene locus_tag LOCUS_20200 gene rpsE 10683 10153 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_20200 11061 10693 gene locus_tag LOCUS_20210 gene rplR 11061 10693 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_20210 11625 11074 gene locus_tag LOCUS_20220 gene rplF 11625 11074 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_20220 12083 11688 gene locus_tag LOCUS_20230 gene rpsH 12083 11688 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_20230 13219 12455 gene locus_tag LOCUS_20240 13219 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 13400 13212 gene locus_tag LOCUS_20250 13400 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 13801 13490 gene locus_tag LOCUS_20260 gene rplN 13801 13490 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_20260 14273 13920 gene locus_tag LOCUS_20270 14273 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 14489 14292 gene locus_tag LOCUS_20280 gene rpmC 14489 14292 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_20280 14986 14489 gene locus_tag LOCUS_20290 gene rplP 14986 14489 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_20290 15889 15068 gene locus_tag LOCUS_20300 gene rpsC 15889 15068 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_20300 16335 15961 gene locus_tag LOCUS_20310 gene rplV 16335 15961 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 protein_id gnl|my_center|LOCUS_20310 16696 16421 gene locus_tag LOCUS_20320 gene rpsS 16696 16421 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_20320 17563 16730 gene locus_tag LOCUS_20330 gene rplB 17563 16730 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_20330 17893 17603 gene locus_tag LOCUS_20340 gene rplW 17893 17603 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_20340 18585 17899 gene locus_tag LOCUS_20350 gene rplD 18585 17899 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774252.1 protein_id gnl|my_center|LOCUS_20350 19207 18578 gene locus_tag LOCUS_20360 gene rplC 19207 18578 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_20360 19587 19279 gene locus_tag LOCUS_20370 gene rpsJ 19587 19279 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence060 30 503 gene locus_tag LOCUS_20380 30 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 917 651 gene locus_tag LOCUS_20390 917 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1931 999 gene locus_tag LOCUS_20400 1931 999 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_20400 2343 2059 gene locus_tag LOCUS_20410 2343 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3448 2390 gene locus_tag LOCUS_20420 3448 2390 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_20420 3939 3529 gene locus_tag LOCUS_20430 3939 3529 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528843.1 protein_id gnl|my_center|LOCUS_20430 4136 4798 gene locus_tag LOCUS_20440 4136 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4753 5256 gene locus_tag LOCUS_20450 4753 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20450 5353 6789 gene locus_tag LOCUS_20460 5353 6789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_20460 6890 8545 gene locus_tag LOCUS_20470 6890 8545 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_20470 8601 8882 gene locus_tag LOCUS_20480 8601 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 8879 10078 gene locus_tag LOCUS_20490 8879 10078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_20490 10185 10367 gene locus_tag LOCUS_20500 10185 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 10552 11517 gene locus_tag LOCUS_20510 10552 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 12999 11533 gene locus_tag LOCUS_20520 12999 11533 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_20520 13833 13177 gene locus_tag LOCUS_20530 13833 13177 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_20530 14372 13923 gene locus_tag LOCUS_20540 14372 13923 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 protein_id gnl|my_center|LOCUS_20540 14754 14392 gene locus_tag LOCUS_20550 14754 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 15138 14791 gene locus_tag LOCUS_20560 15138 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 15657 15256 gene locus_tag LOCUS_20570 15657 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 16159 15710 gene locus_tag LOCUS_20580 16159 15710 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040690.1 protein_id gnl|my_center|LOCUS_20580 17143 16232 gene locus_tag LOCUS_20590 17143 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 18585 17335 gene locus_tag LOCUS_20600 gene fabF 18585 17335 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence061 613 269 gene locus_tag LOCUS_20610 613 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1215 1290 gene locus_tag LOCUS_t00240 1215 1290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1335 1410 gene locus_tag LOCUS_t00250 1335 1410 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2680 1346 gene locus_tag LOCUS_20620 2680 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2600 2770 gene locus_tag LOCUS_20630 2600 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3100 3405 gene locus_tag LOCUS_20640 3100 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3475 4662 gene locus_tag LOCUS_20650 3475 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4706 5071 gene locus_tag LOCUS_20660 4706 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5068 5802 gene locus_tag LOCUS_20670 5068 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5827 6936 gene locus_tag LOCUS_20680 5827 6936 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_20680 6929 7972 gene locus_tag LOCUS_20690 6929 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 9386 8154 gene locus_tag LOCUS_20700 9386 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 10139 11812 gene locus_tag LOCUS_20710 10139 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 13395 11800 gene locus_tag LOCUS_20720 gene guaB 13395 11800 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_20720 13728 15479 gene locus_tag LOCUS_20730 13728 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 15534 16313 gene locus_tag LOCUS_20740 15534 16313 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339314.1 protein_id gnl|my_center|LOCUS_20740 16455 17726 gene locus_tag LOCUS_20750 16455 17726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_20750 18738 17755 gene locus_tag LOCUS_20760 18738 17755 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776467.1 protein_id gnl|my_center|LOCUS_20760 19109 18840 gene locus_tag LOCUS_20770 19109 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence062 445 1308 gene locus_tag LOCUS_20780 445 1308 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_20780 1402 3618 gene locus_tag LOCUS_20790 1402 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3611 4507 gene locus_tag LOCUS_20800 gene pstA 3611 4507 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_20800 4584 5444 gene locus_tag LOCUS_20810 gene pstB 4584 5444 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_20810 5712 6662 gene locus_tag LOCUS_20820 gene pdxS 5712 6662 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_20820 6665 7369 gene locus_tag LOCUS_20830 gene pdxT 6665 7369 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_20830 7539 8159 gene locus_tag LOCUS_20840 7539 8159 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_20840 8205 10922 gene locus_tag LOCUS_20850 8205 10922 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776331.1 protein_id gnl|my_center|LOCUS_20850 11045 11809 gene locus_tag LOCUS_20860 11045 11809 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022990.1 protein_id gnl|my_center|LOCUS_20860 12893 11883 gene locus_tag LOCUS_20870 12893 11883 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_20870 13614 12949 gene locus_tag LOCUS_20880 13614 12949 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_20880 13769 14776 gene locus_tag LOCUS_20890 13769 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 15502 16290 gene locus_tag LOCUS_20900 15502 16290 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_20900 16307 16993 gene locus_tag LOCUS_20910 16307 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <19231 17014 gene locus_tag LOCUS_20920 <19231 17014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043629424.1:glycosyltransferase >Feature sequence063 <1 840 gene locus_tag LOCUS_20930 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033831.1:Gfo/Idh/MocA family oxidoreductase 956 880 gene locus_tag LOCUS_t00260 956 880 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1858 3879 gene locus_tag LOCUS_20940 1858 3879 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_20940 5226 3904 gene locus_tag LOCUS_20950 gene folP 5226 3904 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_20950 5639 5286 gene locus_tag LOCUS_20960 gene folB 5639 5286 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_20960 5881 6858 gene locus_tag LOCUS_20970 gene trxB 5881 6858 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_20970 7138 6908 gene locus_tag LOCUS_20980 7138 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 7469 8020 gene locus_tag LOCUS_20990 7469 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 8918 8031 gene locus_tag LOCUS_21000 8918 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10054 9035 gene locus_tag LOCUS_21010 10054 9035 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_21010 10620 10222 gene locus_tag LOCUS_21020 10620 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 11740 10694 gene locus_tag LOCUS_21030 11740 10694 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_21030 13017 11761 gene locus_tag LOCUS_21040 13017 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 14750 13257 gene locus_tag LOCUS_21050 gene hflX 14750 13257 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_21050 15632 14757 gene locus_tag LOCUS_21060 gene dapF 15632 14757 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140817.1 protein_id gnl|my_center|LOCUS_21060 16679 15645 gene locus_tag LOCUS_21070 gene miaA 16679 15645 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_21070 17127 16789 gene locus_tag LOCUS_21080 17127 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 17302 17976 gene locus_tag LOCUS_21090 17302 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 18052 19065 gene locus_tag LOCUS_21100 18052 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence064 <1 1131 gene locus_tag LOCUS_21110 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467774.1:ABC transporter substrate-binding protein 1239 2246 gene locus_tag LOCUS_21120 1239 2246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_21120 2268 3119 gene locus_tag LOCUS_21130 2268 3119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_21130 3477 3259 gene locus_tag LOCUS_21140 3477 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3477 4205 gene locus_tag LOCUS_21150 3477 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21150 4202 5218 gene locus_tag LOCUS_21160 4202 5218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868062.1 protein_id gnl|my_center|LOCUS_21160 7261 5309 gene locus_tag LOCUS_21170 7261 5309 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_21170 7940 7281 gene locus_tag LOCUS_21180 7940 7281 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530712.1 protein_id gnl|my_center|LOCUS_21180 8193 9293 gene locus_tag LOCUS_21190 8193 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 9362 10078 gene locus_tag LOCUS_21200 9362 10078 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 protein_id gnl|my_center|LOCUS_21200 10135 11289 gene locus_tag LOCUS_21210 10135 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 11291 11782 gene locus_tag LOCUS_21220 11291 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 12043 14070 gene locus_tag LOCUS_21230 gene ppk1 12043 14070 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_21230 14953 14135 gene locus_tag LOCUS_21240 gene galU 14953 14135 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_21240 15589 15242 gene locus_tag LOCUS_21250 15589 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 15874 15593 gene locus_tag LOCUS_21260 15874 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 16235 15783 gene locus_tag LOCUS_21270 16235 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 18228 16303 gene locus_tag LOCUS_21280 18228 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 19005 18400 gene locus_tag LOCUS_21290 19005 18400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190882.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence065 1945 2586 gene locus_tag LOCUS_21300 1945 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3230 2763 gene locus_tag LOCUS_21310 3230 2763 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 protein_id gnl|my_center|LOCUS_21310 4538 3294 gene locus_tag LOCUS_21320 gene thrC 4538 3294 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_21320 4765 6561 gene locus_tag LOCUS_21330 4765 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6677 7870 gene locus_tag LOCUS_21340 6677 7870 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_21340 8269 7976 gene locus_tag LOCUS_21350 8269 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 8397 8197 gene locus_tag LOCUS_21360 8397 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 9358 8504 gene locus_tag LOCUS_21370 9358 8504 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930246.1 protein_id gnl|my_center|LOCUS_21370 10854 9445 gene locus_tag LOCUS_21380 10854 9445 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_21380 11630 10935 gene locus_tag LOCUS_21390 11630 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 11760 12533 gene locus_tag LOCUS_21400 11760 12533 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_21400 13793 12972 gene locus_tag LOCUS_21410 13793 12972 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_21410 15026 13980 gene locus_tag LOCUS_21420 gene corA 15026 13980 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_21420 16221 15259 gene locus_tag LOCUS_21430 16221 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 16130 16390 gene locus_tag LOCUS_21440 16130 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 16394 16699 gene locus_tag LOCUS_21450 16394 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence066 209 1198 gene locus_tag LOCUS_21460 209 1198 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_21460 1219 2283 gene locus_tag LOCUS_21470 1219 2283 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_21470 2280 3281 gene locus_tag LOCUS_21480 2280 3281 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_21480 4088 3315 gene locus_tag LOCUS_21490 4088 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4188 4493 gene locus_tag LOCUS_21500 4188 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4456 5448 gene locus_tag LOCUS_21510 4456 5448 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_21510 5513 6454 gene locus_tag LOCUS_21520 5513 6454 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_21520 6451 7347 gene locus_tag LOCUS_21530 6451 7347 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_21530 8493 7357 gene locus_tag LOCUS_21540 gene tal 8493 7357 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_21540 9363 8587 gene locus_tag LOCUS_21550 9363 8587 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_21550 10183 9377 gene locus_tag LOCUS_21560 10183 9377 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_21560 10364 11413 gene locus_tag LOCUS_21570 10364 11413 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_21570 11454 12392 gene locus_tag LOCUS_21580 11454 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14065 12578 gene locus_tag LOCUS_21590 14065 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 15226 14207 gene locus_tag LOCUS_21600 15226 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 15143 15625 gene locus_tag LOCUS_21610 15143 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 16321 15548 gene locus_tag LOCUS_21620 16321 15548 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence067 411 1400 gene locus_tag LOCUS_21630 411 1400 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_21630 1414 1677 gene locus_tag LOCUS_21640 1414 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1719 2105 gene locus_tag LOCUS_21650 1719 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2338 3735 gene locus_tag LOCUS_21660 2338 3735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_21660 3776 3943 gene locus_tag LOCUS_21670 3776 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3940 4887 gene locus_tag LOCUS_21680 3940 4887 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978441.1 protein_id gnl|my_center|LOCUS_21680 5610 6668 gene locus_tag LOCUS_21690 5610 6668 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_21690 6665 8071 gene locus_tag LOCUS_21700 6665 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 8400 8600 gene locus_tag LOCUS_21710 8400 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 9942 8830 gene locus_tag LOCUS_21720 9942 8830 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_21720 10348 10076 gene locus_tag LOCUS_21730 10348 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 10302 10580 gene locus_tag LOCUS_21740 10302 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 10574 11803 gene locus_tag LOCUS_21750 10574 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 11939 12754 gene locus_tag LOCUS_21760 11939 12754 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022990.1 protein_id gnl|my_center|LOCUS_21760 12747 13670 gene locus_tag LOCUS_21770 12747 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 14516 13743 gene locus_tag LOCUS_21780 14516 13743 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_21780 15880 14606 gene locus_tag LOCUS_21790 15880 14606 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552062.1 protein_id gnl|my_center|LOCUS_21790 16457 15954 gene locus_tag LOCUS_21800 16457 15954 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304069.