>Feature sequence001 596 3352 gene locus_tag LOCUS_00010 596 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3345 5879 gene locus_tag LOCUS_00020 3345 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6127 6831 gene locus_tag LOCUS_00030 6127 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6831 7736 gene locus_tag LOCUS_00040 6831 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7750 8286 gene locus_tag LOCUS_00050 7750 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9125 8205 gene locus_tag LOCUS_00060 9125 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 protein_id gnl|my_center|LOCUS_00060 9747 9544 gene locus_tag LOCUS_00070 9747 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9746 10219 gene locus_tag LOCUS_00080 9746 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10229 13243 gene locus_tag LOCUS_00090 10229 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13240 13782 gene locus_tag LOCUS_00100 13240 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13793 14251 gene locus_tag LOCUS_00110 13793 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14277 16025 gene locus_tag LOCUS_00120 14277 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16022 16294 gene locus_tag LOCUS_00130 16022 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16297 16935 gene locus_tag LOCUS_00140 16297 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16935 18482 gene locus_tag LOCUS_00150 16935 18482 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_00150 18492 19577 gene locus_tag LOCUS_00160 18492 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20175 19597 gene locus_tag LOCUS_00170 20175 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20411 20181 gene locus_tag LOCUS_00180 20411 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20736 20476 gene locus_tag LOCUS_00190 20736 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20976 21743 gene locus_tag LOCUS_00200 20976 21743 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_00200 21740 23035 gene locus_tag LOCUS_00210 21740 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23032 23877 gene locus_tag LOCUS_00220 23032 23877 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 protein_id gnl|my_center|LOCUS_00220 23874 24485 gene locus_tag LOCUS_00230 23874 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24628 25860 gene locus_tag LOCUS_00240 24628 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25860 27656 gene locus_tag LOCUS_00250 25860 27656 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_00250 27632 28291 gene locus_tag LOCUS_00260 27632 28291 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_00260 28279 28917 gene locus_tag LOCUS_00270 28279 28917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28914 31565 gene locus_tag LOCUS_00280 28914 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31575 32309 gene locus_tag LOCUS_00290 31575 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32849 32367 gene locus_tag LOCUS_00300 32849 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33063 33206 gene locus_tag LOCUS_00310 33063 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33372 34412 gene locus_tag LOCUS_00320 33372 34412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34581 35801 gene locus_tag LOCUS_00330 34581 35801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35963 38914 gene locus_tag LOCUS_00340 35963 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38911 39864 gene locus_tag LOCUS_00350 38911 39864 CDS product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 protein_id gnl|my_center|LOCUS_00350 39944 43066 gene locus_tag LOCUS_00360 39944 43066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45246 43141 gene locus_tag LOCUS_00370 45246 43141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47510 45246 gene locus_tag LOCUS_00380 47510 45246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 50174 47511 gene locus_tag LOCUS_00390 50174 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 53491 50174 gene locus_tag LOCUS_00400 53491 50174 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015333.1 protein_id gnl|my_center|LOCUS_00400 56059 53504 gene locus_tag LOCUS_00410 56059 53504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 56409 56056 gene locus_tag LOCUS_00420 56409 56056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 56694 58985 gene locus_tag LOCUS_00430 56694 58985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 58988 61105 gene locus_tag LOCUS_00440 58988 61105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence002 285 1331 gene locus_tag LOCUS_00450 285 1331 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930166.1 protein_id gnl|my_center|LOCUS_00450 2327 1335 gene locus_tag LOCUS_00460 2327 1335 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_00460 2532 2813 gene locus_tag LOCUS_00470 2532 2813 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053170.1 protein_id gnl|my_center|LOCUS_00470 2883 3218 gene locus_tag LOCUS_00480 2883 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4555 3215 gene locus_tag LOCUS_00490 4555 3215 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_00490 4627 4905 gene locus_tag LOCUS_00500 gene clpS 4627 4905 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_00500 4905 5507 gene locus_tag LOCUS_00510 4905 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 5517 6338 gene locus_tag LOCUS_00520 gene murI 5517 6338 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776024.1 protein_id gnl|my_center|LOCUS_00520 6335 7129 gene locus_tag LOCUS_00530 6335 7129 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_00530 7148 7882 gene locus_tag LOCUS_00540 gene rph 7148 7882 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776022.1 protein_id gnl|my_center|LOCUS_00540 7879 8577 gene locus_tag LOCUS_00550 gene rdgB 7879 8577 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776021.1 protein_id gnl|my_center|LOCUS_00550 8923 8525 gene locus_tag LOCUS_00560 8923 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9456 8920 gene locus_tag LOCUS_00570 9456 8920 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_00570 9684 9609 gene locus_tag LOCUS_t00010 9684 9609 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9801 10271 gene locus_tag LOCUS_00580 gene bcp 9801 10271 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_00580 10307 10390 gene locus_tag LOCUS_t00020 10307 10390 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10449 12146 gene locus_tag LOCUS_00590 10449 12146 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_00590 12891 12184 gene locus_tag LOCUS_00600 12891 12184 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_00600 13625 12930 gene locus_tag LOCUS_00610 13625 12930 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_00610 16299 13708 gene locus_tag LOCUS_00620 16299 13708 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_00620 16401 17846 gene locus_tag LOCUS_00630 16401 17846 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196738.1 protein_id gnl|my_center|LOCUS_00630 17886 18650 gene locus_tag LOCUS_00640 17886 18650 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_00640 19823 18687 gene locus_tag LOCUS_00650 19823 18687 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_00650 19798 21360 gene locus_tag LOCUS_00660 gene gltX 19798 21360 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_00660 21840 21364 gene locus_tag LOCUS_00670 21840 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 22075 22149 gene locus_tag LOCUS_t00030 22075 22149 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22210 22283 gene locus_tag LOCUS_t00040 22210 22283 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23114 22353 gene locus_tag LOCUS_00680 23114 22353 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_00680 23179 24588 gene locus_tag LOCUS_00690 gene leuC 23179 24588 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775884.1 protein_id gnl|my_center|LOCUS_00690 24599 25234 gene locus_tag LOCUS_00700 gene leuD 24599 25234 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775883.1 protein_id gnl|my_center|LOCUS_00700 25321 26637 gene locus_tag LOCUS_00710 gene murA 25321 26637 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_00710 26637 27464 gene locus_tag LOCUS_00720 26637 27464 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_00720 27475 28467 gene locus_tag LOCUS_00730 27475 28467 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_00730 28486 29637 gene locus_tag LOCUS_00740 28486 29637 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_00740 30210 29641 gene locus_tag LOCUS_00750 30210 29641 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775877.1 protein_id gnl|my_center|LOCUS_00750 30176 31159 gene locus_tag LOCUS_00760 30176 31159 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_00760 31397 31206 gene locus_tag LOCUS_00770 gene rpmB 31397 31206 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_00770 31575 33047 gene locus_tag LOCUS_00780 31575 33047 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_00780 33044 35191 gene locus_tag LOCUS_00790 gene recG 33044 35191 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_00790 35193 35747 gene locus_tag LOCUS_00800 gene rsmD 35193 35747 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_00800 35773 36234 gene locus_tag LOCUS_00810 gene coaD 35773 36234 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389543.1 protein_id gnl|my_center|LOCUS_00810 36231 36728 gene locus_tag LOCUS_00820 36231 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 36725 37273 gene locus_tag LOCUS_00830 36725 37273 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 protein_id gnl|my_center|LOCUS_00830 37270 37995 gene locus_tag LOCUS_00840 gene rnc 37270 37995 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_00840 37988 38896 gene locus_tag LOCUS_00850 gene mutM 37988 38896 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414814.1 protein_id gnl|my_center|LOCUS_00850 38893 39546 gene locus_tag LOCUS_00860 38893 39546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775862.1 protein_id gnl|my_center|LOCUS_00860 41210 39564 gene locus_tag LOCUS_00870 41210 39564 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_00870 42967 41207 gene locus_tag LOCUS_00880 42967 41207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00880 44616 42964 gene locus_tag LOCUS_00890 44616 42964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00890 45784 44693 gene locus_tag LOCUS_00900 gene cydB 45784 44693 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_00900 47269 45797 gene locus_tag LOCUS_00910 47269 45797 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 protein_id gnl|my_center|LOCUS_00910 47404 47565 gene locus_tag LOCUS_00920 47404 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 47607 50225 gene locus_tag LOCUS_00930 47607 50225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 50401 50709 gene locus_tag LOCUS_00940 gene rplU 50401 50709 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_00940 50748 50999 gene locus_tag LOCUS_00950 gene rpmA 50748 50999 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_00950 51081 52595 gene locus_tag LOCUS_00960 gene obgE 51081 52595 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_00960 52640 53782 gene locus_tag LOCUS_00970 gene proB 52640 53782 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811720.1 protein_id gnl|my_center|LOCUS_00970 53793 55046 gene locus_tag LOCUS_00980 53793 55046 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_00980 55105 55257 gene locus_tag LOCUS_00990 55105 55257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 55257 55898 gene locus_tag LOCUS_01000 gene nadD 55257 55898 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_01000 55888 56604 gene locus_tag LOCUS_01010 55888 56604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 56601 56975 gene locus_tag LOCUS_01020 gene rsfS 56601 56975 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074555.1 protein_id gnl|my_center|LOCUS_01020 56972 57598 gene locus_tag LOCUS_01030 56972 57598 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_01030 57683 58381 gene locus_tag LOCUS_01040 57683 58381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 59417 58350 gene locus_tag LOCUS_01050 59417 58350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258295.1 protein_id gnl|my_center|LOCUS_01050 59923 59414 gene locus_tag LOCUS_01060 59923 59414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence003 1001 555 gene locus_tag LOCUS_01070 1001 555 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_01070 2692 998 gene locus_tag LOCUS_01080 gene ctaD 2692 998 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_01080 3510 2692 gene locus_tag LOCUS_01090 gene coxB 3510 2692 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_01090 4511 3636 gene locus_tag LOCUS_01100 4511 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 4876 4529 gene locus_tag LOCUS_01110 gene erpA 4876 4529 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_01110 5889 4951 gene locus_tag LOCUS_01120 5889 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5941 6363 gene locus_tag LOCUS_01130 5941 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7684 6368 gene locus_tag LOCUS_01140 7684 6368 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_01140 7792 8388 gene locus_tag LOCUS_01150 7792 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 8416 9429 gene locus_tag LOCUS_01160 8416 9429 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_01160 10464 9403 gene locus_tag LOCUS_01170 10464 9403 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930218.1 protein_id gnl|my_center|LOCUS_01170 10932 10483 gene locus_tag LOCUS_01180 10932 10483 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_01180 11264 10929 gene locus_tag LOCUS_01190 11264 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11330 12793 gene locus_tag LOCUS_01200 11330 12793 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_01200 12899 14272 gene locus_tag LOCUS_01210 gene lpdA 12899 14272 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_01210 14285 16054 gene locus_tag LOCUS_01220 gene sucB 14285 16054 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_01220 17375 16122 gene locus_tag LOCUS_01230 17375 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 17498 18190 gene locus_tag LOCUS_01240 17498 18190 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_01240 18317 19741 gene locus_tag LOCUS_01250 gene glnA 18317 19741 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_01250 19890 22301 gene locus_tag LOCUS_01260 19890 22301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 22927 22298 gene locus_tag LOCUS_01270 22927 22298 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_01270 25898 22941 gene locus_tag LOCUS_01280 25898 22941 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_01280 27233 25899 gene locus_tag LOCUS_01290 gene glnA 27233 25899 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_01290 27386 28219 gene locus_tag LOCUS_01300 gene panB 27386 28219 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_01300 28407 28207 gene locus_tag LOCUS_01310 28407 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 28437 29309 gene locus_tag LOCUS_01320 gene map 28437 29309 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_01320 29361 31283 gene locus_tag LOCUS_01330 29361 31283 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_01330 32216 31293 gene locus_tag LOCUS_01340 32216 31293 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_01340 32286 32597 gene locus_tag LOCUS_01350 gene lsrG 32286 32597 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_01350 32605 33741 gene locus_tag LOCUS_01360 32605 33741 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_01360 33796 35379 gene locus_tag LOCUS_01370 33796 35379 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728644.1 protein_id gnl|my_center|LOCUS_01370 35405 36658 gene locus_tag LOCUS_01380 gene dinB 35405 36658 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530729.1 protein_id gnl|my_center|LOCUS_01380 37508 36672 gene locus_tag LOCUS_01390 37508 36672 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_01390 38713 37586 gene locus_tag LOCUS_01400 38713 37586 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_01400 39999 38806 gene locus_tag LOCUS_01410 39999 38806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777043.1 protein_id gnl|my_center|LOCUS_01410 41651 40416 gene locus_tag LOCUS_01420 41651 40416 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_01420 42382 41651 gene locus_tag LOCUS_01430 42382 41651 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_01430 42508 42433 gene locus_tag LOCUS_t00050 42508 42433 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42994 42581 gene locus_tag LOCUS_01440 42994 42581 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_01440 43203 45953 gene locus_tag LOCUS_01450 gene aceE 43203 45953 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_01450 46664 46017 gene locus_tag LOCUS_01460 46664 46017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 46795 48003 gene locus_tag LOCUS_01470 gene fasR 46795 48003 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence004 1593 2090 gene locus_tag LOCUS_01480 1593 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 2682 2065 gene locus_tag LOCUS_01490 2682 2065 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_01490 2789 2707 gene locus_tag LOCUS_t00060 2789 2707 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4284 2854 gene locus_tag LOCUS_01500 gene pyk 4284 2854 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_01500 5788 4325 gene locus_tag LOCUS_01510 5788 4325 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_01510 10313 5781 gene locus_tag LOCUS_01520 gene gltB 10313 5781 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_01520 11358 10453 gene locus_tag LOCUS_01530 gene lgt 11358 10453 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_01530 12146 11355 gene locus_tag LOCUS_01540 gene trpA 12146 11355 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805093.1 protein_id gnl|my_center|LOCUS_01540 13366 12143 gene locus_tag LOCUS_01550 gene trpB 13366 12143 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 protein_id gnl|my_center|LOCUS_01550 14189 13377 gene locus_tag LOCUS_01560 gene trpC 14189 13377 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_01560 14458 14198 gene locus_tag LOCUS_01570 14458 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15045 14455 gene locus_tag LOCUS_01580 15045 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16571 15042 gene locus_tag LOCUS_01590 gene trpE 16571 15042 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_01590 17384 16617 gene locus_tag LOCUS_01600 gene hisF 17384 16617 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805041.1 protein_id gnl|my_center|LOCUS_01600 17429 18016 gene locus_tag LOCUS_01610 17429 18016 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_01610 18922 18050 gene locus_tag LOCUS_01620 18922 18050 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805214.1 protein_id gnl|my_center|LOCUS_01620 20299 18932 gene locus_tag LOCUS_01630 gene pafA 20299 18932 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908273.1 protein_id gnl|my_center|LOCUS_01630 20481 20296 gene locus_tag LOCUS_01640 20481 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 21984 20491 gene locus_tag LOCUS_01650 gene dop 21984 20491 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_01650 23594 21981 gene locus_tag LOCUS_01660 gene arc 23594 21981 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 protein_id gnl|my_center|LOCUS_01660 24630 23587 gene locus_tag LOCUS_01670 24630 23587 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_01670 25688 24642 gene locus_tag LOCUS_01680 25688 24642 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_01680 25755 26600 gene locus_tag LOCUS_01690 25755 26600 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_01690 27240 26554 gene locus_tag LOCUS_01700 27240 26554 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816035.1 protein_id gnl|my_center|LOCUS_01700 27273 28103 gene locus_tag LOCUS_01710 gene parJ 27273 28103 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 29305 28076 gene locus_tag LOCUS_01720 gene mshC 29305 28076 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_01720 29410 30345 gene locus_tag LOCUS_01730 29410 30345 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_01730 30751 30353 gene locus_tag LOCUS_01740 30751 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 32102 30792 gene locus_tag LOCUS_01750 32102 30792 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_01750 32171 32749 gene locus_tag LOCUS_01760 32171 32749 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948663.1 protein_id gnl|my_center|LOCUS_01760 34108 32804 gene locus_tag LOCUS_01770 34108 32804 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_01770 34203 34991 gene locus_tag LOCUS_01780 34203 34991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777133.1 protein_id gnl|my_center|LOCUS_01780 36663 34993 gene locus_tag LOCUS_01790 36663 34993 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_01790 36816 37583 gene locus_tag LOCUS_01800 36816 37583 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_01800 37580 38539 gene locus_tag LOCUS_01810 37580 38539 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence005 323 721 gene locus_tag LOCUS_01820 323 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 724 945 gene locus_tag LOCUS_01830 724 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1164 2210 gene locus_tag LOCUS_01840 gene recA 1164 2210 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_01840 2210 2737 gene locus_tag LOCUS_01850 2210 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01850 2794 4446 gene locus_tag LOCUS_01860 2794 4446 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_01860 4480 5958 gene locus_tag LOCUS_01870 gene miaB 4480 5958 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_01870 6380 5961 gene locus_tag LOCUS_01880 6380 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6811 6377 gene locus_tag LOCUS_01890 6811 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6810 7724 gene locus_tag LOCUS_01900 gene miaA 6810 7724 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_01900 7712 8584 gene locus_tag LOCUS_01910 gene dapF 7712 8584 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_01910 9158 8553 gene locus_tag LOCUS_01920 9158 8553 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_01920 9277 10710 gene locus_tag LOCUS_01930 gene hflX 9277 10710 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_01930 10700 12676 gene locus_tag LOCUS_01940 10700 12676 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804683.1 protein_id gnl|my_center|LOCUS_01940 12702 13661 gene locus_tag LOCUS_01950 12702 13661 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_01950 14369 13695 gene locus_tag LOCUS_01960 gene lexA 14369 13695 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804684.1 protein_id gnl|my_center|LOCUS_01960 14537 14950 gene locus_tag LOCUS_01970 14537 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 15027 15497 gene locus_tag LOCUS_01980 gene nrdR 15027 15497 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 16562 15534 gene locus_tag LOCUS_01990 gene mgrA 16562 15534 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_01990 17801 16587 gene locus_tag LOCUS_02000 gene serA 17801 16587 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 protein_id gnl|my_center|LOCUS_02000 20074 17816 gene locus_tag LOCUS_02010 20074 17816 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_02010 20217 21131 gene locus_tag LOCUS_02020 20217 21131 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_02020 21844 21128 gene locus_tag LOCUS_02030 21844 21128 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02030 21955 23178 gene locus_tag LOCUS_02040 gene dinB 21955 23178 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_02040 23271 23624 gene locus_tag LOCUS_02050 23271 23624 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804692.1 protein_id gnl|my_center|LOCUS_02050 23912 24343 gene locus_tag LOCUS_02060 gene mraZ 23912 24343 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_02060 24471 25421 gene locus_tag LOCUS_02070 gene rsmH 24471 25421 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110491.1 protein_id gnl|my_center|LOCUS_02070 25418 25816 gene locus_tag LOCUS_02080 25418 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 25813 27624 gene locus_tag LOCUS_02090 25813 27624 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 protein_id gnl|my_center|LOCUS_02090 27621 28997 gene locus_tag LOCUS_02100 27621 28997 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_02100 28994 30364 gene locus_tag LOCUS_02110 28994 30364 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_02110 30361 31443 gene locus_tag LOCUS_02120 gene mraY 30361 31443 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_02120 31440 32900 gene locus_tag LOCUS_02130 gene murD 31440 32900 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_02130 32897 34153 gene locus_tag LOCUS_02140 32897 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02140 34146 35258 gene locus_tag LOCUS_02150 34146 35258 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812327.1 protein_id gnl|my_center|LOCUS_02150 35252 36580 gene locus_tag LOCUS_02160 gene murC 35252 36580 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_02160 36676 37464 gene locus_tag LOCUS_02170 36676 37464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence006 1425 391 gene locus_tag LOCUS_02180 1425 391 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_02180 1919 1446 gene locus_tag LOCUS_02190 1919 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 2124 2693 gene locus_tag LOCUS_02200 2124 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3779 2706 gene locus_tag LOCUS_02210 3779 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6097 3776 gene locus_tag LOCUS_02220 6097 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 6236 8176 gene locus_tag LOCUS_02230 6236 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 8258 8683 gene locus_tag LOCUS_02240 8258 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8680 10755 gene locus_tag LOCUS_02250 8680 10755 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_02250 10892 11947 gene locus_tag LOCUS_02260 10892 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11944 14475 gene locus_tag LOCUS_02270 11944 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14506 15303 gene locus_tag LOCUS_02280 14506 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15374 16638 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttctatccgctatttcgcgggacctgatctcagac 17089 16805 gene locus_tag LOCUS_02290 17089 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 18954 17080 gene locus_tag LOCUS_02300 18954 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 19716 18970 gene locus_tag LOCUS_02310 19716 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 20122 19718 gene locus_tag LOCUS_02320 20122 19718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 21099 20119 gene locus_tag LOCUS_02330 21099 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 21656 21252 gene locus_tag LOCUS_02340 21656 21252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 23017 21653 gene locus_tag LOCUS_02350 23017 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 24366 23014 gene locus_tag LOCUS_02360 24366 23014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 24944 24363 gene locus_tag LOCUS_02370 24944 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 26446 24941 gene locus_tag LOCUS_02380 26446 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 28593 26443 gene locus_tag LOCUS_02390 28593 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 28789 31328 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttactatccgctatttcgcgggacctgatctcagac >Feature sequence007 304 879 gene locus_tag LOCUS_02400 304 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1123 1344 gene locus_tag LOCUS_02410 1123 1344 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_02410 1398 2417 gene locus_tag LOCUS_02420 1398 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02420 2347 3927 gene locus_tag LOCUS_02430 2347 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02430 4313 4110 gene locus_tag LOCUS_02440 4313 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 5425 4343 gene locus_tag LOCUS_02450 5425 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5545 6720 gene locus_tag LOCUS_02460 5545 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6727 7563 gene locus_tag LOCUS_02470 6727 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7589 8821 gene locus_tag LOCUS_02480 7589 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9266 8883 gene locus_tag LOCUS_02490 9266 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10045 9443 gene locus_tag LOCUS_02500 10045 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11232 10039 gene locus_tag LOCUS_02510 11232 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12317 11256 gene locus_tag LOCUS_02520 12317 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12635 13003 gene locus_tag LOCUS_02530 12635 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13254 14417 gene locus_tag LOCUS_02540 13254 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15605 14382 gene locus_tag LOCUS_02550 15605 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15535 15720 gene locus_tag LOCUS_02560 15535 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 15758 16693 gene locus_tag LOCUS_02570 15758 16693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 17440 16703 gene locus_tag LOCUS_02580 17440 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 20427 17497 gene locus_tag LOCUS_02590 20427 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20624 20534 gene locus_tag LOCUS_t00070 20624 20534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20881 20796 gene locus_tag LOCUS_t00080 20881 20796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20976 21944 gene locus_tag LOCUS_02600 20976 21944 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_02600 23369 22059 gene locus_tag LOCUS_02610 23369 22059 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 protein_id gnl|my_center|LOCUS_02610 23559 23735 gene locus_tag LOCUS_02620 23559 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23735 24214 gene locus_tag LOCUS_02630 23735 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24466 24795 gene locus_tag LOCUS_02640 24466 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 24798 26387 gene locus_tag LOCUS_02650 24798 26387 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_02650 26384 26602 gene locus_tag LOCUS_02660 26384 26602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 27356 26673 gene locus_tag LOCUS_02670 27356 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence008 <1 1208 gene locus_tag LOCUS_02680 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258483.1:S9 family peptidase 4001 1209 gene locus_tag LOCUS_02690 gene acnA 4001 1209 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805056.1 protein_id gnl|my_center|LOCUS_02690 5319 4114 gene locus_tag LOCUS_02700 5319 4114 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389698.1 protein_id gnl|my_center|LOCUS_02700 7289 5316 gene locus_tag LOCUS_02710 7289 5316 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_02710 7360 8025 gene locus_tag LOCUS_02720 7360 8025 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_02720 8025 8690 gene locus_tag LOCUS_02730 8025 8690 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_02730 9318 8641 gene locus_tag LOCUS_02740 9318 8641 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389697.1 protein_id gnl|my_center|LOCUS_02740 9651 9322 gene locus_tag LOCUS_02750 9651 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 10316 9648 gene locus_tag LOCUS_02760 10316 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10430 10876 gene locus_tag LOCUS_02770 10430 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11176 10877 gene locus_tag LOCUS_02780 11176 10877 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_02780 12082 11273 gene locus_tag LOCUS_02790 12082 11273 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_02790 12178 13158 gene locus_tag LOCUS_02800 12178 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 13822 13163 gene locus_tag LOCUS_02810 13822 13163 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_02810 14949 13822 gene locus_tag LOCUS_02820 14949 13822 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 protein_id gnl|my_center|LOCUS_02820 15530 14946 gene locus_tag LOCUS_02830 15530 14946 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_02830 17931 15538 gene locus_tag LOCUS_02840 17931 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 17993 20425 gene locus_tag LOCUS_02850 17993 20425 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_02850 21504 20434 gene locus_tag LOCUS_02860 21504 20434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22451 21501 gene locus_tag LOCUS_02870 22451 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 24588 22486 gene locus_tag LOCUS_02880 24588 22486 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_02880 24627 24923 gene locus_tag LOCUS_02890 24627 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 26559 25018 gene locus_tag LOCUS_02900 26559 25018 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 protein_id gnl|my_center|LOCUS_02900 <27198 26601 gene locus_tag LOCUS_02910 <27198 26601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973202.1:RNA polymerase sigma factor >Feature sequence009 393 998 gene locus_tag LOCUS_02920 gene pcp 393 998 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230445.1 protein_id gnl|my_center|LOCUS_02920 995 1606 gene locus_tag LOCUS_02930 995 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1640 3694 gene locus_tag LOCUS_02940 gene uvrB 1640 3694 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_02940 3766 4875 gene locus_tag LOCUS_02950 3766 4875 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 protein_id gnl|my_center|LOCUS_02950 5204 4923 gene locus_tag LOCUS_02960 5204 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5303 8155 gene locus_tag LOCUS_02970 gene uvrA 5303 8155 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805115.1 protein_id gnl|my_center|LOCUS_02970 8158 10059 gene locus_tag LOCUS_02980 gene uvrC 8158 10059 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_02980 10160 11050 gene locus_tag LOCUS_02990 gene rapZ 10160 11050 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_02990 11050 11994 gene locus_tag LOCUS_03000 gene yvcK 11050 11994 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_03000 12009 12992 gene locus_tag LOCUS_03010 gene whiA 12009 12992 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_03010 13206 14210 gene locus_tag LOCUS_03020 gene gap 13206 14210 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_03020 14283 15473 gene locus_tag LOCUS_03030 14283 15473 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_03030 15473 16255 gene locus_tag LOCUS_03040 gene tpiA 15473 16255 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_03040 16341 16586 gene locus_tag LOCUS_03050 gene secG 16341 16586 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_03050 16596 16943 gene locus_tag LOCUS_03060 16596 16943 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_03060 17208 16960 gene locus_tag LOCUS_03070 17208 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 18625 17690 gene locus_tag LOCUS_03080 18625 17690 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 protein_id gnl|my_center|LOCUS_03080 20146 18635 gene locus_tag LOCUS_03090 gene zwf 20146 18635 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_03090 21254 20160 gene locus_tag LOCUS_03100 gene tal 21254 20160 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_03100 23386 21284 gene locus_tag LOCUS_03110 gene tkt 23386 21284 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_03110 23585 24517 gene locus_tag LOCUS_03120 23585 24517 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_03120 24514 25431 gene locus_tag LOCUS_03130 gene xerD 24514 25431 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_03130 25441 26766 gene locus_tag LOCUS_03140 25441 26766 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775673.