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence068 982 440 gene locus_tag LOCUS_21810 gene grpE 982 440 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_21810 3113 1137 gene locus_tag LOCUS_21820 gene dnaK 3113 1137 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_21820 5640 3175 gene locus_tag LOCUS_21830 gene lon 5640 3175 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172865.1 protein_id gnl|my_center|LOCUS_21830 7071 5782 gene locus_tag LOCUS_21840 7071 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7730 7095 gene locus_tag LOCUS_21850 7730 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 7927 9048 gene locus_tag LOCUS_21860 7927 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10043 9147 gene locus_tag LOCUS_21870 10043 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 10310 11281 gene locus_tag LOCUS_21880 gene gmd 10310 11281 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_21880 11690 11382 gene locus_tag LOCUS_21890 gene groES 11690 11382 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_21890 11985 13544 gene locus_tag LOCUS_21900 11985 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 13694 14500 gene locus_tag LOCUS_21910 gene ccsB 13694 14500 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_21910 14520 15116 gene locus_tag LOCUS_21920 14520 15116 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269085.1 protein_id gnl|my_center|LOCUS_21920 16253 15129 gene locus_tag LOCUS_21930 gene tsaD 16253 15129 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_21930 <17130 16389 gene locus_tag LOCUS_21940 <17130 16389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258576.1:ribosomal protein S18-alanine N-acetyltransferase >Feature sequence069 1145 1429 gene locus_tag LOCUS_21950 1145 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1422 2882 gene locus_tag LOCUS_21960 1422 2882 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727400.1 protein_id gnl|my_center|LOCUS_21960 3045 3845 gene locus_tag LOCUS_21970 3045 3845 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_21970 4239 3829 gene locus_tag LOCUS_21980 4239 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5543 4338 gene locus_tag LOCUS_21990 5543 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 5713 5639 gene locus_tag LOCUS_t00270 5713 5639 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5909 5825 gene locus_tag LOCUS_t00280 5909 5825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6064 6140 gene locus_tag LOCUS_t00290 6064 6140 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7031 6159 gene locus_tag LOCUS_22000 7031 6159 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_22000 7178 7252 gene locus_tag LOCUS_t00300 7178 7252 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8308 7259 gene locus_tag LOCUS_22010 8308 7259 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_22010 9817 8420 gene locus_tag LOCUS_22020 9817 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 10659 12167 gene locus_tag LOCUS_22030 10659 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 12155 12610 gene locus_tag LOCUS_22040 12155 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 12628 12879 gene locus_tag LOCUS_22050 12628 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 13604 12897 gene locus_tag LOCUS_22060 13604 12897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_22060 13826 14794 gene locus_tag LOCUS_22070 13826 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 15277 14894 gene locus_tag LOCUS_22080 15277 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 16015 15389 gene locus_tag LOCUS_22090 16015 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence070 <1 1903 gene locus_tag LOCUS_22100 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein note possible pseudo, frameshifted 1897 3219 gene locus_tag LOCUS_22110 1897 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22110 3320 6397 gene locus_tag LOCUS_22120 3320 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6515 9160 gene locus_tag LOCUS_22130 6515 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9157 9930 gene locus_tag LOCUS_22140 9157 9930 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_22140 10156 11994 gene locus_tag LOCUS_22150 gene aspS 10156 11994 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_22150 12214 13617 gene locus_tag LOCUS_22160 12214 13617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_22160 13758 14717 gene locus_tag LOCUS_22170 13758 14717 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_22170 14722 15573 gene locus_tag LOCUS_22180 14722 15573 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence071 1205 3 gene locus_tag LOCUS_22190 gene tuf 1205 3 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_22190 1459 1385 gene locus_tag LOCUS_t00310 1459 1385 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1646 1573 gene locus_tag LOCUS_t00320 1646 1573 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2321 1689 gene locus_tag LOCUS_22200 gene rlmB 2321 1689 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 protein_id gnl|my_center|LOCUS_22200 3649 2852 gene locus_tag LOCUS_22210 gene cysE 3649 2852 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257712.1 protein_id gnl|my_center|LOCUS_22210 5049 3826 gene locus_tag LOCUS_22220 5049 3826 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_22220 6571 5102 gene locus_tag LOCUS_22230 gene radA 6571 5102 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_22230 9375 6880 gene locus_tag LOCUS_22240 9375 6880 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_22240 10715 9543 gene locus_tag LOCUS_22250 gene rpsA 10715 9543 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_22250 11047 11496 gene locus_tag LOCUS_22260 11047 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 12127 11516 gene locus_tag LOCUS_22270 12127 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 12458 12383 gene locus_tag LOCUS_t00330 12458 12383 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12584 13513 gene locus_tag LOCUS_22280 12584 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 13634 13957 gene locus_tag LOCUS_22290 13634 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 14722 16188 gene locus_tag LOCUS_22300 14722 16188 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence072 <1 688 gene locus_tag LOCUS_22310 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257731.1:sigma-70 family RNA polymerase sigma factor 860 1615 gene locus_tag LOCUS_22320 860 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2127 1633 gene locus_tag LOCUS_22330 2127 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2267 2749 gene locus_tag LOCUS_22340 2267 2749 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_22340 3244 3534 gene locus_tag LOCUS_22350 gene gatC 3244 3534 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_22350 3621 5258 gene locus_tag LOCUS_22360 gene gatA 3621 5258 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_22360 5255 6538 gene locus_tag LOCUS_22370 5255 6538 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_22370 6601 8022 gene locus_tag LOCUS_22380 gene gatB 6601 8022 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_22380 8015 9643 gene locus_tag LOCUS_22390 8015 9643 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257120.1 protein_id gnl|my_center|LOCUS_22390 10780 9938 gene locus_tag LOCUS_22400 10780 9938 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_22400 11670 10795 gene locus_tag LOCUS_22410 11670 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 11800 13428 gene locus_tag LOCUS_22420 11800 13428 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259564.1 protein_id gnl|my_center|LOCUS_22420 14730 13531 gene locus_tag LOCUS_22430 14730 13531 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_22430 <16240 14900 gene locus_tag LOCUS_22440 <16240 14900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase >Feature sequence073 843 463 gene locus_tag LOCUS_22450 gene rpsG 843 463 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_22450 1464 1012 gene locus_tag LOCUS_22460 gene rpsL 1464 1012 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_22460 3576 1678 gene locus_tag LOCUS_22470 3576 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22470 6023 3573 gene locus_tag LOCUS_22480 6023 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 6771 6382 gene locus_tag LOCUS_22490 6771 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 7327 7013 gene locus_tag LOCUS_22500 7327 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 7865 7368 gene locus_tag LOCUS_22510 7865 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8106 9536 gene locus_tag LOCUS_22520 8106 9536 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_22520 10363 9548 gene locus_tag LOCUS_22530 10363 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 11264 10428 gene locus_tag LOCUS_22540 11264 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 12913 11438 gene locus_tag LOCUS_22550 12913 11438 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_22550 13806 12997 gene locus_tag LOCUS_22560 13806 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 14873 13803 gene locus_tag LOCUS_22570 14873 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 15822 15262 gene locus_tag LOCUS_22580 15822 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence074 1110 2564 gene locus_tag LOCUS_22590 1110 2564 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763187.1 protein_id gnl|my_center|LOCUS_22590 2699 3691 gene locus_tag LOCUS_22600 2699 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3883 5268 gene locus_tag LOCUS_22610 3883 5268 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_22610 5443 6603 gene locus_tag LOCUS_22620 5443 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 8023 7178 gene locus_tag LOCUS_22630 8023 7178 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_22630 8294 9016 gene locus_tag LOCUS_22640 8294 9016 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_22640 9074 10249 gene locus_tag LOCUS_22650 gene rhmD 9074 10249 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_22650 11094 10318 gene locus_tag LOCUS_22660 11094 10318 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_22660 12450 11104 gene locus_tag LOCUS_22670 12450 11104 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414579.1 protein_id gnl|my_center|LOCUS_22670 12570 14399 gene locus_tag LOCUS_22680 12570 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_22680 14514 15155 gene locus_tag LOCUS_22690 14514 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 15897 15214 gene locus_tag LOCUS_22700 15897 15214 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence075 557 228 gene locus_tag LOCUS_22710 557 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1378 554 gene locus_tag LOCUS_22720 gene glpF 1378 554 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092166.1 protein_id gnl|my_center|LOCUS_22720 3382 1811 gene locus_tag LOCUS_22730 3382 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4095 3586 gene locus_tag LOCUS_22740 4095 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5631 4261 gene locus_tag LOCUS_22750 5631 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5703 6230 gene locus_tag LOCUS_22760 5703 6230 CDS product arsinothricin resistance N-acetyltransferase ArsN1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 protein_id gnl|my_center|LOCUS_22760 6985 6254 gene locus_tag LOCUS_22770 6985 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7155 7823 gene locus_tag LOCUS_22780 7155 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7970 8182 gene locus_tag LOCUS_22790 7970 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 8869 9642 gene locus_tag LOCUS_22800 8869 9642 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_22800 9639 10868 gene locus_tag LOCUS_22810 gene coaBC 9639 10868 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_22810 12095 11058 gene locus_tag LOCUS_22820 12095 11058 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907513.1 protein_id gnl|my_center|LOCUS_22820 12165 12575 gene locus_tag LOCUS_22830 12165 12575 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_22830 12649 13881 gene locus_tag LOCUS_22840 12649 13881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_22840 13953 14615 gene locus_tag LOCUS_22850 13953 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 14802 15089 gene locus_tag LOCUS_22860 14802 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence076 <1 685 gene locus_tag LOCUS_22870 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921052.1:amidohydrolase 696 1040 gene locus_tag LOCUS_22880 696 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2108 1119 gene locus_tag LOCUS_22890 2108 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2201 4696 gene locus_tag LOCUS_22900 2201 4696 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_22900 4855 7311 gene locus_tag LOCUS_22910 4855 7311 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_22910 7588 7376 gene locus_tag LOCUS_22920 7588 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 8244 7768 gene locus_tag LOCUS_22930 8244 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 9012 8353 gene locus_tag LOCUS_22940 gene nadD 9012 8353 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_22940 9808 9005 gene locus_tag LOCUS_22950 9808 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 10150 9881 gene locus_tag LOCUS_22960 gene xseB 10150 9881 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367987.1 protein_id gnl|my_center|LOCUS_22960 11497 10151 gene locus_tag LOCUS_22970 gene xseA 11497 10151 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234453.1 protein_id gnl|my_center|LOCUS_22970 11776 12957 gene locus_tag LOCUS_22980 11776 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 13328 13519 gene locus_tag LOCUS_22990 13328 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 14287 13547 gene locus_tag LOCUS_23000 14287 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <15360 14512 gene locus_tag LOCUS_23010 <15360 14512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001011576.1:(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence077 939 115 gene locus_tag LOCUS_23020 939 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1419 949 gene locus_tag LOCUS_23030 1419 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1372 1572 gene locus_tag LOCUS_23040 1372 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2480 1923 gene locus_tag LOCUS_23050 2480 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2776 2967 gene locus_tag LOCUS_23060 2776 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3270 3854 gene locus_tag LOCUS_23070 3270 3854 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928648.1 protein_id gnl|my_center|LOCUS_23070 4992 3856 gene locus_tag LOCUS_23080 gene ada 4992 3856 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208972.1 protein_id gnl|my_center|LOCUS_23080 5211 6272 gene locus_tag LOCUS_23090 5211 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 6278 7765 gene locus_tag LOCUS_23100 6278 7765 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_23100 7961 8425 gene locus_tag LOCUS_23110 7961 8425 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_23110 8713 9489 gene locus_tag LOCUS_23120 8713 9489 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_23120 9562 10455 gene locus_tag LOCUS_23130 9562 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 11381 10368 gene locus_tag LOCUS_23140 11381 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11713 12663 gene locus_tag LOCUS_23150 11713 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 12766 13425 gene locus_tag LOCUS_23160 gene pyrE 12766 13425 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_23160 14031 14107 gene locus_tag LOCUS_t00340 14031 14107 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 929 2176 gene locus_tag LOCUS_23170 929 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257322.1 protein_id gnl|my_center|LOCUS_23170 2847 2212 gene locus_tag LOCUS_23180 2847 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2788 3048 gene locus_tag LOCUS_23190 2788 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4009 3125 gene locus_tag LOCUS_23200 4009 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4661 4023 gene locus_tag LOCUS_23210 4661 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4746 4982 gene locus_tag LOCUS_23220 4746 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 5186 5491 gene locus_tag LOCUS_23230 gene rpsP 5186 5491 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720111.1 protein_id gnl|my_center|LOCUS_23230 5505 5732 gene locus_tag LOCUS_23240 5505 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 6032 6505 gene locus_tag LOCUS_23250 gene rimM 6032 6505 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_23250 6564 7361 gene locus_tag LOCUS_23260 gene trmD 6564 7361 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_23260 7460 7810 gene locus_tag LOCUS_23270 gene rplS 7460 7810 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_23270 7948 8586 gene locus_tag LOCUS_23280 7948 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 9125 9322 gene locus_tag LOCUS_23290 9125 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 10735 9323 gene locus_tag LOCUS_23300 10735 9323 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_23300 12186 10732 gene locus_tag LOCUS_23310 12186 10732 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259723.1 protein_id gnl|my_center|LOCUS_23310 12677 12183 gene locus_tag LOCUS_23320 12677 12183 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_23320 13563 12727 gene locus_tag LOCUS_23330 13563 12727 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_23330 13701 14000 gene locus_tag LOCUS_23340 13701 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 13997 14302 gene locus_tag LOCUS_23350 13997 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 14299 14817 gene locus_tag LOCUS_23360 14299 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence079 123 596 gene locus_tag LOCUS_23370 123 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 796 1086 gene locus_tag LOCUS_23380 796 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1910 1332 gene locus_tag LOCUS_23390 1910 1332 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_23390 3197 2166 gene locus_tag LOCUS_23400 3197 2166 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_23400 5148 3268 gene locus_tag LOCUS_23410 5148 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975439.1 protein_id gnl|my_center|LOCUS_23410 5369 5824 gene locus_tag LOCUS_23420 5369 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 7457 5841 gene locus_tag LOCUS_23430 7457 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9014 7566 gene locus_tag LOCUS_23440 9014 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9302 10471 gene locus_tag LOCUS_23450 9302 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 10540 10923 gene locus_tag LOCUS_23460 10540 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 10945 11424 gene locus_tag LOCUS_23470 10945 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 11429 12418 gene locus_tag LOCUS_23480 11429 12418 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_23480 12561 13601 gene locus_tag LOCUS_23490 12561 13601 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_23490 13625 14434 gene locus_tag LOCUS_23500 13625 14434 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201007.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence080 <1 914 gene locus_tag LOCUS_23510 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085891.1:thiamine pyrophosphate-requiring protein 1024 1191 gene locus_tag LOCUS_23520 1024 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1191 1667 gene locus_tag LOCUS_23530 1191 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2220 1696 gene locus_tag LOCUS_23540 2220 1696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090500.1 protein_id gnl|my_center|LOCUS_23540 3606 2329 gene locus_tag LOCUS_23550 3606 2329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_23550 4667 3678 gene locus_tag LOCUS_23560 4667 3678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_23560 6974 4890 gene locus_tag LOCUS_23570 6974 4890 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_23570 7434 8213 gene locus_tag LOCUS_23580 7434 8213 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_23580 8457 9599 gene locus_tag LOCUS_23590 8457 9599 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_23590 9832 11145 gene locus_tag LOCUS_23600 9832 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 11212 12144 gene locus_tag LOCUS_23610 11212 12144 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_23610 12141 13103 gene locus_tag LOCUS_23620 12141 13103 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_23620 13845 13132 gene locus_tag LOCUS_23630 13845 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence081 <1 1117 gene locus_tag LOCUS_23640 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase 2574 1150 gene locus_tag LOCUS_23650 2574 1150 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_23650 2860 4452 gene locus_tag LOCUS_23660 gene aceB 2860 4452 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_23660 5190 4660 gene locus_tag LOCUS_23670 5190 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 5430 7175 gene locus_tag LOCUS_23680 5430 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7336 8385 gene locus_tag LOCUS_23690 7336 8385 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888703.1 protein_id gnl|my_center|LOCUS_23690 9759 8455 gene locus_tag LOCUS_23700 9759 8455 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_23700 10955 9855 gene locus_tag LOCUS_23710 10955 9855 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_23710 12220 11063 gene locus_tag LOCUS_23720 12220 11063 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_23720 12720 12505 gene locus_tag LOCUS_23730 12720 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence082 <1 760 gene locus_tag LOCUS_23740 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582463.1:phosphoglycerate dehydrogenase 764 1051 gene locus_tag LOCUS_23750 764 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1452 1967 gene locus_tag LOCUS_23760 1452 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3192 1981 gene locus_tag LOCUS_23770 3192 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_23770 3326 3919 gene locus_tag LOCUS_23780 3326 3919 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_23780 4057 5322 gene locus_tag LOCUS_23790 4057 5322 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_23790 5500 6909 gene locus_tag LOCUS_23800 5500 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 6896 7753 gene locus_tag LOCUS_23810 6896 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8315 7917 gene locus_tag LOCUS_23820 8315 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8642 9289 gene locus_tag LOCUS_23830 8642 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 9823 9476 gene locus_tag LOCUS_23840 9823 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 10186 9851 gene locus_tag LOCUS_23850 10186 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10080 10493 gene locus_tag LOCUS_23860 10080 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 10490 14716 gene locus_tag LOCUS_23870 10490 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence083 1756 152 gene locus_tag LOCUS_23880 1756 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2095 3144 gene locus_tag LOCUS_23890 2095 3144 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533013.1 protein_id gnl|my_center|LOCUS_23890 5337 3229 gene locus_tag LOCUS_23900 gene ilvG 5337 3229 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 protein_id gnl|my_center|LOCUS_23900 5387 5578 gene locus_tag LOCUS_23910 5387 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5982 6389 gene locus_tag LOCUS_23920 5982 6389 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_23920 6412 6831 gene locus_tag LOCUS_23930 6412 6831 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_23930 7506 6946 gene locus_tag LOCUS_23940 7506 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 8168 7701 gene locus_tag LOCUS_23950 8168 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 9798 8341 gene locus_tag LOCUS_23960 9798 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10162 9968 gene locus_tag LOCUS_23970 10162 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 11237 10245 gene locus_tag LOCUS_23980 11237 10245 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_23980 11630 11244 gene locus_tag LOCUS_23990 11630 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 12021 12455 gene locus_tag LOCUS_24000 12021 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 12576 13895 gene locus_tag LOCUS_24010 12576 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence084 582 220 gene locus_tag LOCUS_24020 582 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1166 2038 gene locus_tag LOCUS_24030 1166 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2304 3509 gene locus_tag LOCUS_24040 2304 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3523 3954 gene locus_tag LOCUS_24050 3523 3954 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_24050 4123 4818 gene locus_tag LOCUS_24060 4123 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 6002 4878 gene locus_tag LOCUS_24070 6002 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 6205 7638 gene locus_tag LOCUS_24080 6205 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7635 8666 gene locus_tag LOCUS_24090 7635 8666 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_24090 11296 8936 gene locus_tag LOCUS_24100 11296 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 14179 11795 gene locus_tag LOCUS_24110 14179 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence085 <1 1765 gene locus_tag LOCUS_24120 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268660.1:RecQ family ATP-dependent DNA helicase 1762 2826 gene locus_tag LOCUS_24130 1762 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2953 3294 gene locus_tag LOCUS_24140 2953 3294 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_24140 4004 3372 gene locus_tag LOCUS_24150 4004 3372 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_24150 4190 5188 gene locus_tag LOCUS_24160 4190 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 8310 5272 gene locus_tag LOCUS_24170 8310 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 9317 8307 gene locus_tag LOCUS_24180 9317 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 10542 9505 gene locus_tag LOCUS_24190 10542 9505 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_24190 11589 10624 gene locus_tag LOCUS_24200 11589 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence086 935 699 gene locus_tag LOCUS_24210 935 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 1612 932 gene locus_tag LOCUS_24220 1612 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2333 2728 gene locus_tag LOCUS_24230 2333 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4158 2824 gene locus_tag LOCUS_24240 4158 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4368 4997 gene locus_tag LOCUS_24250 4368 4997 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_24250 5961 5032 gene locus_tag LOCUS_24260 5961 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 6438 6046 gene locus_tag LOCUS_24270 6438 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 7109 6495 gene locus_tag LOCUS_24280 7109 6495 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_24280 9138 7171 gene locus_tag LOCUS_24290 gene ctaD 9138 7171 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_24290 10284 9172 gene locus_tag LOCUS_24300 gene coxB 10284 9172 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 protein_id gnl|my_center|LOCUS_24300 11517 10519 gene locus_tag LOCUS_24310 11517 10519 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728677.1 protein_id gnl|my_center|LOCUS_24310 11767 11492 gene locus_tag LOCUS_24320 11767 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 11669 12703 gene locus_tag LOCUS_24330 11669 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 12767 13891 gene locus_tag LOCUS_24340 12767 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence087 1282 437 gene locus_tag LOCUS_24350 1282 437 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_24350 1800 1435 gene locus_tag LOCUS_24360 1800 1435 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_24360 1923 2288 gene locus_tag LOCUS_24370 1923 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2335 2709 gene locus_tag LOCUS_24380 2335 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2807 2992 gene locus_tag LOCUS_24390 2807 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4567 3008 gene locus_tag LOCUS_24400 4567 3008 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_24400 4814 6394 gene locus_tag LOCUS_24410 4814 6394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_24410 6478 7419 gene locus_tag LOCUS_24420 6478 7419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_24420 7469 8281 gene locus_tag LOCUS_24430 7469 8281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_24430 10538 8745 gene locus_tag LOCUS_24440 10538 8745 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_24440 11473 10628 gene locus_tag LOCUS_24450 11473 10628 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_24450 12292 11681 gene locus_tag LOCUS_24460 12292 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13170 12289 gene locus_tag LOCUS_24470 gene lipA 13170 12289 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence088 1486 1148 gene locus_tag LOCUS_24480 1486 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1610 3001 gene locus_tag LOCUS_24490 1610 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5648 3024 gene locus_tag LOCUS_24500 5648 3024 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_24500 7196 5877 gene locus_tag LOCUS_24510 7196 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 7507 7196 gene locus_tag LOCUS_24520 7507 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 7433 7618 gene locus_tag LOCUS_24530 7433 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 9277 8054 gene locus_tag LOCUS_24540 9277 8054 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971597.1 protein_id gnl|my_center|LOCUS_24540 10481 9336 gene locus_tag LOCUS_24550 gene dgoD 10481 9336 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_24550 10876 12783 gene locus_tag LOCUS_24560 gene typA 10876 12783 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_24560 13675 12887 gene locus_tag LOCUS_24570 13675 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence089 3656 588 gene locus_tag LOCUS_24580 3656 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5563 3653 gene locus_tag LOCUS_24590 5563 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 6362 5571 gene locus_tag LOCUS_24600 6362 