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence010 193 109 gene locus_tag LOCUS_t00090 193 109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 572 1270 gene locus_tag LOCUS_03150 572 1270 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 protein_id gnl|my_center|LOCUS_03150 1293 1856 gene locus_tag LOCUS_03160 1293 1856 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_03160 1853 3148 gene locus_tag LOCUS_03170 1853 3148 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_03170 3148 4608 gene locus_tag LOCUS_03180 3148 4608 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_03180 4605 6062 gene locus_tag LOCUS_03190 4605 6062 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_03190 6059 6958 gene locus_tag LOCUS_03200 6059 6958 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 protein_id gnl|my_center|LOCUS_03200 6952 8772 gene locus_tag LOCUS_03210 gene pknB 6952 8772 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068568.1 protein_id gnl|my_center|LOCUS_03210 9472 8813 gene locus_tag LOCUS_03220 9472 8813 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 protein_id gnl|my_center|LOCUS_03220 9626 9465 gene locus_tag LOCUS_03230 9626 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10399 9626 gene locus_tag LOCUS_03240 10399 9626 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_03240 11124 10396 gene locus_tag LOCUS_03250 11124 10396 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776678.1 protein_id gnl|my_center|LOCUS_03250 11205 11456 gene locus_tag LOCUS_03260 11205 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11775 11434 gene locus_tag LOCUS_03270 11775 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 11790 11991 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacccgcaggatcgttctgcgtacgctcttgggg 13400 12561 gene locus_tag LOCUS_03280 13400 12561 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803866.1 protein_id gnl|my_center|LOCUS_03280 13926 13405 gene locus_tag LOCUS_03290 13926 13405 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_03290 14103 15047 gene locus_tag LOCUS_03300 14103 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 15683 15099 gene locus_tag LOCUS_03310 15683 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 15586 16107 gene locus_tag LOCUS_03320 15586 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 16551 16180 gene locus_tag LOCUS_03330 16551 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 16917 16636 gene locus_tag LOCUS_03340 16917 16636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17077 17748 gene locus_tag LOCUS_03350 17077 17748 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977730.1 protein_id gnl|my_center|LOCUS_03350 17745 18419 gene locus_tag LOCUS_03360 17745 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 19224 18424 gene locus_tag LOCUS_03370 19224 18424 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776922.1 protein_id gnl|my_center|LOCUS_03370 19314 19242 gene locus_tag LOCUS_t00100 19314 19242 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19551 19399 gene locus_tag LOCUS_03380 19551 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 19651 19576 gene locus_tag LOCUS_t00110 19651 19576 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 20321 19719 gene locus_tag LOCUS_03390 20321 19719 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803675.1 protein_id gnl|my_center|LOCUS_03390 22882 20318 gene locus_tag LOCUS_03400 gene gyrA 22882 20318 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_03400 24904 22892 gene locus_tag LOCUS_03410 gene gyrB 24904 22892 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_03410 25624 25106 gene locus_tag LOCUS_03420 25624 25106 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_03420 <26500 25621 gene locus_tag LOCUS_03430 <26500 25621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975056.1:DNA replication/repair protein RecF >Feature sequence011 1297 311 gene locus_tag LOCUS_03440 1297 311 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_03440 1929 1333 gene locus_tag LOCUS_03450 1929 1333 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_03450 1972 2592 gene locus_tag LOCUS_03460 1972 2592 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_03460 2589 3416 gene locus_tag LOCUS_03470 2589 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3435 3767 gene locus_tag LOCUS_03480 3435 3767 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805149.1 protein_id gnl|my_center|LOCUS_03480 3770 4504 gene locus_tag LOCUS_03490 3770 4504 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805150.1 protein_id gnl|my_center|LOCUS_03490 4556 5014 gene locus_tag LOCUS_03500 4556 5014 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805151.1 protein_id gnl|my_center|LOCUS_03500 5011 5760 gene locus_tag LOCUS_03510 5011 5760 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_03510 5948 6472 gene locus_tag LOCUS_03520 5948 6472 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_03520 6474 7154 gene locus_tag LOCUS_03530 6474 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 7165 7938 gene locus_tag LOCUS_03540 7165 7938 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103980.1 protein_id gnl|my_center|LOCUS_03540 8530 7925 gene locus_tag LOCUS_03550 8530 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 10032 8527 gene locus_tag LOCUS_03560 10032 8527 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_03560 10164 10568 gene locus_tag LOCUS_03570 10164 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 11669 10644 gene locus_tag LOCUS_03580 11669 10644 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_03580 11831 12184 gene locus_tag LOCUS_03590 11831 12184 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_03590 12939 12181 gene locus_tag LOCUS_03600 12939 12181 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_03600 14447 12936 gene locus_tag LOCUS_03610 gene lnt 14447 12936 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805197.1 protein_id gnl|my_center|LOCUS_03610 17326 14639 gene locus_tag LOCUS_03620 17326 14639 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_03620 18207 17323 gene locus_tag LOCUS_03630 18207 17323 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_03630 18998 18219 gene locus_tag LOCUS_03640 gene tatC 18998 18219 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805201.1 protein_id gnl|my_center|LOCUS_03640 19277 19011 gene locus_tag LOCUS_03650 19277 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 19630 19331 gene locus_tag LOCUS_03660 19630 19331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 20535 19648 gene locus_tag LOCUS_03670 20535 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 21185 20532 gene locus_tag LOCUS_03680 21185 20532 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815827.1 protein_id gnl|my_center|LOCUS_03680 22117 21182 gene locus_tag LOCUS_03690 22117 21182 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262982.1 protein_id gnl|my_center|LOCUS_03690 22776 22117 gene locus_tag LOCUS_03700 gene dmsB 22776 22117 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421848.1 protein_id gnl|my_center|LOCUS_03700 25369 22793 gene locus_tag LOCUS_03710 gene dmsA 25369 22793 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850310.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence012 1037 3 gene locus_tag LOCUS_03720 gene tsaD 1037 3 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054363.1 protein_id gnl|my_center|LOCUS_03720 1870 1127 gene locus_tag LOCUS_03730 1870 1127 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_03730 3843 1867 gene locus_tag LOCUS_03740 3843 1867 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_03740 4500 3853 gene locus_tag LOCUS_03750 4500 3853 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_03750 5104 4649 gene locus_tag LOCUS_03760 5104 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5723 5091 gene locus_tag LOCUS_03770 gene tsaB 5723 5091 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776313.1 protein_id gnl|my_center|LOCUS_03770 6409 5720 gene locus_tag LOCUS_03780 6409 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6909 6406 gene locus_tag LOCUS_03790 gene tsaE 6909 6406 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_03790 8018 6900 gene locus_tag LOCUS_03800 gene alr 8018 6900 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_03800 9562 8042 gene locus_tag LOCUS_03810 9562 8042 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 protein_id gnl|my_center|LOCUS_03810 9906 9559 gene locus_tag LOCUS_03820 9906 9559 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_03820 11766 9907 gene locus_tag LOCUS_03830 gene glmS 11766 9907 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776318.1 protein_id gnl|my_center|LOCUS_03830 11819 12751 gene locus_tag LOCUS_03840 gene coaA 11819 12751 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_03840 13555 12761 gene locus_tag LOCUS_03850 13555 12761 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804918.1 protein_id gnl|my_center|LOCUS_03850 14191 13709 gene locus_tag LOCUS_03860 gene rpsI 14191 13709 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_03860 14663 14220 gene locus_tag LOCUS_03870 gene rplM 14663 14220 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_03870 14924 15349 gene locus_tag LOCUS_03880 14924 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 16191 15232 gene locus_tag LOCUS_03890 gene truA 16191 15232 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_03890 16239 16997 gene locus_tag LOCUS_03900 16239 16997 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_03900 17603 17055 gene locus_tag LOCUS_03910 17603 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 18639 17626 gene locus_tag LOCUS_03920 18639 17626 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_03920 19152 18745 gene locus_tag LOCUS_03930 gene rpsK 19152 18745 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_03930 19573 19199 gene locus_tag LOCUS_03940 gene rpsM 19573 19199 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053047.1 protein_id gnl|my_center|LOCUS_03940 20106 19876 gene locus_tag LOCUS_03950 gene infA 20106 19876 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_03950 21111 20269 gene locus_tag LOCUS_03960 gene map 21111 20269 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_03960 21676 21101 gene locus_tag LOCUS_03970 21676 21101 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_03970 22962 21673 gene locus_tag LOCUS_03980 gene secY 22962 21673 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_03980 23557 23093 gene locus_tag LOCUS_03990 gene rplO 23557 23093 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_03990 23742 23557 gene locus_tag LOCUS_04000 gene rpmD 23742 23557 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_04000 24431 23739 gene locus_tag LOCUS_04010 gene rpsE 24431 23739 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_04010 24831 24460 gene locus_tag LOCUS_04020 gene rplR 24831 24460 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814538.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence013 577 1293 gene locus_tag LOCUS_04030 577 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3114 1381 gene locus_tag LOCUS_04040 3114 1381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_04040 4900 3095 gene locus_tag LOCUS_04050 4900 3095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_04050 4970 5392 gene locus_tag LOCUS_04060 4970 5392 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929893.1 protein_id gnl|my_center|LOCUS_04060 5389 6951 gene locus_tag LOCUS_04070 gene guaA 5389 6951 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804508.1 protein_id gnl|my_center|LOCUS_04070 8086 6968 gene locus_tag LOCUS_04080 8086 6968 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229156.1 protein_id gnl|my_center|LOCUS_04080 8316 8825 gene locus_tag LOCUS_04090 8316 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 8923 9264 gene locus_tag LOCUS_04100 8923 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 9266 9748 gene locus_tag LOCUS_04110 9266 9748 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079757.1 protein_id gnl|my_center|LOCUS_04110 9776 10411 gene locus_tag LOCUS_04120 9776 10411 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_04120 10480 12915 gene locus_tag LOCUS_04130 gene pcrA 10480 12915 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_04130 12989 14917 gene locus_tag LOCUS_04140 12989 14917 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700513.1 protein_id gnl|my_center|LOCUS_04140 15014 16174 gene locus_tag LOCUS_04150 gene sucC 15014 16174 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_04150 16182 17099 gene locus_tag LOCUS_04160 gene sucD 16182 17099 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_04160 17156 18562 gene locus_tag LOCUS_04170 17156 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18567 19178 gene locus_tag LOCUS_04180 gene purN 18567 19178 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_04180 19298 20863 gene locus_tag LOCUS_04190 gene purH 19298 20863 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_04190 20906 23161 gene locus_tag LOCUS_04200 20906 23161 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_04200 24329 23148 gene locus_tag LOCUS_04210 24329 23148 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_04210 24352 24618 gene locus_tag LOCUS_04220 24352 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence014 1288 644 gene locus_tag LOCUS_04230 1288 644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804879.1 protein_id gnl|my_center|LOCUS_04230 2532 1279 gene locus_tag LOCUS_04240 2532 1279 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804880.1 protein_id gnl|my_center|LOCUS_04240 3361 2597 gene locus_tag LOCUS_04250 3361 2597 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_04250 3471 3665 gene locus_tag LOCUS_04260 3471 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3797 6505 gene locus_tag LOCUS_04270 gene ppdK 3797 6505 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_04270 6615 8780 gene locus_tag LOCUS_04280 gene feoB 6615 8780 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887862.1 protein_id gnl|my_center|LOCUS_04280 8777 9049 gene locus_tag LOCUS_04290 8777 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9058 11904 gene locus_tag LOCUS_04300 9058 11904 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_04300 11963 13024 gene locus_tag LOCUS_04310 11963 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 14053 13025 gene locus_tag LOCUS_04320 14053 13025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819405.1 protein_id gnl|my_center|LOCUS_04320 15234 14068 gene locus_tag LOCUS_04330 15234 14068 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_04330 16601 15231 gene locus_tag LOCUS_04340 16601 15231 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_04340 17042 18571 gene locus_tag LOCUS_04350 17042 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 19081 18587 gene locus_tag LOCUS_04360 19081 18587 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804890.1 protein_id gnl|my_center|LOCUS_04360 19171 20502 gene locus_tag LOCUS_04370 19171 20502 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804891.1 protein_id gnl|my_center|LOCUS_04370 20518 21531 gene locus_tag LOCUS_04380 20518 21531 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_04380 21531 22559 gene locus_tag LOCUS_04390 gene tilS 21531 22559 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_04390 22561 23118 gene locus_tag LOCUS_04400 gene hpt 22561 23118 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence015 <1 964 gene locus_tag LOCUS_04410 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918509.1:type I restriction endonuclease subunit R 967 1242 gene locus_tag LOCUS_04420 967 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2988 1540 gene locus_tag LOCUS_04430 2988 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3218 4438 gene locus_tag LOCUS_04440 3218 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4438 5610 gene locus_tag LOCUS_04450 4438 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5607 6494 gene locus_tag LOCUS_04460 5607 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6768 6511 gene locus_tag LOCUS_04470 6768 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7749 6844 gene locus_tag LOCUS_04480 7749 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8055 8669 gene locus_tag LOCUS_04490 8055 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8980 9585 gene locus_tag LOCUS_04500 8980 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 9799 10500 gene locus_tag LOCUS_04510 9799 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 10724 11383 gene locus_tag LOCUS_04520 10724 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 12059 11598 gene locus_tag LOCUS_04530 12059 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12530 13300 gene locus_tag LOCUS_04540 12530 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 13293 15377 gene locus_tag LOCUS_04550 13293 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15377 16498 gene locus_tag LOCUS_04560 15377 16498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_04560 16500 19148 gene locus_tag LOCUS_04570 16500 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 19223 19570 gene locus_tag LOCUS_04580 19223 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 19731 20003 gene locus_tag LOCUS_04590 19731 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 20000 20926 gene locus_tag LOCUS_04600 20000 20926 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_04600 20942 21133 gene locus_tag LOCUS_04610 20942 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 21154 21507 gene locus_tag LOCUS_04620 21154 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 21504 21977 gene locus_tag LOCUS_04630 21504 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929970.1 protein_id gnl|my_center|LOCUS_04630 21983 22444 gene locus_tag LOCUS_04640 21983 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence016 <1 871 gene locus_tag LOCUS_04650 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030868159.1:alanine dehydrogenase 1493 891 gene locus_tag LOCUS_04660 1493 891 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_04660 1792 1499 gene locus_tag LOCUS_04670 1792 1499 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031865.1 protein_id gnl|my_center|LOCUS_04670 1791 3170 gene locus_tag LOCUS_04680 1791 3170 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_04680 3915 3196 gene locus_tag LOCUS_04690 3915 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 5618 3909 gene locus_tag LOCUS_04700 5618 3909 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_04700 6667 5615 gene locus_tag LOCUS_04710 6667 5615 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_04710 6882 7148 gene locus_tag LOCUS_04720 6882 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 7502 7152 gene locus_tag LOCUS_04730 gene mnhG 7502 7152 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064840.1 protein_id gnl|my_center|LOCUS_04730 7873 7502 gene locus_tag LOCUS_04740 7873 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 8466 7870 gene locus_tag LOCUS_04750 8466 7870 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776503.1 protein_id gnl|my_center|LOCUS_04750 9997 8453 gene locus_tag LOCUS_04760 9997 8453 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776504.1 protein_id gnl|my_center|LOCUS_04760 10470 9994 gene locus_tag LOCUS_04770 10470 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 13460 10467 gene locus_tag LOCUS_04780 13460 10467 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_04780 13508 14134 gene locus_tag LOCUS_04790 13508 14134 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_04790 14535 14155 gene locus_tag LOCUS_04800 14535 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 14660 15106 gene locus_tag LOCUS_04810 14660 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 15708 15136 gene locus_tag LOCUS_04820 15708 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 16696 15800 gene locus_tag LOCUS_04830 16696 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 17270 16689 gene locus_tag LOCUS_04840 gene dcd 17270 16689 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_04840 17835 17908 gene locus_tag LOCUS_t00120 17835 17908 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17950 18960 gene locus_tag LOCUS_04850 17950 18960 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_04850 19227 20207 gene locus_tag LOCUS_04860 19227 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 20217 21275 gene locus_tag LOCUS_04870 gene tdh 20217 21275 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_04870 21275 22477 gene locus_tag LOCUS_04880 21275 22477 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence017 1418 462 gene locus_tag LOCUS_04890 1418 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1513 2919 gene locus_tag LOCUS_04900 1513 2919 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_04900 4255 2912 gene locus_tag LOCUS_04910 4255 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4668 4357 gene locus_tag LOCUS_04920 4668 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6059 9574 gene locus_tag LOCUS_04930 6059 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9579 10205 gene locus_tag LOCUS_04940 9579 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11717 10224 gene locus_tag LOCUS_04950 11717 10224 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_04950 12431 11730 gene locus_tag LOCUS_04960 12431 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13462 12446 gene locus_tag LOCUS_04970 13462 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 14449 13505 gene locus_tag LOCUS_04980 14449 13505 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950734.1 protein_id gnl|my_center|LOCUS_04980 15682 14450 gene locus_tag LOCUS_04990 gene hsdS 15682 14450 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_04990 18447 15679 gene locus_tag LOCUS_05000 18447 15679 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_05000 18877 19662 gene locus_tag LOCUS_05010 18877 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 20395 20099 gene locus_tag LOCUS_05020 20395 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 21652 20525 gene locus_tag LOCUS_05030 21652 20525 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_05030 21957 22253 gene locus_tag LOCUS_05040 21957 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 22250 22783 gene locus_tag LOCUS_05050 22250 22783 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_05050 <23401 22780 gene locus_tag LOCUS_05060 <23401 22780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179719124.1:TetR/AcrR family transcriptional regulator C-terminal domain-containing protein >Feature sequence018 1540 557 gene locus_tag LOCUS_05070 1540 557 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_05070 2546 1545 gene locus_tag LOCUS_05080 gene argF 2546 1545 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_05080 3813 2587 gene locus_tag LOCUS_05090 3813 2587 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_05090 5276 4038 gene locus_tag LOCUS_05100 5276 4038 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_05100 6438 5269 gene locus_tag LOCUS_05110 6438 5269 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_05110 7340 6435 gene locus_tag LOCUS_05120 gene argB 7340 6435 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_05120 8500 7337 gene locus_tag LOCUS_05130 gene argJ 8500 7337 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776181.1 protein_id gnl|my_center|LOCUS_05130 9549 8497 gene locus_tag LOCUS_05140 gene argC 9549 8497 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729317.1 protein_id gnl|my_center|LOCUS_05140 9617 10591 gene locus_tag LOCUS_05150 9617 10591 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_05150 11098 10595 gene locus_tag LOCUS_05160 11098 10595 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_05160 11894 11145 gene locus_tag LOCUS_05170 11894 11145 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976119.1 protein_id gnl|my_center|LOCUS_05170 14425 11891 gene locus_tag LOCUS_05180 gene pheT 14425 11891 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_05180 15489 14425 gene locus_tag LOCUS_05190 gene pheS 15489 14425 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_05190 15636 16055 gene locus_tag LOCUS_05200 15636 16055 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_05200 16024 16896 gene locus_tag LOCUS_05210 16024 16896 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_05210 17672 16869 gene locus_tag LOCUS_05220 17672 16869 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_05220 18060 17680 gene locus_tag LOCUS_05230 gene rplT 18060 17680 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_05230 18274 18080 gene locus_tag LOCUS_05240 18274 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 18811 18278 gene locus_tag LOCUS_05250 gene infC 18811 18278 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997922.1 protein_id gnl|my_center|LOCUS_05250 19925 19137 gene locus_tag LOCUS_05260 19925 19137 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776202.1 protein_id gnl|my_center|LOCUS_05260 20520 19918 gene locus_tag LOCUS_05270 gene priA 20520 19918 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_05270 21281 20652 gene locus_tag LOCUS_05280 gene hisH 21281 20652 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 protein_id gnl|my_center|LOCUS_05280 21835 21278 gene locus_tag LOCUS_05290 21835 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 22437 21835 gene locus_tag LOCUS_05300 gene hisB 22437 21835 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776207.1 protein_id gnl|my_center|LOCUS_05300 <22959 22430 gene locus_tag LOCUS_05310 <22959 22430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929983.1:histidinol-phosphate transaminase >Feature sequence019 471 1982 gene locus_tag LOCUS_05320 471 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3835 2360 gene locus_tag LOCUS_05330 3835 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5477 4101 gene locus_tag LOCUS_05340 5477 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6992 5667 gene locus_tag LOCUS_05350 6992 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7112 7447 gene locus_tag LOCUS_05360 7112 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8902 7490 gene locus_tag LOCUS_05370 8902 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9433 10488 gene locus_tag LOCUS_05380 9433 10488 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_05380 11774 10563 gene locus_tag LOCUS_05390 11774 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12053 13375 gene locus_tag LOCUS_05400 12053 13375 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_05400 13540 14508 gene locus_tag LOCUS_05410 13540 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14510 15457 gene locus_tag LOCUS_05420 14510 15457 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_05420 15462 16400 gene locus_tag LOCUS_05430 15462 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 17220 16864 gene locus_tag LOCUS_05440 17220 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 17108 17998 gene locus_tag LOCUS_05450 17108 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 18438 17962 gene locus_tag LOCUS_05460 18438 17962 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_05460 18667 18431 gene locus_tag LOCUS_05470 18667 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 19099 20637 gene locus_tag LOCUS_05480 19099 20637 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015563.1 protein_id gnl|my_center|LOCUS_05480 21033 20704 gene locus_tag LOCUS_05490 21033 20704 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_05490 21179 21030 gene locus_tag LOCUS_05500 21179 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 21997 21263 gene locus_tag LOCUS_05510 21997 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 22288 22109 gene locus_tag LOCUS_05520 22288 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence020 1346 636 gene locus_tag LOCUS_05530 1346 636 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728735.1 protein_id gnl|my_center|LOCUS_05530 1485 3086 gene locus_tag LOCUS_05540 1485 3086 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805005.1 protein_id gnl|my_center|LOCUS_05540 3142 3681 gene locus_tag LOCUS_05550 3142 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5956 3638 gene locus_tag LOCUS_05560 gene relA 5956 3638 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_05560 6534 5998 gene locus_tag LOCUS_05570 6534 5998 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_05570 7628 6531 gene locus_tag LOCUS_05580 gene secF 7628 6531 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_05580 9541 7628 gene locus_tag LOCUS_05590 gene secD 9541 7628 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_05590 9901 9569 gene locus_tag LOCUS_05600 9901 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10997 9993 gene locus_tag LOCUS_05610 gene ruvB 10997 9993 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804998.1 protein_id gnl|my_center|LOCUS_05610 11589 11005 gene locus_tag LOCUS_05620 gene ruvA 11589 11005 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_05620 12202 11624 gene locus_tag LOCUS_05630 gene ruvC 12202 11624 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_05630 12963 12202 gene locus_tag LOCUS_05640 12963 12202 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_05640 14467 13058 gene locus_tag LOCUS_05650 14467 13058 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_05650 15090 14497 gene locus_tag LOCUS_05660 gene pdxT 15090 14497 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_05660 15620 15087 gene locus_tag LOCUS_05670 15620 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16501 15614 gene locus_tag LOCUS_05680 gene pdxS 16501 15614 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_05680 17631 16528 gene locus_tag LOCUS_05690 17631 16528 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804994.1 protein_id gnl|my_center|LOCUS_05690 18227 17628 gene locus_tag LOCUS_05700 18227 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19393 18215 gene locus_tag LOCUS_05710 19393 18215 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_05710 20322 19390 gene locus_tag LOCUS_05720 20322 19390 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_05720 20935 20312 gene locus_tag LOCUS_05730 20935 20312 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_05730 21477 20935 gene locus_tag LOCUS_05740 21477 20935 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence021 <1 814 gene locus_tag LOCUS_05750 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805006.1:histidine--tRNA ligase 827 2569 gene locus_tag LOCUS_05760 827 2569 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776427.1 protein_id gnl|my_center|LOCUS_05760 2566 4158 gene locus_tag LOCUS_05770 2566 4158 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_05770 5861 4134 gene locus_tag LOCUS_05780 5861 4134 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805008.1 protein_id gnl|my_center|LOCUS_05780 7321 5927 gene locus_tag LOCUS_05790 7321 5927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_05790 7409 9193 gene locus_tag LOCUS_05800 gene aspS 7409 9193 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_05800 9204 9956 gene locus_tag LOCUS_05810 9204 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11384 10116 gene locus_tag LOCUS_05820 11384 10116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_05820 13634 11400 gene locus_tag LOCUS_05830 13634 11400 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_05830 13725 14579 gene locus_tag LOCUS_05840 13725 14579 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_05840 14569 15381 gene locus_tag LOCUS_05850 14569 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 15374 15967 gene locus_tag LOCUS_05860 gene scpB 15374 15967 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_05860 15964 16695 gene locus_tag LOCUS_05870 15964 16695 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079325.1 protein_id gnl|my_center|LOCUS_05870 16725 17801 gene locus_tag LOCUS_05880 16725 17801 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_05880 17798 18496 gene locus_tag LOCUS_05890 17798 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 18493 19176 gene locus_tag LOCUS_05900 18493 19176 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence022 <1 1501 gene locus_tag LOCUS_05910 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036267.1:DEAD/DEAH box helicase family protein 1491 4196 gene locus_tag LOCUS_05920 1491 4196 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 protein_id gnl|my_center|LOCUS_05920 4261 4557 gene locus_tag LOCUS_05930 4261 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4568 5653 gene locus_tag LOCUS_05940 4568 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5653 8433 gene locus_tag LOCUS_05950 5653 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9914 8508 gene locus_tag LOCUS_05960 9914 8508 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256617.1 protein_id gnl|my_center|LOCUS_05960 11952 9916 gene locus_tag LOCUS_05970 11952 9916 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256616.1 protein_id gnl|my_center|LOCUS_05970 12955 11882 gene locus_tag LOCUS_05980 12955 11882 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256615.1 protein_id gnl|my_center|LOCUS_05980 13219 17760 gene locus_tag LOCUS_05990 13219 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 18306 18662 gene locus_tag LOCUS_06000 18306 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 19407 18649 gene locus_tag LOCUS_06010 19407 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence023 <1 1198 gene locus_tag LOCUS_06020 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776040.1:ATP-dependent RNA helicase HrpA 1292 1690 gene locus_tag LOCUS_06030 1292 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1849 2340 gene locus_tag LOCUS_06040 1849 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2378 3346 gene locus_tag LOCUS_06050 2378 3346 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776805.1 protein_id gnl|my_center|LOCUS_06050 3343 4275 gene locus_tag LOCUS_06060 3343 4275 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776806.1 protein_id gnl|my_center|LOCUS_06060 4385 5872 gene locus_tag LOCUS_06070 4385 5872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_06070 5883 6551 gene locus_tag LOCUS_06080 5883 6551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_06080 6706 8052 gene locus_tag LOCUS_06090 6706 8052 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776807.1 protein_id gnl|my_center|LOCUS_06090 10796 8517 gene locus_tag LOCUS_06100 gene metE 10796 8517 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_06100 11803 10793 gene locus_tag LOCUS_06110 11803 10793 