5571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_24600 7028 6708 gene locus_tag LOCUS_24610 7028 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 7239 8219 gene locus_tag LOCUS_24620 7239 8219 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258131.1 protein_id gnl|my_center|LOCUS_24620 8678 9115 gene locus_tag LOCUS_24630 8678 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9167 10147 gene locus_tag LOCUS_24640 9167 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 11260 10184 gene locus_tag LOCUS_24650 11260 10184 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence090 12 998 gene locus_tag LOCUS_24660 12 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1454 1026 gene locus_tag LOCUS_24670 1454 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1776 2093 gene locus_tag LOCUS_24680 1776 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2126 2707 gene locus_tag LOCUS_24690 2126 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3810 2737 gene locus_tag LOCUS_24700 3810 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4551 4369 gene locus_tag LOCUS_24710 4551 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4966 4754 gene locus_tag LOCUS_24720 4966 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4926 9080 gene locus_tag LOCUS_24730 4926 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence091 829 359 gene locus_tag LOCUS_24740 829 359 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434115.1 protein_id gnl|my_center|LOCUS_24740 1395 1321 gene locus_tag LOCUS_t00350 1395 1321 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2739 1501 gene locus_tag LOCUS_24750 gene rpoD 2739 1501 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_24750 3706 2846 gene locus_tag LOCUS_24760 3706 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4826 3657 gene locus_tag LOCUS_24770 4826 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 7679 5004 gene locus_tag LOCUS_24780 gene ppdK 7679 5004 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_24780 9237 7897 gene locus_tag LOCUS_24790 9237 7897 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_24790 9507 10592 gene locus_tag LOCUS_24800 9507 10592 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_24800 12071 10623 gene locus_tag LOCUS_24810 12071 10623 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 protein_id gnl|my_center|LOCUS_24810 12814 12068 gene locus_tag LOCUS_24820 12814 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 12716 13051 gene locus_tag LOCUS_24830 12716 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence092 119 1051 gene locus_tag LOCUS_24840 119 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 2282 1218 gene locus_tag LOCUS_24850 2282 1218 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_24850 3363 2293 gene locus_tag LOCUS_24860 3363 2293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_24860 4292 3363 gene locus_tag LOCUS_24870 4292 3363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_24870 5316 4348 gene locus_tag LOCUS_24880 5316 4348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_24880 7254 5419 gene locus_tag LOCUS_24890 7254 5419 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_24890 8371 7505 gene locus_tag LOCUS_24900 8371 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 9577 8384 gene locus_tag LOCUS_24910 9577 8384 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_24910 9617 10168 gene locus_tag LOCUS_24920 9617 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 11485 10199 gene locus_tag LOCUS_24930 11485 10199 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24930 >Feature sequence093 85 1023 gene locus_tag LOCUS_24940 85 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1037 1420 gene locus_tag LOCUS_24950 1037 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24950 1567 2385 gene locus_tag LOCUS_24960 gene nadC 1567 2385 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_24960 2599 3000 gene locus_tag LOCUS_24970 2599 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 4009 3053 gene locus_tag LOCUS_24980 4009 3053 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_24980 5560 4103 gene locus_tag LOCUS_24990 gene mazG 5560 4103 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_24990 6764 5553 gene locus_tag LOCUS_25000 6764 5553 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_25000 7371 8228 gene locus_tag LOCUS_25010 7371 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 9074 8280 gene locus_tag LOCUS_25020 9074 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 11315 9126 gene locus_tag LOCUS_25030 11315 9126 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_25030 <11939 11322 gene locus_tag LOCUS_25040 <11939 11322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776877.1:phytanoyl-CoA dioxygenase family protein >Feature sequence094 501 1484 gene locus_tag LOCUS_25050 501 1484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_25050 1534 2751 gene locus_tag LOCUS_25060 1534 2751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970414.1 protein_id gnl|my_center|LOCUS_25060 2812 3945 gene locus_tag LOCUS_25070 2812 3945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 protein_id gnl|my_center|LOCUS_25070 4011 5120 gene locus_tag LOCUS_25080 4011 5120 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_25080 5117 5989 gene locus_tag LOCUS_25090 5117 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 6062 6670 gene locus_tag LOCUS_25100 6062 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7878 7249 gene locus_tag LOCUS_25110 gene nthA 7878 7249 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726895.1 protein_id gnl|my_center|LOCUS_25110 8210 7917 gene locus_tag LOCUS_25120 8210 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8577 8221 gene locus_tag LOCUS_25130 8577 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25130 8703 9737 gene locus_tag LOCUS_25140 8703 9737 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404004.1 protein_id gnl|my_center|LOCUS_25140 9774 10850 gene locus_tag LOCUS_25150 9774 10850 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence095 2751 616 gene locus_tag LOCUS_25160 2751 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2698 2892 gene locus_tag LOCUS_25170 2698 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3281 3904 gene locus_tag LOCUS_25180 3281 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 4452 4919 gene locus_tag LOCUS_25190 4452 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4949 5680 gene locus_tag LOCUS_25200 gene phnH 4949 5680 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861994.1 protein_id gnl|my_center|LOCUS_25200 5682 6947 gene locus_tag LOCUS_25210 5682 6947 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_25210 6940 7842 gene locus_tag LOCUS_25220 6940 7842 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_25220 7839 8741 gene locus_tag LOCUS_25230 7839 8741 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258834.1 protein_id gnl|my_center|LOCUS_25230 8752 9510 gene locus_tag LOCUS_25240 gene phnL 8752 9510 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051689.1 protein_id gnl|my_center|LOCUS_25240 10645 9842 gene locus_tag LOCUS_25250 10645 9842 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_25250 <11363 10803 gene locus_tag LOCUS_25260 <11363 10803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000586325.1:alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase >Feature sequence096 667 1881 gene locus_tag LOCUS_25270 667 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1957 3993 gene locus_tag LOCUS_25280 1957 3993 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_25280 4081 4410 gene locus_tag LOCUS_25290 4081 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 4582 5046 gene locus_tag LOCUS_25300 4582 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 5133 6080 gene locus_tag LOCUS_25310 5133 6080 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_25310 6120 7256 gene locus_tag LOCUS_25320 6120 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 7291 8292 gene locus_tag LOCUS_25330 7291 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 8371 9384 gene locus_tag LOCUS_25340 8371 9384 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_25340 9436 10239 gene locus_tag LOCUS_25350 9436 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence097 451 705 gene locus_tag LOCUS_25360 451 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 702 1076 gene locus_tag LOCUS_25370 702 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1079 1264 gene locus_tag LOCUS_25380 1079 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1219 1695 gene locus_tag LOCUS_25390 1219 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1858 2205 gene locus_tag LOCUS_25400 1858 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2371 2820 gene locus_tag LOCUS_25410 2371 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3265 3092 gene locus_tag LOCUS_25420 3265 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3456 3265 gene locus_tag LOCUS_25430 3456 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4121 3459 gene locus_tag LOCUS_25440 4121 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4723 4232 gene locus_tag LOCUS_25450 4723 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 4830 4758 gene locus_tag LOCUS_t00360 4830 4758 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5034 4855 gene locus_tag LOCUS_25460 5034 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5350 5084 gene locus_tag LOCUS_25470 5350 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 5773 5432 gene locus_tag LOCUS_25480 5773 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 6040 5852 gene locus_tag LOCUS_25490 6040 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 6204 6037 gene locus_tag LOCUS_25500 6204 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 6481 6179 gene locus_tag LOCUS_25510 6481 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 6647 6465 gene locus_tag LOCUS_25520 6647 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 6818 6651 gene locus_tag LOCUS_25530 6818 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 7022 6837 gene locus_tag LOCUS_25540 7022 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 7522 7247 gene locus_tag LOCUS_25550 7522 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 7842 7519 gene locus_tag LOCUS_25560 7842 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 8059 7826 gene locus_tag LOCUS_25570 8059 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 8166 9371 gene locus_tag LOCUS_25580 8166 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 9432 9920 gene locus_tag LOCUS_25590 9432 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 9922 10377 gene locus_tag LOCUS_25600 9922 10377 CDS product NIF family HAD-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 protein_id gnl|my_center|LOCUS_25600 10377 10757 gene locus_tag LOCUS_25610 10377 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence098 <1 1200 gene locus_tag LOCUS_25620 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888355.1:aconitate hydratase AcnA 1647 3800 gene locus_tag LOCUS_25630 1647 3800 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_25630 4259 6268 gene locus_tag LOCUS_25640 4259 6268 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_25640 6639 8987 gene locus_tag LOCUS_25650 6639 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence099 597 331 gene locus_tag LOCUS_25660 597 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1192 575 gene locus_tag LOCUS_25670 1192 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1146 1577 gene locus_tag LOCUS_25680 1146 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2764 1586 gene locus_tag LOCUS_25690 2764 1586 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_25690 3043 4707 gene locus_tag LOCUS_25700 3043 4707 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_25700 4803 5729 gene locus_tag LOCUS_25710 gene dppB 4803 5729 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 protein_id gnl|my_center|LOCUS_25710 5867 6718 gene locus_tag LOCUS_25720 5867 6718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_25720 6770 7897 gene locus_tag LOCUS_25730 6770 7897 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_25730 7894 9957 gene locus_tag LOCUS_25740 7894 9957 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_25740 <10705 10119 gene locus_tag LOCUS_25750 <10705 10119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258927.1:thiamine diphosphokinase >Feature sequence100 1164 37 gene locus_tag LOCUS_25760 1164 37 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_25760 2443 1199 gene locus_tag LOCUS_25770 2443 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2734 3429 gene locus_tag LOCUS_25780 2734 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3426 5087 gene locus_tag LOCUS_25790 3426 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 5948 5262 gene locus_tag LOCUS_25800 5948 5262 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243175.1 protein_id gnl|my_center|LOCUS_25800 6622 5969 gene locus_tag LOCUS_25810 6622 5969 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_25810 7657 6770 gene locus_tag LOCUS_25820 7657 6770 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 protein_id gnl|my_center|LOCUS_25820 8118 9065 gene locus_tag LOCUS_25830 8118 9065 CDS product IS5-like element ISPsy2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054991743.1 protein_id gnl|my_center|LOCUS_25830 9074 9427 gene locus_tag LOCUS_25840 9074 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 10156 9644 gene locus_tag LOCUS_25850 10156 9644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence101 420 1292 gene locus_tag LOCUS_25860 420 1292 CDS product fumarylacetoacetate (FAA) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 protein_id gnl|my_center|LOCUS_25860 2873 1530 gene locus_tag LOCUS_25870 2873 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2987 4411 gene locus_tag LOCUS_25880 2987 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 6047 4509 gene locus_tag LOCUS_25890 6047 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 8178 6286 gene locus_tag LOCUS_25900 8178 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 8587 9105 gene locus_tag LOCUS_25910 8587 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25910 9102 10028 gene locus_tag LOCUS_25920 9102 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 >Feature sequence102 <1 906 gene locus_tag LOCUS_25930 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072763.1:exonuclease SbcCD subunit D 970 4479 gene locus_tag LOCUS_25940 970 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 5167 4532 gene locus_tag LOCUS_25950 5167 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 6227 5172 gene locus_tag LOCUS_25960 6227 5172 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920455.1 protein_id gnl|my_center|LOCUS_25960 6511 7887 gene locus_tag LOCUS_25970 6511 7887 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_25970 7894 8877 gene locus_tag LOCUS_25980 7894 8877 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence103 1853 864 gene locus_tag LOCUS_25990 1853 864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973627.1 protein_id gnl|my_center|LOCUS_25990 4029 1972 gene locus_tag LOCUS_26000 4029 1972 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_26000 4429 4812 gene locus_tag LOCUS_26010 4429 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 7104 5038 gene locus_tag LOCUS_26020 7104 5038 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_26020 7304 8443 gene locus_tag LOCUS_26030 gene dgoD 7304 8443 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_26030 8521 9516 gene locus_tag LOCUS_26040 8521 9516 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence104 <1 1144 gene locus_tag LOCUS_26050 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812102.1:mandelate racemase/muconate lactonizing enzyme family protein 1544 1170 gene locus_tag LOCUS_26060 1544 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1905 4211 gene locus_tag LOCUS_26070 gene ftsH 1905 4211 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_26070 5299 4313 gene locus_tag LOCUS_26080 5299 4313 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_26080 5454 6974 gene locus_tag LOCUS_26090 5454 6974 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_26090 7045 7275 gene locus_tag LOCUS_26100 7045 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 9327 7321 gene locus_tag LOCUS_26110 9327 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 <9989 9422 gene locus_tag LOCUS_26120 <9989 9422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121747.1:TIM barrel protein >Feature sequence105 1439 3829 gene locus_tag LOCUS_26130 1439 3829 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_26130 4362 3838 gene locus_tag LOCUS_26140 4362 3838 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157023138.1 protein_id gnl|my_center|LOCUS_26140 5661 4423 gene locus_tag LOCUS_26150 5661 4423 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_26150 6798 7043 gene locus_tag LOCUS_26160 6798 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7425 8792 gene locus_tag LOCUS_26170 7425 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 9406 8816 gene locus_tag LOCUS_26180 gene rfbC 9406 8816 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence106 2995 4209 gene locus_tag LOCUS_26190 2995 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 4427 4125 gene locus_tag LOCUS_26200 4427 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4360 5187 gene locus_tag LOCUS_26210 4360 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 5516 6766 gene locus_tag LOCUS_26220 5516 6766 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_26220 6930 7721 gene locus_tag LOCUS_26230 gene kduD 6930 7721 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_26230 8580 7810 gene locus_tag LOCUS_26240 8580 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 9503 8580 gene locus_tag LOCUS_26250 9503 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence107 117 27 gene locus_tag LOCUS_t00370 117 27 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2180 189 gene locus_tag LOCUS_26260 2180 189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929981.1 protein_id gnl|my_center|LOCUS_26260 3461 2370 gene locus_tag LOCUS_26270 3461 2370 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_26270 3749 3486 gene locus_tag LOCUS_26280 3749 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4086 3742 gene locus_tag LOCUS_26290 gene yciH 4086 3742 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210612.1 protein_id gnl|my_center|LOCUS_26290 5676 4210 gene locus_tag LOCUS_26300 5676 4210 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_26300 6180 5836 gene locus_tag LOCUS_26310 6180 5836 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688316.1 protein_id gnl|my_center|LOCUS_26310 6366 7166 gene locus_tag LOCUS_26320 6366 7166 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_26320 7395 8393 gene locus_tag LOCUS_26330 7395 8393 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence108 894 2531 gene locus_tag LOCUS_26340 894 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2859 2512 gene locus_tag LOCUS_26350 2859 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2972 4153 gene locus_tag LOCUS_26360 2972 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4370 4951 gene locus_tag LOCUS_26370 4370 4951 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_26370 5291 6427 gene locus_tag LOCUS_26380 gene dgoD 5291 6427 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_26380 6690 6899 gene locus_tag LOCUS_26390 6690 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 6899 7366 gene locus_tag LOCUS_26400 6899 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 7469 8215 gene locus_tag LOCUS_26410 7469 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 8321 8779 gene locus_tag LOCUS_26420 8321 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9033 9368 gene locus_tag LOCUS_26430 9033 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence109 107 310 gene locus_tag LOCUS_26440 107 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 340 1011 gene locus_tag LOCUS_26450 340 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2303 1194 gene locus_tag LOCUS_26460 gene parJ 2303 1194 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_26460 3432 2410 gene locus_tag LOCUS_26470 3432 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3728 4921 gene locus_tag LOCUS_26480 3728 4921 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817351.1 protein_id gnl|my_center|LOCUS_26480 6201 5029 gene locus_tag LOCUS_26490 6201 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6403 7383 gene locus_tag LOCUS_26500 6403 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 8203 7403 gene locus_tag LOCUS_26510 8203 7403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_26510 <8911 8348 gene locus_tag LOCUS_26520 <8911 8348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258638.1:ABC transporter permease >Feature sequence110 4577 978 gene locus_tag LOCUS_26530 4577 978 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_26530 5302 4919 gene locus_tag LOCUS_26540 gene rplL 5302 4919 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316437.1 protein_id gnl|my_center|LOCUS_26540 5847 5320 gene locus_tag LOCUS_26550 gene rplJ 5847 5320 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258052.1 protein_id gnl|my_center|LOCUS_26550 6868 6155 gene locus_tag LOCUS_26560 gene rplA 6868 6155 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_26560 7350 6928 gene locus_tag LOCUS_26570 gene rplK 7350 6928 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_26570 8010 7438 gene locus_tag LOCUS_26580 gene nusG 8010 7438 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_26580 8417 8070 gene locus_tag LOCUS_26590 8417 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence111 1845 349 gene locus_tag LOCUS_26600 1845 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2679 2257 gene locus_tag LOCUS_26610 2679 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2600 2923 gene locus_tag LOCUS_26620 2600 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2920 4461 gene locus_tag LOCUS_26630 2920 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4652 5125 gene locus_tag LOCUS_26640 4652 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5128 5502 gene locus_tag LOCUS_26650 5128 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 6753 5545 gene locus_tag LOCUS_26660 6753 5545 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_26660 6927 7550 gene locus_tag LOCUS_26670 6927 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 8241 7522 gene locus_tag LOCUS_26680 8241 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 8143 8355 gene locus_tag LOCUS_26690 8143 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 8368 8871 gene locus_tag LOCUS_26700 8368 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence112 740 240 gene locus_tag LOCUS_26710 740 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2344 737 gene locus_tag LOCUS_26720 2344 737 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_26720 3217 2375 gene locus_tag LOCUS_26730 3217 2375 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038966.1 protein_id gnl|my_center|LOCUS_26730 3786 3301 gene locus_tag LOCUS_26740 3786 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3968 4753 gene locus_tag LOCUS_26750 3968 4753 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_26750 5565 4834 gene locus_tag LOCUS_26760 5565 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26760 6195 5977 gene locus_tag LOCUS_26770 6195 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 7346 6300 gene locus_tag LOCUS_26780 7346 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence113 <1 1176 gene locus_tag LOCUS_26790 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975246.1:efflux RND transporter periplasmic adaptor subunit 1388 4267 gene locus_tag LOCUS_26800 1388 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4419 5426 gene locus_tag LOCUS_26810 4419 5426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_26810 5548 6429 gene locus_tag LOCUS_26820 5548 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 6477 7211 gene locus_tag LOCUS_26830 6477 7211 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_26830 8481 7273 gene locus_tag LOCUS_26840 8481 7273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence114 515 297 gene locus_tag LOCUS_26850 515 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 769 1347 gene locus_tag LOCUS_26860 769 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1383 1709 gene locus_tag LOCUS_26870 1383 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2295 2092 gene locus_tag LOCUS_26880 2295 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3512 2271 gene locus_tag LOCUS_26890 3512 2271 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 3813 3571 gene locus_tag LOCUS_26900 3813 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3967 6243 gene locus_tag LOCUS_26910 3967 6243 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_26910 6240 8018 gene locus_tag LOCUS_26920 6240 8018 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence115 219 1424 gene locus_tag LOCUS_26930 219 1424 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067758.1 protein_id gnl|my_center|LOCUS_26930 1502 3061 gene locus_tag LOCUS_26940 1502 3061 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_26940 4675 3407 gene locus_tag LOCUS_26950 4675 3407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_26950 5184 4903 gene locus_tag LOCUS_26960 5184 4903 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970104.1 protein_id gnl|my_center|LOCUS_26960 5678 5220 gene locus_tag LOCUS_26970 5678 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 <8534 5694 gene locus_tag LOCUS_26980 <8534 5694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA >Feature sequence116 1769 1350 gene locus_tag LOCUS_26990 1769 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1945 3210 gene locus_tag LOCUS_27000 1945 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3387 3716 gene locus_tag LOCUS_27010 gene trxA 3387 3716 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258400.1 protein_id gnl|my_center|LOCUS_27010 4174 3884 gene locus_tag LOCUS_27020 4174 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4451 4666 gene locus_tag LOCUS_27030 4451 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4987 5565 gene locus_tag LOCUS_27040 4987 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 5562 6005 gene locus_tag LOCUS_27050 5562 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 6163 5939 gene locus_tag LOCUS_27060 6163 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 6453 7232 gene locus_tag LOCUS_27070 gene fabG 6453 7232 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_27070 <7994 7258 gene locus_tag LOCUS_27080 <7994 7258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807374.1:alpha/beta hydrolase >Feature sequence117 105 728 gene locus_tag LOCUS_27090 105 728 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040363.1 protein_id gnl|my_center|LOCUS_27090 762 1778 gene locus_tag LOCUS_27100 762 1778 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_27100 1975 1805 gene locus_tag LOCUS_27110 1975 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 1898 4006 gene locus_tag LOCUS_27120 1898 4006 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120563.1 protein_id gnl|my_center|LOCUS_27120 4163 5326 gene locus_tag LOCUS_27130 4163 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 5396 6535 gene locus_tag LOCUS_27140 gene dgoD 5396 6535 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_27140 7013 6564 gene locus_tag LOCUS_27150 7013 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 7493 7065 gene locus_tag LOCUS_27160 7493 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 7604 7807 gene locus_tag LOCUS_27170 7604 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence118 142 1470 gene locus_tag LOCUS_27180 142 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2390 1605 gene locus_tag LOCUS_27190 2390 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3583 2480 gene locus_tag LOCUS_27200 gene recA 3583 2480 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_27200 4555 3782 gene locus_tag LOCUS_27210 4555 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 <7769 4557 gene locus_tag LOCUS_27220 <7769 4557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence119 379 179 gene locus_tag LOCUS_27230 379 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 579 2480 gene locus_tag LOCUS_27240 579 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3844 2501 gene locus_tag LOCUS_27250 3844 2501 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828469.1 protein_id gnl|my_center|LOCUS_27250 4654 3863 gene locus_tag LOCUS_27260 4654 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 5083 4700 gene locus_tag LOCUS_27270 5083 4700 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967915.1 protein_id gnl|my_center|LOCUS_27270 6342 5080 gene locus_tag LOCUS_27280 6342 5080 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_27280 7676 6447 gene locus_tag LOCUS_27290 7676 6447 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence120 743 1543 gene locus_tag LOCUS_27300 743 1543 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_27300 1707 2324 gene locus_tag LOCUS_27310 1707 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2389 2718 gene locus_tag LOCUS_27320 2389 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2952 3437 gene locus_tag LOCUS_27330 2952 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3529 3744 gene locus_tag LOCUS_27340 3529 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3776 4192 gene locus_tag LOCUS_27350 3776 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4189 4710 gene locus_tag LOCUS_27360 4189 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4838 6439 gene locus_tag LOCUS_27370 4838 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 6564 7202 gene locus_tag LOCUS_27380 6564 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence121 <1 1065 gene locus_tag LOCUS_27390 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257157.1:ABC transporter substrate-binding protein 1198 1288 gene locus_tag LOCUS_t00380 1198 1288 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1326 1400 gene locus_tag LOCUS_t00390 1326 1400 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1458 1533 gene locus_tag LOCUS_t00400 1458 1533 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2031 3041 gene locus_tag LOCUS_27400 gene holB 2031 3041 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_27400 3589 3230 gene locus_tag LOCUS_27410 3589 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3485 4000 gene locus_tag LOCUS_27420 gene dtd 3485 4000 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_27420 4056 5591 gene locus_tag LOCUS_27430 gene hisZ 4056 5591 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257149.1 protein_id gnl|my_center|LOCUS_27430 5588 6616 gene locus_tag LOCUS_27440 gene hisG 5588 6616 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257147.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence122 771 529 gene locus_tag LOCUS_27450 771 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1120 2445 gene locus_tag LOCUS_27460 1120 2445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_27460 3063 2470 gene locus_tag LOCUS_27470 3063 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3611 3069 gene locus_tag LOCUS_27480 3611 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4331 3783 gene locus_tag LOCUS_27490 4331 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 5001 4534 gene locus_tag LOCUS_27500 5001 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5154 5639 gene locus_tag LOCUS_27510 5154 5639 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_27510 5801 6844 gene locus_tag LOCUS_27520 5801 6844 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 protein_id gnl|my_center|LOCUS_27520 6828 7412 gene locus_tag LOCUS_27530 6828 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence123 1114 62 gene locus_tag LOCUS_27540 1114 62 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_27540 2332 1439 gene locus_tag LOCUS_27550 2332 1439 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_27550 4442 2751 gene locus_tag LOCUS_27560 gene murJ 4442 2751 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_27560 5056 4439 gene locus_tag LOCUS_27570 5056 4439 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_27570 6358 5177 gene locus_tag LOCUS_27580 6358 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 <7259 6587 gene locus_tag LOCUS_27590 <7259 6587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205614.1:tetratricopeptide repeat protein >Feature sequence124 1641 2057 gene locus_tag LOCUS_27600 1641 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence125 1607 2668 gene locus_tag LOCUS_27610 1607 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3231 4706 gene locus_tag LOCUS_27620 3231 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 5023 4805 gene locus_tag LOCUS_27630 5023 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5203 5382 gene locus_tag LOCUS_27640 5203 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6048 7082 gene locus_tag LOCUS_27650 6048 7082 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence126 2021 477 gene locus_tag LOCUS_27660 2021 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2936 2160 gene locus_tag LOCUS_27670 2936 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4474 2930 gene locus_tag LOCUS_27680 4474 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4653 5882 gene locus_tag LOCUS_27690 4653 5882 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104261.