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 protein_id gnl|my_center|LOCUS_06110 12137 14764 gene locus_tag LOCUS_06120 12137 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14754 16223 gene locus_tag LOCUS_06130 14754 16223 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_06130 16263 16922 gene locus_tag LOCUS_06140 16263 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 16943 17761 gene locus_tag LOCUS_06150 16943 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 18722 17766 gene locus_tag LOCUS_06160 18722 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence024 1014 49 gene locus_tag LOCUS_06170 1014 49 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_06170 1982 1017 gene locus_tag LOCUS_06180 gene pdhA 1982 1017 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_06180 3746 1986 gene locus_tag LOCUS_06190 gene acsA 3746 1986 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_06190 3745 4506 gene locus_tag LOCUS_06200 3745 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5248 4463 gene locus_tag LOCUS_06210 5248 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5381 6721 gene locus_tag LOCUS_06220 5381 6721 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_06220 6718 8025 gene locus_tag LOCUS_06230 6718 8025 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612466.1 protein_id gnl|my_center|LOCUS_06230 8022 9011 gene locus_tag LOCUS_06240 8022 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 9054 9596 gene locus_tag LOCUS_06250 9054 9596 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064991.1 protein_id gnl|my_center|LOCUS_06250 9679 11460 gene locus_tag LOCUS_06260 9679 11460 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_06260 12554 11463 gene locus_tag LOCUS_06270 12554 11463 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 protein_id gnl|my_center|LOCUS_06270 12559 13419 gene locus_tag LOCUS_06280 12559 13419 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_06280 13416 14363 gene locus_tag LOCUS_06290 13416 14363 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_06290 16558 14360 gene locus_tag LOCUS_06300 16558 14360 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_06300 17423 16647 gene locus_tag LOCUS_06310 17423 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 18534 17518 gene locus_tag LOCUS_06320 18534 17518 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_06320 <19302 18586 gene locus_tag LOCUS_06330 <19302 18586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225455.1:N(5)-(carboxyethyl)ornithine synthase >Feature sequence025 669 4 gene locus_tag LOCUS_06340 gene rpe 669 4 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805209.1 protein_id gnl|my_center|LOCUS_06340 2071 680 gene locus_tag LOCUS_06350 2071 680 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_06350 2979 2068 gene locus_tag LOCUS_06360 gene fmt 2979 2068 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805211.1 protein_id gnl|my_center|LOCUS_06360 3626 2991 gene locus_tag LOCUS_06370 3626 2991 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812477.1 protein_id gnl|my_center|LOCUS_06370 5526 3598 gene locus_tag LOCUS_06380 5526 3598 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_06380 6738 5539 gene locus_tag LOCUS_06390 gene metK 6738 5539 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805085.1 protein_id gnl|my_center|LOCUS_06390 7939 6743 gene locus_tag LOCUS_06400 gene coaBC 7939 6743 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_06400 8205 7939 gene locus_tag LOCUS_06410 8205 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8827 8210 gene locus_tag LOCUS_06420 gene gmk 8827 8210 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_06420 9167 8856 gene locus_tag LOCUS_06430 gene mihF 9167 8856 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_06430 10070 9243 gene locus_tag LOCUS_06440 gene pyrF 10070 9243 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805080.1 protein_id gnl|my_center|LOCUS_06440 13351 10067 gene locus_tag LOCUS_06450 gene carB 13351 10067 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_06450 14553 13351 gene locus_tag LOCUS_06460 gene carA 14553 13351 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819349.1 protein_id gnl|my_center|LOCUS_06460 15860 14550 gene locus_tag LOCUS_06470 15860 14550 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_06470 16837 15857 gene locus_tag LOCUS_06480 16837 15857 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_06480 17364 16834 gene locus_tag LOCUS_06490 gene pyrR 17364 16834 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_06490 17928 17452 gene locus_tag LOCUS_06500 gene nusB 17928 17452 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412985.1 protein_id gnl|my_center|LOCUS_06500 18488 17928 gene locus_tag LOCUS_06510 gene efp 18488 17928 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence026 1245 313 gene locus_tag LOCUS_06520 1245 313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_06520 1337 2017 gene locus_tag LOCUS_06530 1337 2017 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_06530 2014 3456 gene locus_tag LOCUS_06540 gene sufB 2014 3456 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805064.1 protein_id gnl|my_center|LOCUS_06540 3456 4628 gene locus_tag LOCUS_06550 gene sufD 3456 4628 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_06550 4673 4951 gene locus_tag LOCUS_06560 4673 4951 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_06560 4964 5722 gene locus_tag LOCUS_06570 gene sufC 4964 5722 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_06570 5722 7002 gene locus_tag LOCUS_06580 5722 7002 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111284.1 protein_id gnl|my_center|LOCUS_06580 7002 7469 gene locus_tag LOCUS_06590 7002 7469 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_06590 7472 7783 gene locus_tag LOCUS_06600 7472 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 7783 9081 gene locus_tag LOCUS_06610 7783 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 10021 9137 gene locus_tag LOCUS_06620 10021 9137 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_06620 10116 11729 gene locus_tag LOCUS_06630 10116 11729 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_06630 12538 11702 gene locus_tag LOCUS_06640 12538 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06640 12855 12535 gene locus_tag LOCUS_06650 12855 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12957 13649 gene locus_tag LOCUS_06660 12957 13649 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805189.1 protein_id gnl|my_center|LOCUS_06660 13658 14428 gene locus_tag LOCUS_06670 gene fabI 13658 14428 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_06670 14425 14934 gene locus_tag LOCUS_06680 14425 14934 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084578.1 protein_id gnl|my_center|LOCUS_06680 16210 14969 gene locus_tag LOCUS_06690 16210 14969 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_06690 16582 16262 gene locus_tag LOCUS_06700 16582 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 16466 16765 gene locus_tag LOCUS_06710 16466 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 18015 16771 gene locus_tag LOCUS_06720 gene glgC 18015 16771 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence027 1402 122 gene locus_tag LOCUS_06730 1402 122 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_06730 1595 2926 gene locus_tag LOCUS_06740 gene radA 1595 2926 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_06740 2999 4018 gene locus_tag LOCUS_06750 gene disA 2999 4018 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_06750 4665 4036 gene locus_tag LOCUS_06760 4665 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4765 5643 gene locus_tag LOCUS_06770 4765 5643 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804920.1 protein_id gnl|my_center|LOCUS_06770 5658 6107 gene locus_tag LOCUS_06780 5658 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6638 6114 gene locus_tag LOCUS_06790 6638 6114 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_06790 7634 6693 gene locus_tag LOCUS_06800 7634 6693 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_06800 7725 9458 gene locus_tag LOCUS_06810 7725 9458 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_06810 9471 10979 gene locus_tag LOCUS_06820 gene glpK 9471 10979 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_06820 11023 11685 gene locus_tag LOCUS_06830 11023 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 12863 11682 gene locus_tag LOCUS_06840 12863 11682 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_06840 14381 12867 gene locus_tag LOCUS_06850 gene lysS 14381 12867 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_06850 14500 14757 gene locus_tag LOCUS_06860 14500 14757 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_06860 15308 14820 gene locus_tag LOCUS_06870 15308 14820 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_06870 16144 15305 gene locus_tag LOCUS_06880 gene panC 16144 15305 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804902.1 protein_id gnl|my_center|LOCUS_06880 17022 16141 gene locus_tag LOCUS_06890 17022 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence028 <1 840 gene locus_tag LOCUS_06900 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829380.1:autolysin/adhesin Aae 896 2782 gene locus_tag LOCUS_06910 gene pknB 896 2782 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_06910 2366 2273 gene locus_tag LOCUS_t00130 2366 2273 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4051 2846 gene locus_tag LOCUS_06920 4051 2846 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775974.1 protein_id gnl|my_center|LOCUS_06920 5056 4103 gene locus_tag LOCUS_06930 5056 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5078 5470 gene locus_tag LOCUS_06940 5078 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6417 5482 gene locus_tag LOCUS_06950 6417 5482 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_06950 6567 8372 gene locus_tag LOCUS_06960 6567 8372 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_06960 8444 10195 gene locus_tag LOCUS_06970 8444 10195 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_06970 10265 10543 gene locus_tag LOCUS_06980 10265 10543 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805023.1 protein_id gnl|my_center|LOCUS_06980 11595 10549 gene locus_tag LOCUS_06990 gene trpD 11595 10549 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_06990 11993 11598 gene locus_tag LOCUS_07000 11993 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_07000 12185 12775 gene locus_tag LOCUS_07010 12185 12775 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_07010 12792 13568 gene locus_tag LOCUS_07020 12792 13568 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_07020 13565 14599 gene locus_tag LOCUS_07030 13565 14599 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_07030 14596 16266 gene locus_tag LOCUS_07040 14596 16266 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805018.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence029 741 1151 gene locus_tag LOCUS_07050 741 1151 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_07050 1332 2702 gene locus_tag LOCUS_07060 gene atpD 1332 2702 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_07060 2699 3106 gene locus_tag LOCUS_07070 2699 3106 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_07070 3099 3434 gene locus_tag LOCUS_07080 3099 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3431 3712 gene locus_tag LOCUS_07090 3431 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3709 4419 gene locus_tag LOCUS_07100 3709 4419 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_07100 4422 4685 gene locus_tag LOCUS_07110 4422 4685 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_07110 4721 5476 gene locus_tag LOCUS_07120 4721 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5494 6996 gene locus_tag LOCUS_07130 5494 6996 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921807.1 protein_id gnl|my_center|LOCUS_07130 6996 7883 gene locus_tag LOCUS_07140 6996 7883 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_07140 8131 11061 gene locus_tag LOCUS_07150 8131 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11493 11140 gene locus_tag LOCUS_07160 11493 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11753 11493 gene locus_tag LOCUS_07170 11753 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 12103 11750 gene locus_tag LOCUS_07180 12103 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13650 12103 gene locus_tag LOCUS_07190 13650 12103 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 protein_id gnl|my_center|LOCUS_07190 13949 13617 gene locus_tag LOCUS_07200 13949 13617 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 protein_id gnl|my_center|LOCUS_07200 16234 13946 gene locus_tag LOCUS_07210 16234 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence030 1463 315 gene locus_tag LOCUS_07220 gene ftsY 1463 315 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_07220 1769 1497 gene locus_tag LOCUS_07230 1769 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 5392 1847 gene locus_tag LOCUS_07240 gene smc 5392 1847 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_07240 5864 5439 gene locus_tag LOCUS_07250 gene ndk 5864 5439 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_07250 6241 5861 gene locus_tag LOCUS_07260 6241 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 6919 6260 gene locus_tag LOCUS_07270 gene dhaM 6919 6260 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_07270 7548 6916 gene locus_tag LOCUS_07280 gene dhaL 7548 6916 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_07280 8556 7555 gene locus_tag LOCUS_07290 gene dhaK 8556 7555 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_07290 9976 8630 gene locus_tag LOCUS_07300 9976 8630 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_07300 13188 9973 gene locus_tag LOCUS_07310 gene ileS 13188 9973 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407714.1 protein_id gnl|my_center|LOCUS_07310 14888 13410 gene locus_tag LOCUS_07320 14888 13410 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence031 269 1186 gene locus_tag LOCUS_07330 269 1186 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_07330 1786 1190 gene locus_tag LOCUS_07340 1786 1190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_07340 3456 1783 gene locus_tag LOCUS_07350 3456 1783 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 protein_id gnl|my_center|LOCUS_07350 4547 3468 gene locus_tag LOCUS_07360 4547 3468 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804980.1 protein_id gnl|my_center|LOCUS_07360 6172 4556 gene locus_tag LOCUS_07370 6172 4556 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 protein_id gnl|my_center|LOCUS_07370 6969 6169 gene locus_tag LOCUS_07380 6969 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_07380 7961 6966 gene locus_tag LOCUS_07390 7961 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9176 7971 gene locus_tag LOCUS_07400 gene steA 9176 7971 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_07400 10848 9181 gene locus_tag LOCUS_07410 gene recN 10848 9181 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_07410 11677 10841 gene locus_tag LOCUS_07420 11677 10841 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_07420 12516 11674 gene locus_tag LOCUS_07430 12516 11674 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079310.1 protein_id gnl|my_center|LOCUS_07430 12667 12518 gene locus_tag LOCUS_07440 12667 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13689 12664 gene locus_tag LOCUS_07450 13689 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14669 13686 gene locus_tag LOCUS_07460 14669 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 15820 14639 gene locus_tag LOCUS_07470 15820 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence032 197 2761 gene locus_tag LOCUS_07480 197 2761 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_07480 2898 6032 gene locus_tag LOCUS_07490 2898 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6172 7170 gene locus_tag LOCUS_07500 6172 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7563 7216 gene locus_tag LOCUS_07510 7563 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230027.1 protein_id gnl|my_center|LOCUS_07510 9233 7725 gene locus_tag LOCUS_07520 9233 7725 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_07520 9588 9259 gene locus_tag LOCUS_07530 9588 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9716 11029 gene locus_tag LOCUS_07540 9716 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11026 11214 gene locus_tag LOCUS_07550 11026 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12207 11263 gene locus_tag LOCUS_07560 12207 11263 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950734.1 protein_id gnl|my_center|LOCUS_07560 13401 12208 gene locus_tag LOCUS_07570 13401 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 <15590 13398 gene locus_tag LOCUS_07580 <15590 13398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546856.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein >Feature sequence033 1793 774 gene locus_tag LOCUS_07590 1793 774 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776398.1 protein_id gnl|my_center|LOCUS_07590 1866 3086 gene locus_tag LOCUS_07600 1866 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3727 3071 gene locus_tag LOCUS_07610 3727 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3855 4247 gene locus_tag LOCUS_07620 3855 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4917 4249 gene locus_tag LOCUS_07630 4917 4249 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_07630 6348 4942 gene locus_tag LOCUS_07640 6348 4942 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_07640 6650 6348 gene locus_tag LOCUS_07650 6650 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7934 6729 gene locus_tag LOCUS_07660 7934 6729 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_07660 8136 8209 gene locus_tag LOCUS_t00140 8136 8209 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8276 8521 gene locus_tag LOCUS_07670 gene secE 8276 8521 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_07670 8547 9272 gene locus_tag LOCUS_07680 gene nusG 8547 9272 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_07680 9328 9762 gene locus_tag LOCUS_07690 gene rplK 9328 9762 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_07690 9834 10550 gene locus_tag LOCUS_07700 gene rplA 9834 10550 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_07700 10798 11319 gene locus_tag LOCUS_07710 gene rplJ 10798 11319 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_07710 11382 11768 gene locus_tag LOCUS_07720 gene rplL 11382 11768 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence034 1790 285 gene locus_tag LOCUS_07730 1790 285 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_07730 2350 1802 gene locus_tag LOCUS_07740 2350 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2520 2918 gene locus_tag LOCUS_07750 2520 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4685 2919 gene locus_tag LOCUS_07760 4685 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5692 4682 gene locus_tag LOCUS_07770 5692 4682 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_07770 7485 5689 gene locus_tag LOCUS_07780 7485 5689 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 protein_id gnl|my_center|LOCUS_07780 7789 7499 gene locus_tag LOCUS_07790 7789 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8229 7786 gene locus_tag LOCUS_07800 8229 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8636 8232 gene locus_tag LOCUS_07810 8636 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9124 8633 gene locus_tag LOCUS_07820 9124 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9597 9298 gene locus_tag LOCUS_07830 9597 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9559 9759 gene locus_tag LOCUS_07840 9559 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9915 12503 gene locus_tag LOCUS_07850 9915 12503 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030835.1 protein_id gnl|my_center|LOCUS_07850 12565 12999 gene locus_tag LOCUS_07860 12565 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12999 14696 gene locus_tag LOCUS_07870 12999 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence035 919 50 gene locus_tag LOCUS_07880 919 50 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_07880 1596 916 gene locus_tag LOCUS_07890 1596 916 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_07890 3377 1599 gene locus_tag LOCUS_07900 3377 1599 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014079.1 protein_id gnl|my_center|LOCUS_07900 4000 3383 gene locus_tag LOCUS_07910 4000 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4130 6247 gene locus_tag LOCUS_07920 gene glgX 4130 6247 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 protein_id gnl|my_center|LOCUS_07920 6250 8730 gene locus_tag LOCUS_07930 gene treY 6250 8730 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930196.1 protein_id gnl|my_center|LOCUS_07930 8727 10463 gene locus_tag LOCUS_07940 gene treZ 8727 10463 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_07940 11724 10483 gene locus_tag LOCUS_07950 11724 10483 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 protein_id gnl|my_center|LOCUS_07950 11809 12378 gene locus_tag LOCUS_07960 11809 12378 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_07960 12375 13562 gene locus_tag LOCUS_07970 12375 13562 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence036 <1 739 gene locus_tag LOCUS_07980 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804257.1:GNAT family N-acetyltransferase 1000 1431 gene locus_tag LOCUS_07990 1000 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1428 3137 gene locus_tag LOCUS_08000 1428 3137 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_08000 3894 3172 gene locus_tag LOCUS_08010 3894 3172 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262866.1 protein_id gnl|my_center|LOCUS_08010 5795 3891 gene locus_tag LOCUS_08020 5795 3891 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_08020 5987 8761 gene locus_tag LOCUS_08030 5987 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9566 8778 gene locus_tag LOCUS_08040 9566 8778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_08040 10485 9568 gene locus_tag LOCUS_08050 10485 9568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 protein_id gnl|my_center|LOCUS_08050 11576 10554 gene locus_tag LOCUS_08060 11576 10554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_08060 12263 11715 gene locus_tag LOCUS_08070 12263 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014412.1 protein_id gnl|my_center|LOCUS_08070 12442 12720 gene locus_tag LOCUS_08080 12442 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 13350 12928 gene locus_tag LOCUS_08090 13350 12928 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_08090 <14465 13544 gene locus_tag LOCUS_08100 <14465 13544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003856232.1:NADP-dependent phosphogluconate dehydrogenase >Feature sequence037 1045 134 gene locus_tag LOCUS_08110 1045 134 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804638.1 protein_id gnl|my_center|LOCUS_08110 1599 1042 gene locus_tag LOCUS_08120 gene frr 1599 1042 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_08120 2348 1632 gene locus_tag LOCUS_08130 gene pyrH 2348 1632 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_08130 3227 2409 gene locus_tag LOCUS_08140 gene tsf 3227 2409 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_08140 4286 3243 gene locus_tag LOCUS_08150 4286 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4618 5148 gene locus_tag LOCUS_08160 4618 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6074 5151 gene locus_tag LOCUS_08170 6074 5151 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_08170 7227 6079 gene locus_tag LOCUS_08180 gene dprA 7227 6079 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804631.1 protein_id gnl|my_center|LOCUS_08180 8746 7211 gene locus_tag LOCUS_08190 8746 7211 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804630.1 protein_id gnl|my_center|LOCUS_08190 9102 8740 gene locus_tag LOCUS_08200 9102 8740 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_08200 9539 9240 gene locus_tag LOCUS_08210 9539 9240 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804628.1 protein_id gnl|my_center|LOCUS_08210 10222 9536 gene locus_tag LOCUS_08220 10222 9536 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_08220 10967 10203 gene locus_tag LOCUS_08230 10967 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08230 11388 11038 gene locus_tag LOCUS_08240 gene rplS 11388 11038 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_08240 12917 11553 gene locus_tag LOCUS_08250 12917 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 13420 12917 gene locus_tag LOCUS_08260 gene rimM 13420 12917 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_08260 13721 13485 gene locus_tag LOCUS_08270 13721 13485 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence038 641 21 gene locus_tag LOCUS_08280 gene orn 641 21 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_08280 755 681 gene locus_tag LOCUS_t00150 755 681 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 867 2459 gene locus_tag LOCUS_08290 867 2459 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_08290 2449 3924 gene locus_tag LOCUS_08300 2449 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08300 4006 4494 gene locus_tag LOCUS_08310 4006 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4590 6272 gene locus_tag LOCUS_08320 gene ettA 4590 6272 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_08320 6284 6718 gene locus_tag LOCUS_08330 6284 6718 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_08330 7625 6723 gene locus_tag LOCUS_08340 7625 6723 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_08340 9365 7698 gene locus_tag LOCUS_08350 gene ptsP 9365 7698 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_08350 9518 11662 gene locus_tag LOCUS_08360 gene malQ 9518 11662 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804935.1 protein_id gnl|my_center|LOCUS_08360 11721 11951 gene locus_tag LOCUS_08370 11721 11951 CDS product glucose PTS transporter subunit EIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284356.1 protein_id gnl|my_center|LOCUS_08370 11951 12406 gene locus_tag LOCUS_08380 11951 12406 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_08380 12403 13053 gene locus_tag LOCUS_08390 12403 13053 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972881.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence039 217 960 gene locus_tag LOCUS_08400 217 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1550 939 gene locus_tag LOCUS_08410 1550 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1588 2409 gene locus_tag LOCUS_08420 1588 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2406 2783 gene locus_tag LOCUS_08430 2406 2783 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_08430 3958 2780 gene locus_tag LOCUS_08440 3958 2780 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 protein_id gnl|my_center|LOCUS_08440 5175 3970 gene locus_tag LOCUS_08450 5175 3970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 protein_id gnl|my_center|LOCUS_08450 5586 5176 gene locus_tag LOCUS_08460 5586 5176 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_08460 6056 5583 gene locus_tag LOCUS_08470 6056 5583 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776156.1 protein_id gnl|my_center|LOCUS_08470 6252 6082 gene locus_tag LOCUS_08480 gene rpmG 6252 6082 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_08480 6357 6282 gene locus_tag LOCUS_t00160 6357 6282 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6467 6394 gene locus_tag LOCUS_t00170 6467 6394 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6661 6579 gene locus_tag LOCUS_t00180 6661 6579 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6786 7283 gene locus_tag LOCUS_08490 6786 7283 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_08490 8143 7280 gene locus_tag LOCUS_08500 gene htpX 8143 7280 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 protein_id gnl|my_center|LOCUS_08500 9569 8184 gene locus_tag LOCUS_08510 9569 8184 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_08510 9658 10605 gene locus_tag LOCUS_08520 gene rarD 9658 10605 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_08520 11564 10602 gene locus_tag LOCUS_08530 11564 10602 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 protein_id gnl|my_center|LOCUS_08530 <12910 11593 gene locus_tag LOCUS_08540 <12910 11593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974371.1:NADH-quinone oxidoreductase subunit NuoN >Feature sequence040 1685 2245 gene locus_tag LOCUS_08550 1685 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4192 2246 gene locus_tag LOCUS_08560 4192 2246 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_08560 4863 4228 gene locus_tag LOCUS_08570 4863 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5791 4865 gene locus_tag LOCUS_08580 gene cysK 5791 4865 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804846.1 protein_id gnl|my_center|LOCUS_08580 6627 5983 gene locus_tag LOCUS_08590 6627 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7084 7299 gene locus_tag LOCUS_08600 gene rpmF 7084 7299 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804941.1 protein_id gnl|my_center|LOCUS_08600 7461 8210 gene locus_tag LOCUS_08610 7461 8210 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_08610 8293 8219 gene locus_tag LOCUS_t00190 8293 8219 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8399 8471 gene locus_tag LOCUS_t00200 8399 8471 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8521 9984 gene locus_tag LOCUS_08620 gene tig 8521 9984 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 protein_id gnl|my_center|LOCUS_08620 10115 10720 gene locus_tag LOCUS_08630 10115 10720 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_08630 10730 11401 gene locus_tag LOCUS_08640 10730 11401 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence041 1408 203 gene locus_tag LOCUS_08650 gene manA 1408 203 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 protein_id gnl|my_center|LOCUS_08650 1770 2441 gene locus_tag LOCUS_08660 1770 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3508 2645 gene locus_tag LOCUS_08670 3508 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4167 3511 gene locus_tag LOCUS_08680 4167 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7434 4390 gene locus_tag LOCUS_08690 7434 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 8122 7505 gene locus_tag LOCUS_08700 8122 7505 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_08700 9979 8735 gene locus_tag LOCUS_08710 9979 8735 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_08710 10799 11002 gene locus_tag LOCUS_08720 10799 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08720 11021 11599 gene locus_tag LOCUS_08730 11021 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08730 11638 11853 gene locus_tag LOCUS_08740 11638 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence042 1697 633 gene locus_tag LOCUS_08750 1697 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2712 1780 gene locus_tag LOCUS_08760 2712 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3470 2709 gene locus_tag LOCUS_08770 3470 2709 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_08770 3673 4758 gene locus_tag LOCUS_08780 gene amrS 3673 4758 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_08780 4764 5561 gene locus_tag LOCUS_08790 gene amrB 4764 5561 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_08790 5567 6133 gene locus_tag LOCUS_08800 5567 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6239 7186 gene locus_tag LOCUS_08810 6239 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7186 8289 gene locus_tag LOCUS_08820 7186 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 8277 8891 gene locus_tag LOCUS_08830 8277 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8891 9388 gene locus_tag LOCUS_08840 8891 9388 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114161.1 protein_id gnl|my_center|LOCUS_08840 9513 9755 gene locus_tag LOCUS_08850 9513 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 9778 10146 gene locus_tag LOCUS_08860 9778 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 <12346 10673 gene locus_tag LOCUS_08870 <12346 10673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041449634.1:sodium-translocating pyrophosphatase >Feature sequence043 <1 1176 gene locus_tag LOCUS_08880 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068058.1:leucine--tRNA ligase 3046 1184 gene locus_tag LOCUS_08890 3046 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3078 3989 gene locus_tag LOCUS_08900 3078 3989 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_08900 4064 4708 gene locus_tag LOCUS_08910 4064 4708 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775772.1 protein_id gnl|my_center|LOCUS_08910 4705 7026 gene locus_tag LOCUS_08920 4705 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6428 6336 gene locus_tag LOCUS_t00210 6428 6336 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7063 8037 gene locus_tag LOCUS_08930 7063 8037 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_08930 8370 8107 gene locus_tag LOCUS_08940 gene rpsT 8370 8107 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_08940 9116 8580 gene locus_tag LOCUS_08950 9116 8580 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775768.1 protein_id gnl|my_center|LOCUS_08950 9710 9150 gene locus_tag LOCUS_08960 9710 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 9829 11682 gene locus_tag LOCUS_08970 gene lepA 9829 11682 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence044 272 1765 gene locus_tag LOCUS_08980 gene guaB 272 1765 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_08980 1805 2932 gene locus_tag LOCUS_08990 1805 2932 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 protein_id gnl|my_center|LOCUS_08990 3000 4394 gene locus_tag LOCUS_09000 3000 4394 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_09000 5626 4436 gene locus_tag LOCUS_09010 5626 4436 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 protein_id gnl|my_center|LOCUS_09010 7707 5623 gene locus_tag LOCUS_09020 gene pta 7707 5623 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085777.1 protein_id gnl|my_center|LOCUS_09020 10244 7779 gene locus_tag LOCUS_09030 10244 7779 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776228.1 protein_id gnl|my_center|LOCUS_09030 10334 11155 gene locus_tag LOCUS_09040 10334 11155 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929892.