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence127 2809 470 gene locus_tag LOCUS_27700 gene uvrC 2809 470 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_27700 3044 4291 gene locus_tag LOCUS_27710 3044 4291 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_27710 4337 4999 gene locus_tag LOCUS_27720 4337 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 5537 6166 gene locus_tag LOCUS_27730 5537 6166 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082813.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence128 453 635 gene locus_tag LOCUS_27740 453 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2688 709 gene locus_tag LOCUS_27750 2688 709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_27750 2919 3989 gene locus_tag LOCUS_27760 2919 3989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_27760 4039 4872 gene locus_tag LOCUS_27770 4039 4872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082483.1 protein_id gnl|my_center|LOCUS_27770 5004 5963 gene locus_tag LOCUS_27780 5004 5963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706885.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence129 2884 2282 gene locus_tag LOCUS_27790 2884 2282 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 protein_id gnl|my_center|LOCUS_27790 3008 3808 gene locus_tag LOCUS_27800 gene ppk2 3008 3808 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_27800 3979 4251 gene locus_tag LOCUS_27810 3979 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 4393 5841 gene locus_tag LOCUS_27820 gene miaB 4393 5841 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence130 133 1116 gene locus_tag LOCUS_27830 133 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1272 1583 gene locus_tag LOCUS_27840 1272 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1469 2014 gene locus_tag LOCUS_27850 1469 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2002 2325 gene locus_tag LOCUS_27860 2002 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 4052 2445 gene locus_tag LOCUS_27870 4052 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4309 5760 gene locus_tag LOCUS_27880 4309 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 <6991 5854 gene locus_tag LOCUS_27890 <6991 5854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162708822.1:muconate cycloisomerase family protein >Feature sequence131 1562 915 gene locus_tag LOCUS_27900 1562 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 3370 1823 gene locus_tag LOCUS_27910 3370 1823 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_27910 3522 3692 gene locus_tag LOCUS_27920 3522 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3683 3868 gene locus_tag LOCUS_27930 3683 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4114 5316 gene locus_tag LOCUS_27940 4114 5316 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_27940 5711 5274 gene locus_tag LOCUS_27950 5711 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 5898 6590 gene locus_tag LOCUS_27960 5898 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 6931 6856 gene locus_tag LOCUS_t00410 6931 6856 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 262 1404 gene locus_tag LOCUS_27970 262 1404 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_27970 1837 4056 gene locus_tag LOCUS_27980 1837 4056 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198752.1 protein_id gnl|my_center|LOCUS_27980 4963 4121 gene locus_tag LOCUS_27990 4963 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5923 5162 gene locus_tag LOCUS_28000 5923 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6969 6106 gene locus_tag LOCUS_28010 6969 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence133 1826 537 gene locus_tag LOCUS_28020 1826 537 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_28020 2175 2549 gene locus_tag LOCUS_28030 2175 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2707 2949 gene locus_tag LOCUS_28040 2707 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 4145 3003 gene locus_tag LOCUS_28050 4145 3003 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_28050 5410 4241 gene locus_tag LOCUS_28060 5410 4241 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_28060 6777 5509 gene locus_tag LOCUS_28070 6777 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence134 1292 60 gene locus_tag LOCUS_28080 1292 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1854 3014 gene locus_tag LOCUS_28090 1854 3014 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_28090 3011 4264 gene locus_tag LOCUS_28100 3011 4264 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_28100 5397 4315 gene locus_tag LOCUS_28110 5397 4315 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_28110 6120 6281 gene locus_tag LOCUS_28120 6120 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence135 3727 3005 gene locus_tag LOCUS_28130 3727 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3831 4034 gene locus_tag LOCUS_28140 3831 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 4351 5316 gene locus_tag LOCUS_28150 4351 5316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_28150 5382 5822 gene locus_tag LOCUS_28160 5382 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 6537 5920 gene locus_tag LOCUS_28170 6537 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence136 2203 3288 gene locus_tag LOCUS_28180 2203 3288 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259275.1 protein_id gnl|my_center|LOCUS_28180 4446 3388 gene locus_tag LOCUS_28190 gene ltaE 4446 3388 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_28190 5109 4459 gene locus_tag LOCUS_28200 gene plsY 5109 4459 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140665.1 protein_id gnl|my_center|LOCUS_28200 6620 5454 gene locus_tag LOCUS_28210 gene der 6620 5454 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence137 553 1110 gene locus_tag LOCUS_28220 553 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1659 5234 gene locus_tag LOCUS_28230 1659 5234 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence138 <1 2253 gene locus_tag LOCUS_28240 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001237656.1:Ig-like domain repeat protein >Feature sequence139 1537 56 gene locus_tag LOCUS_28250 1537 56 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_28250 2529 1774 gene locus_tag LOCUS_28260 2529 1774 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_28260 2714 3505 gene locus_tag LOCUS_28270 2714 3505 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_28270 4793 3621 gene locus_tag LOCUS_28280 4793 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 6062 5292 gene locus_tag LOCUS_28290 6062 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence140 467 168 gene locus_tag LOCUS_28300 467 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 737 1588 gene locus_tag LOCUS_28310 737 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1853 2221 gene locus_tag LOCUS_28320 1853 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28320 2325 3818 gene locus_tag LOCUS_28330 2325 3818 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_28330 4062 5798 gene locus_tag LOCUS_28340 4062 5798 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_28340 <6540 5875 gene locus_tag LOCUS_28350 <6540 5875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103676442.1:alpha/beta hydrolase >Feature sequence141 >Feature sequence142 158 1210 gene locus_tag LOCUS_28360 158 1210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_28360 1210 1521 gene locus_tag LOCUS_28370 1210 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 1518 2252 gene locus_tag LOCUS_28380 1518 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 2322 2603 gene locus_tag LOCUS_28390 2322 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3550 2600 gene locus_tag LOCUS_28400 3550 2600 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_28400 3713 4477 gene locus_tag LOCUS_28410 3713 4477 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_28410 4580 5638 gene locus_tag LOCUS_28420 4580 5638 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_28420 6290 6153 gene locus_tag LOCUS_28430 6290 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence143 1373 414 gene locus_tag LOCUS_28440 1373 414 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_28440 3068 1383 gene locus_tag LOCUS_28450 3068 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3360 4589 gene locus_tag LOCUS_28460 3360 4589 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530306.1 protein_id gnl|my_center|LOCUS_28460 4631 5068 gene locus_tag LOCUS_28470 4631 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 6269 5052 gene locus_tag LOCUS_28480 6269 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence144 1154 1348 gene locus_tag LOCUS_28490 1154 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1542 6248 gene locus_tag LOCUS_28500 1542 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence145 201 395 gene locus_tag LOCUS_28510 201 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1261 386 gene locus_tag LOCUS_28520 1261 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28520 1382 1939 gene locus_tag LOCUS_28530 1382 1939 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_28530 1936 3036 gene locus_tag LOCUS_28540 1936 3036 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_28540 3159 4316 gene locus_tag LOCUS_28550 3159 4316 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_28550 4373 5089 gene locus_tag LOCUS_28560 4373 5089 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_28560 5193 5414 gene locus_tag LOCUS_28570 5193 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence146 1198 137 gene locus_tag LOCUS_28580 1198 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 1182 1784 gene locus_tag LOCUS_28590 1182 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2888 1854 gene locus_tag LOCUS_28600 2888 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3529 2885 gene locus_tag LOCUS_28610 3529 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 4647 3526 gene locus_tag LOCUS_28620 4647 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence147 562 1194 gene locus_tag LOCUS_28630 562 1194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119828.1 protein_id gnl|my_center|LOCUS_28630 2264 1350 gene locus_tag LOCUS_28640 2264 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2431 2844 gene locus_tag LOCUS_28650 2431 2844 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_28650 2969 3892 gene locus_tag LOCUS_28660 2969 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 4296 3880 gene locus_tag LOCUS_28670 4296 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256057.1 protein_id gnl|my_center|LOCUS_28670 4552 5598 gene locus_tag LOCUS_28680 4552 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence148 749 18 gene locus_tag LOCUS_28690 749 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2258 1125 gene locus_tag LOCUS_28700 2258 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 5061 4054 gene locus_tag LOCUS_28710 5061 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 5346 5137 gene locus_tag LOCUS_28720 5346 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 5866 5411 gene locus_tag LOCUS_28730 5866 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence149 3675 58 gene locus_tag LOCUS_28740 3675 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3726 4199 gene locus_tag LOCUS_28750 3726 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 4323 4511 gene locus_tag LOCUS_28760 4323 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 4542 5351 gene locus_tag LOCUS_28770 4542 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 5601 5912 gene locus_tag LOCUS_28780 5601 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence150 <1 885 gene locus_tag LOCUS_28790 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393401.1:ABC transporter ATP-binding protein 891 1631 gene locus_tag LOCUS_28800 891 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3424 1898 gene locus_tag LOCUS_28810 3424 1898 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_28810 3338 3595 gene locus_tag LOCUS_28820 3338 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 4624 3611 gene locus_tag LOCUS_28830 4624 3611 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence151 133 1071 gene locus_tag LOCUS_28840 gene cysK 133 1071 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_28840 1152 2270 gene locus_tag LOCUS_28850 1152 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2466 2882 gene locus_tag LOCUS_28860 2466 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 4464 2929 gene locus_tag LOCUS_28870 4464 2929 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_28870 4560 5480 gene locus_tag LOCUS_28880 gene larE 4560 5480 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_28880 <6029 5489 gene locus_tag LOCUS_28890 <6029 5489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083449.1:hydratase >Feature sequence152 1970 771 gene locus_tag LOCUS_28900 1970 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5614 2192 gene locus_tag LOCUS_28910 5614 2192 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence153 369 1169 gene locus_tag LOCUS_28920 369 1169 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_28920 1361 2758 gene locus_tag LOCUS_28930 1361 2758 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_28930 3010 5058 gene locus_tag LOCUS_28940 3010 5058 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_28940 5822 5439 gene locus_tag LOCUS_28950 5822 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence154 1146 178 gene locus_tag LOCUS_28960 1146 178 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_28960 1322 2881 gene locus_tag LOCUS_28970 1322 2881 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_28970 2947 4359 gene locus_tag LOCUS_28980 2947 4359 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_28980 4552 5613 gene locus_tag LOCUS_28990 4552 5613 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence155 1943 957 gene locus_tag LOCUS_29000 1943 957 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807688.1 protein_id gnl|my_center|LOCUS_29000 2043 2627 gene locus_tag LOCUS_29010 2043 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2683 3021 gene locus_tag LOCUS_29020 2683 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3201 4217 gene locus_tag LOCUS_29030 3201 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 4278 4697 gene locus_tag LOCUS_29040 4278 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 4697 5356 gene locus_tag LOCUS_29050 4697 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence156 1701 2657 gene locus_tag LOCUS_29060 1701 2657 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705190.1 protein_id gnl|my_center|LOCUS_29060 2960 3904 gene locus_tag LOCUS_29070 2960 3904 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_29070 4017 5450 gene locus_tag LOCUS_29080 4017 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence157 1469 753 gene locus_tag LOCUS_29090 1469 753 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_29090 1770 3206 gene locus_tag LOCUS_29100 1770 3206 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_29100 3217 3816 gene locus_tag LOCUS_29110 gene tadA 3217 3816 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_29110 3918 4004 gene locus_tag LOCUS_t00420 3918 4004 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4100 4189 gene locus_tag LOCUS_t00430 4100 4189 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 1376 879 gene locus_tag LOCUS_29120 gene tsaE 1376 879 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_29120 1611 2822 gene locus_tag LOCUS_29130 1611 2822 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_29130 2838 3380 gene locus_tag LOCUS_29140 2838 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3410 4159 gene locus_tag LOCUS_29150 3410 4159 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968194.1 protein_id gnl|my_center|LOCUS_29150 4296 4598 gene locus_tag LOCUS_29160 4296 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 <5752 4629 gene locus_tag LOCUS_29170 <5752 4629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227103.1:YibE/F family protein >Feature sequence159 834 19 gene locus_tag LOCUS_29180 834 19 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_29180 1955 1059 gene locus_tag LOCUS_29190 1955 1059 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_29190 3843 2314 gene locus_tag LOCUS_29200 3843 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 5133 4111 gene locus_tag LOCUS_29210 5133 4111 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence160 90 623 gene locus_tag LOCUS_29220 90 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 620 2014 gene locus_tag LOCUS_29230 620 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2049 3191 gene locus_tag LOCUS_29240 gene metK 2049 3191 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_29240 4730 3339 gene locus_tag LOCUS_29250 4730 3339 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582767.