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence045 452 1042 gene locus_tag LOCUS_09050 452 1042 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_09050 1398 2318 gene locus_tag LOCUS_09060 1398 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776697.1 protein_id gnl|my_center|LOCUS_09060 6332 2577 gene locus_tag LOCUS_09070 6332 2577 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265956.1 protein_id gnl|my_center|LOCUS_09070 8655 6496 gene locus_tag LOCUS_09080 8655 6496 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731342.1 protein_id gnl|my_center|LOCUS_09080 10226 8697 gene locus_tag LOCUS_09090 10226 8697 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804270.1 protein_id gnl|my_center|LOCUS_09090 10280 10912 gene locus_tag LOCUS_09100 10280 10912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_09100 11348 10914 gene locus_tag LOCUS_09110 11348 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence046 38 457 gene locus_tag LOCUS_09120 38 457 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_09120 1974 499 gene locus_tag LOCUS_09130 gene pafA 1974 499 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_09130 2157 1975 gene locus_tag LOCUS_09140 2157 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3918 2188 gene locus_tag LOCUS_09150 gene dop 3918 2188 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775655.1 protein_id gnl|my_center|LOCUS_09150 5706 3928 gene locus_tag LOCUS_09160 gene arc 5706 3928 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_09160 6224 6856 gene locus_tag LOCUS_09170 gene rhtB 6224 6856 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171710.1 protein_id gnl|my_center|LOCUS_09170 6908 7345 gene locus_tag LOCUS_09180 gene arfB 6908 7345 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_09180 7946 7362 gene locus_tag LOCUS_09190 7946 7362 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_09190 11405 8016 gene locus_tag LOCUS_09200 11405 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence047 2090 3082 gene locus_tag LOCUS_09210 2090 3082 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775927.1 protein_id gnl|my_center|LOCUS_09210 3135 3974 gene locus_tag LOCUS_09220 3135 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3961 4401 gene locus_tag LOCUS_09230 3961 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4395 5402 gene locus_tag LOCUS_09240 4395 5402 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775924.1 protein_id gnl|my_center|LOCUS_09240 5399 6415 gene locus_tag LOCUS_09250 5399 6415 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775923.1 protein_id gnl|my_center|LOCUS_09250 6399 7040 gene locus_tag LOCUS_09260 6399 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7629 7042 gene locus_tag LOCUS_09270 7629 7042 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082703.1 protein_id gnl|my_center|LOCUS_09270 7725 8822 gene locus_tag LOCUS_09280 7725 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9248 8832 gene locus_tag LOCUS_09290 9248 8832 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_09290 10231 9245 gene locus_tag LOCUS_09300 10231 9245 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091036.1 protein_id gnl|my_center|LOCUS_09300 <11634 10177 gene locus_tag LOCUS_09310 <11634 10177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049769952.1:circularly permuted type 2 ATP-grasp protein >Feature sequence048 2535 1423 gene locus_tag LOCUS_09320 2535 1423 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_09320 3577 2540 gene locus_tag LOCUS_09330 3577 2540 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_09330 4721 3693 gene locus_tag LOCUS_09340 gene ilvC 4721 3693 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_09340 5277 4756 gene locus_tag LOCUS_09350 gene ilvN 5277 4756 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_09350 7103 5289 gene locus_tag LOCUS_09360 7103 5289 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_09360 9663 7330 gene locus_tag LOCUS_09370 9663 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence049 <1 1160 gene locus_tag LOCUS_09380 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804843.1:extracellular solute-binding protein 1257 2840 gene locus_tag LOCUS_09390 1257 2840 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_09390 2840 3745 gene locus_tag LOCUS_09400 2840 3745 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_09400 3805 5100 gene locus_tag LOCUS_09410 3805 5100 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390121.1 protein_id gnl|my_center|LOCUS_09410 5143 7011 gene locus_tag LOCUS_09420 gene dnaG 5143 7011 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_09420 7166 9286 gene locus_tag LOCUS_09430 7166 9286 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118645.1 protein_id gnl|my_center|LOCUS_09430 9357 10277 gene locus_tag LOCUS_09440 9357 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10432 10358 gene locus_tag LOCUS_t00220 10432 10358 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10470 10994 gene locus_tag LOCUS_09450 10470 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11071 11145 gene locus_tag LOCUS_t00230 11071 11145 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 2477 720 gene locus_tag LOCUS_09460 2477 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3627 2716 gene locus_tag LOCUS_09470 3627 2716 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013482.1 protein_id gnl|my_center|LOCUS_09470 4024 6054 gene locus_tag LOCUS_09480 4024 6054 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_09480 6119 6550 gene locus_tag LOCUS_09490 6119 6550 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_09490 7295 6534 gene locus_tag LOCUS_09500 7295 6534 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_09500 9632 7314 gene locus_tag LOCUS_09510 9632 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence051 1625 195 gene locus_tag LOCUS_09520 1625 195 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876388.1 protein_id gnl|my_center|LOCUS_09520 2386 2048 gene locus_tag LOCUS_09530 2386 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2894 2601 gene locus_tag LOCUS_09540 2894 2601 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_09540 3149 2904 gene locus_tag LOCUS_09550 3149 2904 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_09550 4000 3389 gene locus_tag LOCUS_09560 4000 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4151 5167 gene locus_tag LOCUS_09570 4151 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5174 5821 gene locus_tag LOCUS_09580 5174 5821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_09580 6455 6012 gene locus_tag LOCUS_09590 6455 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6534 6935 gene locus_tag LOCUS_09600 6534 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7782 7450 gene locus_tag LOCUS_09610 7782 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8156 7782 gene locus_tag LOCUS_09620 8156 7782 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_09620 8264 8599 gene locus_tag LOCUS_09630 8264 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9299 9625 gene locus_tag LOCUS_09640 9299 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9738 9959 gene locus_tag LOCUS_09650 9738 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9950 10360 gene locus_tag LOCUS_09660 9950 10360 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence052 1305 1099 gene locus_tag LOCUS_09670 1305 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1408 2937 gene locus_tag LOCUS_09680 1408 2937 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_09680 3130 3573 gene locus_tag LOCUS_09690 3130 3573 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_09690 3585 3980 gene locus_tag LOCUS_09700 3585 3980 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_09700 4004 6070 gene locus_tag LOCUS_09710 4004 6070 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901403.1 protein_id gnl|my_center|LOCUS_09710 6080 6595 gene locus_tag LOCUS_09720 6080 6595 CDS product glycine cleavage system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775899.1 protein_id gnl|my_center|LOCUS_09720 8078 6585 gene locus_tag LOCUS_09730 8078 6585 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_09730 9589 8075 gene locus_tag LOCUS_09740 9589 8075 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_09740 10590 9610 gene locus_tag LOCUS_09750 10590 9610 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence053 449 2470 gene locus_tag LOCUS_09760 449 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2491 4881 gene locus_tag LOCUS_09770 2491 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4978 5772 gene locus_tag LOCUS_09780 4978 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7822 6242 gene locus_tag LOCUS_09790 7822 6242 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 protein_id gnl|my_center|LOCUS_09790 9666 7819 gene locus_tag LOCUS_09800 gene iniA 9666 7819 CDS product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900124.1 protein_id gnl|my_center|LOCUS_09800 10830 9823 gene locus_tag LOCUS_09810 10830 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence054 47 1222 gene locus_tag LOCUS_09820 gene ftsZ 47 1222 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_09820 1227 1934 gene locus_tag LOCUS_09830 gene pgeF 1227 1934 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_09830 1994 2470 gene locus_tag LOCUS_09840 gene sepF 1994 2470 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804707.1 protein_id gnl|my_center|LOCUS_09840 2478 2774 gene locus_tag LOCUS_09850 2478 2774 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 protein_id gnl|my_center|LOCUS_09850 2885 3529 gene locus_tag LOCUS_09860 2885 3529 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804709.1 protein_id gnl|my_center|LOCUS_09860 3648 4166 gene locus_tag LOCUS_09870 3648 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4159 5076 gene locus_tag LOCUS_09880 4159 5076 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057888.1 protein_id gnl|my_center|LOCUS_09880 5073 5546 gene locus_tag LOCUS_09890 5073 5546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_09890 5573 9100 gene locus_tag LOCUS_09900 gene dnaE 5573 9100 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_09900 9137 10435 gene locus_tag LOCUS_09910 gene hisD 9137 10435 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence055 2697 1 gene locus_tag LOCUS_09920 2697 1 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_09920 5392 2726 gene locus_tag LOCUS_09930 5392 2726 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805171.1 protein_id gnl|my_center|LOCUS_09930 5451 6092 gene locus_tag LOCUS_09940 5451 6092 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805170.1 protein_id gnl|my_center|LOCUS_09940 6145 7188 gene locus_tag LOCUS_09950 6145 7188 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_09950 8155 7220 gene locus_tag LOCUS_09960 8155 7220 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892442.1 protein_id gnl|my_center|LOCUS_09960 8154 9410 gene locus_tag LOCUS_09970 8154 9410 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_09970 9407 10360 gene locus_tag LOCUS_09980 9407 10360 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776412.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence056 <1 828 gene locus_tag LOCUS_09990 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804643.1:site-2 protease family protein 852 2024 gene locus_tag LOCUS_10000 gene ispG 852 2024 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_10000 2025 2861 gene locus_tag LOCUS_10010 2025 2861 CDS product DUF4081 domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193499286.1 protein_id gnl|my_center|LOCUS_10010 2900 4699 gene locus_tag LOCUS_10020 2900 4699 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_10020 5602 4751 gene locus_tag LOCUS_10030 5602 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5679 6116 gene locus_tag LOCUS_10040 gene rimP 5679 6116 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_10040 6119 7177 gene locus_tag LOCUS_10050 gene nusA 6119 7177 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_10050 7592 10426 gene locus_tag LOCUS_10060 gene infB 7592 10426 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152204006.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence057 1241 303 gene locus_tag LOCUS_10070 1241 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1543 1322 gene locus_tag LOCUS_10080 1543 1322 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_10080 1858 1631 gene locus_tag LOCUS_10090 1858 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1796 4816 gene locus_tag LOCUS_10100 1796 4816 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_10100 4813 8019 gene locus_tag LOCUS_10110 4813 8019 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804755.1 protein_id gnl|my_center|LOCUS_10110 9226 8024 gene locus_tag LOCUS_10120 9226 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence058 952 3510 gene locus_tag LOCUS_10130 952 3510 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_10130 4678 3584 gene locus_tag LOCUS_10140 gene trpS 4678 3584 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_10140 6862 4688 gene locus_tag LOCUS_10150 gene glgX 6862 4688 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_10150 7003 7770 gene locus_tag LOCUS_10160 7003 7770 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_10160 7770 8693 gene locus_tag LOCUS_10170 7770 8693 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_10170 8690 9838 gene locus_tag LOCUS_10180 8690 9838 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence059 1145 2899 gene locus_tag LOCUS_10190 gene leuA 1145 2899 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_10190 2936 4579 gene locus_tag LOCUS_10200 2936 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4619 5368 gene locus_tag LOCUS_10210 gene recO 4619 5368 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412222.1 protein_id gnl|my_center|LOCUS_10210 5365 6138 gene locus_tag LOCUS_10220 5365 6138 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_10220 6677 6141 gene locus_tag LOCUS_10230 6677 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7069 6677 gene locus_tag LOCUS_10240 7069 6677 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_10240 7229 8617 gene locus_tag LOCUS_10250 7229 8617 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_10250 8619 9824 gene locus_tag LOCUS_10260 gene dusB 8619 9824 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence060 1894 374 gene locus_tag LOCUS_10270 1894 374 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_10270 1935 2498 gene locus_tag LOCUS_10280 1935 2498 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_10280 3621 2509 gene locus_tag LOCUS_10290 gene dpaL 3621 2509 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 protein_id gnl|my_center|LOCUS_10290 3704 4888 gene locus_tag LOCUS_10300 gene ygeW 3704 4888 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_10300 4908 6110 gene locus_tag LOCUS_10310 4908 6110 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_10310 6189 6992 gene locus_tag LOCUS_10320 6189 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7031 8641 gene locus_tag LOCUS_10330 7031 8641 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence061 1195 3816 gene locus_tag LOCUS_10340 1195 3816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_10340 3813 4550 gene locus_tag LOCUS_10350 3813 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4642 4959 gene locus_tag LOCUS_10360 4642 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5420 4992 gene locus_tag LOCUS_10370 5420 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 6988 5417 gene locus_tag LOCUS_10380 6988 5417 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_10380 7646 7158 gene locus_tag LOCUS_10390 7646 7158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_10390 8245 8940 gene locus_tag LOCUS_10400 8245 8940 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_10400 <9819 8944 gene locus_tag LOCUS_10410 <9819 8944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003819430.1:Cof-type HAD-IIB family hydrolase >Feature sequence062 1806 430 gene locus_tag LOCUS_10420 1806 430 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_10420 2514 1933 gene locus_tag LOCUS_10430 2514 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3224 2517 gene locus_tag LOCUS_10440 gene deoD 3224 2517 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 protein_id gnl|my_center|LOCUS_10440 3387 4151 gene locus_tag LOCUS_10450 3387 4151 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_10450 4148 5644 gene locus_tag LOCUS_10460 4148 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776875.1 protein_id gnl|my_center|LOCUS_10460 5697 6074 gene locus_tag LOCUS_10470 5697 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6079 7599 gene locus_tag LOCUS_10480 6079 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7542 8264 gene locus_tag LOCUS_10490 7542 8264 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415007.1 protein_id gnl|my_center|LOCUS_10490 8715 8269 gene locus_tag LOCUS_10500 8715 8269 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908780.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence063 1199 1849 gene locus_tag LOCUS_10510 1199 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3384 2368 gene locus_tag LOCUS_10520 3384 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4675 3548 gene locus_tag LOCUS_10530 gene wecB 4675 3548 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261049.1 protein_id gnl|my_center|LOCUS_10530 5768 4680 gene locus_tag LOCUS_10540 5768 4680 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_10540 6793 5768 gene locus_tag LOCUS_10550 6793 5768 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_10550 8592 7084 gene locus_tag LOCUS_10560 8592 7084 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_10560 9157 8579 gene locus_tag LOCUS_10570 9157 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence064 <1 1498 gene locus_tag LOCUS_10580 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804877.1:acetate--CoA ligase 1569 2465 gene locus_tag LOCUS_10590 1569 2465 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 protein_id gnl|my_center|LOCUS_10590 3488 2529 gene locus_tag LOCUS_10600 3488 2529 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_10600 4167 3493 gene locus_tag LOCUS_10610 4167 3493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_10610 4850 4164 gene locus_tag LOCUS_10620 4850 4164 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_10620 5680 4847 gene locus_tag LOCUS_10630 5680 4847 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_10630 6381 5677 gene locus_tag LOCUS_10640 6381 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6483 7163 gene locus_tag LOCUS_10650 6483 7163 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_10650 7661 7182 gene locus_tag LOCUS_10660 7661 7182 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_10660 7822 7658 gene locus_tag LOCUS_10670 7822 7658 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_10670 8348 7857 gene locus_tag LOCUS_10680 8348 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence065 2196 4394 gene locus_tag LOCUS_10690 gene ligA 2196 4394 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_10690 5706 4468 gene locus_tag LOCUS_10700 5706 4468 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_10700 5790 6062 gene locus_tag LOCUS_10710 gene gatC 5790 6062 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775914.1 protein_id gnl|my_center|LOCUS_10710 6059 7564 gene locus_tag LOCUS_10720 gene gatA 6059 7564 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_10720 7561 9051 gene locus_tag LOCUS_10730 gene gatB 7561 9051 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775912.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence066 2329 1049 gene locus_tag LOCUS_10740 2329 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2687 2316 gene locus_tag LOCUS_10750 2687 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3275 3042 gene locus_tag LOCUS_10760 3275 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5891 4170 gene locus_tag LOCUS_10770 5891 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6903 5863 gene locus_tag LOCUS_10780 6903 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8915 6924 gene locus_tag LOCUS_10790 8915 6924 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112778.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence067 1063 2751 gene locus_tag LOCUS_10800 gene pgi 1063 2751 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_10800 3324 2770 gene locus_tag LOCUS_10810 3324 2770 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803962.1 protein_id gnl|my_center|LOCUS_10810 3795 3358 gene locus_tag LOCUS_10820 3795 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3933 4823 gene locus_tag LOCUS_10830 3933 4823 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_10830 5779 4826 gene locus_tag LOCUS_10840 5779 4826 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_10840 5854 6312 gene locus_tag LOCUS_10850 5854 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6359 7069 gene locus_tag LOCUS_10860 6359 7069 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence068 861 2732 gene locus_tag LOCUS_10870 gene dnaK 861 2732 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_10870 2729 3358 gene locus_tag LOCUS_10880 2729 3358 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804831.1 protein_id gnl|my_center|LOCUS_10880 3437 4453 gene locus_tag LOCUS_10890 3437 4453 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_10890 4473 4886 gene locus_tag LOCUS_10900 4473 4886 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_10900 4978 5787 gene locus_tag LOCUS_10910 4978 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6436 5873 gene locus_tag LOCUS_10920 6436 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 7025 6606 gene locus_tag LOCUS_10930 7025 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <9104 7089 gene locus_tag LOCUS_10940 <9104 7089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038598.1:prolyl oligopeptidase family serine peptidase >Feature sequence069 611 2380 gene locus_tag LOCUS_10950 611 2380 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_10950 2442 3602 gene locus_tag LOCUS_10960 2442 3602 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775935.1 protein_id gnl|my_center|LOCUS_10960 3599 4765 gene locus_tag LOCUS_10970 3599 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4766 5059 gene locus_tag LOCUS_10980 4766 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5179 5997 gene locus_tag LOCUS_10990 5179 5997 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_10990 6407 5994 gene locus_tag LOCUS_11000 6407 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7602 6433 gene locus_tag LOCUS_11010 7602 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7794 8897 gene locus_tag LOCUS_11020 7794 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence070 1880 1185 gene locus_tag LOCUS_11030 1880 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2379 1882 gene locus_tag LOCUS_11040 2379 1882 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_11040 3650 2436 gene locus_tag LOCUS_11050 gene yidC 3650 2436 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_11050 3940 3653 gene locus_tag LOCUS_11060 3940 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4293 3937 gene locus_tag LOCUS_11070 gene rnpA 4293 3937 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899767.1 protein_id gnl|my_center|LOCUS_11070 4434 4297 gene locus_tag LOCUS_11080 gene rpmH 4434 4297 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_11080 4738 6204 gene locus_tag LOCUS_11090 4738 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6591 7721 gene locus_tag LOCUS_11100 gene dnaN 6591 7721 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_11100 7731 8615 gene locus_tag LOCUS_11110 gene gnd 7731 8615 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079128.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence071 361 1020 gene locus_tag LOCUS_11120 361 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1339 2652 gene locus_tag LOCUS_11130 1339 2652 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_11130 2720 3694 gene locus_tag LOCUS_11140 2720 3694 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_11140 3691 4623 gene locus_tag LOCUS_11150 3691 4623 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_11150 5802 4684 gene locus_tag LOCUS_11160 5802 4684 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence072 577 1290 gene locus_tag LOCUS_11170 577 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1621 1935 gene locus_tag LOCUS_11180 1621 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1932 2510 gene locus_tag LOCUS_11190 1932 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2950 2621 gene locus_tag LOCUS_11200 2950 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3185 2961 gene locus_tag LOCUS_11210 3185 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3804 3220 gene locus_tag LOCUS_11220 3804 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4128 4778 gene locus_tag LOCUS_11230 4128 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5248 4790 gene locus_tag LOCUS_11240 5248 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 6168 5245 gene locus_tag LOCUS_11250 6168 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7327 6197 gene locus_tag LOCUS_11260 7327 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 7571 7759 gene locus_tag LOCUS_11270 7571 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 7756 7995 gene locus_tag LOCUS_11280 7756 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence073 5 445 gene locus_tag LOCUS_11290 5 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 442 1872 gene locus_tag LOCUS_11300 442 1872 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_11300 1884 2894 gene locus_tag LOCUS_11310 1884 2894 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_11310 2917 5043 gene locus_tag LOCUS_11320 2917 5043 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227897.1 protein_id gnl|my_center|LOCUS_11320 6373 5096 gene locus_tag LOCUS_11330 6373 5096 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_11330 7184 6540 gene locus_tag LOCUS_11340 7184 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7253 8566 gene locus_tag LOCUS_11350 7253 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence074 3905 1125 gene locus_tag LOCUS_11360 gene gcvP 3905 1125 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_11360 4333 3953 gene locus_tag LOCUS_11370 gene gcvH 4333 3953 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804853.1 protein_id gnl|my_center|LOCUS_11370 5451 4360 gene locus_tag LOCUS_11380 gene gcvT 5451 4360 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_11380 6549 5488 gene locus_tag LOCUS_11390 6549 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6658 7725 gene locus_tag LOCUS_11400 6658 7725 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_11400 8097 7726 gene locus_tag LOCUS_11410 8097 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence075 <1 819 gene locus_tag LOCUS_11420 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730948.1:glucose-1-phosphate thymidylyltransferase RfbA 1562 825 gene locus_tag LOCUS_11430 1562 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2524 1682 gene locus_tag LOCUS_11440 gene rfbD 2524 1682 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_11440 2628 3257 gene locus_tag LOCUS_11450 2628 3257 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_11450 3685 3254 gene locus_tag LOCUS_11460 3685 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4437 3682 gene locus_tag LOCUS_11470 4437 3682 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_11470 4641 5849 gene locus_tag LOCUS_11480 4641 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5851 6870 gene locus_tag LOCUS_11490 5851 6870 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_11490 8241 6892 gene locus_tag LOCUS_11500 8241 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence076 950 354 gene locus_tag LOCUS_11510 950 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1065 1715 gene locus_tag LOCUS_11520 1065 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2493 2158 gene locus_tag LOCUS_11530 gene pemK 2493 2158 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416110.1 protein_id gnl|my_center|LOCUS_11530 2731 2477 gene locus_tag LOCUS_11540 2731 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3871 2807 gene locus_tag LOCUS_11550 3871 2807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_11550 5595 3868 gene locus_tag LOCUS_11560 5595 3868 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_11560 6734 5667 gene locus_tag LOCUS_11570 6734 5667 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_11570 8142 7120 gene locus_tag LOCUS_11580 8142 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence077 5231 2697 gene locus_tag LOCUS_11590 5231 2697 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_11590 6189 5224 gene locus_tag LOCUS_11600 6189 5224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_11600 6410 6994 gene locus_tag LOCUS_11610 6410 6994 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_11610 7452 6982 gene locus_tag LOCUS_11620 7452 6982 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_11620 8192 7458 gene locus_tag LOCUS_11630 8192 7458 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030186.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence078 <1 702 gene locus_tag LOCUS_11640 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029734.1:NADH-quinone oxidoreductase subunit D 699 1535 gene locus_tag LOCUS_11650 gene nuoE 699 1535 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_11650 1532 2857 gene locus_tag LOCUS_11660 gene nuoF 1532 2857 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_11660 2854 5472 gene locus_tag LOCUS_11670 2854 5472 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026459974.1 protein_id gnl|my_center|LOCUS_11670 5472 6776 gene locus_tag LOCUS_11680 gene nuoH 5472 6776 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147918608.1 protein_id gnl|my_center|LOCUS_11680 6769 7443 gene locus_tag LOCUS_11690 6769 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7440 8315 gene locus_tag LOCUS_11700 7440 8315 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence079 5773 2672 gene locus_tag LOCUS_11710 5773 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5924 6523 gene locus_tag LOCUS_11720 5924 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6534 6740 gene locus_tag LOCUS_11730 6534 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6766 7251 gene locus_tag LOCUS_11740 6766 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 8173 7244 gene locus_tag LOCUS_11750 8173 7244 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence080 1065 1976 gene locus_tag LOCUS_11760 gene pheA 1065 1976 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_11760 1973 3307 gene locus_tag LOCUS_11770 1973 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4594 3359 gene locus_tag LOCUS_11780 4594 3359 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_11780 4853 6124 gene locus_tag LOCUS_11790 gene serS 4853 6124 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_11790 6121 6957 gene locus_tag LOCUS_11800 6121 6957 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_11800 6974 7795 gene locus_tag LOCUS_11810 6974 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence081 2537 1398 gene locus_tag LOCUS_11820 2537 1398 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_11820 3166 2534 gene locus_tag LOCUS_11830 3166 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4249 3176 gene locus_tag LOCUS_11840 4249 3176 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776595.1 protein_id gnl|my_center|LOCUS_11840 4584 4252 gene locus_tag LOCUS_11850 4584 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7336 4688 gene locus_tag LOCUS_11860 gene topA 7336 4688 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence082 <1 979 gene locus_tag LOCUS_11870 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166233908.1:MFS transporter 979 2541 gene locus_tag LOCUS_11880 979 2541 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_11880 3213 2626 gene locus_tag LOCUS_11890 3213 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11890 3291 4580 gene locus_tag LOCUS_11900 3291 4580 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804747.1 protein_id gnl|my_center|LOCUS_11900 4573 5097 gene locus_tag LOCUS_11910 4573 5097 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_11910 5108 6232 gene locus_tag LOCUS_11920 5108 6232 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_11920 6235 6624 gene locus_tag LOCUS_11930 6235 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7896 6628 gene locus_tag LOCUS_11940 7896 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence083 <1 858 gene locus_tag LOCUS_11950 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030863476.1:ParB/RepB/Spo0J family partition protein 1881 859 gene locus_tag LOCUS_11960 1881 859 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_11960 3123 1891 gene locus_tag LOCUS_11970 3123 1891 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_11970 3869 3531 gene locus_tag LOCUS_11980 gene trxA 3869 3531 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_11980 4922 3888 gene locus_tag LOCUS_11990 gene trxB 4922 3888 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_11990 <8092 5006 gene locus_tag LOCUS_12000 <8092 5006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029297.1:murein biosynthesis integral membrane protein MurJ >Feature sequence084 1180 293 gene locus_tag LOCUS_12010 1180 293 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_12010 1287 2306 gene locus_tag LOCUS_12020 gene hrcA 1287 2306 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_12020 2319 3443 gene locus_tag LOCUS_12030 gene dnaJ 2319 3443 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_12030 3440 4216 gene locus_tag LOCUS_12040 3440 4216 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812898.1 protein_id gnl|my_center|LOCUS_12040 4213 5235 gene locus_tag LOCUS_12050 4213 5235 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_12050 5232 5684 gene locus_tag LOCUS_12060 gene ybeY 5232 5684 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812903.1 protein_id gnl|my_center|LOCUS_12060 5684 6964 gene locus_tag LOCUS_12070 5684 6964 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775753.1 protein_id gnl|my_center|LOCUS_12070 6961 7932 gene locus_tag LOCUS_12080 gene era 6961 7932 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence085 811 1779 gene locus_tag LOCUS_12090 811 1779 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_12090 3054 1840 gene locus_tag LOCUS_12100 3054 1840 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_12100 3757 3068 gene locus_tag LOCUS_12110 gene mtnN 3757 3068 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804292.1 protein_id gnl|my_center|LOCUS_12110 4269 3754 gene locus_tag LOCUS_12120 4269 3754 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289439.1 protein_id gnl|my_center|LOCUS_12120 6076 4271 gene locus_tag LOCUS_12130 6076 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6199 6981 gene locus_tag LOCUS_12140 gene ddaH 6199 6981 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_12140 <7822 6995 gene locus_tag LOCUS_12150 <7822 6995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837937.1:carotenoid oxygenase family protein >Feature sequence086 1833 382 gene locus_tag LOCUS_12160 1833 382 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776710.1 protein_id gnl|my_center|LOCUS_12160 1907 2221 gene locus_tag LOCUS_12170 1907 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2495 2190 gene locus_tag LOCUS_12180 2495 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3418 2492 gene locus_tag LOCUS_12190 3418 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3767 3429 gene locus_tag LOCUS_12200 3767 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3934 4524 gene locus_tag LOCUS_12210 3934 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5125 4568 gene locus_tag LOCUS_12220 5125 4568 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111272.1 protein_id gnl|my_center|LOCUS_12220 5241 6260 gene locus_tag LOCUS_12230 gene corA 5241 6260 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_12230 <7816 6650 gene locus_tag LOCUS_12240 <7816 6650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence087 3177 571 gene locus_tag LOCUS_12250 3177 571 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_12250 3695 3270 gene locus_tag LOCUS_12260 gene dtd 3695 3270 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_12260 4003 3695 gene locus_tag LOCUS_12270 4003 3695 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776557.1 protein_id gnl|my_center|LOCUS_12270 4039 4443 gene locus_tag LOCUS_12280 4039 4443 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224598.1 protein_id gnl|my_center|LOCUS_12280 5510 4446 gene locus_tag LOCUS_12290 5510 4446 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 protein_id gnl|my_center|LOCUS_12290 6082 5507 gene locus_tag LOCUS_12300 6082 5507 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_12300 6815 6102 gene locus_tag LOCUS_12310 6815 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6903 7601 gene locus_tag LOCUS_12320 gene glnR 6903 7601 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence088 3154 1679 gene locus_tag LOCUS_12330 3154 1679 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153442001.1 protein_id gnl|my_center|LOCUS_12330 5189 4545 gene locus_tag LOCUS_12340 5189 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 <7561 5235 gene locus_tag LOCUS_12350 <7561 5235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase >Feature sequence089 <1 1323 gene locus_tag LOCUS_12360 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272538.1:cell wall-binding repeat-containing protein 1815 1381 gene locus_tag LOCUS_12370 1815 1381 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776107.1 protein_id gnl|my_center|LOCUS_12370 2507 1827 gene locus_tag LOCUS_12380 2507 1827 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_12380 2562 4523 gene locus_tag LOCUS_12390 2562 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776113.1 protein_id gnl|my_center|LOCUS_12390 4568 5545 gene locus_tag LOCUS_12400 gene galE 4568 5545 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116755.1 protein_id gnl|my_center|LOCUS_12400 6459 5542 gene locus_tag LOCUS_12410 6459 5542 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776104.1 protein_id gnl|my_center|LOCUS_12410 7535 6837 gene locus_tag LOCUS_12420 7535 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence090 891 421 gene locus_tag LOCUS_12430 891 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1913 1629 gene locus_tag LOCUS_12440 1913 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1983 2507 gene locus_tag LOCUS_12450 1983 2507 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 protein_id gnl|my_center|LOCUS_12450 2664 3689 gene locus_tag LOCUS_12460 2664 3689 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_12460 3751 4485 gene locus_tag LOCUS_12470 3751 4485 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_12470 4485 5072 gene locus_tag LOCUS_12480 4485 5072 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_12480 6083 5073 gene locus_tag LOCUS_12490 6083 5073 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_12490 <7506 6097 gene locus_tag LOCUS_12500 <7506 6097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582633.