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence161 132 1226 gene locus_tag LOCUS_29260 132 1226 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 protein_id gnl|my_center|LOCUS_29260 1775 1260 gene locus_tag LOCUS_29270 1775 1260 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_29270 1951 3486 gene locus_tag LOCUS_29280 1951 3486 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_29280 3709 5277 gene locus_tag LOCUS_29290 3709 5277 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence162 1976 1023 gene locus_tag LOCUS_29300 gene selD 1976 1023 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_29300 2080 1994 gene locus_tag LOCUS_t00440 2080 1994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2169 5351 gene locus_tag LOCUS_29310 gene ppc 2169 5351 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence163 1449 592 gene locus_tag LOCUS_29320 1449 592 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_29320 2459 1566 gene locus_tag LOCUS_29330 2459 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4109 2592 gene locus_tag LOCUS_29340 gene gabD 4109 2592 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358103.1 protein_id gnl|my_center|LOCUS_29340 <5544 4358 gene locus_tag LOCUS_29350 <5544 4358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786111.1:alpha/beta hydrolase family protein >Feature sequence164 91 1023 gene locus_tag LOCUS_29360 91 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2839 1064 gene locus_tag LOCUS_29370 2839 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 3050 2826 gene locus_tag LOCUS_29380 3050 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 4741 3095 gene locus_tag LOCUS_29390 4741 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 4730 4897 gene locus_tag LOCUS_29400 4730 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4854 5198 gene locus_tag LOCUS_29410 4854 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence165 1566 295 gene locus_tag LOCUS_29420 1566 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3279 2194 gene locus_tag LOCUS_29430 3279 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3503 4318 gene locus_tag LOCUS_29440 3503 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 4722 5201 gene locus_tag LOCUS_29450 4722 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence166 1218 73 gene locus_tag LOCUS_29460 1218 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2379 1231 gene locus_tag LOCUS_29470 gene csm4 2379 1231 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256462.1 protein_id gnl|my_center|LOCUS_29470 2649 2386 gene locus_tag LOCUS_29480 2649 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29480 3145 2705 gene locus_tag LOCUS_29490 3145 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 3682 3155 gene locus_tag LOCUS_29500 3682 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 4371 3679 gene locus_tag LOCUS_29510 4371 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29510 <5280 4343 gene locus_tag LOCUS_29520 <5280 4343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256465.1:type III-A CRISPR-associated protein Cas10/Csm1 note possible pseudo, frameshifted >Feature sequence167 633 1409 gene locus_tag LOCUS_29530 633 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1409 1615 gene locus_tag LOCUS_29540 1409 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2954 1689 gene locus_tag LOCUS_29550 2954 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3141 4406 gene locus_tag LOCUS_29560 3141 4406 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence168 1737 184 gene locus_tag LOCUS_29570 1737 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2249 3070 gene locus_tag LOCUS_29580 2249 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence169 1535 378 gene locus_tag LOCUS_29590 gene dgoD 1535 378 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_29590 2546 1857 gene locus_tag LOCUS_29600 2546 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3941 3411 gene locus_tag LOCUS_29610 3941 3411 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence170 43 984 gene locus_tag LOCUS_29620 43 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1256 1483 gene locus_tag LOCUS_29630 1256 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1532 2239 gene locus_tag LOCUS_29640 1532 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2395 3411 gene locus_tag LOCUS_29650 2395 3411 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence171 269 784 gene locus_tag LOCUS_29660 269 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 990 1292 gene locus_tag LOCUS_29670 990 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2543 1764 gene locus_tag LOCUS_29680 2543 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3286 2540 gene locus_tag LOCUS_29690 3286 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 4469 3279 gene locus_tag LOCUS_29700 4469 3279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887119.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence172 354 1685 gene locus_tag LOCUS_29710 354 1685 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_29710 1908 3137 gene locus_tag LOCUS_29720 1908 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3193 3627 gene locus_tag LOCUS_29730 3193 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 4888 3707 gene locus_tag LOCUS_29740 4888 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence173 705 430 gene locus_tag LOCUS_29750 705 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 776 982 gene locus_tag LOCUS_29760 776 982 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 protein_id gnl|my_center|LOCUS_29760 1582 1088 gene locus_tag LOCUS_29770 1582 1088 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_29770 2286 1828 gene locus_tag LOCUS_29780 2286 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 4888 2408 gene locus_tag LOCUS_29790 4888 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence174 <1 914 gene locus_tag LOCUS_29800 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262977.1:MSHA biogenesis protein MshQ 1416 934 gene locus_tag LOCUS_29810 1416 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2535 1621 gene locus_tag LOCUS_29820 2535 1621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_29820 3208 3011 gene locus_tag LOCUS_29830 3208 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3479 3670 gene locus_tag LOCUS_29840 3479 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence175 319 717 gene locus_tag LOCUS_29850 319 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2368 971 gene locus_tag LOCUS_29860 gene cysS 2368 971 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_29860 3420 2422 gene locus_tag LOCUS_29870 3420 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 4319 3492 gene locus_tag LOCUS_29880 4319 3492 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence176 206 421 gene locus_tag LOCUS_29890 206 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 582 1844 gene locus_tag LOCUS_29900 582 1844 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_29900 1931 2869 gene locus_tag LOCUS_29910 1931 2869 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_29910 3116 3934 gene locus_tag LOCUS_29920 3116 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4202 3891 gene locus_tag LOCUS_29930 4202 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence177 785 51 gene locus_tag LOCUS_29940 785 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3888 1552 gene locus_tag LOCUS_29950 3888 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4699 4553 gene locus_tag LOCUS_29960 4699 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence178 315 1115 gene locus_tag LOCUS_29970 gene phnC 315 1115 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_29970 1200 2048 gene locus_tag LOCUS_29980 gene phnE 1200 2048 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_29980 2083 3192 gene locus_tag LOCUS_29990 2083 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3192 3935 gene locus_tag LOCUS_30000 3192 3935 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_30000 3928 4458 gene locus_tag LOCUS_30010 3928 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence179 420 1139 gene locus_tag LOCUS_30020 420 1139 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_30020 2262 3437 gene locus_tag LOCUS_30030 2262 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3612 4568 gene locus_tag LOCUS_30040 gene msrP 3612 4568 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence180 <1 750 gene locus_tag LOCUS_30050 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257502.1:Gfo/Idh/MocA family oxidoreductase 747 1520 gene locus_tag LOCUS_30060 747 1520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_30060 1522 3639 gene locus_tag LOCUS_30070 gene asnB 1522 3639 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence181 1703 3091 gene locus_tag LOCUS_30080 1703 3091 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence182 172 387 gene locus_tag LOCUS_30090 172 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1608 493 gene locus_tag LOCUS_30100 1608 493 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040369.1 protein_id gnl|my_center|LOCUS_30100 1993 1625 gene locus_tag LOCUS_30110 1993 1625 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226457.1 protein_id gnl|my_center|LOCUS_30110 2442 3830 gene locus_tag LOCUS_30120 2442 3830 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence183 >Feature sequence184 788 345 gene locus_tag LOCUS_30130 788 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1245 889 gene locus_tag LOCUS_30140 1245 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1633 1304 gene locus_tag LOCUS_30150 1633 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 1783 1707 gene locus_tag LOCUS_t00450 1783 1707 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2638 1847 gene locus_tag LOCUS_30160 2638 1847 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence185 <1 1139 gene locus_tag LOCUS_30170 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1588 2952 gene locus_tag LOCUS_30180 1588 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3083 3667 gene locus_tag LOCUS_30190 gene tdk 3083 3667 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence186 1798 392 gene locus_tag LOCUS_30200 1798 392 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368028.1 protein_id gnl|my_center|LOCUS_30200 2518 1823 gene locus_tag LOCUS_30210 2518 1823 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 protein_id gnl|my_center|LOCUS_30210 3231 2518 gene locus_tag LOCUS_30220 3231 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence187 920 1195 gene locus_tag LOCUS_30230 920 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1138 2619 gene locus_tag LOCUS_30240 1138 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3293 2595 gene locus_tag LOCUS_30250 3293 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3913 3269 gene locus_tag LOCUS_30260 3913 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence188 <1 829 gene locus_tag LOCUS_30270 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein 2029 1010 gene locus_tag LOCUS_30280 2029 1010 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_30280 3259 2315 gene locus_tag LOCUS_30290 3259 2315 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_30290 3602 4171 gene locus_tag LOCUS_30300 3602 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence189 1662 262 gene locus_tag LOCUS_30310 gene sufD 1662 262 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_30310 3270 1801 gene locus_tag LOCUS_30320 gene sufB 3270 1801 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_30320 4229 3327 gene locus_tag LOCUS_30330 gene sufC 4229 3327 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence190 209 760 gene locus_tag LOCUS_30340 209 760 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_30340 968 762 gene locus_tag LOCUS_30350 968 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2092 953 gene locus_tag LOCUS_30360 2092 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3586 2210 gene locus_tag LOCUS_30370 3586 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence191 241 1407 gene locus_tag LOCUS_30380 241 1407 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525362.1 protein_id gnl|my_center|LOCUS_30380 1486 3087 gene locus_tag LOCUS_30390 1486 3087 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_30390 3429 3214 gene locus_tag LOCUS_30400 3429 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3756 3999 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggggttttaggggtctgcagg >Feature sequence192 1023 139 gene locus_tag LOCUS_30410 1023 139 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 protein_id gnl|my_center|LOCUS_30410 1868 1014 gene locus_tag LOCUS_30420 1868 1014 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_30420 3497 1977 gene locus_tag LOCUS_30430 3497 1977 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531800.