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence091 906 649 gene locus_tag LOCUS_12510 gene rsrA 906 649 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416891.1 protein_id gnl|my_center|LOCUS_12510 1565 903 gene locus_tag LOCUS_12520 gene sigR 1565 903 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_12520 1658 2155 gene locus_tag LOCUS_12530 1658 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2152 3180 gene locus_tag LOCUS_12540 gene rsgA 2152 3180 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 protein_id gnl|my_center|LOCUS_12540 3191 3979 gene locus_tag LOCUS_12550 3191 3979 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_12550 4497 4048 gene locus_tag LOCUS_12560 4497 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5728 4514 gene locus_tag LOCUS_12570 5728 4514 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_12570 6338 5721 gene locus_tag LOCUS_12580 6338 5721 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776071.1 protein_id gnl|my_center|LOCUS_12580 6455 6679 gene locus_tag LOCUS_12590 6455 6679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_12590 7233 6709 gene locus_tag LOCUS_12600 7233 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence092 988 533 gene locus_tag LOCUS_12610 988 533 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_12610 1600 992 gene locus_tag LOCUS_12620 1600 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3261 1600 gene locus_tag LOCUS_12630 3261 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5653 3263 gene locus_tag LOCUS_12640 5653 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6846 5650 gene locus_tag LOCUS_12650 gene dcm 6846 5650 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence093 1210 173 gene locus_tag LOCUS_12660 gene pstA 1210 173 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_12660 2175 1210 gene locus_tag LOCUS_12670 gene pstC 2175 1210 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_12670 3286 2216 gene locus_tag LOCUS_12680 gene pstS 3286 2216 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_12680 3512 4477 gene locus_tag LOCUS_12690 3512 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4492 5451 gene locus_tag LOCUS_12700 gene pstC 4492 5451 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_12700 5451 6365 gene locus_tag LOCUS_12710 gene pstA 5451 6365 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_12710 6370 7206 gene locus_tag LOCUS_12720 gene pstB 6370 7206 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence094 3158 2274 gene locus_tag LOCUS_12730 3158 2274 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_12730 4159 3158 gene locus_tag LOCUS_12740 4159 3158 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_12740 5500 4166 gene locus_tag LOCUS_12750 5500 4166 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226351.1 protein_id gnl|my_center|LOCUS_12750 5695 6858 gene locus_tag LOCUS_12760 5695 6858 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_12760 6969 7193 gene locus_tag LOCUS_12770 6969 7193 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence095 1327 92 gene locus_tag LOCUS_12780 gene aroC 1327 92 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_12780 1821 1303 gene locus_tag LOCUS_12790 1821 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2939 1818 gene locus_tag LOCUS_12800 gene mltG 2939 1818 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_12800 3402 2932 gene locus_tag LOCUS_12810 gene ruvX 3402 2932 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775670.1 protein_id gnl|my_center|LOCUS_12810 6068 3399 gene locus_tag LOCUS_12820 gene alaS 6068 3399 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775671.1 protein_id gnl|my_center|LOCUS_12820 6252 6055 gene locus_tag LOCUS_12830 6252 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6605 6252 gene locus_tag LOCUS_12840 6605 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <7304 6707 gene locus_tag LOCUS_12850 <7304 6707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775672.1:30S ribosomal protein S4 >Feature sequence096 639 61 gene locus_tag LOCUS_12860 639 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 702 1175 gene locus_tag LOCUS_12870 702 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1595 1771 gene locus_tag LOCUS_12880 1595 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1860 2072 gene locus_tag LOCUS_12890 1860 2072 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_12890 2553 2101 gene locus_tag LOCUS_12900 2553 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2706 3878 gene locus_tag LOCUS_12910 2706 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3886 4374 gene locus_tag LOCUS_12920 3886 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5012 4401 gene locus_tag LOCUS_12930 5012 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5637 5173 gene locus_tag LOCUS_12940 5637 5173 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_12940 5833 5558 gene locus_tag LOCUS_12950 5833 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6927 5830 gene locus_tag LOCUS_12960 6927 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence097 2009 846 gene locus_tag LOCUS_12970 2009 846 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776250.1 protein_id gnl|my_center|LOCUS_12970 3028 2021 gene locus_tag LOCUS_12980 3028 2021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803841.1 protein_id gnl|my_center|LOCUS_12980 3867 3019 gene locus_tag LOCUS_12990 3867 3019 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_12990 3997 4770 gene locus_tag LOCUS_13000 3997 4770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028225.1 protein_id gnl|my_center|LOCUS_13000 4767 6035 gene locus_tag LOCUS_13010 4767 6035 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 protein_id gnl|my_center|LOCUS_13010 <7109 6066 gene locus_tag LOCUS_13020 <7109 6066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784478.1:FAD-dependent oxidoreductase >Feature sequence098 1876 476 gene locus_tag LOCUS_13030 gene pntB 1876 476 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 protein_id gnl|my_center|LOCUS_13030 3527 1881 gene locus_tag LOCUS_13040 3527 1881 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726673.1 protein_id gnl|my_center|LOCUS_13040 5951 3792 gene locus_tag LOCUS_13050 gene nrdE 5951 3792 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_13050 6334 5921 gene locus_tag LOCUS_13060 gene nrdI 6334 5921 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 protein_id gnl|my_center|LOCUS_13060 6606 6352 gene locus_tag LOCUS_13070 6606 6352 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence099 206 925 gene locus_tag LOCUS_13080 206 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 940 1668 gene locus_tag LOCUS_13090 940 1668 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 protein_id gnl|my_center|LOCUS_13090 1750 2562 gene locus_tag LOCUS_13100 1750 2562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_13100 4042 2615 gene locus_tag LOCUS_13110 4042 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6729 4147 gene locus_tag LOCUS_13120 6729 4147 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence100 589 789 gene locus_tag LOCUS_13130 589 789 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_13130 1096 1257 gene locus_tag LOCUS_13140 1096 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2434 1457 gene locus_tag LOCUS_13150 gene nrdF 2434 1457 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893682.1 protein_id gnl|my_center|LOCUS_13150 2670 3734 gene locus_tag LOCUS_13160 2670 3734 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_13160 3767 4660 gene locus_tag LOCUS_13170 3767 4660 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315929.1 protein_id gnl|my_center|LOCUS_13170 5546 4692 gene locus_tag LOCUS_13180 5546 4692 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_13180 <7056 5543 gene locus_tag LOCUS_13190 <7056 5543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805127.1:transketolase >Feature sequence101 1414 2493 gene locus_tag LOCUS_13200 1414 2493 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855107.1 protein_id gnl|my_center|LOCUS_13200 3601 2507 gene locus_tag LOCUS_13210 3601 2507 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_13210 5046 3598 gene locus_tag LOCUS_13220 5046 3598 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_13220 5271 5726 gene locus_tag LOCUS_13230 5271 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence102 756 424 gene locus_tag LOCUS_13240 756 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 850 2004 gene locus_tag LOCUS_13250 850 2004 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727030.1 protein_id gnl|my_center|LOCUS_13250 3486 2032 gene locus_tag LOCUS_13260 3486 2032 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_13260 6583 3518 gene locus_tag LOCUS_13270 6583 3518 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence103 76 1 gene locus_tag LOCUS_t00240 76 1 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1065 172 gene locus_tag LOCUS_13280 1065 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_13280 1377 6374 gene locus_tag LOCUS_13290 1377 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence104 946 434 gene locus_tag LOCUS_13300 946 434 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202425.1 protein_id gnl|my_center|LOCUS_13300 1871 963 gene locus_tag LOCUS_13310 1871 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3283 1871 gene locus_tag LOCUS_13320 gene resB 3283 1871 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_13320 4085 3288 gene locus_tag LOCUS_13330 4085 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5618 4185 gene locus_tag LOCUS_13340 5618 4185 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_13340 6076 5618 gene locus_tag LOCUS_13350 6076 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6339 6524 gene locus_tag LOCUS_13360 6339 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence105 2077 323 gene locus_tag LOCUS_13370 gene pabB 2077 323 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067848429.1 protein_id gnl|my_center|LOCUS_13370 2610 2083 gene locus_tag LOCUS_13380 2610 2083 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_13380 2716 3336 gene locus_tag LOCUS_13390 2716 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3336 4874 gene locus_tag LOCUS_13400 3336 4874 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence106 <1 573 gene locus_tag LOCUS_13410 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022234.1:tetratricopeptide repeat protein 1184 609 gene locus_tag LOCUS_13420 1184 609 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014562.1 protein_id gnl|my_center|LOCUS_13420 1526 1915 gene locus_tag LOCUS_13430 1526 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1984 5358 gene locus_tag LOCUS_13440 1984 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6322 5501 gene locus_tag LOCUS_13450 6322 5501 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence107 154 1119 gene locus_tag LOCUS_13460 154 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1271 1936 gene locus_tag LOCUS_13470 1271 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1961 2224 gene locus_tag LOCUS_13480 1961 2224 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_13480 2224 3072 gene locus_tag LOCUS_13490 gene hisG 2224 3072 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055763.1 protein_id gnl|my_center|LOCUS_13490 3072 3509 gene locus_tag LOCUS_13500 3072 3509 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139538.1 protein_id gnl|my_center|LOCUS_13500 4640 3513 gene locus_tag LOCUS_13510 4640 3513 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_13510 4687 5625 gene locus_tag LOCUS_13520 4687 5625 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908274.1 protein_id gnl|my_center|LOCUS_13520 5615 6535 gene locus_tag LOCUS_13530 5615 6535 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence108 88 435 gene locus_tag LOCUS_13540 88 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1552 563 gene locus_tag LOCUS_13550 gene ccsB 1552 563 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_13550 2994 1549 gene locus_tag LOCUS_13560 2994 1549 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142120627.1 protein_id gnl|my_center|LOCUS_13560 3797 3036 gene locus_tag LOCUS_13570 3797 3036 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_13570 4354 3794 gene locus_tag LOCUS_13580 4354 3794 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_13580 4974 4351 gene locus_tag LOCUS_13590 4974 4351 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_13590 5452 4994 gene locus_tag LOCUS_13600 5452 4994 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930002.1 protein_id gnl|my_center|LOCUS_13600 5583 6116 gene locus_tag LOCUS_13610 5583 6116 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_13610 6444 6205 gene locus_tag LOCUS_13620 6444 6205 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776425.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence109 78 1883 gene locus_tag LOCUS_13630 78 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1899 3470 gene locus_tag LOCUS_13640 gene ffh 1899 3470 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804617.1 protein_id gnl|my_center|LOCUS_13640 3491 4564 gene locus_tag LOCUS_13650 3491 4564 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_13650 5012 4542 gene locus_tag LOCUS_13660 5012 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528687.1 protein_id gnl|my_center|LOCUS_13660 6493 5090 gene locus_tag LOCUS_13670 6493 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence110 406 1548 gene locus_tag LOCUS_13680 406 1548 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379387.1 protein_id gnl|my_center|LOCUS_13680 1551 2474 gene locus_tag LOCUS_13690 1551 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3101 2451 gene locus_tag LOCUS_13700 3101 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3180 4118 gene locus_tag LOCUS_13710 3180 4118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379390.1 protein_id gnl|my_center|LOCUS_13710 4108 4887 gene locus_tag LOCUS_13720 4108 4887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819358.1 protein_id gnl|my_center|LOCUS_13720 4890 5624 gene locus_tag LOCUS_13730 4890 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5621 6349 gene locus_tag LOCUS_13740 5621 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence111 743 21 gene locus_tag LOCUS_13750 743 21 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_13750 1522 746 gene locus_tag LOCUS_13760 1522 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2263 1556 gene locus_tag LOCUS_13770 2263 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3839 2271 gene locus_tag LOCUS_13780 3839 2271 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803796.1 protein_id gnl|my_center|LOCUS_13780 4100 4663 gene locus_tag LOCUS_13790 4100 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4663 5931 gene locus_tag LOCUS_13800 4663 5931 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence112 2432 1233 gene locus_tag LOCUS_13810 2432 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3087 2512 gene locus_tag LOCUS_13820 3087 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3055 4530 gene locus_tag LOCUS_13830 3055 4530 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_13830 4860 4612 gene locus_tag LOCUS_13840 4860 4612 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_13840 5061 5447 gene locus_tag LOCUS_13850 5061 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence113 1066 2727 gene locus_tag LOCUS_13860 1066 2727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115413031.1 protein_id gnl|my_center|LOCUS_13860 2800 3876 gene locus_tag LOCUS_13870 2800 3876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775832.1 protein_id gnl|my_center|LOCUS_13870 3876 4880 gene locus_tag LOCUS_13880 3876 4880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363253.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence114 439 173 gene locus_tag LOCUS_13890 439 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 952 575 gene locus_tag LOCUS_13900 952 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2106 1051 gene locus_tag LOCUS_13910 2106 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389745.1 protein_id gnl|my_center|LOCUS_13910 2705 2103 gene locus_tag LOCUS_13920 2705 2103 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_13920 3718 2696 gene locus_tag LOCUS_13930 3718 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4299 3724 gene locus_tag LOCUS_13940 4299 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4592 4296 gene locus_tag LOCUS_13950 4592 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5984 4737 gene locus_tag LOCUS_13960 5984 4737 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence115 1806 523 gene locus_tag LOCUS_13970 1806 523 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_13970 1880 2650 gene locus_tag LOCUS_13980 1880 2650 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_13980 3799 2777 gene locus_tag LOCUS_13990 gene fbaA 3799 2777 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068538.1 protein_id gnl|my_center|LOCUS_13990 4549 3923 gene locus_tag LOCUS_14000 4549 3923 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_14000 4692 4549 gene locus_tag LOCUS_14010 4692 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5306 4689 gene locus_tag LOCUS_14020 5306 4689 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079790.1 protein_id gnl|my_center|LOCUS_14020 5942 5379 gene locus_tag LOCUS_14030 5942 5379 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776563.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence116 1018 497 gene locus_tag LOCUS_14040 1018 497 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_14040 1956 1084 gene locus_tag LOCUS_14050 1956 1084 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 protein_id gnl|my_center|LOCUS_14050 2084 3226 gene locus_tag LOCUS_14060 2084 3226 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_14060 4702 3242 gene locus_tag LOCUS_14070 4702 3242 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_14070 6148 4871 gene locus_tag LOCUS_14080 6148 4871 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence117 679 2325 gene locus_tag LOCUS_14090 679 2325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_14090 2481 3407 gene locus_tag LOCUS_14100 2481 3407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_14100 3400 4344 gene locus_tag LOCUS_14110 3400 4344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_14110 4341 6047 gene locus_tag LOCUS_14120 4341 6047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence118 541 1383 gene locus_tag LOCUS_14130 541 1383 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_14130 2894 1416 gene locus_tag LOCUS_14140 2894 1416 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 3098 3772 gene locus_tag LOCUS_14150 3098 3772 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056357.1 protein_id gnl|my_center|LOCUS_14150 4474 3776 gene locus_tag LOCUS_14160 4474 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4383 4715 gene locus_tag LOCUS_14170 4383 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence119 <1 822 gene locus_tag LOCUS_14180 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897935.1:ABC transporter ATP-binding protein 1320 5537 gene locus_tag LOCUS_14190 1320 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053004.1 protein_id gnl|my_center|LOCUS_14190 5566 5784 gene locus_tag LOCUS_14200 5566 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence120 223 2718 gene locus_tag LOCUS_14210 223 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2711 3772 gene locus_tag LOCUS_14220 2711 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3769 4023 gene locus_tag LOCUS_14230 3769 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4107 4994 gene locus_tag LOCUS_14240 4107 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5159 5022 gene locus_tag LOCUS_14250 5159 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5190 5561 gene locus_tag LOCUS_14260 5190 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence121 1884 769 gene locus_tag LOCUS_14270 gene rsgA 1884 769 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_14270 3400 1922 gene locus_tag LOCUS_14280 3400 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_14280 3545 4240 gene locus_tag LOCUS_14290 gene rpiA 3545 4240 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_14290 5182 4259 gene locus_tag LOCUS_14300 5182 4259 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence122 <1 1294 gene locus_tag LOCUS_14310 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775961.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase note possible pseudo, frameshifted 1291 2082 gene locus_tag LOCUS_14320 1291 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14320 2079 3185 gene locus_tag LOCUS_14330 2079 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3185 4000 gene locus_tag LOCUS_14340 3185 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4892 4005 gene locus_tag LOCUS_14350 4892 4005 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_14350 4961 5488 gene locus_tag LOCUS_14360 4961 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence123 401 1417 gene locus_tag LOCUS_14370 401 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389743.1 protein_id gnl|my_center|LOCUS_14370 1485 2048 gene locus_tag LOCUS_14380 1485 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14380 2035 3120 gene locus_tag LOCUS_14390 2035 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3227 3595 gene locus_tag LOCUS_14400 3227 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3597 4190 gene locus_tag LOCUS_14410 3597 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4530 4234 gene locus_tag LOCUS_14420 4530 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4845 4770 gene locus_tag LOCUS_t00250 4845 4770 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 1178 69 gene locus_tag LOCUS_14430 1178 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3052 1175 gene locus_tag LOCUS_14440 3052 1175 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_14440 4480 3128 gene locus_tag LOCUS_14450 4480 3128 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence125 152 1180 gene locus_tag LOCUS_14460 152 1180 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_14460 1548 1366 gene locus_tag LOCUS_14470 1548 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2861 3415 gene locus_tag LOCUS_14480 2861 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3412 4350 gene locus_tag LOCUS_14490 3412 4350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_14490 4356 5633 gene locus_tag LOCUS_14500 gene tviB 4356 5633 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence126 180 905 gene locus_tag LOCUS_14510 180 905 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803890.1 protein_id gnl|my_center|LOCUS_14510 1023 2102 gene locus_tag LOCUS_14520 1023 2102 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_14520 2099 3565 gene locus_tag LOCUS_14530 gene crtI 2099 3565 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_14530 3562 4425 gene locus_tag LOCUS_14540 3562 4425 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_14540 4422 4748 gene locus_tag LOCUS_14550 4422 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4745 5059 gene locus_tag LOCUS_14560 4745 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence127 976 2508 gene locus_tag LOCUS_14570 976 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2711 3868 gene locus_tag LOCUS_14580 2711 3868 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_14580 3865 4722 gene locus_tag LOCUS_14590 3865 4722 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_14590 4719 5516 gene locus_tag LOCUS_14600 4719 5516 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence128 57 1334 gene locus_tag LOCUS_14610 gene glgA 57 1334 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_14610 1419 2204 gene locus_tag LOCUS_14620 1419 2204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078324130.1 protein_id gnl|my_center|LOCUS_14620 2217 2666 gene locus_tag LOCUS_14630 2217 2666 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407562.1 protein_id gnl|my_center|LOCUS_14630 2685 3917 gene locus_tag LOCUS_14640 2685 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3914 4753 gene locus_tag LOCUS_14650 3914 4753 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_14650 4806 5570 gene locus_tag LOCUS_14660 4806 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5572 5793 gene locus_tag LOCUS_14670 5572 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence129 643 2040 gene locus_tag LOCUS_14680 643 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2503 2021 gene locus_tag LOCUS_14690 gene greA 2503 2021 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_14690 2987 2583 gene locus_tag LOCUS_14700 2987 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3143 4048 gene locus_tag LOCUS_14710 gene mca 3143 4048 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896662.1 protein_id gnl|my_center|LOCUS_14710 5672 4545 gene locus_tag LOCUS_14720 5672 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence130 1014 211 gene locus_tag LOCUS_14730 1014 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1102 1746 gene locus_tag LOCUS_14740 1102 1746 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_14740 1743 2507 gene locus_tag LOCUS_14750 1743 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3045 2536 gene locus_tag LOCUS_14760 3045 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3412 3140 gene locus_tag LOCUS_14770 3412 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4503 3409 gene locus_tag LOCUS_14780 4503 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 <5552 4982 gene locus_tag LOCUS_14790 <5552 4982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776404.1:polyphosphate kinase 2 >Feature sequence131 2 193 gene locus_tag LOCUS_14800 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 331 1353 gene locus_tag LOCUS_14810 331 1353 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 protein_id gnl|my_center|LOCUS_14810 1703 2917 gene locus_tag LOCUS_14820 1703 2917 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_14820 3074 4063 gene locus_tag LOCUS_14830 gene rsmA 3074 4063 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_14830 4060 4962 gene locus_tag LOCUS_14840 4060 4962 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804944.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence132 605 135 gene locus_tag LOCUS_14850 gene rpsG 605 135 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_14850 979 605 gene locus_tag LOCUS_14860 gene rpsL 979 605 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776386.1 protein_id gnl|my_center|LOCUS_14860 5195 1305 gene locus_tag LOCUS_14870 5195 1305 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence133 433 2379 gene locus_tag LOCUS_14880 433 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2381 4882 gene locus_tag LOCUS_14890 2381 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence134 2126 3424 gene locus_tag LOCUS_14900 2126 3424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_14900 3494 4909 gene locus_tag LOCUS_14910 gene argG 3494 4909 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence135 2669 390 gene locus_tag LOCUS_14920 2669 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2793 4100 gene locus_tag LOCUS_14930 2793 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence136 <1 1395 gene locus_tag LOCUS_14940 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973998.1:phosphoenolpyruvate carboxykinase (GTP) 1501 2778 gene locus_tag LOCUS_14950 gene purD 1501 2778 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_14950 2809 3723 gene locus_tag LOCUS_14960 2809 3723 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_14960 3752 4075 gene locus_tag LOCUS_14970 3752 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4072 4779 gene locus_tag LOCUS_14980 gene purQ 4072 4779 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776337.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence137 156 884 gene locus_tag LOCUS_14990 gene dapB 156 884 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_14990 1600 944 gene locus_tag LOCUS_15000 1600 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1560 2453 gene locus_tag LOCUS_15010 gene dapA 1560 2453 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048369.1 protein_id gnl|my_center|LOCUS_15010 2476 4158 gene locus_tag LOCUS_15020 2476 4158 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence138 711 478 gene locus_tag LOCUS_15030 711 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1168 1584 gene locus_tag LOCUS_15040 1168 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1709 2623 gene locus_tag LOCUS_15050 1709 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3471 2605 gene locus_tag LOCUS_15060 3471 2605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_15060 4226 3468 gene locus_tag LOCUS_15070 gene cbiQ 4226 3468 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_15070 4718 4227 gene locus_tag LOCUS_15080 4718 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 <5281 4715 gene locus_tag LOCUS_15090 <5281 4715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028801.1:energy-coupling factor ABC transporter permease note possible pseudo, internal stop codon, frameshifted >Feature sequence139 <1 852 gene locus_tag LOCUS_15100 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067910.1:MFS transporter 920 1513 gene locus_tag LOCUS_15110 920 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1587 2135 gene locus_tag LOCUS_15120 1587 2135 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776177.1 protein_id gnl|my_center|LOCUS_15120 2197 3561 gene locus_tag LOCUS_15130 gene argH 2197 3561 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_15130 3563 4834 gene locus_tag LOCUS_15140 gene tyrS 3563 4834 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence140 <1 778 gene locus_tag LOCUS_15150 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030867756.1:ATP-dependent zinc metalloprotease FtsH 775 1353 gene locus_tag LOCUS_15160 gene folE 775 1353 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_15160 1377 2177 gene locus_tag LOCUS_15170 gene folP 1377 2177 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_15170 2170 3030 gene locus_tag LOCUS_15180 2170 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3027 3500 gene locus_tag LOCUS_15190 3027 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3567 4052 gene locus_tag LOCUS_15200 3567 4052 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence141 1759 806 gene locus_tag LOCUS_15210 1759 806 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_15210 2548 1832 gene locus_tag LOCUS_15220 2548 1832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence142 267 890 gene locus_tag LOCUS_15230 267 890 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776334.1 protein_id gnl|my_center|LOCUS_15230 927 4190 gene locus_tag LOCUS_15240 927 4190 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168152430.1 protein_id gnl|my_center|LOCUS_15240 5013 4216 gene locus_tag LOCUS_15250 5013 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence143 4111 1937 gene locus_tag LOCUS_15260 4111 1937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776348.1 protein_id gnl|my_center|LOCUS_15260 4953 4108 gene locus_tag LOCUS_15270 4953 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence144 <1 732 gene locus_tag LOCUS_15280 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389404.1:trypsin-like peptidase domain-containing protein 756 1475 gene locus_tag LOCUS_15290 756 1475 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_15290 1535 2827 gene locus_tag LOCUS_15300 1535 2827 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_15300 2844 3206 gene locus_tag LOCUS_15310 2844 3206 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_15310 3215 3769 gene locus_tag LOCUS_15320 3215 3769 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_15320 3766 4491 gene locus_tag LOCUS_15330 3766 4491 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence145 <1 897 gene locus_tag LOCUS_15340 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068258.1:UPF0182 family protein 998 1074 gene locus_tag LOCUS_t00260 998 1074 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1639 1127 gene locus_tag LOCUS_15350 1639 1127 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776902.1 protein_id gnl|my_center|LOCUS_15350 2439 1639 gene locus_tag LOCUS_15360 2439 1639 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225956.1 protein_id gnl|my_center|LOCUS_15360 3149 2436 gene locus_tag LOCUS_15370 3149 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406325.1 protein_id gnl|my_center|LOCUS_15370 3342 4712 gene locus_tag LOCUS_15380 gene zwf 3342 4712 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence146 1109 360 gene locus_tag LOCUS_15390 1109 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1250 2017 gene locus_tag LOCUS_15400 1250 2017 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_15400 2482 2057 gene locus_tag LOCUS_15410 gene aroQ 2482 2057 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_15410 4095 2482 gene locus_tag LOCUS_15420 4095 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4876 4085 gene locus_tag LOCUS_15430 gene aroE 4876 4085 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451221.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence147 1757 939 gene locus_tag LOCUS_15440 1757 939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_15440 2761 1754 gene locus_tag LOCUS_15450 2761 1754 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_15450 3792 2758 gene locus_tag LOCUS_15460 3792 2758 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_15460 4622 3789 gene locus_tag LOCUS_15470 4622 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence148 484 1329 gene locus_tag LOCUS_15480 484 1329 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_15480 1344 1559 gene locus_tag LOCUS_15490 1344 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2827 1655 gene locus_tag LOCUS_15500 2827 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2923 3120 gene locus_tag LOCUS_15510 2923 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3170 4330 gene locus_tag LOCUS_15520 3170 4330 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_15520 4421 4346 gene locus_tag LOCUS_t00270 4421 4346 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4395 4706 gene locus_tag LOCUS_15530 4395 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence149 1132 1359 gene locus_tag LOCUS_15540 1132 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2633 1413 gene locus_tag LOCUS_15550 2633 1413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_15550 3406 2630 gene locus_tag LOCUS_15560 3406 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3783 3406 gene locus_tag LOCUS_15570 3783 3406 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776599.1 protein_id gnl|my_center|LOCUS_15570 4552 3839 gene locus_tag LOCUS_15580 4552 3839 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence150 246 476 gene locus_tag LOCUS_15590 gene rpsR 246 476 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_15590 495 941 gene locus_tag LOCUS_15600 gene rplI 495 941 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_15600 2559 1639 gene locus_tag LOCUS_15610 2559 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_15610 3027 4406 gene locus_tag LOCUS_15620 gene dnaB 3027 4406 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929839.1 protein_id gnl|my_center|LOCUS_15620 4728 4904 gene locus_tag LOCUS_15630 4728 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence151 1372 530 gene locus_tag LOCUS_15640 1372 530 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805043.1 protein_id gnl|my_center|LOCUS_15640 1478 2113 gene locus_tag LOCUS_15650 1478 2113 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804516.1 protein_id gnl|my_center|LOCUS_15650 2168 3562 gene locus_tag LOCUS_15660 2168 3562 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_15660 <4991 3545 gene locus_tag LOCUS_15670 <4991 3545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136193899.1:error-prone DNA polymerase >Feature sequence152 486 73 gene locus_tag LOCUS_15680 486 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 753 493 gene locus_tag LOCUS_15690 753 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2225 750 gene locus_tag LOCUS_15700 gene atpD 2225 750 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_15700 3193 2246 gene locus_tag LOCUS_15710 3193 2246 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 protein_id gnl|my_center|LOCUS_15710 4834 3197 gene locus_tag LOCUS_15720 gene atpA 4834 3197 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence153 1872 2243 gene locus_tag LOCUS_15730 1872 2243 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_15730 2253 3974 gene locus_tag LOCUS_15740 2253 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4847 3981 gene locus_tag LOCUS_15750 4847 3981 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence154 <1 1763 gene locus_tag LOCUS_15760 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222247.1:exporter of polyketide antibiotics 1880 3418 gene locus_tag LOCUS_15770 1880 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3869 3465 gene locus_tag LOCUS_15780 3869 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 <4947 4067 gene locus_tag LOCUS_15790 <4947 4067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085686.1:bifunctional alpha/beta hydrolase/OsmC family protein >Feature sequence155 554 30 gene locus_tag LOCUS_15800 554 30 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029640.1 protein_id gnl|my_center|LOCUS_15800 2110 551 gene locus_tag LOCUS_15810 2110 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2890 2144 gene locus_tag LOCUS_15820 2890 2144 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 protein_id gnl|my_center|LOCUS_15820 3031 3948 gene locus_tag LOCUS_15830 3031 3948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence156 2044 755 gene locus_tag LOCUS_15840 2044 755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 protein_id gnl|my_center|LOCUS_15840 3639 2041 gene locus_tag LOCUS_15850 3639 2041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_15850 4840 3749 gene locus_tag LOCUS_15860 4840 3749 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence157 538 194 gene locus_tag LOCUS_15870 538 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1596 535 gene locus_tag LOCUS_15880 1596 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1680 3131 gene locus_tag LOCUS_15890 1680 3131 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_15890 3797 3138 gene locus_tag LOCUS_15900 3797 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 <4830 3804 gene locus_tag LOCUS_15910 <4830 3804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861089.1:membrane protein >Feature sequence158 988 2 gene locus_tag LOCUS_15920 988 2 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776451.1 protein_id gnl|my_center|LOCUS_15920 1910 1023 gene locus_tag LOCUS_15930 1910 1023 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776450.1 protein_id gnl|my_center|LOCUS_15930 3145 1910 gene locus_tag LOCUS_15940 3145 1910 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930007.1 protein_id gnl|my_center|LOCUS_15940 3654 3472 gene locus_tag LOCUS_15950 3654 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3842 4513 gene locus_tag LOCUS_15960 3842 4513 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence159 836 2173 gene locus_tag LOCUS_15970 836 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2197 4104 gene locus_tag LOCUS_15980 2197 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 <4720 4180 gene locus_tag LOCUS_15990 <4720 4180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776057.1:type II secretion system F family protein >Feature sequence160 4119 1237 gene locus_tag LOCUS_16000 4119 1237 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence161 <1 1482 gene locus_tag LOCUS_16010 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030205.1:transcription termination factor Rho 1592 1801 gene locus_tag LOCUS_16020 gene rpmE 1592 1801 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_16020 1871 2959 gene locus_tag LOCUS_16030 gene prfA 1871 2959 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_16030 2962 3828 gene locus_tag LOCUS_16040 gene prmC 2962 3828 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775948.1 protein_id gnl|my_center|LOCUS_16040 3825 4463 gene locus_tag LOCUS_16050 3825 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence162 976 290 gene locus_tag LOCUS_16060 976 290 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_16060 1432 1181 gene locus_tag LOCUS_16070 1432 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2009 2548 gene locus_tag LOCUS_16080 2009 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3374 2568 gene locus_tag LOCUS_16090 3374 2568 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312799.1 protein_id gnl|my_center|LOCUS_16090 4630 3377 gene locus_tag LOCUS_16100 4630 3377 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence163 1373 609 gene locus_tag LOCUS_16110 gene larB 1373 609 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777074.1 protein_id gnl|my_center|LOCUS_16110 2223 1366 gene locus_tag LOCUS_16120 gene larE 2223 1366 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777075.1 protein_id gnl|my_center|LOCUS_16120 3659 2220 gene locus_tag LOCUS_16130 3659 2220 CDS product LarC family nickel insertion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777110.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence164 <1 691 gene locus_tag LOCUS_16140 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728951.1:alpha/beta fold hydrolase 688 1539 gene locus_tag LOCUS_16150 688 1539 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_16150 1600 3750 gene locus_tag LOCUS_16160 1600 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence165 319 38 gene locus_tag LOCUS_16170 319 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 871 3081 gene locus_tag LOCUS_16180 871 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 <4552 3238 gene locus_tag LOCUS_16190 <4552 3238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090968.1:phage/plasmid primase, P4 family >Feature sequence166 1196 552 gene locus_tag LOCUS_16200 1196 552 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_16200 1974 1315 gene locus_tag LOCUS_16210 1974 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3281 1971 gene locus_tag LOCUS_16220 3281 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4056 3268 gene locus_tag LOCUS_16230 4056 3268 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116382.1 protein_id gnl|my_center|LOCUS_16230 4346 4092 gene locus_tag LOCUS_16240 4346 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence167 905 447 gene locus_tag LOCUS_16250 905 447 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113347.1 protein_id gnl|my_center|LOCUS_16250 2588 942 gene locus_tag LOCUS_16260 2588 942 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_16260 2688 3161 gene locus_tag LOCUS_16270 2688 3161 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623980.1 protein_id gnl|my_center|LOCUS_16270 3204 3842 gene locus_tag LOCUS_16280 3204 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3844 4218 gene locus_tag LOCUS_16290 3844 4218 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence168 1504 164 gene locus_tag LOCUS_16300 1504 164 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_16300 1604 2722 gene locus_tag LOCUS_16310 gene prfB 1604 2722 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_16310 2892 3581 gene locus_tag LOCUS_16320 gene ftsE 2892 3581 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_16320 3585 4496 gene locus_tag LOCUS_16330 gene ftsX 3585 4496 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence169 1603 632 gene locus_tag LOCUS_16340 1603 632 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_16340 2975 1677 gene locus_tag LOCUS_16350 2975 1677 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_16350 <4524 3064 gene locus_tag LOCUS_16360 <4524 3064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886942.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence170 761 1414 gene locus_tag LOCUS_16370 761 1414 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_16370 1411 2754 gene locus_tag LOCUS_16380 1411 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3442 2780 gene locus_tag LOCUS_16390 3442 2780 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_16390 <4522 3448 gene locus_tag LOCUS_16400 <4522 3448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776429.1:potassium transporter TrkG >Feature sequence171 <1 561 gene locus_tag LOCUS_16410 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263500.1:glycosyltransferase 558 2303 gene locus_tag LOCUS_16420 558 2303 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989371.1 protein_id gnl|my_center|LOCUS_16420 2315 2938 gene locus_tag LOCUS_16430 2315 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2977 3468 gene locus_tag LOCUS_16440 2977 3468 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013395.1 protein_id gnl|my_center|LOCUS_16440 3928 3470 gene locus_tag LOCUS_16450 3928 3470 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence172 1921 569 gene locus_tag LOCUS_16460 1921 569 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_16460 2277 1930 gene locus_tag LOCUS_16470 2277 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3578 2382 gene locus_tag LOCUS_16480 3578 2382 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_16480 <4460 3575 gene locus_tag LOCUS_16490 <4460 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941859.1:mannose-1-phosphate guanylyltransferase >Feature sequence173 32 235 gene locus_tag LOCUS_16500 32 235 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804526.1 protein_id gnl|my_center|LOCUS_16500 1320 232 gene locus_tag LOCUS_16510 gene purM 1320 232 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_16510 2816 1317 gene locus_tag LOCUS_16520 gene purF 2816 1317 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_16520 4316 2856 gene locus_tag LOCUS_16530 4316 2856 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence174 49 846 gene locus_tag LOCUS_16540 49 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 843 1442 gene locus_tag LOCUS_16550 843 1442 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930078.1 protein_id gnl|my_center|LOCUS_16550 3463 1460 gene locus_tag LOCUS_16560 3463 1460 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_16560 3624 4328 gene locus_tag LOCUS_16570 3624 4328 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence175 247 459 gene locus_tag LOCUS_16580 247 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3904 3392 gene locus_tag LOCUS_16590 3904 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence176 549 1787 gene locus_tag LOCUS_16600 549 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1784 2722 gene locus_tag LOCUS_16610 1784 2722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_16610 <4318 2844 gene locus_tag LOCUS_16620 <4318 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804342.1:ATP-dependent DNA ligase >Feature sequence177 2424 2155 gene locus_tag LOCUS_16630 gene rpsO 2424 2155 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_16630 3544 2567 gene locus_tag LOCUS_16640 3544 2567 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 protein_id gnl|my_center|LOCUS_16640 <4314 3611 gene locus_tag LOCUS_16650 <4314 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296636.1:tRNA pseudouridine(55) synthase TruB >Feature sequence178 1960 515 gene locus_tag LOCUS_16660 1960 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2244 1957 gene locus_tag LOCUS_16670 2244 1957 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_16670 3173 2241 gene locus_tag LOCUS_16680 3173 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3460 3173 gene locus_tag LOCUS_16690 3460 3173 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_16690 3723 3457 gene locus_tag LOCUS_16700 3723 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4232 3720 gene locus_tag LOCUS_16710 4232 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence179 485 1147 gene locus_tag LOCUS_16720 485 1147 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472143.1 protein_id gnl|my_center|LOCUS_16720 3805 1166 gene locus_tag LOCUS_16730 3805 1166 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_16730 3896 4153 gene locus_tag LOCUS_16740 3896 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16740 >Feature sequence180 3340 1796 gene locus_tag LOCUS_16750 3340 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 <4176 3654 gene locus_tag LOCUS_16760 <4176 3654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036809.1:recombinase family protein >Feature sequence181 2166 1432 gene locus_tag LOCUS_16770 2166 1432 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_16770 3627 2218 gene locus_tag LOCUS_16780 3627 2218 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728998.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence182 192 1409 gene locus_tag LOCUS_16790 192 1409 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence183 <1 2113 gene locus_tag LOCUS_16800 <1 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005055595.1:elongation factor G 2240 3433 gene locus_tag LOCUS_16810 gene tuf 2240 3433 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055596.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence184 734 180 gene locus_tag LOCUS_16820 gene sigE 734 180 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_16820 835 1467 gene locus_tag LOCUS_16830 835 1467 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_16830 2981 1464 gene locus_tag LOCUS_16840 2981 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3148 2981 gene locus_tag LOCUS_16850 3148 2981 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_16850 4037 3258 gene locus_tag LOCUS_16860 4037 3258 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence185 677 889 gene locus_tag LOCUS_16870 677 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2056 1007 gene locus_tag LOCUS_16880 2056 1007 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089272.1 protein_id gnl|my_center|LOCUS_16880 2195 3202 gene locus_tag LOCUS_16890 2195 3202 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404368.1 protein_id gnl|my_center|LOCUS_16890 3174 3974 gene locus_tag LOCUS_16900 3174 3974 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530507.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence186 1068 337 gene locus_tag LOCUS_16910 1068 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1540 1758 gene locus_tag LOCUS_16920 1540 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1996 3516 gene locus_tag LOCUS_16930 gene malQ 1996 3516 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence187 <1 750 gene locus_tag LOCUS_16940 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776538.1:adenylosuccinate lyase 1216 758 gene locus_tag LOCUS_16950 1216 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1614 1213 gene locus_tag LOCUS_16960 1614 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1760 3268 gene locus_tag LOCUS_16970 1760 3268 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_16970 3299 3559 gene locus_tag LOCUS_16980 3299 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3546 3968 gene locus_tag LOCUS_16990 3546 3968 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401406.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence188 586 224 gene locus_tag LOCUS_17000 586 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1002 583 gene locus_tag LOCUS_17010 1002 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3653 1122 gene locus_tag LOCUS_17020 3653 1122 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence189 <1 675 gene locus_tag LOCUS_17030 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803896.1:CPBP family intramembrane metalloprotease 861 1340 gene locus_tag LOCUS_17040 861 1340 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971631.1 protein_id gnl|my_center|LOCUS_17040 1385 1558 gene locus_tag LOCUS_17050 1385 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence190 1899 115 gene locus_tag LOCUS_17060 1899 115 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_17060 2724 2005 gene locus_tag LOCUS_17070 2724 2005 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_17070 <4069 2724 gene locus_tag LOCUS_17080 <4069 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776130.1:DUF885 domain-containing protein >Feature sequence191 234 698 gene locus_tag LOCUS_17090 gene sixA 234 698 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_17090 727 1338 gene locus_tag LOCUS_17100 727 1338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209064.1 protein_id gnl|my_center|LOCUS_17100 2354 1347 gene locus_tag LOCUS_17110 2354 1347 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_17110 2440 3018 gene locus_tag LOCUS_17120 2440 3018 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776242.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence192 645 887 gene locus_tag LOCUS_17130 645 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1638 850 gene locus_tag LOCUS_17140 1638 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3043 1694 gene locus_tag LOCUS_17150 3043 1694 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence193 1 264 gene locus_tag LOCUS_17160 1 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 261 1193 gene locus_tag LOCUS_17170 261 1193 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_17170 1345 3648 gene locus_tag LOCUS_17180 1345 3648 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence194 1226 180 gene locus_tag LOCUS_17190 1226 180 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_17190 3243 1228 gene locus_tag LOCUS_17200 3243 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence195 1989 316 gene locus_tag LOCUS_17210 1989 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3863 2001 gene locus_tag LOCUS_17220 3863 2001 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence196 184 504 gene locus_tag LOCUS_17230 184 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 501 938 gene locus_tag LOCUS_17240 501 938 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_17240 1265 1630 gene locus_tag LOCUS_17250 1265 1630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_17250 1706 3286 gene locus_tag LOCUS_17260 1706 3286 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_17260 3283 3867 gene locus_tag LOCUS_17270 3283 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence197 601 299 gene locus_tag LOCUS_17280 601 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1393 974 gene locus_tag LOCUS_17290 1393 974 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777104.1 protein_id gnl|my_center|LOCUS_17290 2510 1497 gene locus_tag LOCUS_17300 2510 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence198 2549 471 gene locus_tag LOCUS_17310 2549 471 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_17310 3689 2640 gene locus_tag LOCUS_17320 3689 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3810 3896 gene locus_tag LOCUS_t00280 3810 3896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence199 966 1 gene locus_tag LOCUS_17330 966 1 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_17330 3406 977 gene locus_tag LOCUS_17340 3406 977 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence200 780 1403 gene locus_tag LOCUS_17350 780 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1616 2431 gene locus_tag LOCUS_17360 1616 2431 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930036.1 protein_id gnl|my_center|LOCUS_17360 2479 2724 gene locus_tag LOCUS_17370 2479 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2721 3107 gene locus_tag LOCUS_17380 2721 3107 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414064.1 protein_id gnl|my_center|LOCUS_17380 <3846 3117 gene locus_tag LOCUS_17390 <3846 3117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402176.1:exodeoxyribonuclease III >Feature sequence201 1047 1670 gene locus_tag LOCUS_17400 1047 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2237 1731 gene locus_tag LOCUS_17410 2237 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2681 2238 gene locus_tag LOCUS_17420 2681 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3695 2781 gene locus_tag LOCUS_17430 3695 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence202 1140 508 gene locus_tag LOCUS_17440 1140 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_17440 1308 1382 gene locus_tag LOCUS_t00290 1308 1382 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1419 1691 gene locus_tag LOCUS_17450 1419 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2644 3261 gene locus_tag LOCUS_17460 2644 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17460 3258 3587 gene locus_tag LOCUS_17470 3258 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence203 1772 927 gene locus_tag LOCUS_17480 gene nadE 1772 927 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027169.1 protein_id gnl|my_center|LOCUS_17480 2253 1861 gene locus_tag LOCUS_17490 2253 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3035 2295 gene locus_tag LOCUS_17500 3035 2295 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_17500 3206 3637 gene locus_tag LOCUS_17510 3206 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence204 203 820 gene locus_tag LOCUS_17520 203 820 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_17520 817 1563 gene locus_tag LOCUS_17530 817 1563 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_17530 1576 3108 gene locus_tag LOCUS_17540 1576 3108 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence205 1039 623 gene locus_tag LOCUS_17550 1039 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1122 1412 gene locus_tag LOCUS_17560 1122 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1461 1934 gene locus_tag LOCUS_17570 1461 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2275 1922 gene locus_tag LOCUS_17580 2275 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <3750 2322 gene locus_tag LOCUS_17590 <3750 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080124.1:DEAD/DEAH box helicase >Feature sequence206 1144 71 gene locus_tag LOCUS_17600 1144 71 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_17600 1329 1814 gene locus_tag LOCUS_17610 1329 1814 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285387.1 protein_id gnl|my_center|LOCUS_17610 2849 1833 gene locus_tag LOCUS_17620 2849 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 <3736 2839 gene locus_tag LOCUS_17630 <3736 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928605.1:M23 family metallopeptidase >Feature sequence207 105 557 gene locus_tag LOCUS_17640 105 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 550 1248 gene locus_tag LOCUS_17650 550 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1248 1586 gene locus_tag LOCUS_17660 1248 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1601 1927 gene locus_tag LOCUS_17670 1601 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2826 2428 gene locus_tag LOCUS_17680 2826 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2841 3569 gene locus_tag LOCUS_17690 2841 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence208 1077 193 gene locus_tag LOCUS_17700 1077 193 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 protein_id gnl|my_center|LOCUS_17700 2354 1077 gene locus_tag LOCUS_17710 gene glyA 2354 1077 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_17710 3011 2529 gene locus_tag LOCUS_17720 3011 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 <3694 3104 gene locus_tag LOCUS_17730 <3694 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226477.1:malate dehydrogenase >Feature sequence209 <1 536 gene locus_tag LOCUS_17740 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227074.1:glycoside hydrolase family 3 C-terminal domain-containing protein 533 1249 gene locus_tag LOCUS_17750 533 1249 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_17750 1389 1904 gene locus_tag LOCUS_17760 1389 1904 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17760 1971 2846 gene locus_tag LOCUS_17770 1971 2846 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence210 382 1293 gene locus_tag LOCUS_17780 382 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1290 2048 gene locus_tag LOCUS_17790 1290 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2261 2542 gene locus_tag LOCUS_17800 2261 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2506 2667 gene locus_tag LOCUS_17810 2506 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2832 3482 gene locus_tag LOCUS_17820 2832 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence211 <1 960 gene locus_tag LOCUS_17830 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038047495.1:MFS transporter 995 2338 gene locus_tag LOCUS_17840 995 2338 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_17840 3554 2331 gene locus_tag LOCUS_17850 3554 2331 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence212 1014 424 gene locus_tag LOCUS_17860 1014 424 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777028.1 protein_id gnl|my_center|LOCUS_17860 2486 1011 gene locus_tag LOCUS_17870 2486 1011 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 protein_id gnl|my_center|LOCUS_17870 2855 2544 gene locus_tag LOCUS_17880 2855 2544 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776328.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence213 2164 17 gene locus_tag LOCUS_17890 2164 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 <3631 2171 gene locus_tag LOCUS_17900 <3631 2171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706470.1:cation:proton antiporter >Feature sequence214 >Feature sequence215 2632 1436 gene locus_tag LOCUS_17910 2632 1436 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_17910 3101 2742 gene locus_tag LOCUS_17920 3101 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence216 407 153 gene locus_tag LOCUS_17930 gene rpmC 407 153 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776369.1 protein_id gnl|my_center|LOCUS_17930 826 407 gene locus_tag LOCUS_17940 gene rplP 826 407 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_17940 1624 830 gene locus_tag LOCUS_17950 gene rpsC 1624 830 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_17950 2001 1624 gene locus_tag LOCUS_17960 gene rplV 2001 1624 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_17960 2321 2040 gene locus_tag LOCUS_17970 gene rpsS 2321 2040 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776373.1 protein_id gnl|my_center|LOCUS_17970 3174 2338 gene locus_tag LOCUS_17980 gene rplB 3174 2338 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_17980 3482 3174 gene locus_tag LOCUS_17990 gene rplW 3482 3174 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence217 1531 215 gene locus_tag LOCUS_18000 1531 215 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_18000 2165 1569 gene locus_tag LOCUS_18010 2165 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2767 2162 gene locus_tag LOCUS_18020 2767 2162 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218060570.1 protein_id gnl|my_center|LOCUS_18020 <3575 2910 gene locus_tag LOCUS_18030 <3575 2910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776742.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence218 2215 1433 gene locus_tag LOCUS_18040 2215 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3182 2325 gene locus_tag LOCUS_18050 3182 2325 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence219 86 15 gene locus_tag LOCUS_t00300 86 15 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 147 818 gene locus_tag LOCUS_18060 147 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 901 1536 gene locus_tag LOCUS_18070 901 1536 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_18070 1533 2441 gene locus_tag LOCUS_18080 1533 2441 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence220 1659 1405 gene locus_tag LOCUS_18090 1659 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence221 1323 607 gene locus_tag LOCUS_18100 1323 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1480 2001 gene locus_tag LOCUS_18110 1480 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2006 3523 gene locus_tag LOCUS_18120 2006 3523 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence222 744 1124 gene locus_tag LOCUS_18130 744 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1129 1719 gene locus_tag LOCUS_18140 1129 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1879 2082 gene locus_tag LOCUS_18150 1879 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2818 2498 gene locus_tag LOCUS_18160 2818 2498 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_18160 3135 2815 gene locus_tag LOCUS_18170 3135 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence223 824 1660 gene locus_tag LOCUS_18180 824 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1657 2532 gene locus_tag LOCUS_18190 1657 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 <3479 2507 gene locus_tag LOCUS_18200 <3479 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929836.1:glycosyltransferase >Feature sequence224 139 633 gene locus_tag LOCUS_18210 139 633 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_18210 1131 637 gene locus_tag LOCUS_18220 1131 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1042 1509 gene locus_tag LOCUS_18230 1042 1509 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105566594.1 protein_id gnl|my_center|LOCUS_18230 1618 3207 gene locus_tag LOCUS_18240 1618 3207 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence225 <1 678 gene locus_tag LOCUS_18250 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776589.1:methyltransferase 1620 625 gene locus_tag LOCUS_18260 1620 625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_18260 2223 2843 gene locus_tag LOCUS_18270 2223 2843 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence226 802 2253 gene locus_tag LOCUS_18280 802 2253 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776401.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence227 185 607 gene locus_tag LOCUS_18290 185 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1975 617 gene locus_tag LOCUS_18300 1975 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2600 2124 gene locus_tag LOCUS_18310 2600 2124 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence228 1145 105 gene locus_tag LOCUS_18320 1145 105 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054866.1 protein_id gnl|my_center|LOCUS_18320 2101 1142 gene locus_tag LOCUS_18330 2101 1142 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_18330 3303 2098 gene locus_tag LOCUS_18340 3303 2098 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053137.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence229 >Feature sequence230 2172 901 gene locus_tag LOCUS_18350 2172 901 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_18350 <3390 2169 gene locus_tag LOCUS_18360 <3390 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368420.1:class I SAM-dependent DNA methyltransferase >Feature sequence231 1167 28 gene locus_tag LOCUS_18370 1167 28 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730251.1 protein_id gnl|my_center|LOCUS_18370 1272 1643 gene locus_tag LOCUS_18380 1272 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1786 2361 gene locus_tag LOCUS_18390 1786 2361 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence232 <1 529 gene locus_tag LOCUS_18400 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030116.1:SOS response-associated peptidase 3155 492 gene locus_tag LOCUS_18410 3155 492 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence233 <1 1363 gene locus_tag LOCUS_18420 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775929.