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence193 1489 2280 gene locus_tag LOCUS_30440 1489 2280 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_30440 2352 3047 gene locus_tag LOCUS_30450 2352 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence194 1046 1756 gene locus_tag LOCUS_30460 1046 1756 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_30460 1871 2698 gene locus_tag LOCUS_30470 1871 2698 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_30470 2820 3656 gene locus_tag LOCUS_30480 2820 3656 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence195 <3660 358 gene locus_tag LOCUS_30490 <3660 358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183275411.1:DUF3320 domain-containing protein >Feature sequence196 2625 364 gene locus_tag LOCUS_30500 2625 364 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114306.1 protein_id gnl|my_center|LOCUS_30500 <3540 2622 gene locus_tag LOCUS_30510 <3540 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257281.1:response regulator transcription factor >Feature sequence197 325 966 gene locus_tag LOCUS_30520 325 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1094 2104 gene locus_tag LOCUS_30530 1094 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2142 3173 gene locus_tag LOCUS_30540 2142 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence198 418 1254 gene locus_tag LOCUS_30550 418 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 1635 2921 gene locus_tag LOCUS_30560 gene thrC 1635 2921 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_30560 2997 3272 gene locus_tag LOCUS_30570 2997 3272 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence199 <1 797 gene locus_tag LOCUS_30580 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein 978 1124 gene locus_tag LOCUS_30590 978 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1553 1149 gene locus_tag LOCUS_30600 1553 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 1579 2472 gene locus_tag LOCUS_30610 1579 2472 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170158.1 protein_id gnl|my_center|LOCUS_30610 2992 2630 gene locus_tag LOCUS_30620 2992 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3156 3028 gene locus_tag LOCUS_30630 3156 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence200 1194 1457 gene locus_tag LOCUS_30640 1194 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1824 1465 gene locus_tag LOCUS_30650 1824 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1897 2100 gene locus_tag LOCUS_30660 1897 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2103 2405 gene locus_tag LOCUS_30670 2103 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence201 >Feature sequence202 1021 197 gene locus_tag LOCUS_30680 gene galU 1021 197 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_30680 1598 2272 gene locus_tag LOCUS_30690 gene thpR 1598 2272 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence203 >Feature sequence204 352 2748 gene locus_tag LOCUS_30700 352 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 <3330 2776 gene locus_tag LOCUS_30710 <3330 2776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705183.1:ABC transporter ATP-binding protein >Feature sequence205 <1 601 gene locus_tag LOCUS_30720 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257385.1:class I SAM-dependent methyltransferase 598 2943 gene locus_tag LOCUS_30730 598 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence206 1583 420 gene locus_tag LOCUS_30740 1583 420 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_30740 2862 1684 gene locus_tag LOCUS_30750 2862 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2891 3169 gene locus_tag LOCUS_30760 2891 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence207 2948 1956 gene locus_tag LOCUS_30770 2948 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence208 558 1631 gene locus_tag LOCUS_30780 558 1631 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_30780 1638 2792 gene locus_tag LOCUS_30790 1638 2792 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938031.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence209 <1 876 gene locus_tag LOCUS_30800 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086125.1:lipase LipE 1065 1262 gene locus_tag LOCUS_30810 1065 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30810 >Feature sequence210 126 2162 gene locus_tag LOCUS_30820 126 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence211 <1 785 gene locus_tag LOCUS_30830 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804600.1:ABC-2 family transporter protein 934 1770 gene locus_tag LOCUS_30840 934 1770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_30840 1767 2798 gene locus_tag LOCUS_30850 1767 2798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence212 31 2778 gene locus_tag LOCUS_30860 31 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence213 739 954 gene locus_tag LOCUS_30870 739 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 2321 1188 gene locus_tag LOCUS_30880 2321 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 <2970 2407 gene locus_tag LOCUS_30890 <2970 2407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257869.1:ferric reductase-like transmembrane domain-containing protein >Feature sequence214 569 724 gene locus_tag LOCUS_30900 569 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2051 1056 gene locus_tag LOCUS_30910 2051 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 <2941 2177 gene locus_tag LOCUS_30920 <2941 2177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392733.1:ATP-binding cassette domain-containing protein >Feature sequence215 >Feature sequence216 739 2121 gene locus_tag LOCUS_30930 gene lysA 739 2121 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence217 298 1461 gene locus_tag LOCUS_30940 298 1461 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888092.1 protein_id gnl|my_center|LOCUS_30940 2790 1507 gene locus_tag LOCUS_30950 2790 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence218 307 1068 gene locus_tag LOCUS_30960 307 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2636 1119 gene locus_tag LOCUS_30970 2636 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence219 <1 1216 gene locus_tag LOCUS_30980 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880385.1:McrB family protein >Feature sequence220 1268 2278 gene locus_tag LOCUS_30990 1268 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30990 2262 2450 gene locus_tag LOCUS_31000 2262 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence221 1152 1793 gene locus_tag LOCUS_31010 1152 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence222 <2632 1417 gene locus_tag LOCUS_31020 <2632 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948081.1:dihydroxy-acid dehydratase >Feature sequence223 225 1880 gene locus_tag LOCUS_31030 225 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 2395 1949 gene locus_tag LOCUS_31040 2395 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence224 >Feature sequence225 >Feature sequence226 >Feature sequence227 1587 226 gene locus_tag LOCUS_31050 1587 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2271 1759 gene locus_tag LOCUS_31060 2271 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence228 <1 969 gene locus_tag LOCUS_31070 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530068.1:lipopolysaccharide heptosyltransferase II 1018 2142 gene locus_tag LOCUS_31080 1018 2142 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence229 >Feature sequence230 1831 821 gene locus_tag LOCUS_31090 1831 821 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence231 1201 1668 gene locus_tag LOCUS_31100 1201 1668 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974303.1 protein_id gnl|my_center|LOCUS_31100 2278 1694 gene locus_tag LOCUS_31110 2278 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence232 446 1174 gene locus_tag LOCUS_31120 446 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 <2430 1147 gene locus_tag LOCUS_31130 <2430 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence233 2367 1852 gene locus_tag LOCUS_31140 2367 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence234 343 1017 gene locus_tag LOCUS_31150 343 1017 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972950.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence235 1514 609 gene locus_tag LOCUS_31160 1514 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1961 1656 gene locus_tag LOCUS_31170 1961 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence236 >Feature sequence237 <2317 1736 gene locus_tag LOCUS_31180 <2317 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965501.1:flagellin >Feature sequence238 275 1153 gene locus_tag LOCUS_31190 275 1153 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence239 150 587 gene locus_tag LOCUS_31200 150 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence240 >Feature sequence241 863 1543 gene locus_tag LOCUS_31210 863 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1651 2244 gene locus_tag LOCUS_31220 1651 2244 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence242 1094 249 gene locus_tag LOCUS_31230 1094 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 2026 1241 gene locus_tag LOCUS_31240 2026 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence243 <1 1179 gene locus_tag LOCUS_31250 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898047.1:UxaA family hydrolase 1398 1471 gene locus_tag LOCUS_t00460 1398 1471 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence244 1904 309 gene locus_tag LOCUS_31260 1904 309 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence245 214 792 gene locus_tag LOCUS_31270 214 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1373 912 gene locus_tag LOCUS_31280 1373 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228771.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence246 >Feature sequence247 >Feature sequence248 <1 1001 gene locus_tag LOCUS_31290 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532977.1:aldo/keto reductase >Feature sequence249 1824 235 gene locus_tag LOCUS_31300 1824 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence250 1188 865 gene locus_tag LOCUS_31310 1188 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence251 1046 579 gene locus_tag LOCUS_31320 1046 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1756 1421 gene locus_tag LOCUS_31330 1756 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1956 1753 gene locus_tag LOCUS_31340 1956 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence252 354 1484 gene locus_tag LOCUS_31350 354 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence253 168 1739 gene locus_tag LOCUS_31360 168 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence254 1030 689 gene locus_tag LOCUS_31370 1030 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1926 1030 gene locus_tag LOCUS_31380 1926 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence255 769 146 gene locus_tag LOCUS_31390 769 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence256 870 295 gene locus_tag LOCUS_31400 870 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 <1984 902 gene locus_tag LOCUS_31410 <1984 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339612.1:phage portal protein >Feature sequence257 1171 632 gene locus_tag LOCUS_31420 1171 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence258 1720 905 gene locus_tag LOCUS_31430 1720 905 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence259 >Feature sequence260 1011 241 gene locus_tag LOCUS_31440 1011 241 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_31440 <1949 1207 gene locus_tag LOCUS_31450 <1949 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388688.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence261 1180 1791 gene locus_tag LOCUS_31460 1180 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence262 898 356 gene locus_tag LOCUS_31470 898 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 1780 902 gene locus_tag LOCUS_31480 1780 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1682 1891 gene locus_tag LOCUS_31490 1682 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence263 >Feature sequence264 >Feature sequence265 1522 725 gene locus_tag LOCUS_31500 1522 725 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence266 25 1620 gene locus_tag LOCUS_31510 25 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence267 29 1300 gene locus_tag LOCUS_31520 29 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1367 1603 gene locus_tag LOCUS_31530 1367 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence268 860 612 gene locus_tag LOCUS_31540 860 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1281 1024 gene locus_tag LOCUS_31550 1281 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence269 807 268 gene locus_tag LOCUS_31560 807 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 <1740 804 gene locus_tag LOCUS_31570 <1740 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001170714.1:glycosyltransferase family 2 protein >Feature sequence270 >Feature sequence271 369 1001 gene locus_tag LOCUS_31580 369 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1246 1398 gene locus_tag LOCUS_31590 1246 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence272 >Feature sequence273 484 696 gene locus_tag LOCUS_31600 484 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 790 1014 gene locus_tag LOCUS_31610 790 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1038 1113 gene locus_tag LOCUS_t00470 1038 1113 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1195 1443 gene locus_tag LOCUS_31620 1195 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence274 1226 243 gene locus_tag LOCUS_31630 1226 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence275 226 606 gene locus_tag LOCUS_31640 226 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1062 1349 gene locus_tag LOCUS_31650 1062 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence276 >Feature sequence277 439 1494 gene locus_tag LOCUS_31660 439 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence278 >Feature sequence279 <1591 898 gene locus_tag LOCUS_31670 <1591 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117896.1:arylsulfatase >Feature sequence280 65 1369 gene locus_tag LOCUS_31680 65 1369 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence281 200 1321 gene locus_tag LOCUS_31690 200 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence282 1099 632 gene locus_tag LOCUS_31700 1099 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence283 <1560 10 gene locus_tag LOCUS_31710 <1560 10 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256188.1:phosphoglycerate dehydrogenase >Feature sequence284 276 1358 gene locus_tag LOCUS_31720 276 1358 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence285 1 1365 gene locus_tag LOCUS_31730 1 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence286 >Feature sequence287 >Feature sequence288 655 110 gene locus_tag LOCUS_31740 655 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence289 435 1124 gene locus_tag LOCUS_31750 435 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1191 1421 gene locus_tag LOCUS_31760 1191 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence290 >Feature sequence291 >Feature sequence292 276 1394 gene locus_tag LOCUS_31770 276 1394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence293 >Feature sequence294 >Feature sequence295 701 153 gene locus_tag LOCUS_31780 701 153 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence296 >Feature sequence297 1138 389 gene locus_tag LOCUS_31790 1138 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence298 <1 816 gene locus_tag LOCUS_31800 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198094.1:ABC transporter substrate-binding protein >Feature sequence299 >Feature sequence300 <1 1050 gene locus_tag LOCUS_31810 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494105.1:tail fiber protein note possible pseudo, frameshifted >Feature sequence301 >Feature sequence302 1011 139 gene locus_tag LOCUS_31820 1011 139 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112560.1 protein_id gnl|my_center|LOCUS_31820 1313 1035 gene locus_tag LOCUS_31830 1313 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31830 >Feature sequence303 <1349 498 gene locus_tag LOCUS_31840 <1349 498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227672.1:diacylglycerol kinase family lipid kinase >Feature sequence304 <1 1098 gene locus_tag LOCUS_31850 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229000.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence305 1005 571 gene locus_tag LOCUS_31860 1005 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence306 >Feature sequence307 >Feature sequence308 >Feature sequence309 >Feature sequence310 >Feature sequence311 827 531 gene locus_tag LOCUS_31870 827 531 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence312 >Feature sequence313 <1195 48 gene locus_tag LOCUS_31880 <1195 48 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940141.1:phage/plasmid primase, P4 family >Feature sequence314 >Feature sequence315 <1170 314 gene locus_tag LOCUS_31890 <1170 314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804146.1:alpha-glucosidase/alpha-galactosidase >Feature sequence316 >Feature sequence317 >Feature sequence318 >Feature sequence319 >Feature sequence320 299 81 gene locus_tag LOCUS_31900 299 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence321 1130 468 gene locus_tag LOCUS_31910 1130 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence322 <1 1100 gene locus_tag LOCUS_31920 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968624.1:DUF1156 domain-containing protein >Feature sequence323 <1 623 gene locus_tag LOCUS_31930 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943665.1:flagellin >Feature sequence324 >Feature sequence325 >Feature sequence326