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase 1360 3075 gene locus_tag LOCUS_18430 gene treS 1360 3075 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence234 <1 638 gene locus_tag LOCUS_18440 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479947.1:S49 family peptidase 694 873 gene locus_tag LOCUS_18450 694 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 887 2239 gene locus_tag LOCUS_18460 887 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2236 3123 gene locus_tag LOCUS_18470 2236 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence235 452 135 gene locus_tag LOCUS_18480 452 135 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_18480 514 735 gene locus_tag LOCUS_18490 514 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2499 778 gene locus_tag LOCUS_18500 2499 778 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_18500 2970 2584 gene locus_tag LOCUS_18510 2970 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence236 1383 61 gene locus_tag LOCUS_18520 1383 61 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_18520 1752 2039 gene locus_tag LOCUS_18530 1752 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2186 2917 gene locus_tag LOCUS_18540 2186 2917 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence237 369 1652 gene locus_tag LOCUS_18550 369 1652 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_18550 2322 1663 gene locus_tag LOCUS_18560 2322 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3025 2381 gene locus_tag LOCUS_18570 3025 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence238 289 1068 gene locus_tag LOCUS_18580 289 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1065 1748 gene locus_tag LOCUS_18590 1065 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2173 1901 gene locus_tag LOCUS_18600 2173 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence239 1239 1571 gene locus_tag LOCUS_18610 1239 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1892 1602 gene locus_tag LOCUS_18620 1892 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2728 2060 gene locus_tag LOCUS_18630 2728 2060 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence240 274 1731 gene locus_tag LOCUS_18640 274 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1862 3040 gene locus_tag LOCUS_18650 1862 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence241 565 2472 gene locus_tag LOCUS_18660 gene dxs 565 2472 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_18660 <3172 2473 gene locus_tag LOCUS_18670 <3172 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776979.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence242 483 1115 gene locus_tag LOCUS_18680 gene raiA 483 1115 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813792.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence243 1950 589 gene locus_tag LOCUS_18690 1950 589 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776345.1 protein_id gnl|my_center|LOCUS_18690 <3150 1947 gene locus_tag LOCUS_18700 <3150 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230941.1:acetyl-CoA C-acetyltransferase >Feature sequence244 326 1999 gene locus_tag LOCUS_18710 326 1999 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_18710 2730 2077 gene locus_tag LOCUS_18720 gene deoC 2730 2077 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence245 <1 863 gene locus_tag LOCUS_18730 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015394.1:ATP-binding protein 878 2026 gene locus_tag LOCUS_18740 878 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2767 2069 gene locus_tag LOCUS_18750 2767 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence246 <1 807 gene locus_tag LOCUS_18760 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728432.1:glycoside hydrolase family 3 C-terminal domain-containing protein 1372 797 gene locus_tag LOCUS_18770 1372 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1452 2744 gene locus_tag LOCUS_18780 1452 2744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_18780 3104 2745 gene locus_tag LOCUS_18790 3104 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence247 1258 86 gene locus_tag LOCUS_18800 1258 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1547 2152 gene locus_tag LOCUS_18810 1547 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence248 91 1107 gene locus_tag LOCUS_18820 91 1107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_18820 1676 1110 gene locus_tag LOCUS_18830 1676 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence249 <1 529 gene locus_tag LOCUS_18840 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_219537380.1:5-(carboxyamino)imidazole ribonucleotide synthase 529 1032 gene locus_tag LOCUS_18850 gene purE 529 1032 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_18850 2321 1020 gene locus_tag LOCUS_18860 2321 1020 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_18860 <3049 2359 gene locus_tag LOCUS_18870 <3049 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776118.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence250 1683 193 gene locus_tag LOCUS_18880 1683 193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 protein_id gnl|my_center|LOCUS_18880 3020 1749 gene locus_tag LOCUS_18890 3020 1749 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence251 884 684 gene locus_tag LOCUS_18900 884 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 811 1050 gene locus_tag LOCUS_18910 811 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2530 1895 gene locus_tag LOCUS_18920 2530 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence252 1325 297 gene locus_tag LOCUS_18930 1325 297 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_18930 1337 2155 gene locus_tag LOCUS_18940 1337 2155 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040165421.1 protein_id gnl|my_center|LOCUS_18940 2337 2152 gene locus_tag LOCUS_18950 2337 2152 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537577.1 protein_id gnl|my_center|LOCUS_18950 2800 2330 gene locus_tag LOCUS_18960 2800 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence253 1586 819 gene locus_tag LOCUS_18970 1586 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2890 1640 gene locus_tag LOCUS_18980 2890 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence254 1494 208 gene locus_tag LOCUS_18990 1494 208 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_18990 2339 1491 gene locus_tag LOCUS_19000 2339 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_19000 <2961 2383 gene locus_tag LOCUS_19010 <2961 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974139.1:cryptochrome/photolyase family protein >Feature sequence255 1200 145 gene locus_tag LOCUS_19020 1200 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1913 1200 gene locus_tag LOCUS_19030 1913 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2191 2406 gene locus_tag LOCUS_19040 2191 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence256 <1 1078 gene locus_tag LOCUS_19050 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064242829.1:monovalent cation/H+ antiporter subunit D family protein 1075 2721 gene locus_tag LOCUS_19060 1075 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence257 21 701 gene locus_tag LOCUS_19070 gene lipB 21 701 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_19070 698 1714 gene locus_tag LOCUS_19080 gene lipA 698 1714 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775682.1 protein_id gnl|my_center|LOCUS_19080 2157 1705 gene locus_tag LOCUS_19090 2157 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2648 2193 gene locus_tag LOCUS_19100 2648 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence258 165 1433 gene locus_tag LOCUS_19110 165 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1498 2580 gene locus_tag LOCUS_19120 1498 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776114.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence259 <1 715 gene locus_tag LOCUS_19130 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878183.1:amino acid ABC transporter ATP-binding protein 1630 758 gene locus_tag LOCUS_19140 gene panE 1630 758 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690658.1 protein_id gnl|my_center|LOCUS_19140 2665 1862 gene locus_tag LOCUS_19150 2665 1862 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence260 309 1052 gene locus_tag LOCUS_19160 309 1052 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 protein_id gnl|my_center|LOCUS_19160 1686 1060 gene locus_tag LOCUS_19170 1686 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1814 2317 gene locus_tag LOCUS_19180 1814 2317 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 protein_id gnl|my_center|LOCUS_19180 <2912 2334 gene locus_tag LOCUS_19190 <2912 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030587.1:cytochrome c biogenesis CcdA family protein >Feature sequence261 56 1996 gene locus_tag LOCUS_19200 56 1996 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_19200 2112 2540 gene locus_tag LOCUS_19210 2112 2540 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803963.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence262 753 1136 gene locus_tag LOCUS_19220 753 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence263 <1 2748 gene locus_tag LOCUS_19230 <1 2748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972444.1:nitrate reductase subunit alpha >Feature sequence264 735 1667 gene locus_tag LOCUS_19240 gene pfkB 735 1667 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336985.1 protein_id gnl|my_center|LOCUS_19240 2234 1659 gene locus_tag LOCUS_19250 2234 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2809 2234 gene locus_tag LOCUS_19260 2809 2234 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence265 18 1271 gene locus_tag LOCUS_19270 18 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1268 2467 gene locus_tag LOCUS_19280 1268 2467 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084531.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence266 2339 1113 gene locus_tag LOCUS_19290 2339 1113 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence267 1417 71 gene locus_tag LOCUS_19300 1417 71 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094377.1 protein_id gnl|my_center|LOCUS_19300 2745 1417 gene locus_tag LOCUS_19310 gene lat 2745 1417 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080767.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence268 >Feature sequence269 <1 698 gene locus_tag LOCUS_19320 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028504.1:ABC transporter ATP-binding protein 695 1396 gene locus_tag LOCUS_19330 695 1396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_19330 1393 2382 gene locus_tag LOCUS_19340 1393 2382 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence270 <1 891 gene locus_tag LOCUS_19350 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020639906.1:alpha-galactosidase 888 1811 gene locus_tag LOCUS_19360 888 1811 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804377.1 protein_id gnl|my_center|LOCUS_19360 1824 2771 gene locus_tag LOCUS_19370 1824 2771 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804376.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence271 <1 837 gene locus_tag LOCUS_19380 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776843.1:sodium-dependent transporter 834 983 gene locus_tag LOCUS_19390 834 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence272 1258 623 gene locus_tag LOCUS_19400 1258 623 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015395.1 protein_id gnl|my_center|LOCUS_19400 2706 1255 gene locus_tag LOCUS_19410 2706 1255 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence273 <1 579 gene locus_tag LOCUS_19420 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003854900.1:homoserine dehydrogenase 579 1673 gene locus_tag LOCUS_19430 gene thrC 579 1673 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775958.1 protein_id gnl|my_center|LOCUS_19430 1680 2567 gene locus_tag LOCUS_19440 gene thrB 1680 2567 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775957.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence274 1 426 gene locus_tag LOCUS_19450 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 443 1324 gene locus_tag LOCUS_19460 443 1324 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_19460 <2819 1391 gene locus_tag LOCUS_19470 <2819 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224470.1:1,4-alpha-glucan branching protein GlgB >Feature sequence275 1453 764 gene locus_tag LOCUS_19480 1453 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19480 2598 1450 gene locus_tag LOCUS_19490 2598 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2798 2724 gene locus_tag LOCUS_t00310 2798 2724 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence276 <1 1135 gene locus_tag LOCUS_19500 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975538.1:LLM class flavin-dependent oxidoreductase 1132 1740 gene locus_tag LOCUS_19510 1132 1740 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_19510 2298 1741 gene locus_tag LOCUS_19520 2298 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence277 416 1189 gene locus_tag LOCUS_19530 416 1189 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_19530 1306 2568 gene locus_tag LOCUS_19540 1306 2568 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence278 2714 1314 gene locus_tag LOCUS_19550 2714 1314 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence279 >Feature sequence280 901 329 gene locus_tag LOCUS_19560 901 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2115 898 gene locus_tag LOCUS_19570 2115 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2459 2112 gene locus_tag LOCUS_19580 2459 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence281 1869 145 gene locus_tag LOCUS_19590 1869 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 <2758 1927 gene locus_tag LOCUS_19600 <2758 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230995.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence282 535 1134 gene locus_tag LOCUS_19610 535 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence283 <1 650 gene locus_tag LOCUS_19620 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976672.1:response regulator transcription factor 647 976 gene locus_tag LOCUS_19630 647 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1045 1215 gene locus_tag LOCUS_19640 1045 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1212 1847 gene locus_tag LOCUS_19650 1212 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence284 78 731 gene locus_tag LOCUS_19660 78 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 891 1394 gene locus_tag LOCUS_19670 891 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 <2731 1412 gene locus_tag LOCUS_19680 <2731 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836476.1:glycoside hydrolase family 1 protein >Feature sequence285 1898 555 gene locus_tag LOCUS_19690 1898 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence286 132 1568 gene locus_tag LOCUS_19700 132 1568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_19700 1596 2516 gene locus_tag LOCUS_19710 1596 2516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence287 191 264 gene locus_tag LOCUS_t00320 191 264 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 288 1631 gene locus_tag LOCUS_19720 288 1631 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_19720 2406 1648 gene locus_tag LOCUS_19730 2406 1648 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence288 <1 1408 gene locus_tag LOCUS_19740 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804883.1:cysteine--tRNA ligase 1412 2389 gene locus_tag LOCUS_19750 gene rlmB 1412 2389 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804884.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence289 <1 1117 gene locus_tag LOCUS_19760 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462640.1:mechanosensitive ion channel 1114 1512 gene locus_tag LOCUS_19770 gene msrB 1114 1512 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804985.1 protein_id gnl|my_center|LOCUS_19770 1512 2306 gene locus_tag LOCUS_19780 1512 2306 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence290 <1 1330 gene locus_tag LOCUS_19790 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223158.1:acyltransferase <2663 1373 gene locus_tag LOCUS_19800 <2663 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224470.1:1,4-alpha-glucan branching protein GlgB >Feature sequence291 312 572 gene locus_tag LOCUS_19810 312 572 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 protein_id gnl|my_center|LOCUS_19810 687 1592 gene locus_tag LOCUS_19820 687 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1666 2658 gene locus_tag LOCUS_19830 1666 2658 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence292 306 1604 gene locus_tag LOCUS_19840 306 1604 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467692.1 protein_id gnl|my_center|LOCUS_19840 <2645 1623 gene locus_tag LOCUS_19850 <2645 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726746.1:excinuclease ABC subunit UvrA >Feature sequence293 115 1869 gene locus_tag LOCUS_19860 115 1869 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804020.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence294 <1 829 gene locus_tag LOCUS_19870 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804639.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 784 1374 gene locus_tag LOCUS_19880 784 1374 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804641.1 protein_id gnl|my_center|LOCUS_19880 1371 2579 gene locus_tag LOCUS_19890 gene dxr 1371 2579 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence295 426 1526 gene locus_tag LOCUS_19900 426 1526 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 protein_id gnl|my_center|LOCUS_19900 1810 1499 gene locus_tag LOCUS_19910 gene mazF3 1810 1499 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_19910 2045 1812 gene locus_tag LOCUS_19920 2045 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence296 1807 500 gene locus_tag LOCUS_19930 1807 500 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_19930 1877 2602 gene locus_tag LOCUS_19940 1877 2602 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775964.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence297 >Feature sequence298 1147 224 gene locus_tag LOCUS_19950 1147 224 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776540.1 protein_id gnl|my_center|LOCUS_19950 2121 1144 gene locus_tag LOCUS_19960 2121 1144 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence299 >Feature sequence300 891 1085 gene locus_tag LOCUS_19970 891 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1617 1117 gene locus_tag LOCUS_19980 1617 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 <2595 1836 gene locus_tag LOCUS_19990 <2595 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929823.1:HNH endonuclease signature motif containing protein >Feature sequence301 639 118 gene locus_tag LOCUS_20000 639 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 705 1778 gene locus_tag LOCUS_20010 705 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2204 1797 gene locus_tag LOCUS_20020 2204 1797 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence302 23 1168 gene locus_tag LOCUS_20030 23 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 <2584 1550 gene locus_tag LOCUS_20040 <2584 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531164.1:alpha/beta hydrolase >Feature sequence303 1498 398 gene locus_tag LOCUS_20050 1498 398 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_20050 2093 1488 gene locus_tag LOCUS_20060 2093 1488 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence304 1396 386 gene locus_tag LOCUS_20070 1396 386 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_20070 <2556 1399 gene locus_tag LOCUS_20080 <2556 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705395.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence305 <1 719 gene locus_tag LOCUS_20090 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775707.1:ACP S-malonyltransferase 716 1732 gene locus_tag LOCUS_20100 716 1732 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775708.1 protein_id gnl|my_center|LOCUS_20100 1742 1990 gene locus_tag LOCUS_20110 1742 1990 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence306 <1 666 gene locus_tag LOCUS_20120 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775988.1:diaminopimelate dehydrogenase 1847 840 gene locus_tag LOCUS_20130 1847 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence307 1095 22 gene locus_tag LOCUS_20140 gene dapE 1095 22 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_20140 <2520 1110 gene locus_tag LOCUS_20150 <2520 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030872192.1:NAD(P)H-quinone dehydrogenase >Feature sequence308 1178 69 gene locus_tag LOCUS_20160 1178 69 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence309 708 1 gene locus_tag LOCUS_20170 708 1 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_20170 1177 716 gene locus_tag LOCUS_20180 1177 716 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_20180 <2506 1174 gene locus_tag LOCUS_20190 <2506 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224318.1:long-chain fatty acid--CoA ligase >Feature sequence310 2301 1171 gene locus_tag LOCUS_20200 2301 1171 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence311 487 1221 gene locus_tag LOCUS_20210 487 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1991 1239 gene locus_tag LOCUS_20220 1991 1239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_20220 2041 1967 gene locus_tag LOCUS_t00330 2041 1967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence312 >Feature sequence313 <1 2319 gene locus_tag LOCUS_20230 <1 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113370.1:cation-translocating P-type ATPase >Feature sequence314 566 81 gene locus_tag LOCUS_20240 566 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 950 708 gene locus_tag LOCUS_20250 950 708 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_20250 2207 1494 gene locus_tag LOCUS_20260 2207 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence315 559 1131 gene locus_tag LOCUS_20270 559 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence316 502 71 gene locus_tag LOCUS_20280 502 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1821 889 gene locus_tag LOCUS_20290 1821 889 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222855.1 protein_id gnl|my_center|LOCUS_20290 2036 2209 gene locus_tag LOCUS_20300 2036 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence317 1286 147 gene locus_tag LOCUS_20310 1286 147 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence318 745 1854 gene locus_tag LOCUS_20320 745 1854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_20320 1879 2223 gene locus_tag LOCUS_20330 1879 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence319 1294 1061 gene locus_tag LOCUS_20340 1294 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 <2451 1533 gene locus_tag LOCUS_20350 <2451 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257896.1:Fic family protein >Feature sequence320 <1 984 gene locus_tag LOCUS_20360 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113311.1:MFS transporter 1095 1535 gene locus_tag LOCUS_20370 1095 1535 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_20370 1977 1591 gene locus_tag LOCUS_20380 1977 1591 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence321 915 139 gene locus_tag LOCUS_20390 915 139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_20390 1844 912 gene locus_tag LOCUS_20400 1844 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2303 1878 gene locus_tag LOCUS_20410 2303 1878 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence322 182 1042 gene locus_tag LOCUS_20420 gene rsmI 182 1042 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_20420 1626 1039 gene locus_tag LOCUS_20430 1626 1039 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052116.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence323 1767 640 gene locus_tag LOCUS_20440 1767 640 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence324 698 363 gene locus_tag LOCUS_20450 698 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1234 740 gene locus_tag LOCUS_20460 1234 740 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_20460 1381 1890 gene locus_tag LOCUS_20470 1381 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence325 >Feature sequence326 1 1407 gene locus_tag LOCUS_20480 1 1407 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020644771.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence327 1230 412 gene locus_tag LOCUS_20490 1230 412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_20490 2167 1217 gene locus_tag LOCUS_20500 2167 1217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence328 1681 215 gene locus_tag LOCUS_20510 gene ltrA 1681 215 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence329 2138 621 gene locus_tag LOCUS_20520 2138 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence330 108 374 gene locus_tag LOCUS_20530 108 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 463 747 gene locus_tag LOCUS_20540 463 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 881 2206 gene locus_tag LOCUS_20550 881 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence331 1364 2146 gene locus_tag LOCUS_20560 1364 2146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence332 518 156 gene locus_tag LOCUS_20570 518 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 946 641 gene locus_tag LOCUS_20580 946 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 <2329 1340 gene locus_tag LOCUS_20590 <2329 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804192.1:Fic family protein >Feature sequence333 <1 988 gene locus_tag LOCUS_20600 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776349.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence334 2066 1119 gene locus_tag LOCUS_20610 2066 1119 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence335 <2318 383 gene locus_tag LOCUS_20620 <2318 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013569.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase >Feature sequence336 <1 1531 gene locus_tag LOCUS_20630 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015262274.1:IS21 family transposase 2230 2136 gene locus_tag LOCUS_t00340 2230 2136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence337 802 1614 gene locus_tag LOCUS_20640 gene pcaD 802 1614 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929697.1 protein_id gnl|my_center|LOCUS_20640 <2297 1639 gene locus_tag LOCUS_20650 <2297 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803865.1:crosslink repair DNA glycosylase YcaQ family protein >Feature sequence338 154 579 gene locus_tag LOCUS_20660 154 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1354 791 gene locus_tag LOCUS_20670 1354 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence339 681 1316 gene locus_tag LOCUS_20680 681 1316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence340 <1 1387 gene locus_tag LOCUS_20690 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336984.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence341 1359 52 gene locus_tag LOCUS_20700 1359 52 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_20700 1969 1349 gene locus_tag LOCUS_20710 1969 1349 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence342 <1 654 gene locus_tag LOCUS_20720 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185657.1:xanthine dehydrogenase molybdopterin binding subunit 651 1562 gene locus_tag LOCUS_20730 651 1562 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818502.1 protein_id gnl|my_center|LOCUS_20730 1559 1825 gene locus_tag LOCUS_20740 1559 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence343 47 388 gene locus_tag LOCUS_20750 gene rplX 47 388 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403654.1 protein_id gnl|my_center|LOCUS_20750 388 960 gene locus_tag LOCUS_20760 gene rplE 388 960 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_20760 962 1147 gene locus_tag LOCUS_20770 962 1147 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_20770 1206 1604 gene locus_tag LOCUS_20780 gene rpsH 1206 1604 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_20780 1621 2160 gene locus_tag LOCUS_20790 gene rplF 1621 2160 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776362.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence344 853 305 gene locus_tag LOCUS_20800 853 305 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_20800 1674 859 gene locus_tag LOCUS_20810 gene cysE 1674 859 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence345 >Feature sequence346 <1 684 gene locus_tag LOCUS_20820 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027856.1:ferredoxin reductase family protein 693 1199 gene locus_tag LOCUS_20830 693 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1196 1987 gene locus_tag LOCUS_20840 1196 1987 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence347 >Feature sequence348 339 1472 gene locus_tag LOCUS_20850 339 1472 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence349 1470 112 gene locus_tag LOCUS_20860 1470 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence350 51 1652 gene locus_tag LOCUS_20870 51 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence351 45 1256 gene locus_tag LOCUS_20880 45 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1309 1596 gene locus_tag LOCUS_20890 1309 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence352 1258 626 gene locus_tag LOCUS_20900 1258 626 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095323.1 protein_id gnl|my_center|LOCUS_20900 1257 2078 gene locus_tag LOCUS_20910 1257 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence353 836 171 gene locus_tag LOCUS_20920 836 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403957.1 protein_id gnl|my_center|LOCUS_20920 1033 1761 gene locus_tag LOCUS_20930 1033 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence354 53 1294 gene locus_tag LOCUS_20940 53 1294 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925097.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence355 >Feature sequence356 359 940 gene locus_tag LOCUS_20950 359 940 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_20950 1866 952 gene locus_tag LOCUS_20960 1866 952 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence357 <1 580 gene locus_tag LOCUS_20970 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898448.1:LytR C-terminal domain-containing protein 1965 646 gene locus_tag LOCUS_20980 1965 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446567.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence358 1863 406 gene locus_tag LOCUS_20990 1863 406 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775793.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence359 1315 512 gene locus_tag LOCUS_21000 1315 512 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256283.1 protein_id gnl|my_center|LOCUS_21000 1902 1348 gene locus_tag LOCUS_21010 1902 1348 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence360 62 1093 gene locus_tag LOCUS_21020 62 1093 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626372.1 protein_id gnl|my_center|LOCUS_21020 1107 1985 gene locus_tag LOCUS_21030 1107 1985 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence361 844 1818 gene locus_tag LOCUS_21040 844 1818 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025227807.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence362 1 954 gene locus_tag LOCUS_21050 1 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence363 479 243 gene locus_tag LOCUS_21060 479 243 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_21060 993 613 gene locus_tag LOCUS_21070 993 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence364 <1 667 gene locus_tag LOCUS_21080 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111996.1:EamA family transporter 866 612 gene locus_tag LOCUS_21090 866 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2041 875 gene locus_tag LOCUS_21100 2041 875 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064873.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence365 1149 1222 gene locus_tag LOCUS_t00350 1149 1222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence366 1995 1696 gene locus_tag LOCUS_21110 gene nuoK 1995 1696 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence367 >Feature sequence368 1552 197 gene locus_tag LOCUS_21120 1552 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence369 17 1552 gene locus_tag LOCUS_21130 17 1552 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence370 429 1574 gene locus_tag LOCUS_21140 429 1574 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224176.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence371 1221 94 gene locus_tag LOCUS_21150 1221 94 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_21150 <2037 1224 gene locus_tag LOCUS_21160 <2037 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029846.1:class I SAM-dependent methyltransferase >Feature sequence372 657 223 gene locus_tag LOCUS_21170 657 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 810 2036 gene locus_tag LOCUS_21180 810 2036 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013948.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence373 <1 1071 gene locus_tag LOCUS_21190 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350815.1:aminotransferase class V-fold PLP-dependent enzyme 1076 1342 gene locus_tag LOCUS_21200 1076 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1358 1990 gene locus_tag LOCUS_21210 1358 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21210 >Feature sequence374 >Feature sequence375 >Feature sequence376 >Feature sequence377 <1 700 gene locus_tag LOCUS_21220 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259668.1:aldo/keto reductase 1144 713 gene locus_tag LOCUS_21230 1144 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1377 1141 gene locus_tag LOCUS_21240 1377 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1509 1856 gene locus_tag LOCUS_21250 1509 1856 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence378 353 1423 gene locus_tag LOCUS_21260 353 1423 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456631.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence379 424 906 gene locus_tag LOCUS_21270 gene mobB 424 906 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_21270 998 1201 gene locus_tag LOCUS_21280 998 1201 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence380 >Feature sequence381 1607 336 gene locus_tag LOCUS_21290 gene hemW 1607 336 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565753.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence382 317 805 gene locus_tag LOCUS_21300 gene def 317 805 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_21300 903 1403 gene locus_tag LOCUS_21310 903 1403 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_21310 <1969 1466 gene locus_tag LOCUS_21320 <1969 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028323.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein >Feature sequence383 >Feature sequence384 1088 552 gene locus_tag LOCUS_21330 1088 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence385 <1 828 gene locus_tag LOCUS_21340 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932515.1:oxaloacetate decarboxylase subunit alpha >Feature sequence386 <1 1498 gene locus_tag LOCUS_21350 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929902.1:DNA translocase FtsK >Feature sequence387 1547 1020 gene locus_tag LOCUS_21360 1547 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence388 <1935 402 gene locus_tag LOCUS_21370 <1935 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390382.1:serine/threonine-protein kinase >Feature sequence389 <1 997 gene locus_tag LOCUS_21380 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803907.1:mannose-6-phosphate isomerase, class I <1904 1004 gene locus_tag LOCUS_21390 <1904 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097850.1:UDP-glucose 6-dehydrogenase >Feature sequence390 2 382 gene locus_tag LOCUS_21400 2 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 560 1576 gene locus_tag LOCUS_21410 560 1576 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269429.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence391 <1 1442 gene locus_tag LOCUS_21420 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031640.1:beta-galactosidase >Feature sequence392 419 1321 gene locus_tag LOCUS_21430 419 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence393 421 768 gene locus_tag LOCUS_21440 421 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 915 1112 gene locus_tag LOCUS_21450 915 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1417 1115 gene locus_tag LOCUS_21460 1417 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1718 1533 gene locus_tag LOCUS_21470 1718 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence394 509 237 gene locus_tag LOCUS_21480 509 237 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017265847.1 protein_id gnl|my_center|LOCUS_21480 820 557 gene locus_tag LOCUS_21490 820 557 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 protein_id gnl|my_center|LOCUS_21490 1010 1537 gene locus_tag LOCUS_21500 1010 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence395 899 1357 gene locus_tag LOCUS_21510 899 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence396 52 804 gene locus_tag LOCUS_21520 52 804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_21520 801 1532 gene locus_tag LOCUS_21530 801 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence397 <1 1708 gene locus_tag LOCUS_21540 <1 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526850.1:translation initiation factor IF-2 1705 1863 gene locus_tag LOCUS_21550 1705 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence398 1269 664 gene locus_tag LOCUS_21560 1269 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_21560 <1853 1266 gene locus_tag LOCUS_21570 <1853 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401648.1:metalloregulator ArsR/SmtB family transcription factor >Feature sequence399 <1 811 gene locus_tag LOCUS_21580 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775783.1:UTP--glucose-1-phosphate uridylyltransferase <1850 813 gene locus_tag LOCUS_21590 <1850 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229973.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence400 274 1512 gene locus_tag LOCUS_21600 274 1512 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084023633.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence401 >Feature sequence402 663 274 gene locus_tag LOCUS_21610 663 274 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_21610 747 1613 gene locus_tag LOCUS_21620 747 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence403 614 273 gene locus_tag LOCUS_21630 614 273 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930294.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence404 395 1279 gene locus_tag LOCUS_21640 395 1279 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_21640 1428 1736 gene locus_tag LOCUS_21650 1428 1736 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence405 <1 1179 gene locus_tag LOCUS_21660 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975715.1:phosphopyruvate hydratase 1511 1209 gene locus_tag LOCUS_21670 1511 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence406 <1 712 gene locus_tag LOCUS_21680 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978391.1:zinc ABC transporter permease AztB 709 1485 gene locus_tag LOCUS_21690 gene aztA 709 1485 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence407 690 340 gene locus_tag LOCUS_21700 690 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1199 699 gene locus_tag LOCUS_21710 1199 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1498 1355 gene locus_tag LOCUS_21720 1498 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence408 1250 6 gene locus_tag LOCUS_21730 1250 6 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence409 563 1237 gene locus_tag LOCUS_21740 563 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence410 1000 242 gene locus_tag LOCUS_21750 1000 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence411 >Feature sequence412 <1 1032 gene locus_tag LOCUS_21760 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948683.1:Dot/Icm T4SS effector LegP >Feature sequence413 1192 53 gene locus_tag LOCUS_21770 1192 53 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393173.1 protein_id gnl|my_center|LOCUS_21770 <1765 1189 gene locus_tag LOCUS_21780 <1765 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480516.1:N-6 DNA methylase >Feature sequence414 <1756 1151 gene locus_tag LOCUS_21790 <1756 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113016.1:ABC transporter ATP-binding protein >Feature sequence415 1752 1501 gene locus_tag LOCUS_21800 1752 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence416 537 1451 gene locus_tag LOCUS_21810 537 1451 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804108.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence417 85 444 gene locus_tag LOCUS_21820 85 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 441 794 gene locus_tag LOCUS_21830 gene tnpB 441 794 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence418 572 453 gene locus_tag LOCUS_21840 572 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 854 627 gene locus_tag LOCUS_21850 854 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence419 189 1142 gene locus_tag LOCUS_21860 189 1142 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731359.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence420 1220 813 gene locus_tag LOCUS_21870 1220 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 <1723 1208 gene locus_tag LOCUS_21880 <1723 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094791896.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence421 94 777 gene locus_tag LOCUS_21890 94 777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence422 1516 95 gene locus_tag LOCUS_21900 gene uxaC 1516 95 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence423 163 1446 gene locus_tag LOCUS_21910 163 1446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence424 779 120 gene locus_tag LOCUS_21920 779 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1537 923 gene locus_tag LOCUS_21930 1537 923 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence425 1148 6 gene locus_tag LOCUS_21940 1148 6 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484476.1 protein_id gnl|my_center|LOCUS_21940 1572 1414 gene locus_tag LOCUS_21950 1572 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence426 711 289 gene locus_tag LOCUS_21960 gene rbfA 711 289 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_21960 1227 733 gene locus_tag LOCUS_21970 1227 733 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence427 1 876 gene locus_tag LOCUS_21980 1 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence428 127 792 gene locus_tag LOCUS_21990 127 792 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013601.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence429 1333 233 gene locus_tag LOCUS_22000 gene hisC 1333 233 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence430 336 1496 gene locus_tag LOCUS_22010 336 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence431 <1 739 gene locus_tag LOCUS_22020 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389031.1:ribonucleoside triphosphate reductase 736 1512 gene locus_tag LOCUS_22030 736 1512 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence432 679 975 gene locus_tag LOCUS_22040 gene groES 679 975 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_22040 1374 1078 gene locus_tag LOCUS_22050 1374 1078 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence433 254 850 gene locus_tag LOCUS_22060 254 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1287 1105 gene locus_tag LOCUS_22070 1287 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence434 >Feature sequence435 172 660 gene locus_tag LOCUS_22080 172 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1675 725 gene locus_tag LOCUS_22090 1675 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence436 >Feature sequence437 <1 786 gene locus_tag LOCUS_22100 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639874.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) >Feature sequence438 1031 711 gene locus_tag LOCUS_22110 1031 711 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_22110 1348 1028 gene locus_tag LOCUS_22120 1348 1028 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence439 1621 758 gene locus_tag LOCUS_22130 1621 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence440 >Feature sequence441 >Feature sequence442 <1652 71 gene locus_tag LOCUS_22140 <1652 71 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223053.1:DUF2207 domain-containing protein >Feature sequence443 1178 408 gene locus_tag LOCUS_22150 1178 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence444 >Feature sequence445 250 618 gene locus_tag LOCUS_22160 250 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 668 1594 gene locus_tag LOCUS_22170 668 1594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence446 >Feature sequence447 1186 482 gene locus_tag LOCUS_22180 1186 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence448 1143 232 gene locus_tag LOCUS_22190 1143 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1576 1199 gene locus_tag LOCUS_22200 1576 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence449 <1627 387 gene locus_tag LOCUS_22210 <1627 387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224419.1:amidohydrolase family protein >Feature sequence450 677 111 gene locus_tag LOCUS_22220 677 111 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence451 >Feature sequence452 <1 806 gene locus_tag LOCUS_22230 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000229101.1:DEAD/DEAH box helicase family protein 881 1480 gene locus_tag LOCUS_22240 881 1480 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence453 1604 489 gene locus_tag LOCUS_22250 1604 489 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728974.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence454 >Feature sequence455 >Feature sequence456 >Feature sequence457 571 900 gene locus_tag LOCUS_22260 571 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 <1588 904 gene locus_tag LOCUS_22270 <1588 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727336.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase >Feature sequence458 <1 1510 gene locus_tag LOCUS_22280 <1 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775582.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence459 41 604 gene locus_tag LOCUS_22290 41 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 <1584 729 gene locus_tag LOCUS_22300 <1584 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204007.1:prolyl aminopeptidase >Feature sequence460 220 387 gene locus_tag LOCUS_22310 220 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 501 986 gene locus_tag LOCUS_22320 501 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1024 1347 gene locus_tag LOCUS_22330 1024 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence461 1322 75 gene locus_tag LOCUS_22340 1322 75 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence462 141 449 gene locus_tag LOCUS_22350 141 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 645 1565 gene locus_tag LOCUS_22360 645 1565 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence463 512 766 gene locus_tag LOCUS_22370 512 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1169 855 gene locus_tag LOCUS_22380 1169 855 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence464 <1563 948 gene locus_tag LOCUS_22390 <1563 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804757.1:NAD(+) diphosphatase >Feature sequence465 1106 486 gene locus_tag LOCUS_22400 1106 486 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence466 344 1354 gene locus_tag LOCUS_22410 344 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence467 1395 178 gene locus_tag LOCUS_22420 1395 178 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence468 293 946 gene locus_tag LOCUS_22430 293 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 957 1313 gene locus_tag LOCUS_22440 957 1313 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence469 590 147 gene locus_tag LOCUS_22450 590 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 <1551 600 gene locus_tag LOCUS_22460 <1551 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775946.1:MraY family glycosyltransferase >Feature sequence470 >Feature sequence471 >Feature sequence472 1125 1388 gene locus_tag LOCUS_22470 1125 1388 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417918.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence473 <1523 497 gene locus_tag LOCUS_22480 <1523 497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974746.1:ATP-binding protein >Feature sequence474 344 1102 gene locus_tag LOCUS_22490 gene aqpZ 344 1102 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731298.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence475 17 979 gene locus_tag LOCUS_22500 17 979 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence476 92 19 gene locus_tag LOCUS_t00360 92 19 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 209 135 gene locus_tag LOCUS_t00370 209 135 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 308 235 gene locus_tag LOCUS_t00380 308 235 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 462 818 gene locus_tag LOCUS_22510 462 818 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence477 <1502 687 gene locus_tag LOCUS_22520 <1502 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896435.1:LLM class flavin-dependent oxidoreductase >Feature sequence478 <1 676 gene locus_tag LOCUS_22530 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776590.1:phosphatase PAP2 family protein >Feature sequence479 >Feature sequence480 >Feature sequence481 <1 1437 gene locus_tag LOCUS_22540 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811993.1:transglycosylase domain-containing protein >Feature sequence482 247 1188 gene locus_tag LOCUS_22550 247 1188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294698.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence483 1306 317 gene locus_tag LOCUS_22560 gene adhP 1306 317 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence484 323 132 gene locus_tag LOCUS_22570 323 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1100 369 gene locus_tag LOCUS_22580 1100 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence485 <1 1116 gene locus_tag LOCUS_22590 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384638.1:ABC transporter substrate-binding protein >Feature sequence486 1296 34 gene locus_tag LOCUS_22600 1296 34 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930303.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence487 129 521 gene locus_tag LOCUS_22610 129 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 448 786 gene locus_tag LOCUS_22620 448 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 867 1214 gene locus_tag LOCUS_22630 867 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence488 130 56 gene locus_tag LOCUS_t00390 130 56 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 274 1152 gene locus_tag LOCUS_22640 274 1152 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence489 <1472 183 gene locus_tag LOCUS_22650 <1472 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776487.1:catalase >Feature sequence490 454 1143 gene locus_tag LOCUS_22660 gene ispD 454 1143 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence491 <1471 341 gene locus_tag LOCUS_22670 <1471 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974372.1:NADH-quinone oxidoreductase subunit M >Feature sequence492 >Feature sequence493 138 704 gene locus_tag LOCUS_22680 138 704 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_22680 <1460 941 gene locus_tag LOCUS_22690 <1460 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162177767.1:uracil-DNA glycosylase >Feature sequence494 291 1280 gene locus_tag LOCUS_22700 gene glsA 291 1280 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816578.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence495 797 84 gene locus_tag LOCUS_22710 797 84 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 protein_id gnl|my_center|LOCUS_22710 <1456 797 gene locus_tag LOCUS_22720 <1456 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975443.1:sensor histidine kinase >Feature sequence496 2 454 gene locus_tag LOCUS_22730 2 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1386 526 gene locus_tag LOCUS_22740 1386 526 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776465.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence497 1 648 gene locus_tag LOCUS_22750 1 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence498 441 1271 gene locus_tag LOCUS_22760 441 1271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence499 1061 522 gene locus_tag LOCUS_22770 1061 522 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775942.1 protein_id gnl|my_center|LOCUS_22770 1283 1071 gene locus_tag LOCUS_22780 1283 1071 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence500 313 1035 gene locus_tag LOCUS_22790 313 1035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence501 1148 849 gene locus_tag LOCUS_22800 1148 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence502 >Feature sequence503 799 395 gene locus_tag LOCUS_22810 799 395 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_22810 1429 806 gene locus_tag LOCUS_22820 1429 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence504 165 1277 gene locus_tag LOCUS_22830 165 1277 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence505 1 393 gene locus_tag LOCUS_22840 1 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 394 723 gene locus_tag LOCUS_22850 394 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence506 645 493 gene locus_tag LOCUS_22860 645 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence507 481 795 gene locus_tag LOCUS_22870 481 795 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_22870 829 1356 gene locus_tag LOCUS_22880 829 1356 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence508 >Feature sequence509 191 1153 gene locus_tag LOCUS_22890 191 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_22890 1385 1101 gene locus_tag LOCUS_22900 1385 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence510 >Feature sequence511 <1 825 gene locus_tag LOCUS_22910 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338607.1:alpha-amylase family protein <1407 826 gene locus_tag LOCUS_22920 <1407 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969699.1:RpoH suppressor SuhR >Feature sequence512 >Feature sequence513 803 390 gene locus_tag LOCUS_22930 803 390 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence514 75 1244 gene locus_tag LOCUS_22940 75 1244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence515 >Feature sequence516 >Feature sequence517 >Feature sequence518 265 1263 gene locus_tag LOCUS_22950 265 1263 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226128.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence519 <1 527 gene locus_tag LOCUS_22960 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259119.1:SDR family oxidoreductase >Feature sequence520 1386 466 gene locus_tag LOCUS_22970 1386 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence521 560 1315 gene locus_tag LOCUS_22980 560 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence522 1 873 gene locus_tag LOCUS_22990 gene nadC 1 873 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence523 <1387 401 gene locus_tag LOCUS_23000 <1387 401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028725.1:glycosyltransferase note possible pseudo, frameshifted >Feature sequence524 >Feature sequence525 >Feature sequence526 1364 507 gene locus_tag LOCUS_23010 1364 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence527 451 113 gene locus_tag LOCUS_23020 451 113 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_23020 607 1167 gene locus_tag LOCUS_23030 607 1167 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088509.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence528 >Feature sequence529 <1379 664 gene locus_tag LOCUS_23040 <1379 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222252.1:SGNH/GDSL hydrolase family protein >Feature sequence530 <1 741 gene locus_tag LOCUS_23050 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222392.1:phosphoglyceromutase <1379 803 gene locus_tag LOCUS_23060 <1379 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974747.1:phosphate signaling complex protein PhoU >Feature sequence531 1375 965 gene locus_tag LOCUS_23070 1375 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence532 >Feature sequence533 >Feature sequence534 677 240 gene locus_tag LOCUS_23080 gene trxC 677 240 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889424.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence535 1143 319 gene locus_tag LOCUS_23090 1143 319 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence536 913 1095 gene locus_tag LOCUS_23100 913 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence537 273 707 gene locus_tag LOCUS_23110 273 707 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728011.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence538 776 432 gene locus_tag LOCUS_23120 776 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence539 >Feature sequence540 505 1116 gene locus_tag LOCUS_23130 505 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 >Feature sequence541 214 699 gene locus_tag LOCUS_23140 214 699 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061454.1 protein_id gnl|my_center|LOCUS_23140 1192 758 gene locus_tag LOCUS_23150 1192 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence542 >Feature sequence543 106 1176 gene locus_tag LOCUS_23160 106 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence544 >Feature sequence545 >Feature sequence546 1148 516 gene locus_tag LOCUS_23170 1148 516 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223045.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence547 <1 571 gene locus_tag LOCUS_23180 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223046.1:DUF4350 domain-containing protein >Feature sequence548 >Feature sequence549 >Feature sequence550 <1 1177 gene locus_tag LOCUS_23190 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930001.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence551 >Feature sequence552 194 778 gene locus_tag LOCUS_23200 194 778 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence553 <1 606 gene locus_tag LOCUS_23210 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229969.1:aminoacyl-tRNA hydrolase >Feature sequence554 365 1051 gene locus_tag LOCUS_23220 365 1051 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385801.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence555 <1307 478 gene locus_tag LOCUS_23230 <1307 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224177.1:amidohydrolase >Feature sequence556 705 172 gene locus_tag LOCUS_23240 705 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence557 <1300 424 gene locus_tag LOCUS_23250 <1300 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775917.1:RecQ family ATP-dependent DNA helicase >Feature sequence558 >Feature sequence559 >Feature sequence560 >Feature sequence561 1291 50 gene locus_tag LOCUS_23260 1291 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence562 >Feature sequence563 <1 844 gene locus_tag LOCUS_23270 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730250.1:AAA family ATPase 1274 846 gene locus_tag LOCUS_23280 1274 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence564 >Feature sequence565 1212 124 gene locus_tag LOCUS_23290 1212 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence566 >Feature sequence567 <1268 257 gene locus_tag LOCUS_23300 <1268 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868068.1:sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein >Feature sequence568 1223 357 gene locus_tag LOCUS_23310 1223 357 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence569 >Feature sequence570 >Feature sequence571 1 195 gene locus_tag LOCUS_23320 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 276 1217 gene locus_tag LOCUS_23330 276 1217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054291694.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence572 >Feature sequence573 <1 535 gene locus_tag LOCUS_23340 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969667.1:TIGR03885 family FMN-dependent LLM class oxidoreductase >Feature sequence574 1 1218 gene locus_tag LOCUS_23350 1 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence575 >Feature sequence576 >Feature sequence577 436 122 gene locus_tag LOCUS_23360 436 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence578 379 107 gene locus_tag LOCUS_23370 379 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 843 385 gene locus_tag LOCUS_23380 843 385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837475.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence579 2 856 gene locus_tag LOCUS_23390 2 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence580 165 512 gene locus_tag LOCUS_23400 165 512 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084459.1 protein_id gnl|my_center|LOCUS_23400 980 558 gene locus_tag LOCUS_23410 980 558 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence581 <1236 517 gene locus_tag LOCUS_23420 <1236 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003819301.1:universal stress protein >Feature sequence582 >Feature sequence583 <1 1051 gene locus_tag LOCUS_23430 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777144.1:transglycosylase domain-containing protein >Feature sequence584 319 903 gene locus_tag LOCUS_23440 319 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence585 <1 992 gene locus_tag LOCUS_23450 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777012.1:DHA2 family efflux MFS transporter permease subunit >Feature sequence586 >Feature sequence587 >Feature sequence588 <1 755 gene locus_tag LOCUS_23460 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974830.1:phosphate ABC transporter ATP-binding protein PstB 1181 759 gene locus_tag LOCUS_23470 1181 759 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013921.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence589 711 280 gene locus_tag LOCUS_23480 gene crcB 711 280 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence590 >Feature sequence591 <1 694 gene locus_tag LOCUS_23490 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707673.1:DMT family transporter 1173 631 gene locus_tag LOCUS_23500 1173 631 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence592 <1 666 gene locus_tag LOCUS_23510 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804344.1:M50 family metallopeptidase 740 1009 gene locus_tag LOCUS_23520 740 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence593 >Feature sequence594 <1203 360 gene locus_tag LOCUS_23530 <1203 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259408.1:alpha/beta hydrolase >Feature sequence595 <1202 4 gene locus_tag LOCUS_23540 <1202 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705394.1:NAD(P)-binding protein >Feature sequence596 1 1101 gene locus_tag LOCUS_23550 1 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence597 3 458 gene locus_tag LOCUS_23560 3 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1052 480 gene locus_tag LOCUS_23570 1052 480 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence598 677 874 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcgttctgcgtacgca >Feature sequence599 >Feature sequence600 >Feature sequence601 2 229 gene locus_tag LOCUS_23580 2 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 255 551 gene locus_tag LOCUS_23590 255 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23590 >Feature sequence602 >Feature sequence603 >Feature sequence604 <1177 7 gene locus_tag LOCUS_23600 <1177 7 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257766.1:glycoside hydrolase family 31 protein >Feature sequence605 >Feature sequence606 >Feature sequence607 >Feature sequence608 >Feature sequence609 >Feature sequence610 74 805 gene locus_tag LOCUS_23610 74 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence611 >Feature sequence612 >Feature sequence613 1108 500 gene locus_tag LOCUS_23620 1108 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence614 347 102 gene locus_tag LOCUS_23630 347 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 472 687 gene locus_tag LOCUS_23640 472 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 684 1031 gene locus_tag LOCUS_23650 684 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence615 <1 674 gene locus_tag LOCUS_23660 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222835.1:class F sortase >Feature sequence616 >Feature sequence617 400 2 gene locus_tag LOCUS_23670 400 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776367.1 protein_id gnl|my_center|LOCUS_23670 <1130 467 gene locus_tag LOCUS_23680 <1130 467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402379.1:phosphoglyceromutase >Feature sequence618 869 549 gene locus_tag LOCUS_23690 869 549 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence619 <1 736 gene locus_tag LOCUS_23700 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162495273.1:polysaccharide deacetylase family protein >Feature sequence620 221 502 gene locus_tag LOCUS_23710 221 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 637 789 gene locus_tag LOCUS_23720 637 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 793 1038 gene locus_tag LOCUS_23730 793 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence621 89 16 gene locus_tag LOCUS_t00400 89 16 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 742 257 gene locus_tag LOCUS_23740 742 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence622 <1 830 gene locus_tag LOCUS_23750 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015583.1:PTS ascorbate transporter subunit IIC >Feature sequence623 >Feature sequence624 >Feature sequence625 2 235 gene locus_tag LOCUS_23760 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 232 975 gene locus_tag LOCUS_23770 gene istB 232 975 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence626 >Feature sequence627 360 677 gene locus_tag LOCUS_23780 360 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence628 >Feature sequence629 465 935 gene locus_tag LOCUS_23790 465 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence630 998 285 gene locus_tag LOCUS_23800 998 285 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029385.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence631 >Feature sequence632 >Feature sequence633 893 246 gene locus_tag LOCUS_23810 893 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence634 9 989 gene locus_tag LOCUS_23820 9 989 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776608.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence635 190 441 gene locus_tag LOCUS_23830 gene yefM 190 441 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_23830 443 703 gene locus_tag LOCUS_23840 gene yoeB 443 703 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence636 >Feature sequence637 326 913 gene locus_tag LOCUS_23850 326 913 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence638 >Feature sequence639 910 443 gene locus_tag LOCUS_23860 910 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence640 493 663 gene locus_tag LOCUS_23870 493 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence641 17 1081 gene locus_tag LOCUS_23880 17 1081 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894950.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence642 >Feature sequence643 >Feature sequence644 593 198 gene locus_tag LOCUS_23890 593 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23890 >Feature sequence645 <1071 240 gene locus_tag LOCUS_23900 <1071 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869183.1:dihydropyrimidinase >Feature sequence646 >Feature sequence647 158 994 gene locus_tag LOCUS_23910 158 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence648 <1068 207 gene locus_tag LOCUS_23920 <1068 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742122.1:o-succinylbenzoate--CoA ligase >Feature sequence649 <1 946 gene locus_tag LOCUS_23930 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870273.1:type I restriction endonuclease subunit R >Feature sequence650 773 330 gene locus_tag LOCUS_23940 773 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence651 1 189 gene locus_tag LOCUS_23950 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence652 >Feature sequence653 <1052 516 gene locus_tag LOCUS_23960 <1052 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975969.1:xanthine dehydrogenase small subunit >Feature sequence654 411 893 gene locus_tag LOCUS_23970 411 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence655 160 840 gene locus_tag LOCUS_23980 gene mtrA 160 840 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence656 >Feature sequence657 >Feature sequence658 <1 961 gene locus_tag LOCUS_23990 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039770.1:MBL fold metallo-hydrolase >Feature sequence659 204 851 gene locus_tag LOCUS_24000 204 851 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence660 <1039 469 gene locus_tag LOCUS_24010 <1039 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972950.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence661 128 787 gene locus_tag LOCUS_24020 128 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence662 >Feature sequence663 <1 676 gene locus_tag LOCUS_24030 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973510.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence664 975 589 gene locus_tag LOCUS_24040 975 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence665 490 954 gene locus_tag LOCUS_24050 490 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence666 740 186 gene locus_tag LOCUS_24060 740 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence667 <1 962 gene locus_tag LOCUS_24070 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776588.1:DEAD/DEAH box helicase >Feature sequence668 <1 594 gene locus_tag LOCUS_24080 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence669 >Feature sequence670 265 483 gene locus_tag LOCUS_24090 265 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 975 724 gene locus_tag LOCUS_24100 975 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence671 >Feature sequence672 >Feature sequence673 <1 841 gene locus_tag LOCUS_24110 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929846.1:serpin family protein >Feature sequence674 968 171 gene locus_tag LOCUS_24120 gene pflA 968 171 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence675 >Feature sequence676 >Feature sequence677 >Feature sequence678 <1017 108 gene locus_tag LOCUS_24130 <1017 108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007057651.1:galactokinase >Feature sequence679 >Feature sequence680 >Feature sequence681 <1 519 gene locus_tag LOCUS_24140 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929929.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence682 >Feature sequence683 865 281 gene locus_tag LOCUS_24150 865 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence684 >Feature sequence685 >Feature sequence686 <1 940 gene locus_tag LOCUS_24160 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001047667.1:DUF2804 domain-containing protein >Feature sequence687 >Feature sequence688 >Feature sequence689